Sign In to Follow Application
View All Documents & Correspondence

Compositions For Benefitting Gut Health

Abstract: COMPOSITIONS FOR BENEFITTING GUT HEALTH The present disclosure discloses a composition comprising different types of vitamins. The composition comprises a combination of vitamin premix-I and vitamin premix-II. The vitamin premix-I comprises thiamin, riboflavin, pyridoxine, and salts thereof, and the vitamin premix-II comprises folic acid, cobalamine, vitamin K2, and salts thereof. The vitamin premix-I to vitamin premix-II in the present composition has a weight ratio in a range of 3.5:1 to 5:1. Also, disclosed is a process for preparing the composition of the present composition.

Get Free WhatsApp Updates!
Notices, Deadlines & Correspondence

Patent Information

Application #
Filing Date
12 July 2018
Publication Number
03/2020
Publication Type
INA
Invention Field
CHEMICAL
Status
Email
iprdel@lakshmisri.com
Parent Application

Applicants

ITC LIMITED
ITC LIFE SCIENCES & TECHNOLOGY CENTRE, #3. 1st Main, Peenya Industrial Area, Phase-1, Bangalore, Karnataka, India, Pin Code- 560 058.

Inventors

1. KAUSHAL, Deepti
ITC LIFE SCIENCES & TECHNOLOGY CENTRE, #3. 1st Main, Peenya Industrial Area, Phase-1, Bangalore, Karnataka, India, Pin Code- 560 058.
2. KOPPALA, Parameswari
ITC LIFE SCIENCES & TECHNOLOGY CENTRE, #3. 1st Main, Peenya Industrial Area, Phase-1, Bangalore, Karnataka, India, Pin Code- 560 058.
3. KALSI, Gurpreet
ITC LIFE SCIENCES & TECHNOLOGY CENTRE, #3. 1st Main, Peenya Industrial Area, Phase-1, Bangalore, Karnataka, India, Pin Code- 560 058.
4. CHITTUR, Lakshmanan Chandrashekharan
ITC LIFE SCIENCES & TECHNOLOGY CENTRE, #3. 1st Main, Peenya Industrial Area, Phase-1, Bangalore, Karnataka, India, Pin Code- 560 058.

Claims

1. A composition comprising: a) vitamin premix-I comprising: thiamin, riboflavin, pyridoxine, and salts thereof; b) vitamin premix-II comprising: folic acid, cobalamine, vitamin K2, and salts thereof, wherein the vitamin premix-I to the vitamin premix-II weight ratio is in a range of 3.5:1 to 5:1.

2. The composition as claimed in claim 1, wherein the vitamin premix-I to the vitamin premix-II weight ratio is in a range of 3.75:1 to 4.5:1.

3. The composition as claimed in claim 1, wherein thiamin to riboflavin to pyridoxine weight ratio is in a range of 1-1.5:1-2:1-3.

4. The composition as claimed in claim 3, wherein thiamin to riboflavin to pyridoxine weight ratio is 1:1.18:1.81.

5. The composition as claimed in claim 1, wherein folic acid to cobalamine to vitamin K2 weight ratio is in a range of 1-1.5:0.003-0.07:0.15-0.40.

6. The composition as claimed in claim 5, wherein folic acid to cobalamine to vitamin K2 weight ratio is 1:0.005:0.275.

7. The composition as claimed in claim 1, wherein the composition further comprises at least one additive selected from a group consisting of magnesium sulfate, magnesium chloride, magnesium bromide, magnesium iodide, magnesium phosphate, magnesium fluoride, magnesium nitrate, and combinations thereof.

8. A formulation comprising: a) thiamin having a concentration in range of 0.0001 - 0.0005 mg/ml; b) riboflavin having a concentration in range of 0.0001 - 0.0006 mg/ml; c) pyridoxine having a concentration in range of 0.0002 - 0.0009 mg/ml; d) folic acid having a concentration in range of 0.00004 - 0.0005 mg/ml; e) cobalamine having a concentration in range of 0.00000005 -0.000002 mg/ml; f) vitamin K2 having a concentration in range of 0.000007 - 0.0001 mg/ml; g) at least one excipient; and h) at least one additive. h The formulation as claimed in claim 8, wherein the at least one excipient is selected from the group consisting of water, at least one carrier, milk solids, vitamin premix, fibers, natural flavors, colors, and combinations thereof. [0. The formulation as claimed in claim 8, wherein the at least one additive is selected from the group consisting of magnesium sulfate, magnesium chloride, magnesium bromide, magnesium iodide, magnesium phosphate, magnesium fluoride, magnesium nitrate, and combinations thereof. [ 1. A process for preparing the composition as claimed in claim 1, said process comprising: a) obtaining the vitamin premix-I; b) obtaining the vitamin premix-II; and c) contacting the vitamin premix-I and the vitamin premix-II, to obtain the composition. [2. A process for preparing the formulation as claimed in claim 8, said process comprising: a) obtaining thiamin; b) obtaining riboflavin; c) obtaining pyridoxine; d) obtaining folic acid; e) obtaining cobalamine; f) obtaining vitamin K2; g) obtaining at least one excipient; h) obtaining at least one additive and i) contacting thiamin, riboflavin, pyridoxine, folic acid, cobalamine, vitamin K2, the at least one excipient, and the at least one additive, to obtain the formulation.

13. The composition as claimed in claim 1, wherein the composition exhibits immunomodulatory benefits by reducing production of nitric oxide.

14. The composition as claimed in claim 1, wherein the composition exhibits immunomodulatory benefits by reducing expression of IL-6 (interleukin-6) gene.

