Sign In to Follow Application
View All Documents & Correspondence

Compositions Of Constructs Of Modified Dna Sequences Coding Specific Peptides For Vaccine Against Covid 19 And Method Of Preparation Of Adenoviral Vaccines Thereof.

Abstract: TITLE: COMPOSITIONS OF CONSTRUCTS OF MODIFIED DNA SEQUENCES CODING SPECIFIC PEPTIDES FOR VACCINE AGAINST COVID-19 AND METHOD OF PREPARATION OF ADENOVIRAL VACCINES THEREOF. ABSTRACT: The invention describes modified DNA constructs of SEQ ID-1 to 5, using modified plasmids as in SEQ ID- 8 to 15 to create two Adenoviral vaccine candidates as in SEQ ID-6 and SEQ ID-7, wherein SEQ ID-6 is a DNA construct of tricistronic DNA sequences encoding, a) codon optimized RBD sequence, b) RBD SARS Cov-2 natural sequence, c) S1 subunit of Coronavirus fused with a Foldon tag; and SEQ ID-7 is a DNA construct of a monocistronic DNA sequence encoding the receptor binding domain (RBD) by using codon optimized RBD sequence. The invention further describes method of preparation of Adenoviral vaccine using the above two candidates(SEQ ID-6 & 7) such that the modified DNA sequences coding specific peptides are secreted in the extracellular space for the generation of neutralizing antibodies of IgA and IgG types mainly. These vaccine candidates can be delivered intramuscularly, orally (mucosally) and preferably intranasally.

Get Free WhatsApp Updates!
Notices, Deadlines & Correspondence

Patent Information

Application #
Filing Date
25 March 2020
Publication Number
40/2021
Publication Type
INA
Invention Field
BIOTECHNOLOGY
Status
Email
allison@katariyaassociates.com
Parent Application

Applicants

Ansicht Scidel Diagnostics and Therapeutics LLP
18, Mahalaxmi Housing Society, Shahupuri, Satara, 415002 , Maharashtra, India

Inventors

1. Dr.Arati Inamdar
18, Mahalaxmi Housing Society, Shahupuri, Satara, 415002 , Maharashtra, India
2. Dr. Ajinkya Inamdar
18, Mahalaxmi Housing Society, Shahupuri, Satara, 415002 , Maharashtra, India

