Sign In to Follow Application
View All Documents & Correspondence

Composition For Enhancing Intra Cellular Nitric Oxide Generation

Abstract: ABSTRACT COMPOSITION FOR ENHANCING INTRA-CELLULAR NITRIC OXIDE GENERATION The present invention discloses a pharmaceutical composition comprising 1-{3-[9-methoxy-7-(2-methoxyphenyl)-2,3,4,5-tetrahydro-1,4-benzoxazepine-4-carbonyl]phenyl}imidazolidin-2-one ; N-tert-butyl-2-{N-[(furan-2-yl)methyl]-2-[5-(4-methylphenyl)-2H-1,2,3,4-tetrazol-2-yl]acetamido}-2-(4-hydroxyphenyl)acetamide ; 3-[2-(2-{[(6-hydroxy-2,4-dioxo-1,2,3,4-tetrahydropyrimidin-5-yl)(4hydroxyphenyl) methyl]amino}-4-oxo-4,5-dihydro-1,3-thiazol-5-yl)acetamido]benzoic acid; 2-oxo-2-(1H-pyrrol-2-yl)ethyl 2-[(4-fluorophenyl)methoxy]benzoate ; and 5-(3-{[(3-bromo-4-hydroxy-5 methoxyphenyl) methylidene]amino}-2 (butylimino)- 2,3-dihydro-1,3-thiazol-4-yl)-2-hydroxybenzamide.The components are small molecule antagonists that increase the intracellular nitric oxide level by inhibiting the interaction between Nitric oxide synthase interacting proteins and inducible Nitric oxide synthase.

Get Free WhatsApp Updates!
Notices, Deadlines & Correspondence

Patent Information

Application #
Filing Date
20 November 2020
Publication Number
21/2022
Publication Type
INA
Invention Field
CHEMICAL
Status
Email
kolkatapatent@Lsdavar.in
Parent Application
Patent Number
Legal Status
Grant Date
2025-01-23
Renewal Date

Applicants

INSTITUTE OF LIFE SCIENCES
(An Autonomous Institute of the Department of Bio Technology, Govt. of India) Nalco Square
TRANSLATIONAL HEALTH SCIENCES AND TECHNOLOGY INSTITUTE (THSTI)
NCR Biotech Science Cluster 3rd Milestone, Faridabad - Gurgaon Rd, Expressway

Inventors

1. B.Ravindran
Institute of Life Sciences, Nalco Square
2. Diwakar Kumar Singh
Institute of Life Sciences, Nalco Square
3. Shailendra Asthana
Translational Health Sciences and Technology Institute (THSTI)
4. Sagar Gaikwad
Department of Neurology, University of Texas Medical Branch, 301 University Blvd, Route 1045, Galveston, TX
5. Dileep Vasudevan
Institute of Life Sciences, Nalco Square
6. Narottam Acharya
Institute of Life Sciences, Nalco Square

Specification

DESC:FIELD OF INVENTION:

[001] The present disclosure relates to the field of immunology. The present disclosure relates to a pharmaceutical composition comprising small molecules for enhancing the intracellular nitric oxide in vitro in human and mouse leukocytes and endogenous induction of nitric oxide in mice and their use for induction of anti-viral and anti-inflammatory host response.

BACKGROUND AND PRIOR ARTS OF THE INVENTION

[002] Nitric oxide (NO) is a highly potent signaling molecule involved in a variety of physiological processes. NO is produced by neuronal nitric oxide synthase (nNOS or NOS1), inducible nitric oxide synthase (iNOS or NOS2) and endothelial nitric oxide synthase (eNOS or NOS3) which regulate nervous, immune and endothelial system functions respectively ( Förstermann, U., and Sessa, W. C. (2012) European heart journal 33, 829-837Nitric oxide synthases: regulation and function).

[003] A variety of biological functions such as inflammation, vasodilation, platelet aggregation/ adhesion, leucocyte adhesion, vascular smooth muscle proliferation, angiogenesis and other physiological processes are mediated by Nitric Oxide (Niedbala, W., Besnard, A.-G., Jiang, H. R., Alves-Filho, J. C., Fukada, S. Y., Nascimento, D., Mitani, A., Pushparaj, P., Alqahtani, M. H., and Liew, F. Y. (2013) The Journal of Immunology 191, 164-170 Nitric Oxide–Induced Regulatory T Cells Inhibit Th17 but Not Th1 Cell Differentiation and Function; Niedbala, W., Alves-Filho, J. C., Fukada, S. Y., Vieira, S. M., Mitani, A., Sonego, F., Mirchandani, A., Nascimento, D. C., Cunha, F. Q., and Liew, F. Y. (2011) Proceedings of the National Academy of Sciences 108, 9220-9225. Regulation of type 17 helper T-cell function by nitric oxide during inflammation; Lundberg, J. O., Gladwin, M. T., and Weitzberg, E. (2015) Nature Reviews Drug Discovery 14, 623-641. Strategies to increase nitric oxide signalling in cardiovascular diseaseBogdan, C. (2015) Trends in immunology 36, 161-178. Nitric oxide synthase in innate and adaptive immunity: an update ; Bogdan, C. (2001) Nature immunology 2, 907-916 Nitric oxide and the immune response21. ; Bauer, H., Jung, T., Tsikas, D., Stichtenoth, D., FRÖLICH, C., and Neumann, C. (1997) Immunology 90, 205-211 Nitric oxide inhibits the secretion of T-helper 1- and T-helper 2-associated cytokines in activated human Tcells‘pa ; Jon O. Lundberg, Mark T. Gladwin and Eddie Weitzberg, Strategies to increase nitric oxide signalling in cardiovascular disease,doi:10.1038/nrd4623,7 August 2015,Nature Reviews ; Almudena Garcia-Ortiz and Juan M. Serrador, Nitric oxide Signaling in T Cell-Mediated Immunity, https://doi.org/10.1016/j.molmed.2018.02.002.; Wanda Niedbala, Beilei Cai, Haiying Liu, Nick Pitman, Lynda Chang and Foo Y. Liew, Nitric Oxide Induces CD4+ CD25+ Foxp3- regulatory T cells from CD4+CD25- T cells via p53, IL-2, and OX40, www.pnas.org/cgi/doi/10.1073/pnas.0703725104; Wanda Niedbala, Jose C. Alves – Filho, Sandra Y. Fukada, Silvio Manfredo Vieira, Akio Mitani, Fabiane Sonego, regulation of type 17 helper T-cell function by nitric oxide during inflammation,www.pnas.org/cgi/doi/10.1073/pnas.1100667108.).

[004] More importantly, NO plays an integral role in defense against bacterial, viral and parasitic pathogens in immune cell signaling and biochemical pathways and in regulating pathways of host inflammation (Hassan Fahmi, Daniel Charon, Michelle mondange and Richard Chaby,Endotoxin-Induced Desensitization of mouse Macrophages is Mediated in part by Nitric Oxide Production, http://iai.asm.org/, December 29,2019.; Mirela B. , Maria C. Almeida, Evelin C. Carnio and Luiz G. S. Branco, Role of nitric oxide in tolerance to lipopolysaccharide in mice, doi:10.1152/japplphysiol.01243.2004.; Devangi R. Mehta, Ali A. Ashkar, Karen L. Mossman, The nitric oxide pathway provides innate Antiviral protection in Conjunction with the Type 1 Interferon Pathway in Fibroblasts, doi:10.1371/journal.pone.0031688 ; Fabio Lisi, Alexander N. Zelikin and Rona Chandrawati, Nitric Oxide to Fight viral Infections, DOI: 10.1002/advs.202003895,2021.; Howlin, R. P., Cathie, K., Hall-Stoodley, L., Cornelius, V., Duignan, C., Allan, R. N., Fernandez, B. O., Barraud, N., Bruce, K. D., and Jefferies, J. (2017) Molecular Therapy 25, 2104-2116. Low-Dose Nitric Oxide as Targeted Anti-biofilm Adjunctive Therapy to Treat Chronic Pseudomonas aeruginosa Infection in Cystic Fibrosis.; Jeney, V., Ramos, S., Bergman, M.-L., Bechmann, I., Tischer, J., Ferreira, A., Oliveira-Marques, V., Janse, C. J., Rebelo, S., and Cardoso, S. (2014) Cell Reports 8, 126-136 Control of disease tolerance to malaria by nitric oxide and carbon monoxide).

[005] NO is produced at various concentrations (nm-µm) in cells by enzymatic action of NOS using L-arginine as substrate. Among the three isoforms, eNOS and nNOS are constitutively expressed while iNOS is inducible in immune cells during their activation. Synthesis and release of NO is tightly regulated by molecules involved in several regulatory pathways. Fine-tuning of NOS activity is mediated post-transnationally by protein-protein interactions.