Specification

FIELD OF INVENTION
[001] The present disclosure broadly relates to field of healthcare, and particularly discloses a composition comprising vitamins that is beneficial for gut health.
BACKGROUND OF INVENTION
[002] Vitamins play an important role in ensuring regulation of gastrointestinal functions such as digestion, assimilation and elimination. Therefore, poor intake of vitamins is linked to multiple gastrointestinal diseases. For instance, pyridoxine (vitamin B6) deficiency is found to be relatively common in inflammatory bowel
i disease (TBD) affecting 10%-15% of patients in general and up to 25% of patients with active disease (Saibeni et al., 2003. Am J Gastroenterol. Jan;98(l): 112-7.). Low vitamin B6 plasma level may be considered a risk factor for thrombosis in patients with IBD due to its inverse relation with homocysteine. Patients with celiac disease have a higher total plasma homocysteine level than the general
' population, which is indicative of a poor vitamin status, namely low serum levels vitamin B6, B9 and B12 (Hallert et al., 2002. Aliment Pharmacol Ther. Jul;16(7):1333-9). However, daily vitamin B supplementation (0.8 mg folic acid, 0.5 mg cyanocobalamin and 3 mg pyridoxine) for 6 months was found to decrease the plasma homocysteine level by a median of 34% (P < 0.001), accompanied by
1 significant improvement in well-being, followed by lower levels of anxiety and depression (Hallert et al., 2009. Aliment Pharmacol Ther. Apr 15;29(8):811-6. doi: 10.1111/j .1365-2036.2009).
[003] US6468525B1 discloses a probiotic formulation comprising consortia of microorganisms along with fructo-oligosaccharides, L-glutamine, and N-acetyl
' glucosamine.
[004] EP2498626B1 discloses a nutritional composition comprising a fructo-oligosaccharide, and a polysaccharide for improving gut microflora. [005] Referring to the paramount health benefits offered by vitamins, there still exists lacunae in terms of availability of compositions comprising a balanced
1 amount of different type of vitamins that can offer benefits to the gut.

SUMMARY OF THE INVENTION
[006] In an aspect of the present disclosure, there is provided a composition comprising: (a) vitamin premix-I comprising: thiamin, riboflavin, pyridoxine, and salts thereof; (b) vitamin premix-II comprising: folic acid, cobalamine, vitamin K2, and salts thereof, wherein the vitamin premix-I to the vitamin premix-II weight ratio is in a range of 3.5:1 to 5:1.
[007] In an aspect of the present disclosure, there is provided a formulation comprising: (a) thiamin having a concentration in range of 0.0001 - 0.0005 mg/ml; (b) riboflavin having a concentration in range of 0.0001 - 0.0006 mg/ml; (c) pyridoxine having a concentration in range of 0.0002 - 0.0009 mg/ml; (d) folic acid having a concentration in range of 0.00004 - 0.0005 mg/ml; (e) cobalamine having a concentration in range of 0.00000005 - 0.000002 mg/ml; (f) vitamin K2 having a concentration in range of 0.000007 - 0.0001 mg/ml; (g) at least one excipient; and (h) at least one additive.
[008] In an aspect of the present disclosure, there is provided a process for preparing the composition comprising: (a) vitamin premix-I comprising: thiamin, riboflavin, pyridoxine, and salts thereof; (b) vitamin premix-II comprising: folic acid, cobalamine, vitamin K2, and salts thereof, wherein the vitamin premix-I to the vitamin premix-II weight ratio is in a range of 3.5:1 to 5:1, said process comprising: (i) obtaining the vitamin premix-I; (ii) obtaining the vitamin premix-II; and (iii) contacting the vitamin premix-I and the vitamin premix-II, to obtain the composition.
[009] These and other features, aspects, and advantages of the present subject matter will be better understood with reference to the following description and appended claims. This summary is provided to introduce a selection of concepts in a simplified form. This summary is not intended to identify key features or essential features of the claimed subject matter, nor is it intended to be used to limit the scope of the claimed subject matter.

BRIEF DESCRIPTION OF ACCOMPANYING DRAWINGS
[0010] The following drawings form a part of the present specification and are
included to further illustrate aspects of the present disclosure. The disclosure may
be better understood by reference to the drawings in combination with the detailed
description of the specific embodiments presented herein.
[0011] Figure 1A and IB illustrates percentage of lipopolysaccharide (LPS)
induced nitric oxide production in presence of various compositions, in accordance
with an embodiment of the present disclosure.
[0012] Figure 2 illustrates the effect of different compositions on LPS induced
inflammation (IL-6 expression), in accordance with an embodiment of the present
disclosure.
[0013] Figure 3 illustrates the effect of different compositions on production of
nitric oxide from co-culture model, in accordance with an embodiment of the
present disclosure.
DETAILED DESCRIPTION OF THE INVENTION
[0014] Those skilled in the art will be aware that the present disclosure is subject to variations and modifications other than those specifically described. It is to be understood that the present disclosure includes all such variations and modifications. The disclosure also includes all such steps, features, compositions, and compounds referred to or indicated in this specification, individually or collectively, and any and all combinations of any or more of such steps or features. Definitions
[0015] For convenience, before further description of the present disclosure, certain terms employed in the specification, and examples are delineated here. These definitions should be read in the light of the remainder of the disclosure and understood as by a person of skill in the art. The terms used herein have the meanings recognized and known to those of skill in the art, however, for convenience and completeness, particular terms and their meanings are set forth below.

