Abstract: “COMPOSITIONS AND PROCESS FOR DETECTION OF MYCOBACTERIA” The present invention relates to identification and detection of Mycobacterium tuberculosis using a novel set of oligonucleotides and employing nucleic acid amplification assay. The oligonucleotides of the present invention have nucleotide sequences as set forth in SEQ ID NO: 1 SEQ ID NO:2 and SEQ ID NO: 3. The present invention provides a kit for the detection of the M. tuberculosis and also provides a method of detecting M. tuberculosis in a sample using the novel oligonucleotides.
1. A set of oligonucleotides for detection of a target nucleic acid molecule of Mycobacterium tuberculosis in a sample, wherein the nucleotide sequence of the oligonucleotides is as set forth in SEQ ID NO: 1 comprising at least one label, SEQ ID NO: 2, and SEQ ID NO: 3.
2. The set of oligonucleotides as claimed in claim 1, wherein detection of the target nucleic acid molecule of Mycobacterium tuberculosis in a sample is done by real time polymerase chain reaction.
3. The set of oligonucleotides as claimed in claim 1, wherein the label is at least one of a fluorophore and a quencher.
4. The set of oligonucleotides as claimed in claim 3, wherein the fluorophore is selected from the group comprising fluorescein, fluorescein derivatives, VICTM, 6-carboxy-4’,5’-dichloro-2’,7’-dimethoxyfluorescein,5-(2'-aminoethyl) aminonaphthalene-1-sulphonic acid, coumarin, coumarin derivatives, lucifer yellow, texas red, tetramethylrhodamine, 6-carboxy fluorescein, tetrachloro-6-carboxyfluoroscein, 5-carboxyrhodamine, and cyanine dyes.
5. The set of oligonucleotides as claimed in claim 3, wherein the quencher is selected from the group comprising tetra methyl rhodamine (TAMRA), 4'-(4-dimethylaminophenylazo) benzoic acid, 4-dimethylaminophenyl-4'-maleimide, carboxy tetramethyl rhodamine, and black hole quencher (BHQ™) dyes.
6. The set of oligonucleotides as claimed in claim 3, wherein the quencher is a dark quencher selected from the group comprising dimethyl aminoazosulfonic acid (dabsyl) quenchers, black hole quenchers, qxl quenchers, Iowa black FQ, Iowa black RQ, and IRDye QC-1.
7. The set of oligonucleotides as claimed in claim 1, wherein the oligonucleotide as set forth in SEQ ID NO: 1 comprises 6-carboxy fluorescein and black hole quencher 1 (BHQ™).
8. A set of oligonucleotides for detection of a target nucleic acid molecule of Mycobacterium tuberculosis in a sample, wherein the nucleotide sequence of the oligonucleotides is as set forth in SEQ ID NO: 2, and SEQ ID NO: 3.
9. The set of oligonucleotides as claimed in claim 8, wherein detection of the target nucleic acid molecule of Mycobacterium tuberculosis in a sample is done by conventional polymerase chain reaction.
10. A kit for detection of a target nucleic acid molecule of Mycobacterium tuberculosis in a sample, wherein the kit comprises the set of oligonucleotides as claimed in claim 1 or 8, amplification reagents, dNTP mixture, essential co-factors, polymerase enzyme, water, reaction buffer or a combination thereof.
11. A method for detection of a target nucleic acid molecule of Mycobacterium tuberculosis in a sample, wherein the method comprises: a) providing a sample; b) subjecting the sample to a polymerase chain reaction using a set of oligonucleotides having nucleotide sequences as set forth in SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3; and c) detecting presence or absence of the target nucleic acid sequence; wherein presence of the target nucleic acid sequence in the sample detects Mycobacterium tuberculosis.
12. The method as claimed in claim 11, wherein the sample is subjected to real time polymerase chain reaction.
13. The method as claimed in claim 11, wherein the oligonucleotides as set forth in SEQ ID NO: 1 is labelled with atleast one labelling substance.
14. The method as claimed in claim 13, wherein the labelling substance is atleast one of a fluorophore and a quencher.
15. The method as claimed in claim 14, wherein the fluorophore is selected from the group comprising fluorescein, fluorescein derivatives, VICTM , 6-carboxy-4’,5’-dichloro-2’,7’-dimethoxyfluorescein, 5-(2'-aminoethyl) aminonaphthalene-1-sulphonic acid, coumarin, coumarin derivatives, lucifer yellow, texas red, tetramethylrhodamine, 6-carboxy fluorescein, tetrachloro-6-carboxyfluoroscein, 5-carboxyrhodamine, and cyanine dyes.
16. The method as claimed in claim 14, wherein the quencher is selected from the group comprising tetra methyl rhodamine (TAMRA), 4'-(4-dimethylaminophenylazo) benzoic acid, 4-dimethylaminophenyl-4'-maleimide,carboxy tetramethyl rhodamine, and black hole quencher (BHQ™) dyes.
17. The method as claimed in claim 14, wherein the quencher is a dark quencher selected from the group comprising dimethyl aminoazosulfonic acid (dabsyl) quenchers, black hole quenchers, qxl quenchers, Iowa black FQ, Iowa black RQ, and IRDye QC-1.
18. The method as claimed in claim 13, wherein the oligonucleotide as set forth in SEQ ID NO: 1 comprises 6-carboxy fluorescein and black hole quencher 1 (BHQ™).
19. A method for detection of a target nucleic acid molecule of Mycobacterium tuberculosis in a sample, wherein the method comprises: a) providing a sample; b) subjecting the sample to a polymerase chain reaction using a set of oligonucleotides having nucleotide sequences as set forth in SEQ ID NO: 2, and SEQ ID NO: 3; and c) detecting presence or absence of the target nucleic acid sequence; wherein presence of the target nucleic acid sequence in the sample detects Mycobacterium tuberculosis.
20. The method as claimed in claim 19, wherein the sample is subjected to conventional polymerase chain reaction.
FIELD OF INVENTION
The present invention relates to the field of diagnostics and provides a set of oligonucleotides for detection of Mycobacterium tuberculosis in a sample using nucleic acid amplification technique.
BACKGROUND OF THE INVENTION
The effective control of tuberculosis (TB) is impeded by a lack of rapid, accurate, and affordable diagnostic methods. As an airborne infectious disease, approximately one third of the world’s population is infected with TB. India and South East Asia contributes to 50% of global tuberculosis burden. Precise diagnosis of active pulmonary tuberculosis is doubtful during the first clinic visit and therefore to start effective treatment and control the disease spread, it is necessary to have a sensitive and specific diagnostic tool.
Biochemical, phenotypical and growth tests are some of the classical diagnostic procedures involved in the detection of tuberculosis infection. In spite of much technological advances, the diagnosis is based on the practice of limiting to Acid-fast bacillus (AFB) smear microscopy, which is shown to have only 50-60 positive predictive value, due to economic limitations. The standard reference test for detection of tuberculosis infection has historically been culture alone. These diagnostic tools are seriously limited by their speed, cost, technical complexity, difficulty in scale-up, and less-than-ideal accuracy. With the advent of the use of molecular techniques in the field of clinical detection, highly specific and accurate diagnostic tools have been developed. Laboratory tests using molecular techniques involve the use of polymerase chain reaction (PCR) amplification, amplification and digestion with restriction enzymes, hybridization and amplification with specific probes, and sequencing techniques for the detection of mycobacteria. Despite advances in molecular diagnostics, the ability to diagnose infections by PCR is still inadequate, largely because of the possibility of false-negative results. Advent of quantitative real-time PCR (qPCR), which exhibits lower transition times compared with the conventional end-point PCR, increases the rate of detection. Unlike the conventional PCR, quantitative real-time PCR (qPCR) monitors the PCR in situ by fluorescence arising from fluorogenic compounds incorporated in the PCR process which increases the specificity and sensitivity of the test and allows precise quantitative information extracted from the exponential phase of the reaction. High fidelity amplification can be successfully achieved using specially designed probes that show high specificity and sensitivity to the target gene. Real-Time quantitative PCR or qPCR allows single tube analyses without the need for post-amplification processes which drastically reduces the risk of contamination, procedural errors and detection errors.