[006] Nitric oxide synthase interacting protein (NOSIP) has emerged as a central modulator of biological activity of NOS. NOSIP interacts with all three isoforms of NOS with high affinity and is co-expressed in cells (Dedio, J., König, P., Wohlfart, P., SCHROEDER, C., KUMMER, W., and MÜLLER-ESTERL, W. (2001) The FASEB Journal 15, 79-89 NOSIP, a novel modulator of endothelial nitric oxide synthase activity.; Dreyer, J., Schleicher, M., Tappe, A., Schilling, K., Kuner, T., Kusumawidijaja, G., Müller-Esterl, W., Oess, S., and Kuner, R. (2004) Journal of Neuroscience 24, 10454-10465 Nitric oxide synthase (NOS)-interacting protein interacts with neuronal NOS and regulates its distribution and activity). It inhibits synthesis of NO by relocating NOS from the plasma membrane to intracellular compartments thereby uncoupling NOS from plasma membrane caveolae (Dedio, J., König, P., Wohlfart, P., SCHROEDER, C., KUMMER, W., and MÜLLER-ESTERL, W. (2001) The FASEB Journal 15, 79-89 NOSIP, a novel modulator of endothelial nitric oxide synthase activity).

[007] Expression, kinetics and regulation of NOSIP in mammalian cells and organs are largely unexplored. Therefore , NOSIP is a major NOS interacting protein that down-regulates biological activity of all three isoforms of nitric oxide synthases viz., nNOS, iNOS and eNOS. NOSIP indirectly regulates the level of NO produced by different cells/organs.

[008] NO plays a central role in a wide range of pathological conditions such as infectious diseases, cardiovascular diseases, hypertensive pregnancies, rheumatoid arthritis, systemic lupus erythematous, multiple sclerosis, septic shock etc., (Förstermann, U., et al. ( 2016); Howlin, R. P., et al. (2017)). Most of these diseases are associated with impaired NO production and/or activity. Decreased availability of NO has been attributed to imbalance between its synthesis and degradation (Förstermann, U., et al. ( 2016)). Consequently, many chemical NO donors have been designed for potential use for management of several pathologies (Schairer, D. O., Chouake, J. S., Nosanchuk, J. D., and Friedman, A. J. (2012) Virulence 3, 271-279 The potential of nitric oxide releasing therapies as antimicrobial agents). However, such NO donors have very limited clinical application since NO is unstable with very short half-life (Dreyer, J., Schleicher, M., Tappe, A., Schilling, K., Kuner, T., Kusumawidijaja, G., Müller-Esterl, W., Oess, S., and Kuner, R. (2004) Journal of Neuroscience 24, 10454-10465 Nitric oxide synthase (NOS)-interacting protein interacts with neuronal NOS and regulates its distribution and activity; Schairer, D. O., Chouake, J. S., Nosanchuk, J. D., and Friedman, A. J. (2012) Virulence 3, 271-279 The potential of nitric oxide releasing therapies as antimicrobial agents; Levine, A. B., Punihaole, D., and Levine, T. B. (2012) Cardiology 122, 55-68 Characterization of the Role of Nitric Oxide and its Clinical Applications; Reger, N. A., Meng, W. S., and Gawalt, E. S. (2017) Journal of functional biomaterials 8, 20 Antimicrobial Activity of Nitric Oxide-Releasing Ti-6Al-4V Metal Oxide ; Fitzhugh, A. L., and Keefer, L. K. (2000) Free Radical Biology and Medicine 28, 1463-1469. Diazeniumdiolates:: Pro- and antioxidant applications of the “NONOates”; Li, B., Ming, Y., Liu, Y., Xing, H., Fu, R., Li, Z., Ni, R., Li, L., Duan, D., and Xu, J. (2020) Frontiers in Pharmacology 11, 923 Recent Developments in Pharmacological Effect, Mechanism and Application Prospect of Diazeniumdiolates; Arlene Bradley Levine, David Punihaole, T. Barry Levine, Characterization of the role of nitric oxide and its clinical Applications,DOI:10.1159/000338150,19 june,2012; Maurizio Forte, Valeria Conti, Antonio Damato, Mariateresa Ambrosio, Annibale A. Puca, Targeting Nitric Oxide with Natural Derived Compounds as a Therapeutic Strategy in Vascular Diseases,http://dx.doi.org/10.1155/2016/7364138,Hindawi Publishing Corporation; David O. Schairer, Jason S. Chouake, Joshua D. Nosanchuk and Adam J. Friedmam, The Potential of nitric oxide releasing therapies as antimicrobial agents,http://dx.doi.org/10.4161/viru.20328.).

[009] Nitric Oxide (NO) displays a variety of biological activity such as a) vasodilation b) anti-inflammation c) anti-thrombotic d) anti-proliferative e) neuroprotective f) anti-bacterial g) anti-viral effect etc., Thus induction of Nitric Oxide in vivo has been perceived to have several pharmacological benefits. Search for molecules that induce NO has been a major activity in the area of drug development. Currently the following approaches are being pursued - a) consumption or administration of Nitrate/Nitrite salts and their conversion into NO by bacterial nitrate reductase in the gut, b) Dietary supplementation of L-arginine to increase substrate levels for Nitric Oxide Synthase enzyme to generate more NO by cells, c) administration of chemical NO donors which have very short half-life. Such approaches are disclosed in WO1996016645A1 and US20210290663A1.

[0010] Therefore, there exists a need in the art for molecules that can induce Nitric Oxide production in the cells.

OBJECTS OF THE INVENTION:

[0011] It is therefore an object of the present disclosure to propose a composition for increasing intracellular nitric oxide concentration.

[0012] It is an object of the present invention to demonstrate ability of NOSIP to interact with iNOS and inhibit its enzyme activity in a dose dependent manner to generate Nitric Oxide.

[0013] Another object of the invention is to demonstrate affinity of small molecules of the composition to interact with NOSIP for potential use as antagonists.

[0014] Another object of the invention is to induce human and mice cells to generate Nitric Oxide in vitro by treatment with Small Molecule ‘NOSIP antagonists’.

[0015] Yet another object of the invention is to generate endogenous Nitric Oxide in mice by administration of Small Molecule ‘NOSIP antagonists’.
[0016] Yet another object of the invention is to demonstrate up-regulation of type 1 Interferons viz., IFN-a and IFN-b genes and Inflammatory stimulatory genes (ISGs) in vitro by small molecule “NOSIP antagonists”.

[0017] Still another object of the invention is to therapeutically use Small Molecule ‘NOSIP antagonists’ to inhibit generation of inflammatory cytokines in mice induced by administration of bacterial endotoxin, Lipopolysaccharide (LPS).

[0018] These and other objects and advantages of the invention will be apparent from the ensuing description.

SUMMARY OF THE INVENTION:

[0019] According to this invention is provided a composition comprising five small molecules wherein the molecules inhibit nitric oxide snynthase interacting proteins and inducible Nitric oxide synthase interaction.

[0020] In one embodiment , the present invention discloses a pharmaceutical composition for enhancing intracellular nitric oxide in a subject , the said composition comprising 1-{3-[9-methoxy-7-(2-methoxyphenyl)-2,3,4,5-tetrahydro-1,4-benzoxazepine-4-carbonyl]phenyl}imidazolidin-2-one ; N-tert-butyl-2-{N-[(furan-2-yl)methyl]-2-[5-(4-methylphenyl)-2H-1,2,3,4-tetrazol-2-yl]acetamido}-2-(4-hydroxyphenyl)acetamide;
3-[2-(2-{[(6-hydroxy-2,4-dioxo-1,2,3,4-tetrahydropyrimidin-5-yl)(4hydroxyphenyl) methyl]amino}-4-oxo-4,5-dihydro-1,3-thiazol-5-yl)acetamido]benzoic acid; 2-oxo-2-(1H-pyrrol-2-yl)ethyl 2-[(4-fluorophenyl)methoxy]benzoate, and 5-(3-{[(3-bromo-4-hydroxy-5 methoxyphenyl) methylidene]amino}-2 (butylimino)- 2,3-dihydro-1,3-thiazol-4-yl)-2-hydroxybenzamide.

[0021] In another embodiment, the present invention discloses a method of preparing the composition.

BRIEF DESCRIPTION OF THE ACCOMPANYING DRAWINGS:

[0022] It is to be noted, however, that the appended drawings illustrate only typical embodiments of the present subject matter and are therefore not to be considered for limiting of its scope, for the invention may admit to other equally effective embodiments. The detailed description is described with reference to the accompanying figures. Some embodiments of system or methods in accordance with embodiments of the present subject matter are now described, by way of example, and with reference to the accompanying figures, in which:

Figure 1 is a graphical representation of nitrite levels measured by Griess reagent demonstrating recombinant NOSIP inhibits Nitric Oxide Synthase (iNOS) enzyme activity in vitro.