Claims

1. A composition of constructs of modified DNA sequences coding specific peptides for vaccine against covid-19 and method of preparation of adenoviral vaccines thereof comprising of atleast one or a combination of components as follows; a. S1 subunit of the S protein or RBD domain of the S protein, b. S1 subunit of the S protein or RBD domain of the S protein both tagged with an adjuvant peptide, c. S1 subunit of the S protein or RBD domain of the S protein or multiple proteins of SARS Co-2 for vaccination or all such proteins tagged with a FLAG peptide, d. specific DNA sequences in combination such that the size of an adenoviral vaccine genome will exceed the packaging capacity in case of homologous recombination event during expansion of virus in HEK-293 cells during manufacturing; where one sequence is naturally occurring variant of the RBD or S1 subunit, another sequence is codon-optimized version of the RBD or S1 subunit and third sequence is also a variant of the RBD or S1 subunit sequence such that none of the three sequences share a length over 20 to 30 bp which would increase the chance of homologous recombination within the added sequences, e. specific sequences of Chimpanzee Serotype 68 adenovirus such that they include minor sequences of serotype 5 adenovirus and include a variation of above mentioned one to three sequences of the coronavirus, f. RBD and/or S1 subunit sequences where the natural signal peptide is replaced by a synthetic signal peptide such that the antigen is secreted out of the cells and is made available for antibody generation and or a Foldon domain is attached at the 3’ terminal of the coding region such that that a trimer is formed after ribosomal synthesis of the peptide, wherein, composition of DNA constructs of a tricistronic adenoviral vaccine candidate of serotype 5 as shown in SEQ ID NO: 6 and FIG. 11 comprises of three DNA sequences encoding; a.) the receptor binding domain (RBD) by using codon optimized RBD sequence (as shown in Sequence 1 and FIG. 1), b.) natural sequence of the RBD SARS Cov-2 (as shown in Sequence 18 and FIG. 27), and, c.) S1 subunit of Coronavirus fused with a Foldon tag (as shown in Sequence 17 and FIG. 26) formulated for intranasal, intramuscular or subcutaneous administration for prevention against covid-19, using plasmids shown in FIG. 13, FIG. 14, FIG. 15, FIG. 16 (as presented in sequences 8,9,10 and 11), such that the adenovirus generates immunity due to virtue of secreted synthetic secretory peptide used in combiation with tall antigens such that the signal peptide is cleaved after translation and the S1 subunit and RBD are secreted in the extracellular space for the generation of neutralizing antibodies of IgA and IgG types mainly; and wherein composition of DNA constructs of a monocistronic adenoviral vaccine of serotype Chimpanzee 68 with minor sequences from Serotype 5 as shown in SEQ ID NO: 7 and FIG. 12 comprises of; a single DNA sequence encoding the receptor binding domain (RBD) by using codon optimized RBD sequence (as shown in Sequence 1 and FIG. 1 using plasmids shown in FIG. 20, FIG.21, FIG.22 and FIG. 23 (as presented in sequences 12, 13, 14 and 15). 2) The composition as claimed in claim 1, wherein DNA construct of SEQ ID NO: 1, comprises of; i) a DNA sequence encoding the codon optimized receptor binding domain (RBD) of the SARS Cov-2, formulated for adenovorial or adeno-associated viral delivery via intranasal intramuscular or subcutaneous administration, such that the DNA constructs of SEQ ID NO: 1 leads to a biologically expressed RBD, secreted by use of a synthetic secretory peptide used in combiation with the RBD such that the signal peptide is cleaved after translation and the RBD is secreted in the extracellular space for the generation of neutralizing antibodies, ii) The above DNA sequences being expressed in CHO cells or HEK-293 cells such that the proteins are expressed for purification and futher injection into a human for generation of immunogenicity, wherein these sequences after combining them in the form an adenoviral genome (Cosmid) are expressed in HEK-293 cells and tested by Western Blot. 3) The composition as claimed in claim 1, wherein DNA construct of SEQ ID NO: 2, comprises of, a DNA sequence encoding the codon optimized S1 subunit of the SARS Cov-2, formulated for adenovorial or adeno-associated viral delivery via intranasal, intramuscular or subcutaneous administration, such that the DNA constructs of SEQ ID NO: 2 leads to a biologically expressed S1 subunit, secreted by use of a synthetic secretory peptide used in combiation with the S1 subunit such that the signal peptide is cleaved after translation and the S1 subunit is secreted in the extracellular space for the generation of neutralizing antibodies. 4) The composition as claimed in claim 1, wherein DNA construct of SEQ ID NO: 3 comprises of, a DNA sequence encoding a triplicate of the codon optimized receptor binding domain (RBD) of the SARS Cov-2, formulated for adenovorial or adeno-associated viral delivery via intranasal, intramuscular or subcutaneous administration, such that the DNA constructs of SEQ ID NO: 3 leads to a biologically expressed receptor binding domain (RBD) of the SARS Cov-2, whrein each unit in the triplicate is generated at the same time and cleaved at the P2A sequence after translation, leaving the synthetic signal peptide in fusion with the RBD epitope and each RBD epitope is then secreted by virtue of the synthetic secretory peptide such that the signal peptide is cleaved after translation and the RBD domain is secreted in the extracellular space for the generation of neutralizing antibodies. 5) The composition as claimed in claim 1, wherein DNA construct of SEQ ID NO: 4 comprises of, a DNA sequence encoding the codon optimized RBD domain of the SARS Cov-2, formulated for adenovorial or adeno-associated viral delivery via intranasal, intramuscular or subcutaneous administration, such that the DNA constructs of SEQ ID NO: 4 leads to a biologically expressed RBD domain secreted by use of a synthetic secretory peptide used in combiation with the RBD domain such that the signal peptide is cleaved after translation and the S1 subunit is secreted in the extracellular space for the generation of neutralizing antibodiesin addition to a P2A peptide (which is cleaved after translation) for release of a fusion protein of synthetic signal peptide and an adjuvant peptide of sequence gatccgaacgcgccgaaacgcccgccgagcgcgttttttctgttttgcagcgaa. 6) The composition as claimed in claim 1, wherein DNA construct of SEQ ID NO: 5 comprises of, a DNA sequence encoding the codon optimized RBD domain of the SARS Cov-2, formulated for adenovorial or adeno-associated viral delivery via intranasal, intramuscular or subcutaneous administration, such that the DNA constructs of SEQ ID NO: 5 leads to a biologically expressed RBD domain secreted by use of a synthetic secretory peptide used in combiation with the a S1 subunit domain such that both S1 subunit and RBD domain are released after their signal peptides are cleaved after translation, and both RBD and S1 subunit are secreted in the extracellular space for generation of neutralizing antibodies. 7) The composition as claimed in claim 1, wherein SEQ ID NO.- 16 as shown in FIG. 25 is map of plasmid pAD1129-ANS10-modified with DNA sequence created for vaccination against the South African strain B.1.351 which carries mutations from both UK and South African Strain (mutations shown in the black box). 8) The DNA constructs as claimed in claim 1, wherein the adenoviral vaccine candidates (SEQ ID NO.-6 and SEQ ID NO.-7) as produced are such that: i. RBD antigen produces neutralizing antibody only, and does not lead to disease enhancement, ii. Signal peptide attached to the RBD sequence helps extracellular secretion of the antigen once adenoviral particle produces the antigen in the cells, thus increasing the chances of formation of antibodies, iii. S1 subunit attached to foldon trimerization domain is expressed as well in the same viral particle increasing the range of antibodies produced and increasing chance to produce antibodies in the natural trimer form, iv. Adenoviral genome is made such that homologous recombination is not viable and this eliminates the risk of producing replication competent virus even in HEK 293 cell line, v. Intranasal delivery of the vaccine candidates overcomes the drawbacks of thrombosis as the candidate vaccine does not enter the blood and provides high quality mucosal immunity, vi. Chimpanzee Adeno candidate vaccine using the RBD sequence is also able to be given intranasally and thus provides mucosal immunity against the coronavirus without side effects of thrombosis as it never enters the bloodstream, vii. Using natural sequence of the Coronavirus RBD in the same viral genome where the codon-optimized sequence of the Coronavirus RBD is used, prevents any homologous recombination and yet produces the same protein the double amount (two sequences for the same peptide, one natural and one codon-optimized, increasing the overall protein production). 9) The DNA constructs as claimed in claim 1, wherein the method of preparation of Adeno viral vaccine comprises the steps of:

1. Construction of the adenoviral candidate vaccines which includes the steps of: a. Creation of shuttle plasmids, b. Cosmid Construction, c. Rescue, d. Amplification, and,

2. Characterization of the candidate vaccine which includes the steps of: i. Genome Restriction Analysis, ii. Physical titer, iii. Infectious titer, iv. VP/ IU ratio, v. Genome sequencing, vi. Transgene expression, vii. RCA assay.