[0016] The articles "a", "an" and "the" are used to refer to one or to more than one
(i.e., to at least one) of the grammatical object of the article.
[0017] The terms "comprise" and "comprising" are used in the inclusive, open
sense, meaning that additional elements may be included. It is not intended to be
construed as "consists of only".
[0018] Throughout this specification, unless the context requires otherwise the
word "comprise", and variations such as "comprises" and "comprising", will be
understood to imply the inclusion of a stated element or step or group of element or
steps but not the exclusion of any other element or step or group of element or
steps.
[0019] The term "including" is used to mean "including but not limited to".
"Including" and "including but not limited to" are used interchangeably.
[0020] Ratios, concentrations, amounts, and other numerical data may be presented
herein in a range format. It is to be understood that such range format is used
merely for convenience and brevity and should be interpreted flexibly to include
not only the numerical values explicitly recited as the limits of the range, but also
to include all the individual numerical values or sub-ranges encompassed within
that range as if each numerical value and sub-range is explicitly recited. For
example, a weight ratio range of about 3.5:1 to about 5:1 should be interpreted to
include not only the explicitly recited limits of about 3.5:1 to about 5:1, but also to
include sub-ranges, such as 3.75 to 4.5:1, 3.90 to 4.2:1, and so forth, as well as
individual amounts, including fractional amounts, within the specified ranges.
[0021] To address the issue of gut health, the present study identified the optimal
composition of different vitamins required to support gut function, herein evaluated
in term of ability to protect against pathogen stress. The efficacy of vitamin
combination has been studied independently and along with known probiotic strain
B. lactis HN019.
[0022] The present disclosure discloses a composition comprising thiamin,
riboflavin, pyridoxine, folic acid, cobalamine, vitamin K2, and salts thereof. The
ingredients present within disclosed weight ratios exhibit benefits to the human gut
by protecting the gut against pathogenic stress.

[0023] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the
5 disclosure, the preferred methods, and materials are now described. All publications mentioned herein are incorporated herein by reference. [0024] The present disclosure is not to be limited in scope by the specific embodiments described herein, which are intended for the purposes of exemplification only. Functionally-equivalent products, compositions, and methods
0 are clearly within the scope of the disclosure, as described herein.
[0025] In an embodiment of the present disclosure, there is provided a composition comprising: (a) vitamin premix-I comprising: thiamin, riboflavin, pyridoxine, and salts thereof; (b) vitamin premix-II comprising: folic acid, cobalamine, vitamin K2, and salts thereof, wherein the vitamin premix-I to the vitamin premix-II weight
5 ratio is in a range of 3.5:1 to 5:1. In another embodiment of the present disclosure, the vitamin premix-I to the vitamin premix-II weight ratio is in a range of 3.75:1 to 4.5:1.
[0026] In an embodiment of the present disclosure, there is provided a composition comprising: (a) vitamin premix-I comprising: thiamin, riboflavin, pyridoxine, and
0 salts thereof; (b) vitamin premix-II comprising: folic acid, cobalamine, vitamin K2, and salts thereof, wherein the vitamin premix-I to the vitamin premix-II weight ratio is 4.3:1.
[0027] In an embodiment of the present disclosure, there is provided a composition comprising: (a) vitamin premix-I comprising: thiamin, riboflavin, pyridoxine, and
5 salts thereof; (b) vitamin premix-II comprising: folic acid, cobalamine, vitamin K2, and salts thereof, wherein the vitamin premix-I to the vitamin premix-II weight ratio is in a range of 3.5:1 to 5:1, and wherein thiamin to riboflavin to pyridoxine weight ratio is in a range of 1-1.5:1-2:1-3. In another embodiment of the present disclosure, thiamin to riboflavin to pyridoxine is in a range of 1-1.2:1-1.2:1-2.
0 [0028] In an embodiment of the present disclosure, there is provided a composition comprising: (a) vitamin premix-I comprising: thiamin, riboflavin, pyridoxine, and

salts thereof; (b) vitamin premix-II comprising: folic acid, cobalamine, vitamin K2, and salts thereof, wherein the vitamin premix-I to the vitamin premix-II weight ratio is in a range of 3.5:1 to 5:1, and wherein thiamin to riboflavin to pyridoxine weight ratio is 1:1.18:1.81.
[0029] In an embodiment of the present disclosure, there is provided a composition comprising: (a) vitamin premix-I comprising: thiamin, riboflavin, pyridoxine, and salts thereof; (b) vitamin premix-II comprising: folic acid, cobalamine, vitamin K2, and salts thereof, wherein the vitamin premix-I to the vitamin premix-II weight ratio is in a range of 3.5:1 to 5:1, and wherein folic acid to cobalamine to vitamin K2 weight ratio is in range of 1-1.5:0.003-0.07:0.15-0.40. In another embodiment of the present disclosure, folic acid to cobalamine to vitamin K2 weight ratio is in range of 1-1.2:0.003-0.007:0.20-0.30.
[0030] In an embodiment of the present disclosure, there is provided a composition comprising: (a) vitamin premix-I comprising: thiamin, riboflavin, pyridoxine, and salts thereof; (b) vitamin premix-II comprising: folic acid, cobalamine, vitamin K2, and salts thereof, wherein the vitamin premix-I to the vitamin premix-II weight ratio is in a range of 3.5:1 to 5:1, and wherein folic acid to cobalamine to vitamin K2 weight ratio is 1:0.005:0.275.
[0031] In an embodiment of the present disclosure, there is provided a composition as described herein, wherein the composition further comprises at least one additive selected from a group consisting of magnesium sulfate, magnesium chloride, magnesium bromide, magnesium iodide, magnesium phosphate, magnesium fluoride, magnesium nitrate, and combinations thereof. In another embodiment of the present disclosure, the at least one additive is magnesium sulfate.
[0032] In an embodiment of the present disclosure, there is provided a formulation comprising: (a) thiamin having a concentration in range of 0.0001 - 0.0005 mg/ml; (b) riboflavin having a concentration in range of 0.0001 - 0.0006 mg/ml; (c) pyridoxine having a concentration in range of 0.0002 - 0.0009 mg/ml; (d) folic acid having a concentration in range of 0.00004 - 0.0005 mg/ml; (e) cobalamine having a concentration in range of 0.00000005 - 0.000002 mg/ml; (f) vitamin K2