Figure 2 depicts inhibition of iNOS-NOSIP protein interaction by iNOS derived peptides. Figure 2(a) depicts the iNOS and NOSIP purified protein (125nM) interact to each other in SPR analysis as shown in pink at top of graph. These interactions was inhibited in presence of different iNOS peptides (250nM) viz; PP1- red line, PP2 – sky blue line at bottom of graph, PP3 – blue line and PP4 – green line. Figure 2(b) demonstrates dose dependent binding inhibition of NOSIP protein in the presence of iNOS peptide which shows kinetics of NOSIP binding (1000nM to 62.5nM, top to bottom) in presence of 250nM iNOS PP2. The Ka= 5.36e+03, Kd= 2.65 e-03, KD = 4.95 e-07M was obtained in Kinetic – Langmuir analysis.

Figure 3 depicts Calorimetric titration of rNOSIP with 18 mer iNOS peptide (PP2).

Figure 4 depicts Specific Plasmon Resonance Analysis of rNOSIP (250nM) in presence of small molecules NOSIP antagonists (1uM). Figure 4(A). The recombinant NOSIP protein (250nM) binding in pink line at top of graph, blue line- binding of protein in presence of small molecule 2, sky blue line - small molecule 3, green line - small molecule 5 and red line - small molecule 4. (B) Pink line- rNOSIP protein binding, green line- small molecule1, sky blue line- small molecule 7, blue line - small molecule 9, red line- small molecule 6 (C) Pink line- rNOSIP protein binding, green line- small molecule10, sky blue line- small molecule 12, blue line - small molecule 13, red line- small molecule 11. The best binding molecules (n=5) kept for further analysis. (Figures 4(D-G)) shows Isothermal Titration Calorimetry for all the five small molecules NOSIP antagonists and its kinetics are listed in table.

Figure 5 depicts small molecule NOSIP antagonists potentiates TLR ligands-induced NO production in Murine Bone marrow derived mononuclear (BMDM) cells in vitro. Figure 5 (left panel) shows that small molecules combination (tested at two concentrations viz., 0.01uM and 0.1uM) in vitro and incubated overnight at 37C. The SM were incubated with or without the following TLR ligands: LPS, b-glucan, flagellinh, Pam3Csk, Poly IC, and CpG DNA. The SM generates Nitric Oxide in a dose dependent manner and also potentiate Nitric Oxide production in murine BMDM treated with TLR ligands. The right panel in Fig 5 is a replication of the same experiment as described above.

Figure 6 depicts flow cytometry data and DAF-FM staining data for evaluation of Bio-activity of SM ‘NOSIP antagonists’ for induction of Nitric Oxide in vitro by murine BMDM.

Figure 7 illustrates small molecule NOSIP antagonists potentiates TLR ligands-induced NO production in Human peripheral blood mononuclear cells (PBMC).

Figure 8 illustrates nitrite estimation in mouse plasma/peritoneal lavage by Griess reaction on administration of SM NOSIP Antagonists.

Figure 9 depicts ELISA results reflecting pre-treatment of mice with ‘NOSIP Antagonists’ blocked induction of inflammatory cytokines such as TNF a and IL1-ß by LPS.

Figure 10 depicts NOSIP antagonists SM alone or in combination increases NO levels in human PBMCs via calorimetry for nitrite concentration using Griess reagent.

Figure 11 illustrates intraperitoneal administration of NOSIP Antagonists to mice does not significantly increase inflammatory cytokines in peritoneal fluid and plasma unlike positive control LPS.

Figure 12 is a graphical representation of Q-RT PCR results for cytokine genes (12a) and Type 1 Interferon genes (12 b) in RAW 264.7 cells treated with SM NOSIP antagonists for 10 hours.

Figure 13 is a graphical representation of Q-RT PCR results for Interferon stimulated genes in RAW 264.7 cells treated with SM NOSIP antagonists for 10 hours.
Figure 14 is a graphical representation of Q-RT PCR for Type 1 Interferon genes (Figure 14 (a) on the left) and cytokine genes (Figure 14 (b) on the right) in murine BMDM cells treated with SM NOSIP antagonists for 8 hours.

DETAILED DESCRIPTION OF THE INVENTION:
[0023] In the present document, the word “exemplary” is used herein to mean “serving as an example, instance, or illustration.” Any embodiment or implementation of the present subject matter described herein as “exemplary” is not necessarily to be construed as preferred or advantageous over other embodiments.
[0024] While the disclosure is susceptible to various modifications and alternative forms, specific embodiment thereof has been shown by way of example in the drawings and will be described in detail below. It should be understood, however that it is not intended to limit the disclosure to the forms disclosed, but on the contrary, the disclosure is to cover all modifications, equivalents, and alternatives falling within the scope of the disclosure.

[0025] The terminology used herein is to describe particular embodiments only and is not intended to be limiting of example embodiments. As used herein, the singular forms “a”, “an” and “the” are intended to include the plural forms as well, unless the context indicates otherwise.

[0026] It will be further understood that the terms “comprise”, “comprising”, “includes” and/or “including” when used herein, specify the presence of stated features, steps, operations, elements and/or components, but do not preclude the presence or addition of one or more other features, steps, operations, elements, components and/or groups thereof.
[0027] Unless otherwise defined, all terms (including technical and scientific terms) used herein have the same meaning as commonly understood by one of ordinary skill in the art to which example embodiments belong. It will be further understood that terms, e.g., those defined in commonly used dictionaries, should be interpreted as having a meaning that is consistent with their meaning in the context of the relevant art and will not be interpreted in an idealized or overly formal sense unless expressly so defined herein.

[0028] The term “equimolar concentration” implies having same molar concentration of solute in a solution. In the context of the present invention, the said term denotes the molar concentration of each of the 5 small molecule antagonists is same i.e., they are added in the ratio of 1:1:1:1:1 for preparing the stock solution and later suspending in phosphate buffer saline solution.

[0029] The term “MER” denotes the number of amino acid residues. 18 mer means a peptide (PP2) containing 18 amino acids.

[0030] According to the present disclosure, is provided a pharmaceutical composition comprising :
1-{3-[9-methoxy-7-(2-methoxyphenyl)-2,3,4,5-tetrahydro-1,4-benzoxazepine-4-carbonyl]phenyl}imidazolidin-2-one;
N-tert-butyl-2-{N-[(furan-2-yl)methyl]-2-[5-(4-methylphenyl)-2H-1,2,3,4-tetrazol-2-yl]acetamido}-2-(4-hydroxyphenyl)acetamide;
3-[2-(2-{[(6-hydroxy-2,4-dioxo-1,2,3,4-tetrahydropyrimidin-5-yl)(4hydroxyphenyl) methyl]amino}-4-oxo-4,5-dihydro-1,3-thiazol-5-yl)acetamido]benzoic acid;
2-oxo-2-(1H-pyrrol-2-yl)ethyl 2-[(4-fluorophenyl)methoxy]benzoate; and
5-(3-{[(3-bromo-4-hydroxy-5 methoxyphenyl) methylidene]amino}-2 (butylimino)- 2,3-dihydro-1,3-thiazol-4-yl)-2-hydroxybenzamide.

[0031] In an embodiment of the present disclosure, the components are small molecule antagonists that block the interaction between Nitric oxide snynthase interacting proteins and inducible Nitric oxide synthase.

[0032] In one embodiment of the present disclosure, the components are present in an equimolar concentration in phosphate buffer saline.

[0033] In another embodiment of the present disclosure, the components either alone or in combination enhances Nitric Oxide level at 0.1 and 0.01 µM concentrations.

[0034] In yet another embodiment, the present disclosure provides a method for preparing the composition comprising selection of five different small molecules (viz; MCULE3765839647, MCULE8395438746, MCULE8094061955, MCULE8469877005, and MCULE4640800528) from chemical library, preparing 1M stock solution by dissolving 5mg of the powder in 1 ml dimethyl sulfoxide , preparing cocktail of 1M solution by mixing 0.2 ml of each of the small molecule components as claimed in claim 1 making a total volume of 1 ml and storing at -20 0C, preparing 1ml cocktail of 100uM stock solution in phosphate buffer saline by adding 0.1ml of 1M stock in DMSO to 0.9 ml of phosphate buffer saline and storing for further use in -20 C in aliquots of 100 µl each , thawing 100µM stock solution and addition of small molecule antagonists at different concentrations in phosphate buffer solution.
[0035] The small molecules are designated as ‘NOSIP antagonists’ and an equi-molar mixture of all 5 Small Molecule ‘NOSIP antagonists’ were used for biological experiments. Incubation of human peripheral blood mononuclear cells (PBMC) or murine Bone marrow derived Mononuclear cells (BMDM) in vitro with “NOSIP antagonists” induced production of Nitric Oxide by the cells. ‘NOSIP antagonists’ further potentiated TLR (Toll like receptors) agonists (LPS, PGN, CpG DNA, Flagellin) induced synthesis of Nitric Oxide by the above cells. A single dose of 100ul -200ul of 100uM solution of “NOSIP antagonists” by intra-peritoneal route to mice resulted in production of Nitric Oxide in vivo as shown by elevated levels of Nitrate/Nitrite in plasma and peritoneal cavity in BALB/c mice. Mice administered with 100ul of 100uM “NOSIP antagonists” followed by injection of 5mg/kg body weight of bacterial Endotoxin (Lipopolysaccharide, that induces inflammatory cytokines in circulation) resulted in decreased levels of inflammatory cytokines such as TNF-a and IL-1ß. Macrophage cell line RAW incubated with “NOSIP antagonists” in vitro culture for 10 hrs at 37 C and analysed by Q-RT-PR were found to significantly activate for anti-viral genes viz., different subtypes of Interferon-a, Interferon-b, Interferon stimulated genes (ISGs).