Mycobacteria in clinical samples has already been detected and differentiated from non-tuberculosis mycobacteria using the LightCycler system as demonstrated by Shrestha et al. (Shreshta, N.K., Tuohy, M.J., Hall, G.S., Reischl, U., Gordon,S.M. and Procop, G.W. (2003). Journal of Clinical Microbiology 41(11): 5121-5126). Additionally, Broccolo et al. developed two real time PCR assays based on the IS6110 multicopy element and on the senX3-regX3 intergenic region of Mycobacterium tuberculosis for diagnosis of mycobacterial infections (Broccolo, F., Scarpellini, P., Locatelli, G., Zingale, A., Brambilla, A.M., Cichero, P., Sechi, L.A., Lazzarin, A., Lusso, P. and Malnati, M.S. (2003). Journal of Clinical Microbiology 41(10): 4565-4572).
US7329493 describes a method, primers, probe and kit for detecting M. tuberculosis of suspected patients by performing one tube nested PCR.
US8044184 describes primers and probes capable of hybridizing to the IS6110 gene of the Mycobacterium tuberculosis and a method for detecting the human tubercle bacillus, M. tuberculosis using the primers and probes.
US2007/0072188 describes a method and kit for detecting Mycobacterium tuberculosis using a set of oligonucleotide primer pairs for the amplification of Early Secretory Antigenic Target (ESAT)-6 gene of the Mycobacterium species using conventional amplification techniques.
US2009/0023141 describes a method for identifying M. tuberculosis which comprises performing a nucleic acid amplification reaction using a primer for amplification of a nucleotide sequence correspondding to a variable region in a 16S rRNA gene sequence of M. tuberculosis.
US 2010/0304371 describes compositions and method of detecting mycobacteria, wherein the compositions include oligonucleotides that can be used as primers and probes. The primers are used in multiplex PCR for detecting and differentiating samples for the presence of Mycobacterium. The target genes for the primers and probes are the IS1081 and the RD4 nucleotide sequences of the Mycobacterium tuberculosis complex (MTC) organisms.
Most of the detection techniques are lengthy, time consuming and expensive to perform. In the present scenario, there is a dire need to provide a diagnostic tool that is affordable, rapid, easy-to-use, sensitive and can successfully discriminate among tuberculosis and non-tuberculosis mycobacteria to strengthen the health care mission and stop the deadly spread of tuberculosis infection.
The present invention provides a rapid, easy-to-use, high fidelity method for the detection of tuberculosis bacteria in a sample by using a set of novel oligonucleotides.
SUMMARY OF INVENTION
An aspect of the present invention relates to a set of oligonucleotides for detection of a target nucleic acid molecule of Mycobacterium tuberculosis in a sample, wherein the nucleotide sequence of the oligonucleotides is as set forth in SEQ ID NO: 1 comprising at least one label, SEQ ID NO: 2 and SEQ ID NO: 3.
Another aspect of the present invention relates to a set of oligonucleotides for detection of a target nucleic acid molecule of Mycobacterium tuberculosis in a sample, wherein the nucleotide sequence of the oligonucleotides is as set forth in SEQ ID NO: 2 and SEQ ID NO: 3.
Another aspect of the present invention relates to a method for detection of a target nucleic acid molecule of Mycobacterium tuberculosis in a sample, wherein the method comprises: providing a sample; subjecting the sample to a polymerase chain reaction using a set of oligonucleotides having nucleotide sequences as set forth in SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3; and detecting the presence or absence of the target nucleic acid sequence; wherein presence of the target nucleic acid sequence in the sample detects Mycobacterium tuberculosis.
Another aspect of the present invention relates to a method for detection of a target nucleic acid molecule of Mycobacterium tuberculosis in a sample, wherein the method comprises: providing a sample; subjecting the sample to a polymerase chain reaction using a set of oligonucleotides having nucleotide sequences as set forth in SEQ ID NO: 2 and SEQ ID NO: 3; and detecting the presence or absence of the target nucleic acid sequence; wherein presence of the target nucleic acid sequence in the sample detects Mycobacterium tuberculosis.
BRIEF DESCRIPTION OF ACCOMPANYING DRAWINGS
The following drawings form part of the present specification and are included to further illustrate aspects of the present invention. The invention may be better understood by reference to the drawings in combination with the detailed description of the specific embodiments presented herein.
Figure 1 shows the amplification curve from experiments to determine specificity for detection of the genetic target, ribonucleoside-diphosphate reductase gene in the non-tuberculosis strains: Mycobacterium fortuitum (A-1, A-4), Mycobacterium abscessus (A-2, A-3, A-7, B-5, B-6), Mycobacterium kansasii I (A-5), Mycobacterium avium (A-6, B-1, B-3, B-4, B-8), Mycobacterium gordanae (B-2) and Mycobacterium szulgai (B-7) and the tuberculosis strain: Mycobacterium tuberculosis (MTB). The assay was performed following the established protocol according to the present invention.
Figure 2 shows the amplification curve from experiments to determine specificity of the oligonucleotides of the present invention. The bacterial samples tested were common clinical isolates: (1) Klebsiella pneumonia (2) Streptococcus sp (3) Acinetobacter sp (4) Escherichia coli (5) Salmonella typhi (6) Enterococcus sp (7) Pseudomonas aeruginosa (8) Mycobacterium smegmatis and (9) Mycobacterium tuberculosis.
Figure 3 shows the serial dilution curve for Mycobacterium tuberculosis. The samples numbered 1-7 correspond to serial dilutions from 2.00E+08 to 2.00E+02 copies/ml of the Mycobacterium tuberculosis genome.
Figure 4 shows the calibration curve for Mycobacterium tuberculosis obtained by plotting the Ct value (y-axis) versus the copy number of the genome in each DNA sample of the amplification reaction (x-axis, logarithmic value) for the determination of the sensitivity of the target gene detection and the limit of detection of the target gene, ribonucleoside phosphate reductase.
Figure 5 shows the real-time amplification curves for the ribonucleoside-diphosphate reductase target gene of Mycobacterium tuberculosis gene, from 24 clinical samples of tuberculosis infected persons.
Figure 6 shows the real-time PCR amplification profile for SEQ ID NO: 4, 5, and 6 versus SEQ ID NO: 1, 2, and 3
A: Amplification with SEQ ID NO: 1, 2, and 3
B: Amplification with SEQ ID NO: 4, 5, and 6
Figure 7 shows real-time PCR amplification profile for SEQ ID NO: 7, 8, and 9 and SEQ ID NO: 1, 2, and 3
Ribo: Amplification with SEQ ID NO: 1, 2, and 3
lpqI: Amplification with SEQ ID NO: 7, 8, and 9
DETAILED DESCRIPTION OF THE INVENTION
Those skilled in the art will be aware that the invention described herein is subject to variations and modifications other than those specifically described. It is to be understood that the invention described herein includes all such variations and modifications. The invention also includes all such steps, features, compositions and compounds referred to or indicated in this specification, individually or collectively, and any and all combinations of any two or more of said steps or features.
Definitions
For convenience, before further description of the present invention, certain terms employed in the specification, examples and appended claims are collected here. These definitions should be read in light of the remainder of the disclosure and understood as by a person of skill in the art. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by a person of ordinary skill in the art.
The articles "a", "an" and “the” are used to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article.
The terms "comprise" and "comprising" are used in the inclusive, open sense, meaning that additional elements may be included. It is not intended to be construed as "consists of only.”
Throughout this specification, unless the context requires otherwise the word "comprise", and variations such as "comprises" and "comprising", will be understood to imply the inclusion of a stated element or step or group of element or steps but not the exclusion of any other element or step or group of element or steps.
The term "including" is used to mean "including but not limited to”. The terms are used interchangeably.
The term "oligonucleotide” refers to a short sequence of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA).
The term “test sample” or “sample” refers to material obtained from a biological source, environmental source or a processed sample. The processed sample may include extraction of genetic material from the sample. The terms ‘test sample’ or ‘sample’ are used interchangeably.
The term “quencher” refers to a molecule that absorbs the fluorescent emission of reporter molecule when in close vicinity, i.e., the reporter is not fluorescent when the quencher is close by and becomes fluorescent when the quencher is removed.