having a concentration in range of 0.000007 - 0.0001 mg/ml; (g) at least one excipient; and (h) at least one additive.
[0033] In an embodiment of the present disclosure, there is provided a formulation comprising: (a) thiamin having a concentration in range of 0.0001 - 0.0005 mg/ml;
j (b) riboflavin having a concentration in range of 0.0001 - 0.0006 mg/ml; (c) pyridoxine having a concentration in range of 0.0002 - 0.0009 mg/ml; (d) folic acid having a concentration in range of 0.00004 - 0.0005 mg/ml; (e) cobalamine having a concentration in range of 0.00000005 - 0.000002 mg/ml; (f) vitamin K2 having a concentration in range of 0.000007 - 0.0001 mg/ml; (g) at least one
) excipient; and (h) at least one additive, wherein the at least one excipient is selected from a group consisting of water, at least one carrier, milk solids, vitamin premix, fibers, natural flavors, colors, and combinations thereof. In another embodiment of the present disclosure, the at least one carrier is selected from a group consisting of carriers well known in the art for formulating food, and non-food formulations.
3 [0034] In an embodiment of the present disclosure, there is provided a formulation comprising: (a) thiamin having a concentration in range of 0.0001 - 0.0005 mg/ml; (b) riboflavin having a concentration in range of 0.0001 - 0.0006 mg/ml; (c) pyridoxine having a concentration in range of 0.0002 - 0.0009 mg/ml; (d) folic acid having a concentration in range of 0.00004 - 0.0005 mg/ml; (e) cobalamine
D having a concentration in range of 0.00000005 - 0.000002 mg/ml; (f) vitamin K2 having a concentration in range of 0.000007 - 0.0001 mg/ml; (g) at least one excipient; and (h) at least one additive, wherein the at least one additive is selected from the group consisting of magnesium sulfate, magnesium chloride, magnesium bromide, magnesium iodide, magnesium phosphate, magnesium fluoride,
3 magnesium nitrate, and combinations thereof. In another embodiment of the present disclosure, the at least one additive is magnesium sulfate. [0035] In an embodiment of the present disclosure, there is provided a formulation comprising: (a) thiamin having a concentration in range of 0.0001 - 0.0005 mg/ml; (b) riboflavin having a concentration in range of 0.0001 - 0.0006 mg/ml; (c)
) pyridoxine having a concentration in range of 0.0002 - 0.0009 mg/ml; (d) folic acid having a concentration in range of 0.00004 - 0.0005 mg/ml; (e) cobalamine

having a concentration in range of 0.00000005 - 0.000002 mg/ml; (f) vitamin K2
having a concentration in range of 0.000007 - 0.0001 mg/ml; (g) at least one
excipient; and (h) at least one additive, wherein the at least one excipient is selected
from a group consisting of water, at least one carrier, milk solids, vitamin premix,
fibers, natural flavors, colors, and combinations thereof, and the at least one
additive is selected from the group consisting of magnesium sulfate, magnesium
chloride, magnesium bromide, magnesium iodide, magnesium phosphate,
magnesium fluoride, magnesium nitrate, and combinations thereof.
[0036] In an embodiment of the present disclosure, there is provided a composition
as described herein, wherein the composition exhibits immunomodulatory benefits
by reducing production of nitric oxide.
[0037] In an embodiment of the present disclosure, there is provided a composition
as described herein, wherein the composition exhibits immunomodulatory benefits
by reducing expression of IL-6 (interleukin-6) gene.
[0038] In an embodiment of the present disclosure, there is provided a formulation
as described herein, wherein the formulation exhibits immunomodulatory benefits
by reducing production of nitric oxide.
[0039] In an embodiment of the present disclosure, there is provided a formulation
as described herein, wherein the formulation exhibits immunomodulatory benefits
by reducing expression of IL-6 (interleukin-6) gene.
[0040] In an embodiment of the present disclosure, there is provided a process for
preparing the composition comprising: (a) vitamin premix-I comprising: thiamin,
riboflavin, pyridoxine, and salts thereof; (b) vitamin premix-II comprising: folic
acid, cobalamine, vitamin K2, and salts thereof, wherein the vitamin premix-I to
the vitamin premix-II weight ratio is in a range of 3.5:1 to 5:1, said process
comprising: (i) obtaining the vitamin premix-I; (ii) obtaining the vitamin premix-II;
and (iii) contacting the vitamin premix-I and the vitamin premix-II, to obtain the
composition.
[0041] In an embodiment of the present disclosure, there is provided a process for
preparing the composition comprising: (a) vitamin premix-I comprising: thiamin,
riboflavin, pyridoxine, and salts thereof; (b) vitamin premix-II comprising: folic