[0036] The invention is now illustrated by way of non-limiting examples. The examples are intended to be purely exemplary of the invention, should therefore not be considered to limit the scope invention in any way. While the present invention has been described in terms of its specific embodiments, certain modifications and equivalents will be apparent to those skilled in the art and are intended to be included within the scope of the present invention.

EXAMPLES:

Example 1:
Cloning, Expression and Purification of iNOS and NOSIP proteins and their inhibiting interaction:
[0037] The human iNOS oxygenase domain (SEQ ID No.: 24) containing 424 nucleotide sequence and NOSIP gene (SEQ ID No.: 23) containing 301 nucleotide sequences were synthesized by GenScript and cloned in pET22b expression vector. The recombinant pET22b: iNOS and pET22b: NOSIP plasmid was used to transform competent E. coli BL21 (DE3) cells. The proteins were over expressed using 0.2 mM IPTG at 25 0C. The harvested cells were resuspended and sonicated in 20 mM Tris-HCl, pH 7.5, 200 mM NaCl, 0.05% Triton X-100 and protease inhibitor (Sigma). The expressed proteins were purified by nickel nitrilotriacetic acid column using 250 mM imidazole and gel filtration chromatography. The protein was quantified by Bradford assay (Sigma) and integrity of purified protein was checked on 12% SDS-PAGE.

[0038] In a calorimetric assay increasing concentrations of recombinant NOSIP were mixed with recombinant iNOS along with substrate L-Arginine and the resultant product, nitrate was quantified by using Griess reaction kit. The red bar in Figure 1 shows iNOS (0.5µM) enzyme activity in absence of NOSIP and blue bars shows inhibition of iNOS (0.5µM) enzyme activity in presence of different concentration of NOSIP (0.5 to 5 µM). Statistical significance was assessed by one way ANOVA, Tukey's Multiple Comparison Test. It was observed that recombinant NOSIP inhibits enzyme activity of iNOS.

Example 2:
Identification of iNOS peptides that block interaction between iNOS and NOSIP:
[0039] 3-D structures of iNOS and NOSIP were analyzed by 7 different tools (PIPER, SWORM DOCK, PyDOCK, Z-DOCK, HADDOCK, ATTRACT, CLUSPRO) that resulted in prediction of four different iNOS peptides that can interfere with their interactions. The predictions were tested for validation by Specific Plasmon Resonance (SPR). One of the peptides (Peptide-2 abbreviated as PP-2) (SEQ ID No: 26) was found to block significantly interaction between recombinant iNOS and NOSIP as shown by SPR. The other 3 peptides (Peptide -1, SEQ ID No: 25), (Peptide3, SEQ ID No: 27), and (peptide-4, SEQ ID No: 28) were less efficient in inhibiting interaction between iNOS and NOSIP as shown in Figure 2(a) . The Figure 2(b) titration of peptide 2 by SPR demonstrating a dose dependent interaction between NOSIP and iNOS peptide 2. Figure 3 shows interaction between NOSIP and iNOS peptide2 by Isothermal Titration (ITC). NOSIP and iNOS peptide (PP2) binding was measured by titrating 10 µM iNOS peptide in the chamber with 150 µM rNOSIP in syringe at 25 °C. Top panel, raw heating power over time; Bottom panel, fit of integrated injection enthalpy over the mole ratio of the reactants. The resulting isotherms and binding kinetics was obtained by the application of ITC instrumental software, N=0.993, KD (nM)= 493±63.2, ?H (Kcal/mol)= -9.07±0.251, -T?S (Kcal/mol)= 0.459, ?G (Kcal/mol)= -8.61.

[0040] Detailed methods used for the above analysis are the following:

Bimolecular interaction by Surface Plasmon Resonance (SPR):
[0041] Four different iNOS peptides were synthesized commercially by China peptides and iNOS peptides were used for molecular interaction studies with immobilized recombinant iNOS purified protein. The iNOS peptides mediated inhibition of rNOSIP and riNOS protein association in Bio-Rad XPR 36 surface plasmon resonance biosensor instrument. About 3 µg/ml of iNOS was immobilized on GLC chip by amine coupling method as suggested by manufacturer’s instructions. 250nM of iNOS peptides was used for inhibition assay with immobilized ligand(recombinant iNOS) in SPR analysis. Similar condition and concentration of small molecules were used for inhibition of recombinant protein association with immobilized ligand. It inhibited the association of rNOSIP and r iNOS purified protein significantly in this study. The rNOSIP protein was incubated with iNOS derived peptide / small molecules for 30 minutes in ice for inhibition assay before the SPR application in our study. The molecular interaction was carried out at 20°C and kinetic parameters were determined, after fitting the association and dissociation curves to a 1:1 (Langmuir)-binding model. An activated channel without immobilized ligand was used to evaluate nonspecific binding. The response curves were also recorded on control surfaces. Results were calculated after subtraction of the control values using the ProteOn Manager software.

SPR Data Analysis:
[0042] The collected sensorgram data were processed by reference subtraction using double-referencing with the in-line blank buffer. The integrated ProteOn Manager software was used to fit the data with the Langmuir model describing a 1:1 binding stoichiometry. Ka is the association rate constant, Kd is the dissociation rate constant, and KD is the equilibrium dissociation constant, defined by the Kd/Ka ratio for the analytes- ligand binding.

Isothermal titration calorimetry (ITC):
[0043] The 18 mer iNOS peptide (PP2) and small molecules were used for physical association of molecules in calorimetric analysis. The molecular association leads to thermodynamics changes such as Gibb's free energy change (?G), entropy change (?S), enthalpy change (?H) and number of binding sites (N) in interacting solution were investigated by isothermal calorimetry MICROCAL PEQ (Malvern) at 25 °C. The sample cell were ?lled with peptides, small molecules and the reference cell was ?lled with 25mM HEPES and 150 mM Sodium chloride, pH=7 and the syringe was ?lled with NOSIP solution (200µM). The experiment consisted of multiple injections and each injection contained 1.5 µl of binding solution (recombinant NOSIP solution)with 120 second spacing time between subsequent injections. Sequential titrations were carried out and the sample solution was continuously stirred at 270 rpm by the rotating paddle attached to the syringe needle. Multiple injections of NOSIP made into the sample cell containing interacting solution of peptide and small molecules. The titration curves were analyzed using the analysis software provided with the calorimeter.

Example 3:
Identification of Small Molecules that mimic iNOS peptide 2 and Chemical formulae and structure 5 small molecules ‘NOSIP antagonists’:
[0044] Using Peptide 2 of iNOS that significantly inhibited interaction between iNOS and NOSIP in SPR (as demonstrated in Figures 2 and 3), 12 different small molecules designated as CC1 to CC13 (with the exception of CC8) were selected by in silico methods using a virtual chemical library of 1.6 million molecules. The small molecules NOSIP Antagonists were identified by studying their interaction with high affinity to NOSIP as shown by SPR.