Specification

DESC:FIELD OF THE INVENTION:
The invention relates to the field of cell and molecular biology, immunology and vaccine candidates for SARS-Cov, and it more particularly relates to preparation of compositions of constructs of modified DNA sequences for vaccination against covid-19, and even further to adenoviral vaccine production method.

BACKGROUND:
Pandemic of Covid-19 caused by the SARS Cov-2 has caused severe fatalities with life-long repercussions globally and demands urgent and critical address in the form of vaccine. This disease can cause fatality amongst the elderly population especially above 70 years of age at an approximate rate of 2 % to 3%, however it can also cause mass hospitalizations (up to 20% for all population) and a prolonged halt in the economy could lead much disastrous results for pediatric health as well as health of all those who depend on the daily wages for a surviving nutrition. The present invention discloses life-saving solution to this deadly virus in the form of intranasal, oral (mucosal) route delivered vaccine candidates that prevents the otherwise reported drawbacks of clotting etc. in the intravenous route.
The present invention discloses DNA constructs that can be used for the prevention, diagnosis and treatment of Covid-19. For vaccination purpose the present invention describes composition of DNA construct of S1 subunit of the S protein as well as DNA constructs of the Receptor Binding Domain (RBD) of the S protein (spike glycoprotein) tagged with a Foldon domain for trimerization or attached with a synthetic signal peptide that will secrete the peptide out of the cell to make it available for antibody formation and methods to create adenoviral vaccines such that the adenoviral particles are replication non-competent and can be cultured to remain replication non-competent by making candidates incapable to generate a viable replication competent adenovirus by homologous recombination.
In summary, our DNA constructs will be essential in controlling and eliminating the Covid-19 disease, by virtue of diagnosis, prevention and treatment of the disease and the methods associated can be used in creation of vaccines against many other diseases.
Severe acute respiratory syndrome (SARS) emerged as a new disease threat in late 2002 and spread to several countries with considerable loss of life (8096 cases, 774 deaths). The etiological agent in the first outbreak was SARS Coronavirus- 1 (Cov-1). Coronaviruses can infect respiratory, gastrointestinal, hepatic and nervous systems of humans, birds, mice, livestock, bats and many other animals. The Severe Acute Respiratory Syndrome (SARS) outbreak of 2002 and Middle East Respiratory Syndrome (MERS) of 2012 outbreaks gave us warning of ‘animal to human’ and ‘human to human’ transmission of newly emerging coronaviruses. During late 2019, a severe respiratory disease was reported in the city of Wuhan, Hubei Province, China. This disease was named Covid-19 and was caused by another strain of Coronavirus; SARS Cov-2. At the time of writing this General Investigation Plan (GIP), there are at least 169,000 confirmed cases of Covid-19, with more than 7000 fatalities, across over 122 countries, where developed countries like United States (US), France and Italy are attempting or struggling to control further spread of the Cov-2 virus. Such catastrophic spread could wreak havoc in densely populated countries like India, Japan, or UK, stress the healthcare infrastructure in the developing world, and bring economic movement to a halt. It is essential under such circumstances that preventive measures to stop the development of this disease be undertaken under a war-room scenario.
The coronaviruses causing SARS of 2002 or Covid-19 are single-stranded positive sense RNA virus, whose genome encodes nonstructural replicase polyprotein (rep), and structural proteins such as Spike (S), envelope (E), membrane (M) and nucleocapsid (N).
Phylogenetic analysis of the viral genome revealed that the Cov-2 was closely related to a group of SARS-like coronaviruses (genus Betacoronavirus, subgenus Sarbecovirus). These viruses were previously sampled from bats in China.
The complete genome of SARS Cov-2 (Wuhan) has been analyzed after collecting broncho-alveolar lavage from one patient who exhibited the SARS from Cov-2. SARS Cov-2 (causing Covid-19) virus is not very different from SARS Cov-1 that caused the outbreak in year 2002/2003. What is significantly different with this virus is its high infectivity and relatively lower fatality rate. Our own comparisons of the two viruses for their sequences in the specific receptor binding domain as well as others have shown that the virus has significant amino acid sequence similarity (overall region in the RBD- similarity 83% and 50% similarity in the Receptor binding motif). Antibodies induced by anti-SARS vaccines can cross-neutralize bat SARS-like coronaviruses. There is a strong suggestion that there is cross-protection of using SARS-CoV1 RBD as the antigen against SARS-CoV-2. The RBD domain of the Coronavirus binds the Angiotensin Convertase Enzyme receptor 2 (ACE2) which leads to the infection of cells in the respiratory as well as gastrointestinal tracts, hence the use of RBD as an antigen for vaccines will provide neutralizing antibodies which are essential for a vaccine to be successful.

OBJECT OF THE INVENTION:
The primary object of the invention is to provide compositions of DNA constructs either used alone or in combination to provide prevention, diagnosis and treatment of Covid-19.
Yet another object of the present invention is to provide composition of DNA constructs for vaccination against covid-19.
Yet another object of the present invention is to provide DNA constructs to be used for preparing an adenoviral vaccine against covid-19.