acid, cobalamine, vitamin K2, and salts thereof, wherein the vitamin premix-I to the vitamin premix-II weight ratio is 4.3:1, said process comprising: (i) obtaining the vitamin premix-I; (ii) obtaining the vitamin premix-II; and (iii) contacting the vitamin premix-I and the vitamin premix-II, to obtain the composition. [0042] In an embodiment of the present disclosure, there is provided a process for preparing the composition comprising: (a) vitamin premix-I comprising: thiamin, riboflavin, pyridoxine, and salts thereof; (b) vitamin premix-II comprising: folic acid, cobalamine, vitamin K2, and salts thereof, wherein the vitamin premix-I to the vitamin premix-II weight ratio is in a range of 3.5:1 to 5:1, said process comprising: (i) obtaining the vitamin premix-I; (ii) obtaining the vitamin premix-II; and (iii) contacting the vitamin premix-I and the vitamin premix-II, to obtain the composition, and wherein thiamin to riboflavin to pyridoxine weight ratio is in a range of 1-1.5:1-2:1-3.
[0043] In an embodiment of the present disclosure, there is provided a process for preparing the composition comprising: (a) vitamin premix-I comprising: thiamin, riboflavin, pyridoxine, and salts thereof; (b) vitamin premix-II comprising: folic acid, cobalamine, vitamin K2, and salts thereof, wherein the vitamin premix-I to the vitamin premix-II weight ratio is in a range of 3.5:1 to 5:1, said process comprising: (i) obtaining the vitamin premix-I; (ii) obtaining the vitamin premix-II; and (iii) contacting the vitamin premix-I and the vitamin premix-II, to obtain the composition, and wherein folic acid to cobalamine to vitamin K2 weight ratio is in a range of 1-1.5:0.003-0.07:0.15-0.40.
[0044] In an embodiment of the present disclosure, there is provided a process for preparing the composition comprising: (a) vitamin premix-I comprising: thiamin, riboflavin, pyridoxine, and salts thereof; (b) vitamin premix-II comprising: folic acid, cobalamine, vitamin K2, and salts thereof, wherein the vitamin premix-I to the vitamin premix-II weight ratio is in a range of 3.5:1 to 5:1, said process comprising: (i) obtaining the vitamin premix-I; (ii) obtaining the vitamin premix-II; and (iii) contacting the vitamin premix-I and the vitamin premix-II, to obtain the composition, and wherein thiamin to riboflavin to pyridoxine weight ratio is in a

range of 1-1.5:1-2:1-3, and folic acid to cobalamine to vitamin K2 weight ratio is in a range of 1-1.5:0.003-0.07:0.15-0.40.
[0045] In an embodiment of the present disclosure, there is provided a process for preparing the composition comprising: (a) vitamin premix-I comprising: thiamin,
j riboflavin, pyridoxine, and salts thereof; (b) vitamin premix-II comprising: folic acid, cobalamine, vitamin K2, and salts thereof; and (c) at least one additive, wherein the vitamin premix-I to the vitamin premix-II weight ratio is in a range of 3.5:1 to 5:1, said process comprising: (i) obtaining the vitamin premix-I; (ii) obtaining the vitamin premix-II; (iii) obtaining the at least one additive, and (iii)
) contacting the vitamin premix-I, the vitamin premix-II and the at least one additive, to obtain the composition, and the at least one additive is selected from a group consisting of magnesium sulfate, magnesium chloride, magnesium bromide, magnesium iodide, magnesium phosphate, magnesium fluoride, magnesium nitrate, and combinations thereof.
3 [0046] In an embodiment of the present disclosure, there is provided a process for preparing the formulation comprising: (a) thiamin having a concentration in range of 0.0001 - 0.0005 mg/ml; (b) riboflavin having a concentration in range of 0.0001 - 0.0006 mg/ml; (c) pyridoxine having a concentration in range of 0.0002 - 0.0009 mg/ml; (d) folic acid having a concentration in range of 0.00004 - 0.0005 mg/ml;
) (e) cobalamine having a concentration in range of 0.00000005 - 0.000002 mg/ml; (f) vitamin K2 having a concentration in range of 0.000007 - 0.0001 mg/ml; (g) at least one excipient; and (h) at least one additive, said process comprising: (i) obtaining thiamin; (ii) obtaining riboflavin; (iii) obtaining pyridoxine; (iv) obtaining folic acid; (v) obtaining cobalamine; (vi) obtaining vitamin K2; (vii)
3 obtaining at least one excipient; (viii) obtaining at least one additive and (ix) contacting thiamin, riboflavin, pyridoxine, folic acid, cobalamine, vitamin K2, the at least one excipient, and the at least one additive, to obtain the formulation. [0047] Although the subject matter has been described in considerable detail with reference to certain examples and implementations thereof, other implementations
) are possible. EXAMPLES

[0048] The disclosure will now be illustrated with working examples, which is intended to illustrate the working of disclosure and not intended to take restrictively to imply any limitations on the scope of the present disclosure. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which this disclosure belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice of the disclosed methods and compositions, the exemplary methods, devices and materials are described herein. It is to be understood that this disclosure is not limited to particular methods, and experimental conditions described, as such methods and conditions may apply. [0049] The examples describe the beneficial effect of the compositions of the present disclosure. The effect has been shown in macrophage cell lines induced by LPS.
Example 1
Effect of various compositions against LPS induced stress in macrophage cells [0050] The efficacy of vitamin combination was studied independently and along with known probiotic strain B. lactis HN019. Vitamins procured from sigma were used for evaluation. [0051] Macrophage cell lines were used for the evaluation and nitric oxide production post LPS (lipopolysaccharide) stress in the absence and presence of different combinations of vitamins (Table 1) was evaluated to establish the protection potential (stress protection) of various compositions comprising vitamins. Procedure: RAW 264.7 cells (p6-10 passages) were seeded at the density 15000 cells/well in 96 well plate. After confluency, cells were washed with PBS and treated with different vitamin combinations in the presence of E. coli LPS (lOOng/ml) for 5h. Post incubation, supernatant collected and analyzed for Nitric oxide production by Griess reagent. [0052] NO estimation: Supernatants (lOOul) were taken in tube and lOul of VCI3 (2% in 6N HC1) was added. Each sample was mixed thoroughly and incubated at 60°C for lh. Post incubation, lOOul Griess reagent were added and incubated for lOmin at room temperature. Total nitric oxide (NO) was estimated at 540nm.