[0045] Detailed description of SPR and ITC for SM:

[0046] The 18 mer iNOS peptide (PP2) and five small molecules were used to analyze physical association in calorimetric analysis. The molecular association leads to thermodynamics changes such as Gibb's free energy change (?G), entropy change (?S), enthalpy change (?H) and number of binding sites (N) in interacting solution were investigated by isothermal calorimetry MICROCAL PEQ (Malvern) at 25 °C. The sample cell were ?lled with peptides, small molecules and the reference cell was ?lled with 25mM HEPES and 150 mM Sodium chloride, pH=7 and the syringe was ?lled with NOSIP solution (200µM). The experiment consisted of multiple injections and each injection contained 1.5 µl of binding solution with 120 second spacing time between subsequent injections. Sequential titrations were carried out and the sample solution was continuously stirred at 270 rpm by the rotating paddle attached to the syringe needle. Multiple injections of NOSIP made into the sample cell containing interacting solution of peptide and small molecules. The titration curves were analyzed using the analysis software provided with the calorimeter. The SM binding affinity with NOSIP is described below in table below and it indicates the following trends in terms of hierarchy viz, CC4> CC11> CC6>CC5>CC13> Peptide 2 (iNOS). The biophysical parameters observed for the 5 small molecule designated as ‘NOSIP Antagonists’ are shown in Table 1 below:

Small Molecules
(Cell) rNOSIP (Syringe) N (Sites)
KD (nM)
?H
(Kcal/mol)
-T?S
(Kcal/mol)
?G
(Kcal/mol)
Fold Change
(KD)
MCULE-4640800528 NOSIP
1.04
420±57.5
-8.54±0.255
-0.159
-8.70
0.766
MCULE-8469877005 NOSIP
0.794
535±80.8
-29.3±1.12
20.8
-8.56
0.976
MCULE-3765839647 NOSIP
0.989
524±64.9
-27.3±1.11
19.8
-7.5
0.956
MCULE-8094061955 NOSIP
0.993
493±63.2

-9.07±0.251
0.459
-8.61 0.899
MCULE-8395438746 NOSIP
0.864
542±54.9
-28.5±0.694
20.0
-8.55
0.989
iNOS-Peptide2 NOSIP
1.09

548±81.1
-8.44±0.271
-0.10
-8.54
1

Table 1
[0047] The structures for 5 selected SM NOSIP Antagonists are shown below in Table 2:
SN Compound Name Molecule ID/ Matched product/Assign Name Structure Mass
1 N-({1H,4H,5H,6H-cyclopenta[c]pyrazol-3-yl}methyl)-2[(2-methoxy-4-methylphenoxy)methyl]-1,3-oxazole-4-carboxamide MCULE-4640800528/ P-504631944 /CC4
382.4
2 N-tert-butyl-2-{N-[(furan-2-yl)methyl]-2-[5-(4-methylphenyl)-2H-1,2,3,4-tetrazol-2-yl]acetamido}-2-(4-hydroxyphenyl)acetamide

MCULE-8469877005/
P-6260656/CC5

502.6

3 4-(2-{[2-(3,4-dichlorophenyl)-2-oxoethyl]sulfanyl}-4-oxo-3H,4H-thieno[3,2-d]pyrimidin-3-yl)-N-[2-(4-sulfamoylphenyl)ethyl]butanamide
MCULE-3765839647/
P-449585363/CC6
639.6

4 ({2-chloro-5-[ethyl(phenyl)sulfamoyl]phenyl}carbamoyl)methyl 2-({[(2H-1,3-benzodioxol-5-yl)carbamoyl]methyl}sulfanyl)benzoate MCULE-8094061955/
P-17494584/CC11
682.2

5 5-(3-{[(3-bromo-4-hydroxy-5-methoxyphenyl)methylidene]amino}-2-(butylimino)-2,3-dihydro-1,3-thiazol-4-yl)-2-hydroxybenzamide MCULE-8395438746/
P-17901669/CC13
519.4

Table 2

[0048] Kinetic parameter of bi-molecular interaction of between iNOS and NOSIP in the presence and absence of 5 small molecules as shown by SPR. Figures 4(a) to 4(g) shows details of SPR and ITC for all the five SM NOSIP Antagonists. The molecules inhibit the binding of NOSIP with iNOS ligand (Figure 4 (a)) in presence of CC2, CC3, CC4, CC5 (Figure 4 (b) ) In presence of CC1, CC6, CC7 and CC9 (Figure 4 (c)) In presence of CC10, CC11, CC12 and CC13. The same molecules were used for NOSIP binding assay in ITC (Figure 4(d)) Binding of CC4, (Figure 4(e)) Binding of CC5 (Figure 4(f)) Binding of CC6 (Figure 4(g)) Binding of CC13.

[0049] The five small molecules bind with NOSIP and inhibit the association of recombinant NOSIP and recombinant iNOS. The rNOSIP protein was incubated with iNOS derived peptide or small molecules for 30 minutes in ice prior to SPR application. The molecular interaction was carried out at 20°C and kinetic parameters were determined, after fitting the association and dissociation curves to a 1:1 (Langmuir)-binding model. An activated channel without immobilized ligand (recombinant iNOS) was used to evaluate nonspecific binding. The response curves were also recorded on control surfaces. Results were calculated after subtraction of the control values using the ProteOn Manager software.

[0050] The collected sensorgram data were processed by reference subtraction using double-referencing with the in-line blank buffer. The integrated ProteOn Manager software was used to fit the data with the Langmuir model describing a 1:1 binding stoichiometry. Ka is the association rate constant, Kd is the dissociation rate constant, and KD is the equilibrium dissociation constant, defined by the Kd/Ka ratio for the analytes- ligand binding. The Ka , Kd and KD values of the inhibiting interaction between the small molecules and NOSIP and iNOS are shown in table 3 below.
Analytes
Ligand
Ka(1/Ms)
Kd(1/s)
KD (M)
Fold Change
(KD)
NOSIP iNOS 9.57e+04 6.81e-04 7.11 e-09 1.439e-3
rNOSIP + iNOS peptide2
r iNOS
5.36e+02
2.65 e-03
4.94 e-06
1
rNOSIP + MCULE-4640800528 r iNOS
5.63e-01
4.9e-04
8.70e-04
1.761e+2
rNOSIP + MCULE-8469877005
r iNOS
8.22e-01
4.83e-04
5.88e-04
1.190e+2
rNOSIP + MCULE-3765839647
r iNOS
8.07e-01
5.68e-04
7.04e-04
1.425e+2
rNOSIP + MCULE-8094061955
r iNOS
6.7e-01
5.42e-04
8.09e-04
1.637e+2
rNOSIP + MCULE-8395438746
r iNOS
8.35e-01
4.53e-04
5.43e-04
1.099e+2

Table 3

[0051] The different Small Molecules interacted with NOSIP and resulted in inhibition of iNOS-NOSIP protein interaction kinetics in SPR analysis. The inhibition hierarchy of the small molecules were as follow: CC4> CC11> CC6> CC5> CC13> iNOS Peptide 2.
Example 4:
Evaluation of Bio-activity of SM ‘NOSIP antagonists’ for induction of Nitric Oxide in vitro by murine BMDM as estimated by Nitrite production by calorimetry:
[0052] Murine Bone marrow derived mononuclear cells (BMDM – 1 million cells per ml) were treated with or without NOSIP antagonists (equimolar concentration of a mixture of all 5 small molecule antagonists) at 0.1 and 0.01 µM concentrations for 30 min followed by addition of LPS (1 µg/ml), ß-glucan (5 µg/ml), flagellin (200 ng/ml), Pam3CSK4 (100 ng/ml), poly I:C (50 µg/ml), and PGN (10 µg/ml) in triplicate wells and incubated for 24 h at 37 0C. The culture supernatants were analysed by calorimetry for nitrite concentration using Griess reagent. The results (shown in figure 5(b)) reveals induction of NO by ‘NOSIP antagonists’ at 10.1 and 0.01 uM concentrations. TLR agonists mediated induction of NO were further potentiated by pre-treatment of cells with ‘NOSIP antagonists’. The results are shown in Figure 5 (the left and right panels are two set of experiments)

Example 5:
Evaluation of Bio-activity of SM ‘NOSIP antagonists’ for induction of Nitric Oxide in vitro by murine BMDM by Flow Cytometry:
[0053] Bone marrow cells single cell suspension, small molecules treatment and DAF-FM (4-Amino-5-methylamino-2',7'-difluorofluorescein diacetate) staining. The mouse femurs were aseptically isolated in Dubleco’s phosphate buffer saline solution and kept immediately on ice. The muscles and residue tissues surrounding the femur were removed with sterile forceps and scissors. The femurs cut at both ends with sharp sterile scissors and marrow cells were flushed out using 26 gauge needle with ice cold DPBS. The collected sample was filtered through 70 µm nylon cell strainer placed in a 50 ml falcon conical tube. The cells were washed and replaced with complete DMEM media by repeated centrifugation at 300g for 10 minutes. The bone marrow cells were counted with a haemocytometer and 106 cells/ml were used for small molecules cocktail treatment in this studies. Further , titration of 2 and 4 uM concentration of cocktails for 1h and 2hwas carried out . The treated cells were further incubated with 10uM DAF-FM for 30 minutes at 5% CO2 at 370C. The cells were washed with DMEM incomplete media and further incubated with fresh complete DMEM media. The further incubation of cells for 30 minutes allowed complete de esterification. The cells were lysed/ fixed with BD lysis / permeabilization buffer before the flow cytometer analysis at 495nM/515nM. The results are shown in Figure 6.