SUMMARY OF THE INVNETION:
Before the present invention is described, it is to be understood that the present invention is not limited to specific methodologies and materials described, as these may vary as per the person skilled in the art. It is also to be understood that the terminology used in the description is for the purpose of describing the particular embodiments only and is not intended to limit the scope of the present invention.
The present invention discloses composition of constructs of modified DNA sequences and method of preparation of vaccine candidates using adenoviral vectors and constructs of modified DNA sequences against covid-19. Two vaccine candidates are mainly described in the patent application; one is a serotype 5 adenoviral vaccine and another is a Serotype Chimpanzee 68 adenoviral vaccine. No serotype can be patented just as no species of animals or plants can be patented. Because an entire serotype of a Virus cannot be patented, in this invention, we apply to patent the use of DNA modifications and novel use of multiple coronavirus epitopes in a single viral particle for intranasal, oral as well as intramuscular use in the form of a Serotype 5 or Serotype 68 adenoviral vaccine expressing such epitopes by virtue of modified sequences of RBD or S1 subunit alone or in combination.
The invention relates to the compositions of DNA constructs of SEQ ID NO: 1 to 5 for use in the prevention of Covid-19 in humans as well as animals.
The invention relates to the compositions of DNA constructs of SEQ ID NO: 6 and 7 which are the complete genome sequences of two adenoviral vaccine candidates successfully developed based on the sequences described 1 to 5.
The invention relates to the compositions of DNA constructs of SEQ ID NO: 8,9,10,11,12,13,14 and 15 which are the plasmid sequences used for the creation of two adenoviral vaccine candidates. These plasmids were used in creating the whole genome sequences Sequence 6 and Sequence 7.
The invention relates to the compositions of DNA constructs of SEQ ID NO: 16 which is the plasmid sequence used for the creation of adenoviral vaccine candidate against the South African variant strain B.1.351.
The said composition of constructs of DNA sequences comprise of at least 6 different important functional components as follows:
a) S1 subunit of the S protein or RBD domain of the S protein; for vaccination.
b) S1 subunit of the S protein or RBD domain of the S protein both tagged with an adjuvant peptide; for vaccination.
c) S1 subunit of the S protein or RBD domain of the S protein or multiple proteins of SARS Co-2 for vaccination or all such proteins tagged with a FLAG peptide for confirmation of expression in a quick manner or for potential diagnostic use;
d) use of specific DNA sequences in combination such that the size of an adenoviral vaccine genome will exceed the packaging capacity in case of homologous recombination event during expansion of virus in HEK-293 cells during manufacturing; where one sequence is naturally occurring variant of the RBD or S1 subunit, another sequence is codon-optimized version of the RBD or S1 subunit and third sequence is also a variant of the RBD or S1 subunit sequence such that none of the three sequences share a length over 20 to 30 bp which would increase the chance of homologous recombination within the added sequences.
e) specific sequences of Chimpanzee Serotype 68 adenovirus such that they include minor sequences of serotype 5 adenovirus and include a variation of above mentioned one to three sequences of the coronavirus.
f) RBD and or S1 subunit sequences where the natural signal peptide is replaced by a synthetic signal peptide such that the antigen is secreted out of the cells and is made available for antibody generation and or a Foldon domain is attached at the 3’ terminal of the coding region so that a trimer is formed after ribosomal synthesis of the peptide.
For the preventive measures, the primary mode of delivery of therapeutic targets would be an adenoviral delivery or adeno-associated delivery that could be easily provided by intranasal or parenteral (subcutaneous or intramuscular) delivery of a replication-incompetent adenoviral vehicle that can be produced by any of the available platforms. Adeno-associated viruses are used when long term immunity is expected to be delivered. For a country with limited resources and enormous population burden (e.g. India, Bangladesh or countries in Asia and Africa) in our opinion, an adenoviral vector platform is very useful because it can be quickly switched to a replication competent format, and can be of high value in case of need of vaccination to a very large population where the capacity to produce individual doses could become a severe bottleneck.

BRIEF DESCRIPTION OF THE DRAWINGS:
The present invention, together with further objects and advantages thereof, is more particularly described in conjunction with the accompanying drawings in which:

Figure 1 is a diagrammatic representation of the DNA construct of SEQ ID NO: 1 carrying an optimized codon sequence of receptor binding domain (RBD) of SARS Cov-2 for expression via adenoviral or lentiviral or adeno-associated viral or minicircles delivery;

Figure 2 is a diagrammatic representation of the DNA construct of SEQ ID NO: 2 carrying an optimized codon sequence of predicted S1 subunit of S Protein for expression via adenoviral or lentiviral or adeno-associated viral or minicircles delivery;

FIG.3 is a diagrammatic representation of the DNA construct of SEQ ID NO: 3 carrying a triplicate of Optimized RBD Epitope for expression via lentiviral, adenoviral or adeno-associated viral delivery or minicircle delivery; the second and third repeat of the sequence is optimized separately from the first repeat such that the sequences are not exact repeats of themselves. Thus, the DNA sequence is not an exact repeat but the translated proteins will be exact repeats of the RBD epitope (due to Optimizing the sequence).