[0053] Various compositions were prepared by diluting vitamins in DMSO as per the concentrations listed in Table 1 below. All mentioned compositions were tested for their NO inhibitory activity in the macrophage cells. Several control samples such as thiamin, riboflavin, pyridoxine, folic acid, cobalamine and vitamin K2, were also tested individually by preparing samples that have been suitably diluted with DMSO. Next, stepwise inclusion of additional ingredients along with the mentioned vitamins were attempted. Additives such as magnesium sulfate was added to compositions in suitable concentrations. Various compositions were teted with inclusion of B. lactis {Bifidobacterium lactis ATCC 27673), wherein the bacterium was added at a constant concentration of 106 per ml of composition. The various tested combinations are presented below in Table 1. Table 1: Various compositions used in the present study



[0054] It is further noted from entries 33-68 of Table 1 that various dilutions of compositions were attempted and the corresponding effect on NO inhibition was noted. Also, additives such as magnesium sulfate and B. lactis were introduced as 5 part of the compositions to obtain samples that can be established as a wholesome nutrient mix. was Figure 1A and IB depicts the percentage of nitric oxide production in macrophage cells in presence of different compositions. Referring to Figure 1, it can be appreciated that mixture-4 (ref: table 1; Bl, B2, B6, B9, B12 & K2) synergistically inhibits the production of nitric oxide as compared to the other 10 compositions. Therefore, it can be inferred that the present composition protects the cells against inflammatory stress. The process for preparing the composition of the present disclosure comprises: (i) obtaining a vitamin premix-I (Bl, B2, and B6); (ii) obtaining a vitamin premix-II (B9, B12, and K12); and (iii) contacting the

vitamin premix-I and the vitamin premix-II, to obtain the composition. The process
for preparing the formulation comprising: (a) thiamin having a concentration in
range of 0.0001 - 0.0005 mg/ml; (b) riboflavin having a concentration in range of
0.0001 - 0.0006 mg/ml; (c) pyridoxine having a concentration in range of 0.0002 -
0.0009 mg/ml; (d) folic acid having a concentration in range of 0.00004 - 0.0005
mg/ml; (e) cobalamine having a concentration in range of 0.00000005 - 0.000002
mg/ml; (f) vitamin K2 having a concentration in range of 0.000007 - 0.0001
mg/ml; (g) at least one excipient; and (h) at least one additive, said process
comprising: (i) obtaining thiamin; (ii) obtaining riboflavin; (iii) obtaining
pyridoxine; (iv) obtaining folic acid; (v) obtaining cobalamine; (vi) obtaining
vitamin K2; (vii) obtaining at least one excipient; (viii) obtaining at least one
additive and (ix) contacting thiamin, riboflavin, pyridoxine, folic acid, cobalamine,
vitamin K2, the at least one excipient, and the at least one additive, to obtain the
formulation. The compositions as listed in Table 1 above were prepared via the
process as described herein. Various mixes such as Mix-4 were prepared by
combining vitamin premix-1 (or premix-1) and vitamin premix-2 (or premix-2).
Various dilutions of mixes such as Mix-4 were prepared by not only diluting the
whole mix, but also by diluting premix-1 and/or premix-2 separately. An
exemplary process for preparing the mixture 4 (premix-1 0.025X diluted and
premix-2 diluted 0.1X) has been provided: (i) powders of vitamin Bl, B2, B6, B9,
B12 were weighed to prepare stock (w/v) solutions 0.33mg/100ml, 0.39mg/100ml,
0.6mg/100ml, 0.06mg/100ml, and 0.0003mg/100 ml solutions in water
respectively; (ii) vitamin K2 stock (w/v) of 0.165mg/100ml concentration was
prepared in DMSO; and (iii) stocks were then diluted in medium (DMEM) to
achieve final concentration
0.0000165+0.0000195+0.00003+0.000012+0.00000006+0.0000033 of vitamin Bl, B2, B6, B9, B12, and K2 respectively.
[0055] The potential of mixture-4 was further validated using co-culture model and has been described in the forthcoming example.
Example 2

Validation using co-culture model
[0056] Further, immunomodulatory potential was evaluated under inflamed conditions on co-culture model. Intestinal and immune cells were maintained in vitro for generation of the model. Selected vitamin combination was tested individually or with probiotic bacterium to evaluate its efficacy to maintain gastrointestinal wellbeing by protecting against LPS. Supernatant collected from basal side was used for nitric oxide (NO) estimation and cells from the apical side were used for expression studies. Fourteen days post confluence Caco-2 cells in 12 well were pretreated with different fermented prebiotic mixture for 3 hrs. The amount of described vitamin was added to the medium in which the cells were suspended. After incubation, caco-2 cells were infected with LPS (lug/ml) for 21 hrs.
[0057] Expression of IL-6: The cells collected were washed with 0.1M phosphate buffer and harvested with Trizol reagent (Invitrogen) for isolation of RNA. The isolated RNA was checked for its integrity using conventional methods available to a person skilled in the art, following which the RNA was transcribed to prepare cDNA using ABI high capacity cDNA kit as per manufacturer's instruction. Briefly lug of RNA was taken along with 2.5 ul of random hexamers and the volume was made to 15ul with nuclease free water. The sample was incubated at 65°C for 5 min, following which 2.5ul of 25mM dNTPS, 2.5 ul of 10X RT buffer, 0.625ul of RNase inhibitor, 0.875 ul of RT enzyme and 3.5 ul of nuclease free water was added and incubated at a temperature in the range of 45-60°C to obtain cDNA. A person skilled in the art may vary the incubation temperature incubation according to experiment requirement. The cDNA prepared was used for evaluation of expression of genes by real time PCR with nucleotide sequence as set forth in SEQ ID NO: 1-4. cDNA of control and treatment samples were subjected to real time expression study by using SYBR green I mix (ABI system) along with respective primers using the protocols mentioned below, and expression was quantitated using ABI Prism 7500 Sequence Detection System (Applied Biosystems).