The term “fluorophore” refers to a fluorescent chemical compound that can re-emit light upon light excitation.
The term “polymerase chain reaction” or “conventional polymerase chain reaction” refers to a biochemical technology in molecular biology to amplify a single or a few copies of a piece of DNA across several orders of magnitude, generating thousands to millions of copies of a particular DNA sequence.
The term “real time polymerase chain reaction” refers to a laboratory technique based on the polymerase chain reaction (PCR), which is used to amplify and simultaneously quantify a targeted DNA molecule. The real time PCR enables both detection and quantification of DNA molecules.
It is an object of the present invention to provide a rapid, easy-to-use, high fidelity method for the detection of tuberculosis bacteria without exhibiting false positive test in the diagnosis.
It is another object of the present invention to provide novel oligonucleotides for the detection of Mycobacterium tuberculosis, wherein the oligonucleotides hybridize with the target nucleic acid sequence in Mycobacterium tuberculosis.
It is yet another object of the present invention to provide a kit comprising novel oligonucleotides for the detection of Mycobacterium tuberculosis, wherein the oligonucleotides hybridize with the target nucleic acid sequence in Mycobacterium tuberculosis.
It is still another object of the present invention to provide a method for the detection of Mycobacterium tuberculosis using the novel oligonucleotides, wherein the oligonucleotides hybridize with the target nucleic acid sequence in Mycobacterium tuberculosis.
The present invention is not to be limited in scope by the specific embodiments described herein, which are intended for the purposes of exemplification only. Functionally-equivalent products, compositions, and methods are clearly within the scope of the invention, as described herein.
The present invention provides a set of oligonucleotides having sequences as set forth in SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3 for the detection of tuberculosis causing bacterial strain, Mycobacterium tuberculosis by employing real-time Polymerase Chain Reaction (qPCR). The oligonucleotides of the present invention having sequences as set forth in SEQ ID NO: 1-3 were chosen from the Mycobacterium tuberculosis genome and specifically targeted the nucleotide sequence of the ribonucleoside diphosphate reductase gene of Mycobacterium tuberculosis complex.
The oligonucleotide having a nucleotide sequence as set forth in SEQ ID NO: 1 is a probe and is comprised of 19 nucleotides. The oligonucleotide probe specifically hybridizes to the ribonucleoside diphosphate reductase gene sequence of the tuberculosis causing Mycobacterium tuberculosis without exhibiting non-specific hybridization to nucleic acid sequences of the non-tuberculosis mycobacterial strains. The oligonucleotide probe has a detectable label. The oligonucleotide probe is dual-labeled by conjugation with a fluorophore molecule at the 5' end and a quencher molecule at the 3' end of the oligonucleotide.
In a preferred embodiment, the oligonucleotide probe is preferably conjugated with 6-Carboxy fluorescein as the fluorophore and Black hole quencher 1 [BHQ1™] as the quencher.
The oligonucleotide having the nucleotide sequence as set forth in SEQ ID NO: 2 is a primer that is comprised of 18 nucleotides and functions as the sense/forward primer. The oligonucleotide having a nucleotide sequence as set forth in SEQ ID NO: 3 is a primer comprised of 15 nucleotides and functions as an antisense/reverse primer. The oligonucleotide primers having sequences as set forth in SEQ ID NO: 2 and SEQ ID NO: 3 are used to specifically amplify and detect the target ribonucleoside diphosphate reductase gene sequence of Mycobacterium tuberculosis.
The present invention also provides a composition comprising the oligonucleotides having sequences as set forth in SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3. This composition may further comprise nucleic acid amplification reagents, co-factors, reaction buffers, sterile water and a mixture of deoxyribonucleotide triphosphate (dNTP) or a combination thereof. The composition is used for the detection, identification and quantification of Mycobacterium tuberculosis in a test sample.
The present invention also provides a kit comprising the oligonucleotides having sequences as set forth in SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3 for the detection and quantification of Mycobacterium tuberculosis in test samples. The kit may also comprise a composition comprising the oligonucleotides having sequences as set forth in SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3. The kit may further comprise, amplification reagents co-factors, reaction buffers, sterile water and a mixture of dNTP or a combination thereof. The kit may optionally comprise an instruction manual.
The oligonucleotides of the present invention can be used as conventional probes and primers and the methods described herein can include one or more steps directed towards identifying a patient or material in need of testing; providing a sample; processing a sample; amplifying a target sequence within the sample or material; detecting an amplification product and providing the results of the analysis to the concerned personnel.
Oligonucleotides having SEQ ID NO: 2 and SEQ ID NO: 3 can be used in conventional polymerase chain reaction (PCR) assays for the detection of Mycobacterium tuberculosis. In instances where conventional PCR methods are used, post amplification analysis of the amplicons or PCR products are required for detection and identification.
The present invention also provides a kit comprising the oligonucleotides having sequences as set forth in SEQ ID NO: 2 and SEQ ID NO: 3 for the detection and quantification of Mycobacterium tuberculosis in test samples. The kit may also comprise a composition comprising the oligonucleotides having sequences as set forth in SEQ ID NO: 2 and SEQ ID NO: 3. The kit may further comprise, amplification reagents co-factors, reaction buffers, sterile water and a mixture of dNTP or a combination thereof. The kit may optionally comprise an instruction manual.
The present invention provides a method of detecting and quantifying Mycobacterium tuberculosis in a sample, wherein the method comprises providing a sample and subjecting the nucleic acids in the sample to the set of oligonucleotides having sequences as set forth in SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3 to obtain a reaction mixture, subjecting the reaction mixture to a real-time PCR to obtain copies of the target sequence and simultaneously detecting the presence of the target gene sequence of Mycobacterium tuberculosis by measuring the fluorescence signal of the amplified target nucleic acid sequence. In a real-time PCR assay, the amplification of the target nucleic acid sequence can be detected real-time as an increase in the fluorescence signal and there is no need necessity to perform post amplification analysis like electrophoresis for the amplified end products.
The present invention provides another method of detecting and quantifying Mycobacterium tuberculosis in a sample, wherein the method comprises providing a sample and subjecting the nucleic acids in the sample to the set of oligonucleotides having sequences as set forth in SEQ ID NO: 2 and SEQ ID NO: 3 to obtain a reaction mixture, subjecting the reaction mixture to a conventional PCR to obtain copies of the target sequence and detecting the presence of the target nucleic acid sequence in the sample.
The bacterial load of the sample can be quantified using calibration curves prepared using log dilution method and threshold cycles. The oligonucleotides of the present invention show specificity to the Mycobacterium tuberculosis complex including M. tuberculosis and M. bovis but do not show any reactivity with other common clinical pathogens (Figure 1, Figure 2).
Further, to illustrate the specificity and sensitivity of the oligonucleotides as set forth in SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, a comparative study was carried out by synthesizing another set of oligonucleotides having sequences as set forth in SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 6, isolated from the Mycobacterium tuberculosis genome. They were designed for the detection of Mycobacterium tuberculosis in the samples. The oligonucleotide having a nucleotide sequence as set forth in SEQ ID NO: 4 is a probe which specifically hybridizes to the mpt83 gene sequence, coding for a cell surface lipoprotein mpt83. The oligonucleotide (SEQ ID NO: 4) has a detectable label. The oligonucleotide probe is dual labelled by conjugation with a fluorophore molecule at the 5’ end and a quencher molecule at the 3’ end of the oligonucleotide. The oligonucleotides having the nucleotide sequences as set forth in SEQ ID NO: 5 and 6 function as forward/sense primer and reverse/antisense primer respectively.
However, the set of oligonucleotides having sequences as set forth in SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 6 could not detect Mycobacterium tuberculosis in the samples when the reaction mixture was subjected to real-time PCR assay. The absence of results for this set of oligonucleotides indicates that even though the genome of Mycobacterium tuberculosis is known, any sequence will not function as a probe-primer combination for detection of Mycobacterium tuberculosis in samples.