FIG.4 is a diagrammatic representation of the DNA construct of SEQ ID NO: 4, carrying an optimized codon sequence of receptor binding domain (RBD) of SARS Cov-2 and adjuvant peptide that would separate and get secreted to the extracellular space after translation, both for expression via lentiviral, adenoviral or adeno-associated viral delivery or minicircle delivery;

FIG.5 is a diagrammatic representation of the DNA construct of SEQ ID NO: 5 carrying an optimized codon sequence of receptor binding domain (RBD) of SARS Cov-2 and an optimized codon sequence of predicted S1 subunit of S Protein of SARS Cov-2 for expression via lentiviral, adenoviral or adeno-associated viral delivery or minicircle delivery; both peptides (RBD and S1 subunit) get separated and secreted into extracellular space after translation

FIG.6 shows predicted 3-D structures for SARS Cov-1 epitope, SARS Cov-2 epitope and vaccine epitope RBD; the three epitopes are seen having similar 3-D structure

FIG.7 shows alignment of RBD domains from SARS Cov-2 and SARS Cov-1 (labeled as Cov-2 and Cov-1) with the rectangles showing specific sites that have been shown to generate neutralizing antibodies against the SARS Cov-1 virus;

FIG. 8 shows the Western Blot assay expression results of the RBD protein expressed from the natural sequence detected in HEK-293 cell culture supernatant with help of a FLAG epitope under reducing conditions (only a monomer in Lane 1 and Lane 2) and under non-reducing conditions (monomer, and faint bands of dimer and trimer in Lane 3).

FIG. 9 shows the Western Blot assay expression results of the RBD protein expressed from the codon-optimized sequence detected in HEK-293 cell culture supernatant with help of a FLAG epitope under reducing conditions (only a monomer in Lane 2 and Lane 3) and under non-reducing conditions (monomer, and faint bands of dimer and trimer in Lane 5).

FIG. 10 shows the Western Blot assay expression results of the S1-FD protein expressed from the codon-optimized sequence detected in HEK-293 cell culture supernatant with help of a FLAG epitope under reducing conditions (only a monomer in Lane 1 and Lane 2) and under non-reducing conditions (monomer, and strong bands of dimer and trimer in Lanes 3 and 4).

FIG. 11 shows the map of ANS06 Serotype 5 adenoviral candidate vaccine genome.

FIG. 12 shows the map of ANS12 Serotype Chimpanzee 68 adenoviral candidate vaccine genome.

FIG. 13 shows plasmid pAD1127-ANS05 with EF1a-RBD cassette in place of the E1 region; where the RBD sequence is tagged with a synthetic signal peptide for secretion of the antigen outside the cells.

FIG. 14 shows the backbone pAD1128 plasmid for the Serotype 5 adenovirus with wild-type Ad5 E2 and late genes.

FIG. 15 shows the plasmid pAD1129-ANS10 with CMV-S1FD cassette in place of the E3 region and RSV-OPT-RBD cassette between the L5 and E4 poly A signals used for the creation of Ad-ANS06 tricistronic serotype 5 adenoviral vaccine candidate; where the RBD sequence is codon-optimized and natural signal peptide is replaced by synthetic signal peptide and S1 subunit sequence still carries the natural signal peptide sequence but is attached to a Foldon trimerization domain at the 3’ end.

FIG. 16 shows pAD1130 plasmid with E4 genes, this is one of the plasmids used in the creation of adenoviral vaccine candidate ANS06.

FIG. 17 shows the restriction enzyme digest confirmation of genomic map of the cosmid created for the ad-ANS06 genome.

FIG. 18 shows Results of Western Blot Assay for created adenoviral candidate vaccine ANS06 in HEK-293 cells (confirmation of antigen expression of the actual vaccine candidate created from the plasmids) where all lanes showed antigen in monomeric, dimeric and trimeric forms (marked within oval shapes).

FIG 19 shows Results of RCA assay showing no replication competent viral particles for both Ad-ANS06 and Ad-ANS12.

FIG. 20 shows plasmid pAD1144-ANS15 with CMV-codon optimized RBD cassette in place of the E1 region used for the creation of chimpanzee adenoviral candidate Ad-ANS12.

FIG. 21 shows plasmid pAD1145 used for the creation of chimpanzee adenoviral candidate Ad-ANS12.

FIG. 22 shows plasmid pAD1146 used for the creation of chimpanzee adenoviral candidate Ad-ANS12.

FIG. 23 shows plasmid pAD1147 used for the creation of chimpanzee adenoviral candidate Ad-ANS12.

FIG. 24 shows the restriction enzyme digest confirmation of genomic map of the cosmid created for the chimpanzee adenoviral candidate Ad-ANS12.
FIG. 25 shows the map of the first plasmid pAD1129-ANS10-modified with DNA sequence created for vaccination against the South African strain B.1.351 which carries mutations from both UK and South African Strain (mutations shown in the black box);

FIG. 26 shows the map of the S1 subunit sequence with a Foldon trimerization domain attached at the 3’ end.

FIG. 27 shows the map of the natural sequence of the RBD domain.

FIG. 28 and FIG. 29 show the groups of rats used in the animal study where the two vaccine candidates ANS06 and ANS12 were tested.

FIG. 30, FIG. 31 and FIG. 32 show the results of detection of SARS-CoV-2 antibodies by bio layer interferometry in the rat sera vaccinated with the candidate vaccines in the animal studies. The curves show that high rate of antigen antibody binding was present in the sera of the tested rats.