[0058] qPCR conditions: Initial denaturation at 95°C for 10 min was followed by
40 cycles of 95°C for 15s, the primer-specific annealing temperature at 60°C for 5s,
and elongation at 72°C for 15s. Amplification using these primers resulted in a 130
bp fragment length respectively. At the end of each run melting curve profiles were
produced by cooling the sample to 65°C for 15s and then heating slowly at
0.20°C/s to 95°C with continuous measurement of fluorescence to confirm
amplification of specific transcripts. Amplification with GAPDH primers was used
as internal control.
[0059] The SEQ ID NO: 1 discloses the nucleotide sequence for IL-6 forward
primer
CCAGCTATGAACTCCTTCTC
[0060] SEQ ID NO: 2 discloses the nucleotide sequence for IL-6 reverse primer
GCTTGTTCCTCACATCTCTC
[0061] SEQ ID NO:3 discloses the nucleotide sequence for GAPDH forward
primer
CCACTCCTCCACCTTTGAC
[0062] SEQ ID NO: 4 discloses the sequence for GAPDH reverse primer
ACCCTGTTGCTGTAGCCA
[0063] Estimation of nitric oxide production: Supernatants were collected and
used for the estimation of nitric oxide (nitrate and nitrite) by Griess reagent. First, a
lOmM sodium nitrite solution was prepared in distilled water. The stock solution of
sodium nitrite (lOmM) was diluted with distilled water to prepare a gradient of
nitrite standard (0, 1.56, 3.125, 6.25, 12.5, 25, 50 and lOOuM). 20mM sodium
nitrate solution was prepared with distilled water and stock was diluted with
distilled water to prepare a gradient of nitrite standard (0, 3.125, 6.25, 12.5, 25, 50,
100 and 200uM). 50 ul of standard solution or supernatants was added to 96 well
plate to which 50 ul of Griess reagent was added. The samples were incubated at
room temperature (25-30°C) for lOmins. After incubation, the absorbance was read
at 540nm, and the nitrite concentration was calculated by correlating the value with
that of nitrite standard. For total nitric oxide estimation 5 ul of 2% vanadium
chloride (VCI3) (Sigma, USA) was added to each well (a separate reaction) and

incubated at 60°C for lhr and absorbance was measured at 540nm. The total nitric oxide was estimated by calculating the value with that of the nitrate standard. The amount of nitric acid was also measured in the non-LPS infected cells, no extract treated cells to measure the basal level of nitric oxide. Further, nitric acid was calculated in the LPS infected and no extract treated cells. The level of nitric acid inhibition was calculated by comparing the levels of nitric oxide in LPS infected, extracted treated cells with that of LPS infected, and no extracted treated cells. [0064] Effect on IL-6 expression: Figure 2 depicts the IL-6 expression of cells treated with different compositions comprising mixture-4 (mix-4 of Table 1). It can be appreciated that the composition comprising mixture-4, B. lactis, and magnesium sulfate displays the least expression of IL-6 in caco-2 cells (2.58), thereby leading to maximum inhibition of IL-6 expression when compared with LPS induced IL-6 expression. Further, it can also be observed that mixture 4 itself leads to inhibition of IL-6 expression (7.50) when compared with LPS induced IL-6 expression. Therefore, it can be inferred that the composition (mix-4) of present disclosure protects the intestinal cells from LPS induced pathogenic stress by inhibiting the IL-6 expression.
[0065] Effect on NO production: Figure 3 depicts the effect of compositions comprising mixture-4 on NO production in caco-2 cells. It can be appreciated that the composition comprising mixture-4, B. lactis, and magnesium sulfate displays the least production (70.10%) of NO when compared with the LPS induced cells. The composition consisting only mixture-4 also leads to significant inhibition of NO production (81.07%) in caco-2 cells. Therefore, it can be appreciated that the composition (mix-4) of present disclosure leads to enhanced protection of intestinal cells by leading to inhibition of NO production and IL-6 expression. [0066] Formulation comprising the composition of the present disclosure: The formulation comprises (a) thiamin having a concentration in range of 0.0001 -0.0005 mg/ml; (b) riboflavin having a concentration in range of 0.0001 - 0.0006 mg/ml; (c) pyridoxine having a concentration in range of 0.0002 - 0.0009 mg/ml; (d) folic acid having a concentration in range of 0.00004 - 0.0005 mg/ml; (e) cobalamine having a concentration in range of 0.00000005 - 0.000002 mg/ml; (f)