Example 6:
Evaluation of Bio-activity of SM ‘NOSIP antagonists’ for induction of Nitric Oxide in vitro by normal human PBMC:
[0054] Normal human peripheral blood mononuclear cells (PBMC – 1 million cells/ml) were treated with or without NOSIP antagonists ( equimolar concentration of a mixture of all 5 small molecule antagonists) at 0.1 and 0.01 µM concentrations for 30 min followed by addition of LPS (1 µg/ml), ß-glucan (5 µg/ml), flagellin (200 ng/ml), Pam3CSK4 (100 ng/ml), poly I:C (50 µg/ml), and PGN (10 µg/ml) in triplicate wells and incubated for 24 h at 37 0C. The culture supernatants were analysed by calorimetry for nitrite concentration using Griess reagent. The results (shown in figure 3 below) reveals induction of NO by ‘NOSIP antagonists’ at 10.1 and 0.01 uM concentrations. TLR agonists mediated induction of NO were further potentiated by pre-treatment of cells with ‘NOSIP antagonists’. The results are shown in Figure 7.

Example 7:
Kinetics of in vivo Nitric Oxide induction by SM ‘NOSIP antagonists’:
[0055] A mixture of all 5 Small molecule ‘NOISP antagonists’ were injected by intra-peritoneal route (100 µl/mouse of 100 mM) and groups of mice were sacrificed at different time points and plasma and peritoneal lavage were harvested and nitrite levels were quantified using Griess reagent. The levels are shown in Figure 8 - plasma (left) and in Peritoneal fluid (right) at different time points. The Nitrite levels reached a peak at 4 hrs post administration and normal levels were restored at 24 hrs.

Example 8:
SM ‘NOSIP antagonists’ inhibit in vivo induction of inflammatory cytokines (TNF-a and IL-1b) by LPS in mice:
[0056] Six to eight-week-old male C57BL/6 mice were intra-peritoneally injected with 200µl of 100µM SM ‘NOSIP Antagonists’, prepared by mixing equimolar concentration of five small molecules in PBS before each experiment. After 2 hrs, mice were administered 5mg/Kg of LPS and after two hours the animals were euthanized, and blood was collected by cardiac puncture. Plasma levels of inflammatory cytokines TNFa, and IL-1ß were measured using commercially available ELISA kits, as per the manufacturer's instruction (ebioscience, USA; TNFa # 501128954; IL-1ß # 501129749). Pre-treatment of mice with ‘NOSIP Antagonists’ blocked induction of inflammatory cytokines by LPS. The results are shown in Figure 9.

Example 9:
NOSIP antagonists SM alone or in combination increases NO levels in human PBMCs:
[0057] PBMCs (1 million cells/ml) from healthy individuals’ blood was isolated and were treated with or without NOSIP antagonists (either alone or mixture of equimolar concentration of all 5 small molecule antagonists at 0.1 and 0.01 µM) for 30 min in triplicate wells and incubated for 24 h at 37°C. The culture supernatants were analysed by calorimetry for nitrite concentration using Griess reagent, and the NO levels are shown as mean percent increase over untreated control. Results are shown in Figure 10. The panel on the right top of Figure 10 depict nitrite levels by individual small molecules in human PBMCs. A comparison of quantities of nitric oxide produced by individual small molecules and equimolar mixture of all 5 small molecules reveals clear synergistic effect of the mixture in inducing nitric oxide. This also suggests the need for using the mixture to induce biologically effective increase in nitric oxide. Mouse BMDMs and the panel on the right bottom of Fig 10 shows levels of nitric oxide production by individual small molecules by BMDM of mouse. A closer analysis of panels in right bottom and right top indicates that human and mouse cells respond differently to individual small molecules. For eg. CC4 is more effective than molecules in human cells and CC11 is more effective with mouse cells – BMDM. Thus a combined mixture of 5 small molecules will be desirable for use in mouse as well as humans.

Example 10:
Induction of NO production by NOSIP antagonist cocktail is not associated with induction of inflammatory cytokines:
[0058] A mixture of all 5 Small molecule ‘NOISP antagonists’ were injected by intra-peritoneal route (100 µl/mouse of 100 µM) and groups of mice were sacrificed at different time points and plasma and peritoneal lavage were harvested and inflammatory cytokines (IL-1ß, TNF-a and IL-6) levels were quantified using ELISA kits. Administration of NOSIP antagonist SM did not induce the inflammatory cytokines in plasma and in Peritoneal fluid. LPS (5mg/kg) was used as a positive control. Higher dose of NOSIP antagonists SM cocktail (500 µl of 500 µM, i.p.) also did not influence inflammatory cytokine production in vivo. The results are shown in Figure 11.

Example 11:
SM NOSIP Antagonists induce type 1 Interferons in a murine macrophage cell line RAW - IFNa5 and IFNa6 and IFN-b are significaantly raised in treated macrophages:
[0059] The murine macrophage cell line, RAW 264.7 (ATCC® TIB-71™) was maintained in RPMI-1640 medium (PAN Biotech, Aidenbach Germany) supplemented with antibiotics, including penicillin (100 U/ml) and streptomycin (0.1 mg/ml), 2.0 mM L-glutamine (Himedia Laboratories Pvt. Ltd., Mumbai, India), and 10% heat-inactivated FBS (PAN Biotech, Aidenbach Germany) at 37 °C in a humidified incubator with 5% CO2. 8-12 week old male mice was sacrificed via cervical dislocation and legs were dissected. Bone marrow from tibia and femur bones was flushed out using a 25-gauge needle and a 10 ml syringe filled with DMEM (HiMedia Laboratory, Mumbai, India) containing 10% FBS (Gibco Laboratories, USA) under aseptic condition. The cell suspension was centrifuged at 2000 r.p.m for 5 min at room temperature to pellet cells. The supernatant was discarded and cells were resuspended in DMEM containing 10% FBS.

Quantitative Real-time PCR (qRT-PCR) analysis
[0060] For qRT-PCR analysis, RAW 264.7 cells were cultured in 6 well plate at 2×106 cells/ 2 ml in RPMI 1640 containing 10% FBS and incubated overnight at 37 °C and 5% CO2 in a humidified incubator. Next day, the cells were washed with RPMI 1640 media and either treated or untreated with different concentrations of SM (5µM or 15µM). The BMDM cell suspension was cultured in 24 well plate at 5×106 cells/1.5 ml in DMEM supplemented with 10% FBS, 1% antibiotic-antimycotic solution (Gibco Laboratories, USA). The cells were incubated overnight at 37 °C and 5% CO2 in a humidified incubator. Next day, the culture wells were gently washed 2 times with 1 ml with DMEM medium to remove non-adherent cells. The cells were either treated or untreated with LPS (1 µg/ml) or SM (5µM or 15µM). After 8 h, BMDM and RAW 264.7 cells were lysed in 1 ml TRIzol reagent (Thermo Fisher Scientific, IL, USA). Total RNA was extracted with molecular grade reagents according to the instructions provided by the manufacturer (Sigma; St. Louis, MO, USA). First-strand cDNA synthesis was carried out with 0.5 µg of total RNA using random primers and high capacity cDNA reverse transcription kit (Thermo Fisher Scientific, IL, USA). Real-time quantitative PCR was performed using SYBR select master mix (Thermo Fisher Scientific, IL, USA). At the end of PCR, dissociation curve analysis was performed to verify the amplification of a single product. Relative expression of inflammatory cytokines and interferon subtypes were calculated using 2- ??CT method [Pfaffl, Michael W. "A new mathematical model for relative quantification in real-time RT–PCR." Nucleic acids research 29, no. 9 (2001): e45-e45.].

Sequence of the primers used for qPCR
[0061] The forward and reverse primers of genes used were:

IL-1: Forward primer: SEQ ID No: 1; Reverse primer : SEQ ID No: 2
IL-6: Forward primer: SEQ ID No: 3; Reverse primer : SEQ ID No: 4
IL-10: Forward primer: SEQ ID No: 5; Reverse primer: SEQ ID No: 6
TNF a: Forward primer: SEQ ID No: 7; Reverse primer: SEQ ID No: 8
IFN a1: 5 Forward primer: SEQ ID No: 9; Reverse primer: SEQ ID No: 10
IFN a2: Forward primer: SEQ ID No: 11; Reverse primer : SEQ ID No: 12
IFN a5: Forward primer: SEQ ID No: 13; Reverse primer : SEQ ID No: 14
IFN a6: Forward primer: SEQ ID No: 15; Reverse primer : SEQ ID No: 16
IFN a7: Forward primer: SEQ ID No: 17; Reverse primer : SEQ ID No: 18
IFN ß: Forward primer : SEQ ID No: 19 ; Reverse primer : SEQ ID No: 20
ß-actin: Forward primer : SEQ ID No: 21 ; Reverse primer : SEQ ID No: 22

[0062] Significant induction of type 1 Interferons and absence of induction of inflammatory cytokines (TNF-a, IL-b and IL-6) were quantified by Q-RT-PCR and the results are shown in Figure 12. The right panel shows of over expression of Type 1 IFN genes by SM NOSIP Antagonists and the panel on the left reveals very low induction of inflammatory cytokines.