The specificity and sensitivity of the oligonucleotides as set forth in SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3 was reaffirmed by a second comparative study carried out using the set of oligonucleotides as set forth in SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 9, isolated from the Mycobacterium tuberculosis genome. The oligonucleotide sequences were designed for detection of Mycobacterium tuberculosis in the samples. The oligonucleotide as set forth in SEQ ID NO: 7 is a probe which hybridizes to the lpqI gene sequence, coding for a probable conserved lipoprotein LPQI. The oligonucleotide (SEQ ID NO: 7) has a detectable label. The oligonucleotide probe is dual labelled by conjugation with a fluorophore molecule at the 5’ end and a quencher molecule at the 3’ end of the oligonucleotide. The oligonucleotides having the nucleotide sequences as set forth in SEQ ID NO: 8 and 9 function as forward/sense primer and reverse/antisense primer respectively.
The result show that detection of MTB by SEQ ID NO: 7, 8, and 9 is delayed and less sensitive as compared to the results obtained on detection of MTB by SEQ ID NO: 1, 2, and 3. Therefore, the set of oligonucleotides provided in the present invention, having sequences as set forth in SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, are unique, specific and highly sensitive for the detection of Mycobacterium tuberculosis in samples.
The present invention is not to be limited in scope by the specific embodiments described herein, which are intended for the purposes of exemplification only. Functionally-equivalent products, compositions, and methods are clearly within the scope of the invention, as described herein.
In an embodiment of the present invention, there is provided a set of oligonucleotides having nucleotide sequence as set forth in SEQ ID NO: 1 comprising at least one label, SEQ ID NO: 2, and SEQ ID NO: 3. The oligonucleotides of the present invention were tested against a panel of common clinical bacterial samples and different strains of mycobacteria, such as Klebsiella pneumonia, Streptococcus sp, Acinetobacter sp, Escherichia coli, Salmonella typhi, Enterococcus sp, Pseudomonas aeruginosa, Mycobacterium smegmatis, Mycobacterium fortuitum I, Mycobacterium abscessus, Mycobacterium kansasii I, Mycobacterium avium, Mycobacterium gordanae, Mycobacterium szulgai, and Mycobacterium tuberculosis. The oligonucleotides did not hybridize or show any cross reactivity with the DNA of bacterial samples or non-tuberculosis mycobacterial strains and were highly specific for the tuberculosis strain, Mycobacterium tuberculosis.
An embodiment of the present invention provides a set of oligonucleotides for detection of a target nucleic acid molecule of Mycobacterium tuberculosis in a sample, wherein the nucleotide sequence of the oligonucleotides is as set forth in SEQ ID NO: 1 comprising at least one label, SEQ ID NO: 2, and SEQ ID NO: 3.
Another embodiment of the present invention provides a set of oligonucleotides for detection of a target nucleic acid molecule of Mycobacterium tuberculosis in a sample, wherein the nucleotide sequence of the oligonucleotides is as set forth in SEQ ID NO: 1 comprising at least one label, SEQ ID NO: 2, and SEQ ID NO: 3, wherein detection of the target nucleic acid molecule of Mycobacterium tuberculosis in a sample is done by real time polymerase chain reaction.
Another embodiment of the present invention provides a set of oligonucleotides for detection of a target nucleic acid molecule of Mycobacterium tuberculosis in a sample, wherein the nucleotide sequence of the oligonucleotides is as set forth in
SEQ ID NO: 1 comprising at least one label, SEQ ID NO: 2, and SEQ ID NO: 3, and wherein the label is at least one of a fluorophore and a quencher.
Another embodiment of the present invention provides a set of oligonucleotides for detection of a target nucleic acid molecule of Mycobacterium tuberculosis in a sample, wherein the nucleotide sequence of the oligonucleotides is as set forth in SEQ ID NO: 1 comprising at least one label, SEQ ID NO: 2 and SEQ ID NO: 3, wherein the label is at least one of a fluorophore and a quencher, and the fluorophore is selected from the group comprising fluorescein, fluorescein derivatives, VICTM, 6-carboxy-4’,5’-dichloro-2’,7’-dimethoxyfluorescein,5-(2'-aminoethyl) aminonaphthalene-1-sulphonic acid, coumarin, coumarin derivatives, lucifer yellow, texas red, tetramethylrhodamine, 6-carboxy fluorescein, tetrachloro-6-carboxyfluoroscein, 5-carboxyrhodamine, and cyanine dyes.
In an embodiment of the present invention, there is provided a set of oligonucleotides for detection of a target nucleic acid molecule of Mycobacterium tuberculosis in a sample, wherein the nucleotide sequence of the oligonucleotides is as set forth in SEQ ID NO: 1 comprising at least one label, SEQ ID NO: 2 and SEQ ID NO: 3, wherein the label is at least one of a fluorophore and a quencher, and the quencher is selected from the group comprising tetra methyl rhodamine (TAMRA), 4'-(4-dimethylaminophenylazo) benzoic acid, 4-dimethylaminophenyl-4'-maleimide,carboxy tetramethyl rhodamine, and black hole quencher (BHQ™) dyes.
In yet another embodiment of the present invention, there is provided a set of oligonucleotides for detection of a target nucleic acid molecule of Mycobacterium tuberculosis in a sample, wherein the nucleotide sequence of the oligonucleotides is as set forth in SEQ ID NO: 1 comprising at least one label, SEQ ID NO: 2 and SEQ ID NO: 3, wherein the label is at least one of a fluorophore and a quencher , and the quencher is a dark quencher selected from the group comprising dimethyl aminoazosulfonic acid (dabsyl) quenchers, black hole quenchers, qxl quenchers, Iowa black FQ, Iowa black RQ, and IRDye QC-1.
In another embodiment of the present invention, there is provided a set of oligonucleotides for detection of a target nucleic acid molecule of Mycobacterium tuberculosis in a sample, wherein the nucleotide sequence of the oligonucleotides is as set forth in SEQ ID NO: 1 comprising at least one label, SEQ ID NO: 2 and SEQ ID NO: 3, and wherein the oligonucleotide as set forth in SEQ ID NO: 1 comprises 6-carboxy fluorescein and black hole quencher 1 (BHQ™).
Another embodiment of the present invention provides a set of oligonucleotides for detection of a target nucleic acid molecule of Mycobacterium tuberculosis in a sample, wherein the nucleotide sequence of the oligonucleotides is as set forth in SEQ ID NO: 2 and SEQ ID NO: 3.
Another embodiment of the present invention provides a set of oligonucleotides for detection of a target nucleic acid molecule of Mycobacterium tuberculosis in a sample, wherein the nucleotide sequence of the oligonucleotides is as set forth in SEQ ID NO: 2 and SEQ ID NO: 3, and wherein detection of the target nucleic acid molecule of Mycobacterium tuberculosis in a sample is done by conventional polymerase chain reaction.
Another embodiment of the present invention provides a kit for detection of a target nucleic acid molecule of Mycobacterium tuberculosis in a sample, wherein the kit comprises the set of oligonucleotide for detection of a target nucleic acid molecule of Mycobacterium tuberculosis in a sample, wherein the nucleotide sequence of the oligonucleotides is as set forth in SEQ ID NO: 1 comprising atleast one label, SEQ ID NO: 2, and SEQ ID NO: 3, amplification reagents, dNTP mixture, essential co-factors, polymerase enzyme, water, reaction buffer or a combination thereof.
Another embodiment of the present invention provides a kit for detection of a target nucleic acid molecule of Mycobacterium tuberculosis in a sample, wherein the kit comprises a set of oligonucleotides for detection of a target nucleic acid molecule of Mycobacterium tuberculosis in a sample, wherein the nucleotide sequence of the oligonucleotides is as set forth in SEQ ID NO: 2, and SEQ ID NO: 3, amplification reagents, dNTP mixture, essential co-factors, polymerase enzyme, water, reaction buffer or a combination thereof.
In another embodiment of the present invention, there is provided a method for detection of a target nucleic acid molecule of Mycobacterium tuberculosis in a sample, wherein the method comprises: providing a sample; subjecting the sample to a polymerase chain reaction using a set of oligonucleotides having nucleotide sequences as set forth in SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3; and detecting presence or absence of the target nucleic acid sequence; wherein presence of the target nucleic acid sequence in the sample detects Mycobacterium tuberculosis.