DETAILED DESCRIPTION OF THE INVENTION:
The disclosure has been described with reference to the accompanying embodiments which do not limit the scope and ambit of the disclosure. The description provided is purely by way of example and illustration.
The foregoing description of the specific embodiments so fully revealed the general nature of the embodiments herein that others can, by applying current knowledge, readily modify and/or adapt for various applications such specific embodiments without departing from the generic concept, and, therefore, such adaptations and modifications should and are intended to be comprehended within the meaning and range of equivalents of the disclosed embodiments. It is to be understood that the phraseology or terminology employed herein is for description and not of limitation. Therefore, while the embodiments herein have been described in terms of preferred embodiments, those skilled in the art will recognize that the embodiments herein can be practiced with modification within the scope of the embodiments as described herein.
Throughout this specification, the word “comprise”, or variations such as “comprises” or “comprising”, will be understood to imply the inclusion of a stated element, integer or step, or group of elements, integers or steps, but not the exclusion of any other element, integer or step, or group of elements, integers or steps. The use of the expression “at least” or “at least one” suggests the use of one or more elements or ingredients or quantities, as the use may be in the embodiment of the disclosure to achieve one or more of the desired objects or results.
The present invention discloses novel compositions of constructs of modified DNA sequences (SEQ ID NO: 1-18) administered via adenoviral, adeno-associated viral, lentiviral or minicircle delivery either alone, or in combination, for prevention or treatment of Covid-19 disease. The compositions of the said constructs of the modified DNA sequences as described in the present invention for preventive of diseases do not necessarily need a specific promoter or a specific plasmid for the delivery and expression.
In one embodiment of the present invention, the first DNA cassette SEQ ID NO: 1 Receptor Binding Domain of the SARS Cov-2 is constructed and administered via vehicles such as minicircle, adeno-associated virus or adenovirus., such that it would generate immunity against the SARS Cov-2. When this optimized SEQ ID NO: 1 Receptor Binding Domain sequence is delivered via adenoviral particles intranasal, oral (mucosal), as well as systemic immunity is expected to be generated and provide protection against the development of Covid-19 disease.
In another embodiment of this invention, the vaccination via adenoviral viral vector is also enhanced because of presence of a synthetic signal peptide replacing the natural signal peptide associated with the RBD domain which gets released into extracellular space after translation due to the presence of synthetic signal peptide.
The DNA cassettes described in various embodiments of the invention are delivered preferably via intranasal-mucosal route, mucosal route intranasally or, orally, or via other routes mainly subcutaneously or intramuscularly by use of any of the delivery systems used for gene delivery namely adenoviral, adeno-associated viral (AAV), lentiviral systems or minicircles. The adenoviral, AAV or minicircles gene delivery systems are preferred for the episomal expression of the genes in the DNA cassette. Lentiviral delivery systems are preferred for the genetic expression of the genes in the DNA cassette especially when the transduction is conducted in the in-vitro fashion and the cells are reintroduced into the patient’s body.
The different embodiments of the invention are mentioned below. However, different combinations of these constructs can be made and administered by replacing the epitopes for a specific virus or specific promoter for controlled or constitutive expression of described peptides.
The present invention discloses compositions of constructs of modified DNA sequences of constructs of modified DNA sequences/ DNA cassettes (Seq. 1 to Seq. 18) encoding the Kozac sequence for increasing the expression of the epitope, codon-optimized gene sequence of the RBD epitope followed by a stop codon under expression control of any promoter, e.g. CMV promoter, EF1 promoter or RSV promoter. The RBD epitope is preserved among the SARS Cov-1 and SARS Cov-2, as shown in FIG. 6 and FIG. 7. Also as seen in FIG. 7, the rectangle marked epitopes are not only highly conserved but also generate neutralizing antibodies. The RBD protein 3-D structure also shows conservation across SARS Cov-1 and SARS Cov-2. The chosen vaccine epitope also shows the same 3D structure which would be essential for generation of same neutralizing antibodies. The RBD protein 3-D structure also shows conservation across SARS Cov-1 and SARS Cov-2. The chosen vaccine epitope also shows the same 3D structure which would be essential for generation of same neutralizing antibodies. The adenoviral delivery of RBD epitope is a preferred way for vaccine because RBD can generate neutralizing epitopes, adenoviral particles can provide the mucosal immune response against the viruses like SARS Cov-2 along with the systemic immune response.
In another embodiment of the invention, S1 subunit of the S protein is used instead of RBD as the vaccine epitope. Hence the codon optimized sequence of S1 subunit is used for the generation of antibodies whether alone (FIG. 2) or in combination with RBD epitope (FIG. 5) and preferably tagged with Foldon Domain (FIG. 26).
In another embodiment of this invention, the vaccination via adenoviral viral vector is also enhanced because of presence of a Foldon trimerization domain at the end of the S1 subunit such that the S1 subunit forms a trimer and generates high quality antibodies after translation due to the presence of Foldon domain (FIG. 26).
In another embodiment of the invention (shown in FIG. 25), the DNA sequence is modified to reflect certain mutations in the virus such that a vaccine can be created against the South African variant B.1.351. These Sequence variations are described below:
Plasmid pAD1129-ANS10 sequence modifications:

i. 6403 G to C
ii. 1233 G to C
iii. 2130-2133 CTG to CAC
iv. 2142-2144 AGA to ATC
v. 2655-2657 AAA to AAC
vi. 2856-2858 GAA to AAG
vii. 2907-2909 AAC to TAC
In another embodiment, Ad-ANS06 the vector (shown in FIG. 11 as Ad-ANS06b) is designed such that the genome size (of 36.2 KB) becomes unpackageable to produce replication competent virus particles in case homologous recombination occurs in the HEK-293 cells (genome size would become over 38 KB if homologous recombination occurs and thus becomes unpackageable). Thus, this invention eliminates the need of specialized culture cells for production of adenoviral vaccines if the same method can be used for insertion of multiple antigens in the same viral genome. Another advantage this embodiment offers is to provide means of expressing multiple copies of genes or different genes at the same time by use of the same viral particle.
In yet another embodiment, Ad-ANS12 candidate vaccine (shown in FIG. 12 ) was created by using a Chimpanzee adenoviral genome and few small sequences from serotype 5 adenovirus such that, it contains only one sequence of receptor binding domain to express the RBD epitope to generate immunogenicity in the vaccinee. The invention does not patent the serotype itself as a species of organism cannot be patented, however the use of serotype for expression of RBD 193 Covid 19 epitope is being described as a novel embodiment for intranasal use.
The present invention has many advantages as follows:
1) Generation of mucosal immune response against the RBD domain of the SARS Cov-2 when used via an adenoviral vector. The immunity generating neutralizing antibodies against the RBD domain are extremely important because the SARS Cov-2 virus uses the RBD domain to bind ACE2 protein. Once the RBD is associated with ACE2, then the virus S protein transmembrane portions fuse with the cell membrane, giving entry into the cell. The route of entry of Coronavirus is mucosal (through respiratory as well as gastrointestinal tracts) hence the mucosal immunity provided by our vaccine candidates is of critical importance.
2) Antibodies generated against RBD and S1-subunit are mainly neutralizing type and are not expected to lead to antibody mediated disease enhancement.
3) Signal peptide used in the DNA constructs enhances the secretion of the antigen in the extracellular space making it available for the generation of antibodies.
4) The S1 subunit trimerizes due to Foldon domain and thus provides high quality antibodies for protective immunity against the disease.
5) The developed adenoviral vaccine candidates can be used for intranasal as well as intramuscular delivery. Intranasal delivery requires much smaller dose and generates the best quality of antibodies (IgA mucosal antibodies) that are required for blocking the entry of a respiratory pathogen. In another advantage, vaccines given by the intramuscular route may lead to thrombosis and intranasal route eliminates or minimizes this risk completely.
6) Immunity provided against the South African variant and other variants is also of critical essence as described in one embodiment, the vaccine candidate contains the S1 subunit sequence with the mutations present in the variants and thus provides mucosal immunity against these variants.
7) Producing a tricistronic adenoviral vaccine candidate is advantageous such that because of use of natural and codon-optimized sequences in the same viral genome, the protein production (antigen production) is enhanced and yet chances of homologous recombination are minimized.
8) Another major advantage of the invention is that the adenoviral candidate vaccine Ad-ANS06 does not need a special cell line for its manufacturing even though it is of Serotype 5, where the DNA sequence is used to create an adenoviral vaccine of Serotype 5 type, in such a way that the genomic size of adenovirus prevents the viable homologous recombination and thus prevents inadvertent production of replication competent adenoviral particles, which is a major limiting factor in production of adenoviral vaccines in HEK cell line. United States Food and Drug Administration (USFDA) requires that there should be less than 1 replication competent adenoviral particles in 3x10e10 viral particles (vp) for human use. Although other health authorities including Indian FDA may require less than 1 replication competent particle per dose, in both instances the current embodiment of Serotype 5 adenoviral candidate is useful (Example-1).
9) Invention offers another advantage by creating an adenoviral vaccine candidate with Chimpanzee adenoviral serotype 68 in another embodiment, described below in example 2 (an adenoviral candidate vaccine Ad-ANS12), where the candidate vaccine was created using the said DNA sequence in such a way that the vector comprised of Chimp adenovirus type 68 carrying small type 5 adenoviral sequences. In this embodiment, an advantage is such that it prevents inadvertent production of replication competent adenoviral particles as homologous recombination is not possible between the genome of chimp adenovirus type 68 and adenoviral genes inserted in the Human Embryonic Kidney (HEK) cell line.

The HEL cells are used for the manufacturing of adenoviral vaccines since a long time and homologous recombination has been a challenge for the production of vaccines, the approach of the present invention to produce both the vaccine candidates eliminates this challenge as described in example 1 and example 2 due to novel composition of DNA constructs.

EXAMPLES
To further elucidate the mechanism of the invention, two examples are described here for multiple candidate vaccine preparation. The methodology for using the said DNA sequences for the creation of vaccine candidates is described below in brief.
In first example the three DNA sequences [first sequence with Coronavirus S1 subunit tagged with Foldon domain (S1-FD) (FIG. 2 without FD and FIG. 26 with FD) is as in Sequence 17)), second sequence with natural RBD sequence (FIG. 27 and as in Sequence 18) and the third sequence codon-optimized RBD sequence (FIG. 1 and as in Sequence 1)) were used by T4 ligation where a cosmid viral genome (as shown in FIG. 11 and Sequence 6) was produced from four plasmid constructs to create a vaccine candidate called as ANS06 (See Fig. 11, shown as Ad-ANS06b) which has a Serotype 5 Adenovirus genome and which would be expressing Receptor Binding Domain and S1 protein with trimerization Foldon domain. The Foldon domain sequence comprises of 27 amino acid (81 nucleotides) length C-terminal sequence from T4 bacteriophage. This Foldon sequence trimerizes any peptide it is attached with. The S glycoprotein of Coronavirus being a trimer, S1 subunit when in trimerized form produces not only antibodies to epitopes that are available on single chain but also those three-dimensional epitopes that are available only in the trimeric form.