Example 11:
SM NOSIP Antagonists induce several Interferon stimulated genes when murine macrophage cell lines RAW were treated in vitro for 8 hrs:

[0063] RAW 264.7 were treated with different concentration of SM (5µM or 15µM). After 8 h of treatment, RNA was isolated, reverse transcribed to cDNA which was quantified by qRT-PCR. Values were normalized to ß-actin mRNA content, and control cells were assigned a value of 1. Relative expression was calculated using the 2- ??CT method. Values are expressed as Mean ± SEM. Details of genes overexpressed by SM NOSIP antagonists are shown in Fig 13.

Example 12:

[0064] Q-RT PCR for Type 1 Interferon genes (14 a) and cytokine genes (14 b) in murine BMDM cells treated with SM NOSIP antagonists for 8 hrs: BMDM were treated with LPS (1µg/ml) and different concentration of SM (5µM or 15µM). After 8 h of treatment, RNA was isolated, reverse transcribed to cDNA which was quantified by qRT-PCR. Values were normalized to ß-actin mRNA content, and control cells were assigned a value of 1. Relative expression was calculated using the 2- ??CT method. Values are expressed as Mean ± SEM. Details of the results are shown in Fig 14. The left panel shows of inflammatory over expression of Type 1 IFN genes by SM NOSIP Antagonists comparable to LPS and the panel on the right reveals very low induction of inflammatory cytokines unlike the positive control LPS that induced very high induction of inflammatory cytokines. The results are shown in Fig 14.
Source and geographical origin of the biological materials and reagents used:
SN Chemicals / Reagents Supplier details Catalogue. Number
1 Ni-NTA agarose Qiagen, Germantown, MD 20874, USA. 30210
2 DAF FM Diacetate
Thermo Fisher Scientific, Waltham, MA, USA D23842

3 Protease Inhibitor cocktail Sigma,Saint Louis, Missouri, USA. P8465
4 Isopropyl ß-D-1- thiogalactopyranoside, Isopropyl ß-D-thiogalactoside (IPTG) Sigma, St. Louis, MO, USA. I6758
5 Ampicillin sodium salt Sigma, St. Louis, MO, USA. A0166
6 Polyvinylidene difluoride (PVDF) membrane Sigma, St. Louis, MO, USA. Z613835
7 Amicon Ultracel Millipore, Darmstadt, Germany. UFC900324
8 Nitrite Assy Kit
Sigma, St. Louis, MO, USA. 23479
9 Penicillin Streptomycin 100x solution (cytiva hyclone) Thermo Fisher Scientific, Waltham, MA, USA. SV30010
10 ProteOn GLC Sensor Chip Biorad, Hercules, California, USA. 176-5011
11 ProteOn Amine Coupling Kit Biorad, Hercules, California, USA. 176-2410
12 Bradford reagent Sigma, St. Louis, MO, USA. B6916
13 Luminal reagent Santa Cruz Biotechnology, Finnell Street Dallas, USA. sc-2048
14 RPMI-1640 PAN Biotech, Aidenbach Germany P04-17500
15 Protein G sepharose Sigma, St. Louis, MO, USA. P3296
16 L-Glutamine Himedia Laboratories Pvt. Ltd., Mumbai, India TC243
17 Fetal Bovine Serum. Gibco ,Thermo Fisher Scientific, Waltham, MA, USA. 26140079
18 Multiplex Luminex system Millipore, MA, USA. MCYTMAG-70K- PX32
19 Nunc MaxiSorp flat-bottom Thermo Fisher Scientific, Waltham, MA, USA. 44-2404-21
20 o-Phenylenediamine dihydrochloride (OPD) peroxidase substrate Sigma-Aldrich, Saint Louis, Missouri, USA. P1526
21 Hydrogen peroxide solution Sigma-Aldrich, Saint Louis, MO, USA. H1009
22 Bovine Serum Albumins Sigma-Aldrich, Saint Louis, MO, USA. A4612
23 DMEM Himedia Laboratories Pvt. Ltd., Mumbai, India AT186
24 Tween-20 Sigma-Aldrich, Saint Louis, MO, USA. P1379
25 High Capacity Cdna Reverse Trans Kit
Thermo Fisher Scientific, Waltham, MA, USA. 4368814

26 Antifade Solution Life Technologies Corporation, Willow Creek Road, Eugene. P36982
27 DAPI (4',6-Diamidino-2- Phenylindole, Dihydrochloride) Invitrogen Ltd., Paisley PA4 9RF, UK. D1306
28 QIAamp RNA Blood Mini Kit (50)
Qiagen, Germantown, MD 20874, USA. 52304

29 TRIzol reagent Thermo Fisher Scientific, Waltham, MA, USA. 10296028
30 PowerUp™ SYBR™ Green Master Mix (5 ML)
Thermo Fisher Scientific, Waltham, MA, USA. A25742

31 IL6 Mouse uncoated ELISA kit. Thermo Fisher Scientific, Waltham, MA, USA. 88-7064-22
32 IL10 Mouse uncoated ELISA kit. Thermo Fisher Scientific, Waltham, MA, USA. 88-7105-22
33 IL1b Mouse uncoated ELISA kit. Thermo Fisher Scientific, Waltham, MA, USA. 88-7013-22
34 TNFa Mouse uncoated ELISA kit. Thermo Fisher Scientific, Waltham, MA, USA. 88-7324-22
35 IL-1b(F & R):
5- TGCCACCTTTTGACAGTGATG -3 5- AAGGTCCACGGGAAAGACAC -3 Eurofins scientific,
Luxembourg.
36 IL-6(F & R):
5- TCCAGTTGCCTTCTTGGGAC-3
5-GCCATTGCACAACTCTTTTCTCA -3 Eurofins scientific,
Luxembourg.
37 IL-10(F & R):
5-GGTTGCCAAGCCTTATCGGA -3;
5-AATCGATGACAGCGCCTCAG -3 Eurofins scientific,
Luxembourg.
38 TNF a(F & R):
5-CAGAGGGAAGAGTTCCCA -3;
5-CCTTGGTCTGGTAGGAGACG -3 Eurofins scientific,
Luxembourg.
39 IFN a1(F & R):
5-GAG AAG AAA CAC AGC CCC TG -3;
5- TCA GTC TTC CCA GCA CAT TG-3 Eurofins scientific,
Luxembourg.
40 IFN a2(F & R):
5-GTG CAG GAA CCT CTG AC -3;
5-CTT CTG CTC TGA CCA CCT CC -3 Eurofins scientific,
Luxembourg.
41 IFN a5(F & R):
5- GAC TCA TCT GCT GCA TGG AA-3;
5- TGT TGC ATC ACA CAG GCT TT-3 Eurofins scientific,
Luxembourg.
42 IFN a6(F & R):
5- TCC ATC AGC AGC TCA ATG AC-3;
5- TAT GTC CTC ACA GCC AGC AG-3 Eurofins scientific,
Luxembourg.
43 IFN a7(F & R): 5- CTG CCT GAA GGA CAG AAA GG-3; and, 5-ATG CAG AAC ACA GAG GGC TT -3 Eurofins scientific,
Luxembourg.
44 IFN ß(F & R):
5-TCT GGA GCA TCT CTT GGA TGG CAA -3 ,
5-TCC AGC TCC AAG AAA GGA CGA ACA -3 Eurofins scientific,
Luxembourg.
45 ß-actin(F & R):
5-GATTACTGCTCTGGCTCCTAGC -3; and
5-GACTCATCGTACTCCTGCTTGC -3 Eurofins scientific,
Luxembourg.
46 SAMHD1 (F & R): 5-ATGTTTTCCCTGGAGCGTC-3,
5-GCTCACTGATCTGTAGCTCTG-3
Eurofins scientific,
Luxembourg.
47 IRF7 (F & R): 5-TTGATCCGCATAAGGTGTACG-3,
5-TTCCCTATTTTCCGTGGCTG-3
Eurofins scientific,
Luxembourg.
48 STAT1(F & R):
5-CCAAAGGAAGCACCAGAACC-3,
5-GGGTGGACTTCAGACACAGA-3
Eurofins scientific,
Luxembourg.
49 RSAD (F & R):
5-GAAACATTCTTGGAGCGTCAC-3,
5-CCGGTACAGTTCAGAAAGCG-3 Eurofins scientific,
Luxembourg.
50 ISG15 (F & R):
5-GAGAGCAAGCAGCCAGAAG-3,
5-CCCAGGCCATTGCTGCAGGC-3 Eurofins scientific,
Luxembourg.
51 OAS.1 (F & R):
5-AGGTGGAGTTTGATGTGCTG-3,
5-GTAGAGAACTCGCCATCCTTC-3. Eurofins scientific,
Luxembourg.
52 IFITM (F & R):
5-CCGTGAAGTCTAGGGACAGG-3,
5-GACAACGATGACGACGATGG-3 Eurofins scientific,
Luxembourg.
53 IFI16 (F & R):
5-CATTTGTGAGTGGAGAGTACTTAGT-3,
5-CCTGACATTGGTGAGTCTTCC-3. Eurofins scientific,
Luxembourg.
54 RIG1 (F & R):
5-CATTCTCTATGAGTACGTGGGC-3 &
5-ACTTGCTATCTCGTGCTCTTC-3. Eurofins scientific,
Luxembourg.
55 MX1 (F & R):
5-AGGCAGTGGTATTGTCACCA-3 &
5-AGACTTTGCCTCTCCACTCC-3. Eurofins scientific,
Luxembourg.
56 BST2 (F & R):
5-GTCACTGTTCCTGCTCTTTTG-3 &
5-GGTTTCCACATCCTCAGGG-3 Eurofins scientific,
Luxembourg.
57 The murine macrophage cells, RAW 264.7
Procured from ATCC cell repository
58 Murine Bone marrow derived mononuclear cells Primary BMDM cells prepared from bone marrows dissected out from normal BALB/c mice being maintained at the animal facility of the institute. Breeding pairs of BALB/c mice were obtained from National Institute of Immunology, Delhi and bred in the animal facility of Institute of Life Sciences
59 Male C57BL/6 mice Breeding pairs of C57BL/6 mice were obtained from National Institute of Immunology, Delhi and bred in the animal facility of Institute of Life Sciences
60 Human PBMC
PBMCs were prepared from peripheral blood collected from normal human volunteers after taking due consent