In another embodiment of the present invention, there is provided a method for detection of a target nucleic acid molecule of Mycobacterium tuberculosis in a sample, wherein the method comprises: providing a sample; subjecting the sample to a polymerase chain reaction using a set of oligonucleotides having nucleotide sequences as set forth in SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3; and detecting presence or absence of the target nucleic acid sequence; wherein presence of the target nucleic acid sequence in the sample detects Mycobacterium tuberculosis, and wherein the sample is subjected to real time polymerase chain reaction.
In another embodiment of the present invention, there is provided a method for detection of a target nucleic acid molecule of Mycobacterium tuberculosis in a sample, wherein the method comprises: providing a sample; subjecting the sample to a polymerase chain reaction using a set of oligonucleotides having nucleotide sequences as set forth in SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3; and detecting presence or absence of the target nucleic acid sequence; wherein presence of the target nucleic acid sequence in the sample detects Mycobacterium tuberculosis, and wherein the oligonucleotides as set forth in SEQ ID NO: 1 is labelled with atleast one labelling substance.
In another embodiment of the present invention, there is provided a method for detection of a target nucleic acid molecule of Mycobacterium tuberculosis in a sample, wherein the method comprises: providing a sample; subjecting the sample to a polymerase chain reaction using a set of oligonucleotides having nucleotide sequences as set forth in SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3; and detecting presence or absence of the target nucleic acid sequence; wherein presence of the target nucleic acid sequence in the sample detects Mycobacterium tuberculosis, wherein the oligonucleotides as set forth in SEQ ID NO: 1 is labelled with atleast one labelling substance, and wherein the labelling substance is atleast one of a fluorophore and a quencher.
In yet another embodiment of the present invention, there is provided a method for detection of a target nucleic acid molecule of Mycobacterium tuberculosis in a sample, wherein the method comprises: providing a sample; subjecting the sample to a polymerase chain reaction using a set of oligonucleotides having nucleotide sequences as set forth in SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3; and detecting presence or absence of the target nucleic acid sequence; wherein presence of the target nucleic acid sequence in the sample detects Mycobacterium tuberculosis, wherein the oligonucleotides as set forth in SEQ ID NO: 1 is labeled with atleast one labelling substance, and wherein the fluorophore is selected from the group comprising fluorescein, fluorescein derivatives, VICTM , 6-carboxy-4’,5’- dichloro-2’,7’-dimethoxyfluorescein,5-(2'-aminoethyl) aminonaphthalene-1- sulphonic acid, coumarin, coumarin derivatives, lucifer yellow, texas red, tetramethylrhodamine, 6-carboxy fluorescein, tetrachloro-6-carboxyfluoroscein, 5- carboxyrhodamine, and cyanine dyes.
In still another embodiment of the present invention, there is provided a method for detection of a target nucleic acid molecule of Mycobacterium tuberculosis in a sample, wherein the method comprises: providing a sample; subjecting the sample to a polymerase chain reaction using a set of oligonucleotides having nucleotide sequences as set forth in SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3; and detecting presence or absence of the target nucleic acid sequence; wherein presence of the target nucleic acid sequence in the sample detects Mycobacterium tuberculosis, wherein the oligonucleotides as set forth in SEQ ID NO: 1 is labeled with atleast one labelling substance, and wherein the quencher is selected from the group comprising tetra methyl rhodamine (TAMRA), 4'-(4- dimethylaminophenylazo) benzoic acid, 4-imethylaminophenyl-4'- maleimide,carboxy tetramethyl rhodamine, and black hole quencher (BHQ™) dyes.
In an embodiment of the present invention, there is provided a method for detection of a target nucleic acid molecule of Mycobacterium tuberculosis in a sample, wherein the method comprises: providing a sample; subjecting the sample to a polymerase chain reaction using a set of oligonucleotides having nucleotide sequences as set forth in SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3; and detecting presence or absence of the target nucleic acid sequence; wherein presence of the target nucleic acid sequence in the sample detects Mycobacterium tuberculosis, wherein the oligonucleotides as set forth in SEQ ID NO: 1 is labelled with atleast one labelling substance, and wherein the quencher is a dark quencher selected from the group comprising dimethyl aminoazosulfonic acid (dabsyl) quenchers, black hole quenchers, qxl quenchers, Iowa black FQ, Iowa black RQ, and IRDye QC-1.
In yet another embodiment of the present invention, there is provided a method for detection of a target nucleic acid molecule of Mycobacterium tuberculosis in a sample, wherein the method comprises: providing a sample; subjecting the sample to a polymerase chain reaction using a set of oligonucleotides having nucleotide sequences as set forth in SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3; and detecting presence or absence of the target nucleic acid sequence; wherein presence of the target nucleic acid sequence in the sample detects Mycobacterium tuberculosis, and wherein the oligonucleotide as set forth in SEQ ID NO: 1 comprises 6-carboxy fluorescein and black hole quencher 1 (BHQ™).
An embodiment of the present invention provides a method for detection of a target nucleic acid molecule of Mycobacterium tuberculosis in a sample, wherein the method comprises: providing a sample; subjecting the sample to a polymerase chain reaction using a set of oligonucleotides having nucleotide sequences as set forth in SEQ ID NO: 2 and SEQ ID NO: 3; and detecting presence or absence of the target nucleic acid sequence; and wherein presence of the target nucleic acid sequence in the sample detects Mycobacterium tuberculosis.
In an embodiment of the present invention provides a method for detection of a target nucleic acid molecule of Mycobacterium tuberculosis in a sample, wherein the method comprises: providing a sample; subjecting the sample to a polymerase chain reaction using a set of oligonucleotides having nucleotide sequences as set forth in SEQ ID NO: 2 and SEQ ID NO: 3; and detecting presence or absence of the target nucleic acid sequence; wherein presence of the target nucleic acid sequence in the sample detects Mycobacterium tuberculosis, and wherein the sample is subjected to conventional polymerase chain reaction.
Although the subject matter has been described in considerable detail with reference to certain preferred embodiments thereof, other embodiments are possible. As such, the spirit and scope of the appended claims should not be limited to the description of the preferred embodiment contained therein.
EXAMPLES
The disclousure will now be illustrated with working examples, which is intended to illustrate the working of disclosure and not intended to take restrictively to imply any limitations on the scope of the present disclosure. Unless defned otherwise, all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which this disclosure belongs. Although methods and materials similar or equivalent to those described herein can be used in the practive of the disclosed methods and compositions, the exemplary methods, devices and materials are described herein.
Example 1
Synthesis of the oligonucleotides designed to function as probes and primers
Oligonucleotides having nucleotide sequences as set forth in SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3 were custom synthesized by Sigma-Aldrich. The oligonucleotides were designed such that they hybridize to the ribonucleoside diphosphate reductase gene sequence of the tuberculosis causing Mycobacterium tuberculosis.
Preparation of DNA samples
Non-tuberculosis strains of mycobacteria that were tested in this experiment included Mycobacterium fortuitum I, Mycobacterium abscessus, Mycobacterium kansasii I, Mycobacterium avium, Mycobacterium gordanae, and Mycobacterium szulgai. Tuberculosis-causing strain of mycobacteria included Mycobacterium tuberculosis.
DNA was isolated from these cultures using the QIAAmp DNA mini kit (a kit for DNA extraction and purification, ion-exchange resin type, QIAGEN Inc.) as per the manufacturer’s instructions. The DNA samples from the isolates can also be extracted from conventional methods. The purified DNA was used as DNA sample for further detection and analysis.
Detection of Mycobacterium tuberculosis by Real time PCR (qPCR) amplification system
A reaction mixture comprising the DNA sample, a premix reagent (Premix Ex Taq from TAKARA BIO INC.) consisting of TaKaRa Ex Taq ™ HS enzyme, dNTP mixture and Mg2+; oligonucleotide probe having SEQ ID NO: 1, oligonucleotide primer having SEQ ID NO: 2, oligonucleotide primer having sequence ID NO: 3 and sterile water was prepared (Table 1).
Table 1: Reaction mixture for qPCR
Each microtube containing 10 µl of the reaction mixture was subjected to qPCR assay in a ABI 7500 real-time PCR machine (Applied Biosystems). The run program of qPCR protocol consisted of the following conditions as shown in Table 2.