vitamin K2 having a concentration in range of 0.000007 - 0.0001 mg/ml; (g) at least one excipient; and (h) at least one additive. The at least one excipient is selected from a group consisting of water, at least one carrier, milk solids, vitamin premix, fibers, natural flavors, colors, and combinations thereof, and the at least one additive is selected from the group consisting of magnesium sulfate, magnesium chloride, magnesium bromide, magnesium iodide, magnesium phosphate, magnesium fluoride, magnesium nitrate, and combinations thereof. The formulation can be either a food or a non-food formulation. The formulation can also be a dry or liquid formulation. One likely formulation comprising the mix-4 of the present disclosure includes 4 mg of vitamin premix, 3 g of fibers, and 97 ml milk (commercially procured from Nandini- 1.5% fat) to obtain 100 ml of a health drink. Many formulations comprising the composition of the present disclosure are possible as per the convenience of a person skilled in the art.
Advantages of the present disclosure
[0067] The present disclosure discloses a composition comprising a mixture of different vitamin B types that leads to enhanced protection of cells against pathogenic stress. The composition comprises two premixes, premix I comprises vitamin Bl, B2, and B6, and premix II comprises vitamin B9, B12, and K12 at specific weight ratios as disclosed in the present disclosure. The ingredients required to obtain the composition of the present disclosure are easy and inexpensive to obtain. Also, the composition of the present disclosure is simple. The composition being devoid of any complex synthetic drugs does not have any side-effects on the human body.

I/We claim:
1. A composition comprising:
a) vitamin premix-I comprising: thiamin, riboflavin, pyridoxine, and salts thereof;
b) vitamin premix-II comprising: folic acid, cobalamine, vitamin K2, and salts thereof,
wherein the vitamin premix-I to the vitamin premix-II weight ratio is in a range of 3.5:1 to 5:1.
2. The composition as claimed in claim 1, wherein the vitamin premix-I to the vitamin premix-II weight ratio is in a range of 3.75:1 to 4.5:1.
3. The composition as claimed in claim 1, wherein thiamin to riboflavin to pyridoxine weight ratio is in a range of 1-1.5:1-2:1-3.
4. The composition as claimed in claim 3, wherein thiamin to riboflavin to
pyridoxine weight ratio is 1:1.18:1.81.
5. The composition as claimed in claim 1, wherein folic acid to cobalamine to vitamin K2 weight ratio is in a range of 1-1.5:0.003-0.07:0.15-0.40.
6. The composition as claimed in claim 5, wherein folic acid to cobalamine to vitamin K2 weight ratio is 1:0.005:0.275.
7. The composition as claimed in claim 1, wherein the composition further comprises at least one additive selected from a group consisting of magnesium sulfate, magnesium chloride, magnesium bromide, magnesium iodide, magnesium phosphate, magnesium fluoride, magnesium nitrate, and combinations thereof.
8. A formulation comprising:

a) thiamin having a concentration in range of 0.0001 - 0.0005 mg/ml;
b) riboflavin having a concentration in range of 0.0001 - 0.0006 mg/ml;
c) pyridoxine having a concentration in range of 0.0002 - 0.0009 mg/ml;

d) folic acid having a concentration in range of 0.00004 - 0.0005 mg/ml;
e) cobalamine having a concentration in range of 0.00000005 -0.000002 mg/ml;
f) vitamin K2 having a concentration in range of 0.000007 - 0.0001 mg/ml;
g) at least one excipient; and
h) at least one additive.
h The formulation as claimed in claim 8, wherein the at least one excipient is selected from the group consisting of water, at least one carrier, milk solids, vitamin premix, fibers, natural flavors, colors, and combinations thereof.
[0. The formulation as claimed in claim 8, wherein the at least one additive is selected from the group consisting of magnesium sulfate, magnesium chloride, magnesium bromide, magnesium iodide, magnesium phosphate, magnesium fluoride, magnesium nitrate, and combinations thereof.
[ 1. A process for preparing the composition as claimed in claim 1, said process comprising:
a) obtaining the vitamin premix-I;
b) obtaining the vitamin premix-II; and
c) contacting the vitamin premix-I and the vitamin premix-II, to obtain the composition.
[2. A process for preparing the formulation as claimed in claim 8, said process comprising:
a) obtaining thiamin;
b) obtaining riboflavin;
c) obtaining pyridoxine;
d) obtaining folic acid;
e) obtaining cobalamine;
f) obtaining vitamin K2;
g) obtaining at least one excipient; h) obtaining at least one additive and

i) contacting thiamin, riboflavin, pyridoxine, folic acid, cobalamine, vitamin K2, the at least one excipient, and the at least one additive, to obtain the formulation.
13. The composition as claimed in claim 1, wherein the composition exhibits immunomodulatory benefits by reducing production of nitric oxide.
14. The composition as claimed in claim 1, wherein the composition exhibits immunomodulatory benefits by reducing expression of IL-6 (interleukin-6) gene.

Documents

Application Documents

# Name Date
1 201841026133-STATEMENT OF UNDERTAKING (FORM 3) [12-07-2018(online)].pdf 2018-07-12
2 201841026133-SEQUENCE LISTING(PDF) [12-07-2018(online)].pdf 2018-07-12
3 201841026133-SEQUENCE LISTING [12-07-2018(online)].txt 2018-07-12
4 201841026133-FORM 1 [12-07-2018(online)].pdf 2018-07-12
5 201841026133-DRAWINGS [12-07-2018(online)].pdf 2018-07-12
6 201841026133-DECLARATION OF INVENTORSHIP (FORM 5) [12-07-2018(online)].pdf 2018-07-12
7 201841026133-COMPLETE SPECIFICATION [12-07-2018(online)].pdf 2018-07-12
8 201841026133-Proof of Right (MANDATORY) [03-08-2018(online)].pdf 2018-08-03
9 201841026133-FORM-26 [03-08-2018(online)].pdf 2018-08-03
10 Correspondence by Agent_Power of Attorney and Form 1_06-08-2018.pdf 2018-08-06
11 201841026133-FORM 18 [11-07-2022(online)].pdf 2022-07-11