Table 4

[0065] The animal and cells disclosed in the examples of the present invention were procured solely for the purpose of research and experimentation to generate additional data. The invention is based on a composition and do not claim or intend to commercialize any biological material.
,CLAIMS:We Claim:
1. A pharmaceutical composition for enhancing intracellular nitric oxide in a subject , the said composition comprising :
(i) 1-{3-[9-methoxy-7-(2-methoxyphenyl)-2,3,4,5-tetrahydro-1,4-benzoxazepine-4-carbonyl]phenyl}imidazolidin-2-one.
(ii) N-tert-butyl-2-{N-[(furan-2-yl)methyl]-2-[5-(4-methylphenyl)-2H-1,2,3,4-tetrazol-2-yl]acetamido}-2-(4-hydroxyphenyl)acetamide
(iii) 3-[2-(2-{[(6-hydroxy-2,4-dioxo-1,2,3,4-tetrahydropyrimidin-5-yl)(4hydroxyphenyl) methyl]amino}-4-oxo-4,5-dihydro-1,3-thiazol-5-yl)acetamido]benzoic acid
(iv) 2-oxo-2-(1H-pyrrol-2-yl)ethyl 2-[(4-fluorophenyl)methoxy]benzoate, and
(v) 5-(3-{[(3-bromo-4-hydroxy-5 methoxyphenyl) methylidene]amino}-2 (butylimino)- 2,3-dihydro-1,3-thiazol-4-yl)-2-hydroxybenzamide.

2. The composition, as claimed in claim 1, wherein the components are present in an equimolar concentration in phosphate buffer saline.

3. The composition as claimed in claim 1 , wherein the components inhibit nitric oxide snynthase interacting proteins and inducible Nitric oxide synthase interaction.

4. The composition as claimed in claim 1, wherein the components are small molecule, Nitric oxide synthase interacting proteins antagonists, with molecular weight in the range of 382-682u.

5. The composition as claimed in claim 1, wherein the components either standalone or in combination enhances nitric oxide level at 0.1 and 0.01 µM concentrations of the composition.

6. The composition as claimed in claim 1, wherein the increase in nitric oxide level in vitro is measured via increase in nitrite levels in the cell culture supernatant.

7. The method for preparing the composition as claimed in claim 1 , said method comprising:
a) Preparing 1M stock solution by dissolving 5mg of the components as claimed in claim 1 in 1 ml dimethyl sulfoxide;
b) Preparing cocktail of 1M solution by mixing 0.2 ml of each of the small molecule components as claimed in claim 1 making a total volume of 1 ml and storing at -20 0C ;
c) Preparing 1ml cocktail of 100uM stock solution in phosphate buffer saline by adding 0.1ml of 1M stock in DMSO to 0.9 ml of phosphate buffer saline and storing for further use in -20 C in aliquots of 100 µl each ; and
d) Thawing 100µM stock solution and addition of small molecule antagonists at different concentrations in phosphate buffer solution.

Documents

Application Documents

# Name Date
1 202031050500-STATEMENT OF UNDERTAKING (FORM 3) [20-11-2020(online)].pdf 2020-11-20
2 202031050500-PROVISIONAL SPECIFICATION [20-11-2020(online)].pdf 2020-11-20
3 202031050500-PROOF OF RIGHT [20-11-2020(online)].pdf 2020-11-20
4 202031050500-FORM 1 [20-11-2020(online)].pdf 2020-11-20
5 202031050500-FORM-26 [17-12-2020(online)].pdf 2020-12-17
6 202031050500-Proof of Right [18-12-2020(online)].pdf 2020-12-18
7 202031050500-EDUCATIONAL INSTITUTION(S) [13-11-2021(online)].pdf 2021-11-13
8 202031050500-SEQUENCE LISTING (.txt) [15-11-2021(online)].txt 2021-11-15
9 202031050500-FORM 3 [15-11-2021(online)].pdf 2021-11-15
10 202031050500-ENDORSEMENT BY INVENTORS [15-11-2021(online)].pdf 2021-11-15
11 202031050500-DRAWING [15-11-2021(online)].pdf 2021-11-15
12 202031050500-CORRESPONDENCE-OTHERS [15-11-2021(online)].pdf 2021-11-15
13 202031050500-COMPLETE SPECIFICATION [15-11-2021(online)].pdf 2021-11-15
14 202031050500-Request Letter-Correspondence [24-11-2021(online)].pdf 2021-11-24
15 202031050500-Covering Letter [24-11-2021(online)].pdf 2021-11-24
16 202031050500-FORM 18 [02-12-2021(online)].pdf 2021-12-02
17 202031050500-FORM 3 [12-01-2022(online)].pdf 2022-01-12
18 202031050500-FER.pdf 2022-08-23
19 202031050500-FORM 4(ii) [20-02-2023(online)].pdf 2023-02-20
20 202031050500-OTHERS [16-05-2023(online)].pdf 2023-05-16
21 202031050500-FORM 13 [16-05-2023(online)].pdf 2023-05-16
22 202031050500-FER_SER_REPLY [16-05-2023(online)].pdf 2023-05-16
23 202031050500-CLAIMS [16-05-2023(online)].pdf 2023-05-16
24 202031050500-FORM 3 [20-07-2023(online)].pdf 2023-07-20
25 202031050500-US(14)-HearingNotice-(HearingDate-09-07-2024).pdf 2024-06-06
26 202031050500-FORM-26 [01-07-2024(online)].pdf 2024-07-01
27 202031050500-Correspondence to notify the Controller [01-07-2024(online)].pdf 2024-07-01
28 202031050500-Written submissions and relevant documents [22-07-2024(online)].pdf 2024-07-22
29 202031050500-FORM 13 [22-07-2024(online)].pdf 2024-07-22
30 202031050500-US(14)-ExtendedHearingNotice-(HearingDate-14-11-2024)-1200.pdf 2024-10-18
31 202031050500-Correspondence to notify the Controller [11-11-2024(online)].pdf 2024-11-11
32 202031050500-Correspondence to notify the Controller [12-11-2024(online)].pdf 2024-11-12
33 202031050500-MARKED COPIES OF AMENDEMENTS [28-11-2024(online)].pdf 2024-11-28
34 202031050500-FORM 13 [28-11-2024(online)].pdf 2024-11-28
35 202031050500-AMMENDED DOCUMENTS [28-11-2024(online)].pdf 2024-11-28
36 202031050500-Written submissions and relevant documents [29-11-2024(online)].pdf 2024-11-29
37 202031050500-PatentCertificate23-01-2025.pdf 2025-01-23
38 202031050500-IntimationOfGrant23-01-2025.pdf 2025-01-23

Search Strategy

1 SearchstrategyE_22-08-2022.pdf

ERegister / Renewals

3rd: 21 Apr 2025

From 20/11/2022 - To 20/11/2023

4th: 21 Apr 2025

From 20/11/2023 - To 20/11/2024

5th: 21 Apr 2025

From 20/11/2024 - To 20/11/2025

6th: 20 Nov 2025

From 20/11/2025 - To 20/11/2026