Table 2: Real time-PCR run protocol
The measurement of fluorescence value generated from the labelled oligonucleotide probe was recorded by the commercially available ABI 7500 real-time PCR machine (Applied Biosystems).
The specificity of the designed primers and probe designated as SEQ ID No. 1, 2, and 3 was tested by carrying out real-time PCR on a panel comprising of tuberculosis and Non-tuberculosis strains of mycobacterium. The oligonucleotides of the present invention were highly specific for the tuberculosis strain, Mycobacterium tuberculosis as seen in Figure 1. The oligonucleotides did not hybridize or show any cross reactivity with the DNA of the non-tuberculosis mycobacterial strains.
Example 2
Specificity of the oligonucleotides, SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3, in the detection of Mycobacterium tuberculosis
The specificity of the oligonucleotides was tested against a panel of common clinical bacterial samples. The DNA from the clinical isolates, Klebsiella pneumonia, Streptococcus sp, Acinetobacter sp, Escherichia coli, Salmonella typhi, Enterococcus sp, Pseudomonas aeruginosa, Mycobacterium smegmatis and Mycobacterium tuberculosis, was isolated using the QIAAmp DNA mini kit (QIAGEN Inc.).
Each reaction tube containing a reaction mixture of 10 µl including the sample DNA was subjected to a qPCR assay as given in Example 1. It was observed that the oligonucleotides of the present invention were highly specific for Mycobacterium tuberculosis as seen in Figures 1 and 2.
Example 3
Calculation of copy number
Around 25 µl of Mycobacterium tuberculosis DNA purified from culture using QIAAmp DNA mini kit (a kit for DNA extraction and purification, ion-exchange resin type, QIAGEN Inc.) was subjected to conventional PCR assay along using the oligonucleotides having nucleotide sequences SEQ ID NO: 2 and SEQ ID NO: 3 using a conventional PCR machine (Corbett Research). The components of the reaction mixture used for the conventional PCR are shown in Table 3 and the run program of conventional PCR protocol had following conditions as shown in Table 4.
Table 3: Reaction mixture for conventional PCR
Table 4: Conventional PCR run-protocol
After the completion of the PCR assay, the amplified products were electrophoresed on an agarose gel and stained with ethidium bromide. The band of the amplicon was excised from the gel and purified using a QIAquick gel extraction kit (QIAGEN BIO INC.). The absorbance of 2µl of the amplicon (DNA) was measured at 260 nm using a ND-1000 spectrophotometer (Nanodrop).
Extinction coefficient of the DNA was calculated from individual base coefficient by the following formula:
ε260 (mM-1xcm-1) = (15.4xnA) + (7.5xnC) + (11.7xnG) + (9.2xnT)
Where 15.4, 7.5, 11.7, and 9.2 are the monomer extinction coefficients in mM-1cm-1
The dA, dC, dG, dT were measured at 260nm for single strand. The same is calculated for the other complementary strand and the value summed up.
The nanomoles of the amplicon were calculated using the following equation:
nmoles/ml = 1000 x OD260(1cm) x 1 ml (vol)
Extinction coefficient of amplicon
Copy number of the sample was calculated using the formula:
Copy number /ml = (Moles/ml) x Avogadro number
From the copy number of the pure amplicon a standard curve was generated by running log dilutions of the amplicon using a real-time PCR (Figure 4). Copy number of unknown samples can be calculated from the threshold cycles (Ct) obtained from the standard curve.
Serial dilution and detection of samples
Serial dilution of Mycobacterium tuberculosis sample was carried out such that the copy number varied from 2.00E+08 to 2.00E+02 copies of the Mycobacterium tuberculosis genome. The samples were consecutively numbered. Each reaction tube containing a reaction mixture of 10 µl including the sample DNA from the serially diluted tubes was subjected to a qPCR assay as given in Example 1. It was observed that the oligonucleotides of the present invention were able to detect Mycobacterium tuberculosis even at a low copy number of 102. Figure 3 shows the real time PCR profile for the serially diluted samples.
Based on the Ct obtained for the different serially diluted samples a standard curve is generated as shown in Figure 4.
The bacterial load of the sample can be quantified by comparing the Ct values of the sample with the Ct values of the standard curve (Table 5).
Table 5: Standard Curve/Log dilution curve values with respect to Ct
Example 4
Detection of Mycobacterium tuberculosis in clinical samples
A sample panel of 24 clinical sputum samples were characterized and graded by culture and smear microscopy. DNA was isolated from the infected sputum samples using a QIAAmp DNA mini kit (QIAGEN INC.). The isolation process consisted of lysis, binding, washing and elution steps.
The samples were subjected to qPCR assay using the oligonucleotide probe having SEQ ID NO: 1 and the primers having SEQ ID NO: 2 and SEQ ID NO: 3. The run program used for the PCR was as given in Example 2.
The results obtained showed that the oligonucleotides of the present invention successfully detected all the 24 clinical samples as positive (Figure 5). The performance of the oligonucleotides was at par with the culture and smear microscopy techniques (Table 6).
Table 6: Detection of M. tuberculosis in clinical samples
The oligonucleotides of the present invention are highly specific and sensitive (100%) for the detection of the M. tuberculosis. The Mycobacterium tuberculosis load in an infected sample can also be quantified using these oligonucleotides.
Example 5
Specificity study of synthesized oligonucleotides and comparative analysis
Synthesis of the oligonucleotides designed to function as probes and primers
Oligonucleotides having nucleotide sequences as set forth in SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3 were custom synthesized by Sigma-Aldrich. The oligonucleotides were designed such that they hybridize to the ribonucleoside diphosphate reductase gene sequence of the tuberculosis causing Mycobacterium tuberculosis.
Another set of oligonucleotides having nucleotide sequences as set forth in SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 6 were custom synthesized by Sigma-Aldrich. The oligonucleotides were designed such that they hybridize to the mpt83 gene sequence chosen from the genome of Mycobacterium tuberculosis, which codes for a cell surface lipoprotein mpt83.
Preparation of DNA samples
DNA was isolated from clinical specimens using the QIAAmp DNA mini kit (a kit for DNA extraction and purification, ion-exchange resin type, QIAGEN Inc.) as per the manufacturer’s instructions. The DNA samples from the isolates can also be extracted from conventional methods. The purified DNA was used as DNA sample for further detection and analysis.
Each DNA sample was divided into two parts for detection of Mycobacterium tuberculosis by Real time PCR (qPCR) amplification system. The first part was analysed using oligonucleotide probe having SEQ ID NO: 1, oligonucleotide primer having SEQ ID NO: 2 and oligonucleotide primer having SEQ ID NO: 3. The second part was analysed using oligonucleotide probe having SEQ ID NO: 4, oligonucleotide primer having SEQ ID NO: 5, and oligonucleotide primer having SEQ ID NO: 6. In the present example, oligonucleotide probe having SEQ ID NO: 1
and SEQ ID NO: 4 were labelled with 6-carboxy fluorescein at 5’ end and black hole quencher 1 (BHQ™) at 3’ end.
Detection of Mycobacterium tuberculosis by Real time PCR (qPCR) amplification system
The reaction mixtures were prepared separately for two parts of each DNA sample.
A first reaction mixture comprising the first part of DNA sample, a premix reagent (Premix Ex Taq from TAKARA BIO INC.) consisting of TaKaRa Ex Taq ™ HS enzyme, dNTP mixture and Mg2+; oligonucleotide probe having SEQ ID NO: 1, oligonucleotide primer having SEQ ID NO: 2, oligonucleotide primer having sequence ID NO: 3 and sterile water was prepared (Table 7).
Table 7: Reaction mixture for qPCR
A second reaction mixture comprising the second part of DNA sample, a premix reagent (Premix Ex Taq from TAKARA BIO INC.) consisting of TaKaRa Ex Taq ™ HS enzyme, dNTP mixture and Mg2+; oligonucleotide probe having SEQ ID NO: 4, oligonucleotide primer having SEQ ID NO: 5, oligonucleotide primer having sequence ID NO: 6 and sterile water was also prepared (Table 8).
Table 8: Reaction mixture for qPCR
10 µl of each first and second reaction mixture were taken in different microtubes. The microtubes were subjected to qPCR assay in a ABI 7500 real-time PCR machine (Applied Biosystems). The run program of qPCR protocol consisted of the following conditions as shown in Table 9.
Table 9: Real time-PCR run protocol
The measurement of fluorescence value generated from the labelled oligonucleotide probe was recorded by the commercially available ABI 7500 real-time PCR machine (Applied Biosystems).
The performance of SEQ ID NO: 4, 5 and 6 versus the performance of SEQ ID NO: 1, 2 and 3 in detecting MTB showed that SEQ ID NO: 4, 5 and 6 failed to detect MTB, while SEQ ID NO: 1, 2 & 3 showed MTB detection at 31 Ct (Figure 6).
Example 6
Specificity study of synthesized oligonucleotides and comparative analysis
Synthesis of the oligonucleotides designed to function as probes and primers
Oligonucleotides having nucleotide sequences as set forth in SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3 were custom synthesized by Sigma-Aldrich. The oligonucleotides were designed such that they hybridize to the ribonucleoside diphosphate reductase gene sequence of the tuberculosis causing Mycobacterium tuberculosis.
Another set of oligonucleotides having nucleotide sequences as set forth in SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 9 were custom synthesized by Sigma-Aldrich. The oligonucleotides were designed such that they hybridize to lpqI gene sequence chosen from the genome of Mycobacterium tuberculosis, coding for a probable conserved lipoprotein LPQI
Preparation of DNA samples
DNA was isolated from clinical specimens using the QIAAmp DNA mini kit (a kit for DNA extraction and purification, ion-exchange resin type, QIAGEN Inc.) as per the manufacturer’s instructions. The DNA samples from the isolates can also be extracted from conventional methods. The purified DNA was used as DNA sample for further detection and analysis.
Each DNA sample was divided into two parts for detection of Mycobacterium tuberculosis by Real time PCR (qPCR) amplification system. The first part was analysed using oligonucleotide probe having SEQ ID NO: 1, oligonucleotide primer having SEQ ID NO: 2 and oligonucleotide primer having SEQ ID NO: 3. The second part was analysed using oligonucleotide probe having SEQ ID NO: 7, oligonucleotide primer having SEQ ID NO: 8, and oligonucleotide primer having SEQ ID NO: 9. In the present example, oligonucleotide probe having SEQ ID NO: 1 and SEQ ID NO: 7 were labelled with 6-carboxy fluorescein at 5’ end and black hole quencher 1 (BHQ™) at 3’ end.
Detection of Mycobacterium tuberculosis by Real time PCR (qPCR) amplification system
The reaction mixtures were prepared separately for two parts of each DNA sample.
A first reaction mixture comprising the first part of DNA sample, a premix reagent (Premix Ex Taq from TAKARA BIO INC.) consisting of TaKaRa Ex Taq ™ HS enzyme, dNTP mixture and Mg2+; oligonucleotide probe having SEQ ID NO: 1, oligonucleotide primer having SEQ ID NO: 2, oligonucleotide primer having sequence ID NO: 3 and sterile water was prepared (Table 10).
Table 10: Reaction mixture for Qpcr
A second reaction mixture comprising the second part of DNA sample, a premix reagent (Premix Ex Taq from TAKARA BIO INC.) consisting of TaKaRa Ex Taq ™ HS enzyme, dNTP mixture and Mg2+; oligonucleotide probe having SEQ ID NO: 7, oligonucleotide primer having SEQ ID NO: 8, oligonucleotide primer having sequence ID NO: 9 and sterile water was also prepared (Table 11).
Table 11: Reaction mixture for qPCR
10 µl of each first and second reaction mixture were taken in different microtubes. The microtubes were subjected to qPCR assay in a ABI 7500 real-time PCR machine (Applied Biosystems). The run program of qPCR protocol consisted of the following conditions as shown in Table 12. The reaction was done in duplicates.
Table 12: Real time-PCR run protocol
The measurement of fluorescence value generated from the labelled oligonucleotide probe was recorded by the commercially available ABI 7500 real-time PCR machine (Applied Biosystems).
Results obtained showed that SEQ ID NO: 7, 8, and 9 detected MTB at a delayed Ct of 30 and 31. While, SEQ ID NO: 1, 2, and 3 showed MTB detection at 26 Ct (Figure 7). Samples with lower loads of bacteria (with smear statuses scanty, occasional or negative especially) were not detected in the test involving SEQ ID NO: 7, 8, and 9 due to the lower sensitivity compared to SEQ ID 1, 2 and 3.
Example 7
Sensitivity of the oligonucleotides, SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, in detection of Mycobacterium tuberculosis
Test 1
A sample panel of 235 strains in the WHO/TDR TB Strain Bank were tested in a blinded study to check the sensitivity of the oligonucleotides against a panel of geographically diverse MTB strains. Real-time PCR reactions involving a mastermix containing SEQ IDs 1, 2, and 3 was able to identify all 233 M. tuberculosis strains and obtained a negative result for the two non-tuberculosis mycobacteria that were included (M. terrae and M. avium) in the test panel indicating that the sequences are able to detect are able to detect a large variety of catalogued MTB strains.
Test 2
Another study evaluating the sensitivity of the oligonucleotides was performed using a characterized 100 sample panel from suspected TB patients in South East Asia. The samples were subjected to smear microscopy (S) and culture (C). Purified nucleic acids were tested using a master mix containing SEQ ID NO: 1, 2 and 3. The test was able to detect 100% of the S+C+ samples (40/40), 75% of S-C+ samples (30/40) and gave a negative result for 100% of the S-C- samples (20/20). It should be noted here that, these values fall within acceptable ranges, since for S-C+ samples, various studies evaluating molecular diagnostic tools have reported sensitivities of between 50-75%.
SEQ ID NO: 1 Probe sequence complementary to ribonucleoside diphosphate reductase gene sequence of MTB genome (wherein 5' end of SEQ ID NO: 1 is attached to fluorophore and 3’ end is attached to a quencher) CCACCCGATTGTGCACCCA
SEQ ID NO: 2 Forward primer for ribonucleoside diphosphate reductase gene sequence of MTB genome CTGGGAGAAGTTGTCGGA
SEQ ID NO: 3 Reverse primer for ribonucleoside diphosphate reductase gene sequence of MTB genome GTCACCGCCTCCTCG
SEQ ID NO: 4 Probe sequence complementary to mpt83 gene sequence of MTB genome (wherein 5' end of SEQ ID NO: 4 is attached to fluorophore and 3’ end is attached to a quencher) AGTACCCTGACCTCGGCTCTGTCGG
SEQ ID NO: 5 Forward primer for mpt83 gene sequence of MTB genome ACCGCGGCTTCCAACA
SEQ ID NO: 6 Reverse primer for mpt83 gene sequence of MTB genome TTCACATCCGGGTTCAGCT
SEQ ID NO: 7 Probe sequence complementary to lpqI gene sequence of MTB genome (wherein 5' end of SEQ ID NO: 7 is attached to fluorophore and 3’ end is attached to a quencher) CGACCTCTCTGGTATGGCCGC
SEQ ID NO: 8 Forward primer for lpqI gene sequence of MTB genome CCGTTCGATGGTCCAGTGTT
SEQ ID NO: 9 Reverse primer for lpqI gene sequence of MTB genome CAACACCGCCTCGCTG
I/We Claim:
1. A set of oligonucleotides for detection of a target nucleic acid molecule of Mycobacterium tuberculosis in a sample, wherein the nucleotide sequence of the oligonucleotides is as set forth in SEQ ID NO: 1 comprising at least one label, SEQ ID NO: 2, and SEQ ID NO: 3.
2. The set of oligonucleotides as claimed in claim 1, wherein detection of the target nucleic acid molecule of Mycobacterium tuberculosis in a sample is done by real time polymerase chain reaction.
3. The set of oligonucleotides as claimed in claim 1, wherein the label is at least one of a fluorophore and a quencher.
4. The set of oligonucleotides as claimed in claim 3, wherein the fluorophore is selected from the group comprising fluorescein, fluorescein derivatives, VICTM, 6-carboxy-4’,5’-dichloro-2’,7’-dimethoxyfluorescein,5-(2'-aminoethyl) aminonaphthalene-1-sulphonic acid, coumarin, coumarin derivatives, lucifer yellow, texas red, tetramethylrhodamine, 6-carboxy fluorescein, tetrachloro-6-carboxyfluoroscein, 5-carboxyrhodamine, and cyanine dyes.
5. The set of oligonucleotides as claimed in claim 3, wherein the quencher is selected from the group comprising tetra methyl rhodamine (TAMRA), 4'-(4-dimethylaminophenylazo) benzoic acid, 4-dimethylaminophenyl-4'-maleimide, carboxy tetramethyl rhodamine, and black hole quencher (BHQ™) dyes.
6. The set of oligonucleotides as claimed in claim 3, wherein the quencher is a dark quencher selected from the group comprising dimethyl aminoazosulfonic acid (dabsyl) quenchers, black hole quenchers, qxl quenchers, Iowa black FQ, Iowa black RQ, and IRDye QC-1.
7. The set of oligonucleotides as claimed in claim 1, wherein the oligonucleotide as set forth in SEQ ID NO: 1 comprises 6-carboxy fluorescein and black hole quencher 1 (BHQ™).
8. A set of oligonucleotides for detection of a target nucleic acid molecule of Mycobacterium tuberculosis in a sample, wherein the nucleotide sequence of the oligonucleotides is as set forth in SEQ ID NO: 2, and SEQ ID NO: 3.
9. The set of oligonucleotides as claimed in claim 8, wherein detection of the target nucleic acid molecule of Mycobacterium tuberculosis in a sample is done by conventional polymerase chain reaction.
10. A kit for detection of a target nucleic acid molecule of Mycobacterium tuberculosis in a sample, wherein the kit comprises the set of oligonucleotides as claimed in claim 1 or 8, amplification reagents, dNTP mixture, essential co-factors, polymerase enzyme, water, reaction buffer or a combination thereof.
11. A method for detection of a target nucleic acid molecule of Mycobacterium tuberculosis in a sample, wherein the method comprises:
a) providing a sample;
b) subjecting the sample to a polymerase chain reaction using a set of oligonucleotides having nucleotide sequences as set forth in SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3; and
c) detecting presence or absence of the target nucleic acid sequence;
wherein presence of the target nucleic acid sequence in the sample detects Mycobacterium tuberculosis.
12. The method as claimed in claim 11, wherein the sample is subjected to real time polymerase chain reaction.
13. The method as claimed in claim 11, wherein the oligonucleotides as set forth in SEQ ID NO: 1 is labelled with atleast one labelling substance.
14. The method as claimed in claim 13, wherein the labelling substance is atleast one of a fluorophore and a quencher.
15. The method as claimed in claim 14, wherein the fluorophore is selected from the group comprising fluorescein, fluorescein derivatives, VICTM , 6-carboxy-4’,5’-dichloro-2’,7’-dimethoxyfluorescein, 5-(2'-aminoethyl) aminonaphthalene-1-sulphonic acid, coumarin, coumarin derivatives, lucifer yellow, texas red, tetramethylrhodamine, 6-carboxy fluorescein, tetrachloro-6-carboxyfluoroscein, 5-carboxyrhodamine, and cyanine dyes.
16. The method as claimed in claim 14, wherein the quencher is selected from the group comprising tetra methyl rhodamine (TAMRA), 4'-(4-dimethylaminophenylazo) benzoic acid, 4-dimethylaminophenyl-4'-maleimide,carboxy tetramethyl rhodamine, and black hole quencher (BHQ™) dyes.
17. The method as claimed in claim 14, wherein the quencher is a dark quencher selected from the group comprising dimethyl aminoazosulfonic acid (dabsyl) quenchers, black hole quenchers, qxl quenchers, Iowa black FQ, Iowa black RQ, and IRDye QC-1.
18. The method as claimed in claim 13, wherein the oligonucleotide as set forth in SEQ ID NO: 1 comprises 6-carboxy fluorescein and black hole quencher 1 (BHQ™).
19. A method for detection of a target nucleic acid molecule of Mycobacterium tuberculosis in a sample, wherein the method comprises:
a) providing a sample;
b) subjecting the sample to a polymerase chain reaction using a set of oligonucleotides having nucleotide sequences as set forth in SEQ ID NO: 2, and SEQ ID NO: 3; and
c) detecting presence or absence of the target nucleic acid sequence;
wherein presence of the target nucleic acid sequence in the sample detects Mycobacterium tuberculosis.
20. The method as claimed in claim 19, wherein the sample is subjected to conventional polymerase chain reaction.
| Section | Controller | Decision Date |
|---|---|---|
| # | Name | Date |
|---|---|---|
| 1 | Form-3.pdf | 2012-03-09 |
| 2 | Form-1.pdf | 2012-03-09 |
| 3 | Drawings.pdf | 2012-03-09 |
| 4 | 796-CHE-2012 POWER OF ATTORNEY 24-04-2012.pdf | 2012-04-24 |
| 5 | 796-CHE-2012 FORM-1 24-04-2012.pdf | 2012-04-24 |
| 6 | 796-CHE-2012 CORRESPONDENCE OTHERS 24-04-2012.pdf | 2012-04-24 |
| 7 | 796-CHE-2012 CORRESPONDENCE OTHERS 28-02-2013.pdf | 2013-02-28 |
| 8 | Figures_PD005636IN-SC.pdf | 2013-03-28 |
| 9 | Complete specification_PD005636IN-SC.pdf | 2013-03-28 |
| 10 | 796-CHE-2012 FORM-3 25-04-2013.pdf | 2013-04-25 |
| 11 | 796-CHE-2012 CORRESPONDENCE OTHERS 25-04-2013.pdf | 2013-04-25 |
| 12 | 796-CHE-2012 FORM-5 02-07-2014.pdf | 2014-07-02 |
| 13 | 796-CHE-2012 FORM-5 02-07-2014....pdf | 2014-07-02 |
| 14 | 796-CHE-2012 CORRESPONDENCE OTHERS 02-07-2014.pdf | 2014-07-02 |
| 15 | 796-CHE-2012-FER.pdf | 2018-09-07 |
| 16 | 796-CHE-2012-FORM 4(ii) [06-03-2019(online)].pdf | 2019-03-06 |
| 17 | 796-CHE-2012-FER_SER_REPLY [04-04-2019(online)].pdf | 2019-04-04 |
| 18 | 796-CHE-2012-HearingNoticeLetter-(DateOfHearing-02-12-2019).pdf | 2019-11-01 |
| 19 | 796-CHE-2012-Correspondence to notify the Controller (Mandatory) [28-11-2019(online)].pdf | 2019-11-28 |
| 20 | 796-CHE-2012-Written submissions and relevant documents (MANDATORY) [16-12-2019(online)].pdf | 2019-12-16 |
| 21 | 796-CHE-2012-PatentCertificate16-06-2020.pdf | 2020-06-16 |
| 22 | 796-CHE-2012-Marked up Claims_Granted 338590_16-06-2020.pdf | 2020-06-16 |
| 23 | 796-CHE-2012-IntimationOfGrant16-06-2020.pdf | 2020-06-16 |
| 24 | 796-CHE-2012-Drawings_Granted 338590_16-06-2020.pdf | 2020-06-16 |
| 25 | 796-CHE-2012-Description_Granted 338590_16-06-2020.pdf | 2020-06-16 |
| 26 | 796-CHE-2012-Claims_Granted 338590_16-06-2020.pdf | 2020-06-16 |
| 27 | 796-CHE-2012-Abstract_Granted 338590_16-06-2020.pdf | 2020-06-16 |
| 28 | 796-CHE-2012-RELEVANT DOCUMENTS [23-09-2022(online)].pdf | 2022-09-23 |
| 29 | 796-CHE-2012-RELEVANT DOCUMENTS [19-06-2023(online)].pdf | 2023-06-19 |
| 30 | 796-CHE-2012-FORM-27 [31-07-2026(online)].pdf | 2026-07-31 |
| 31 | 796-CHE-2012-FORM-27 [31-07-2026(online)]-2.pdf | 2026-07-31 |
| 32 | 796-CHE-2012-FORM-27 [31-07-2026(online)]-1.pdf | 2026-07-31 |
| 1 | searchstrategy_21-08-2018.pdf |