In second example, a codon-optimized single copy of RBD DNA sequence (FIG. 1 and Sequence 1) was used to create a vaccine candidate called as Ad-ANS12 (see FIG. 12) which is a Serotype 68 Chimpanzee Adenovirus with a few Serotype 5 adenovirus sequences while carrying a Codon-Optimized sequence of the Receptor Binding Domain. The process again involves use of four construct plasmids which are combined by T4 ligation to create a cosmid viral genome sequence as shown in FIG. 12.
Sequences for Receptor Binding Domain (193 aa) and S1 subunit of the Spike glycoprotein of the coronavirus bound to a Foldon domain were synthesized and tested for expression in HEK cells. FIG. 8 shows expression of RBD protein from a plasmid with natural sequence of RBD. FIG. 9 shows expression of RBD protein from a plasmid with codon-optimized sequence of RBD. FIG. 10 shows expression of S1 subunit protein bound to a Foldon tag by use of a plasmid with codon-optimized sequence of S1-FD. These three sequences were then inserted into plasmids that were used for the creation of cosmids (genomes for adenoviral candidate vaccines).

In yet another embodiment of the present invention is described the method of preparation, characterization and testing of the candidates ANS06 and ANS12 as vaccine against covid-19 using SEQ-1 to SEQ-18.
A.) Method to produce and test the Candidate Adenoviral vaccine using the DNA sequences consists the steps of;
1. Construction of the adenoviral candidate vaccines which includes the steps of:
a. Creation of shuttle plasmids,
b. Cosmid Construction,
c. Rescue,
d. Amplification, and
2. Characterization of the candidate vaccine which includes the steps of:
i. Genome Restriction Analysis,
ii. Physical titer,
iii. Infectious titer,
iv. VP/ IU ratio,
v. Genome sequencing,
vi. Transgene expression,
vii. RCA assay.
Example 1:
Construction of candidate vaccine ANS06; a serotype 5 Adenoviral vaccine candidate with three gene inserts for more expression, where one gene sequence is of S1 subunit of the S glycoprotein tagged with FD domain, and two sequences are codon optimized sequence of the receptor binding domain (RBD) and natural sequence of the RBD.

AD-ANS06:
1. Construction of the adenoviral candidate vaccines:
a. Creation of shuttle plasmids: Four plasmids were created for creation of ANS06.
i. pAD1127-ANS05 (see FIG. 13) (which has EF1a promoter driving the expression of natural RBD sequence leading to expression of 193 amino acids).
ii. pAD1128 (see FIG. 14) such that pAd1128 is a shuttle plasmid that contains WT Ad5 E2 and late genes.
iii. pAD1129-ANS10 (see FIG. 15) (which has RSV promoter driving the expression of codon-optimized RBD sequence leading to expression of 193 amino acids).
iv. pAD1130 (see FIG. 16) pAd1130 is a shuttle plasmid that contains the WT Ad5 E4 region.

The importance of presenting natural as well as codon-optimized sequences of antigen provides multiple advantages:
i. it increases the size of the final adenoviral genome such that it is incapable of producing replication competent adenoviral particles, because after homologous recombination the packaging capacity would be surpassed.
ii. it increases the expression of the antigen without creating a self-repeating DNA sequence within the plasmid.
iii. It eliminates any uncertainty whether natural or codon-optimized sequences should be used for antigen expression as both sequences are present.
Another advantage of the present invention is that the S1 subunit and RBD subunit both are available for creation of antibodies against the antigenic epitope.
b. Cosmid Construction Ad-ANS06:
The entire genome of tricistronic virus Ad-ANS06 was reconstituted in a cosmid using the four shuttle plasmids mentioned above namely; pAD1127-ANS05 (E1/pIX shuttle), pAD1128 (E2 shuttle), pAD1129-ANS10 (E3/ fiber shuttle) and pAD1130 (E4 shuttle). These four plasmids were used to create a cosmid with restriction enzyme digestion and ligation with T4 DNA ligase. The ligation product was packaged into lambda phage heads which were subsequently used to infect competent E. Coli. E. coli were selected with the help of ampicillin and kanamycin selection and cosmid DNA was purified using the alkaline lysis method and confirmed with restriction enzyme digestion to be correct. Ad5-based tri-cistronic vector with a EF1a-RBD cassette in place of the E1 region (see figure 13), a CMV-S1FD cassette in place of the E3 region (see FIG. 26 and FIG. 15), and an RSV-OPT-RBD cassette between the L5 and E4 polyA signals (see FIG. 15). All 3 cassettes (placed in two plasmids overall during the creation of AD-ANS06; pAD1127-ANS05 carrying EF1a-RBD cassette and pAD1129-ANS10 plasmid carrying CMV-S1FD and RSV-OPT-RBD cassettes) feature ATG triplets upstream of the initiator codon of interest which reduces the efficiency of expression. A vector where there were no ATG triplets upstream of the initiator codon could not produce a viable candidate potentially due to interference of the expressed proteins with the candidate production, hence the extra ATG triplets were maintained for a little inefficiency in expression.
c. Rescue:
i. Transfection: Two 6-cm dishes of 293 cells were transfected with PacI-digested pAd5-ANS06 using the calcium phosphate-DNA co-precipitation method. Ad5.CMV-GFP DNA (a known GFP insert) was used as positive control. Cells were rinsed twice with DMEM about 12 hours after the transfection.
ii. Harvest: Virus plaque harvest (day 11 post-transfection) was conducted when the first plaque was detected in one of the dishes of the HEK293 cells transfected with pAD5-ANS06; four plaques were harvested.
d. Amplification:
i. Pre-amplification (first round of expansion): A confluent 15-cm dish of 293 cells was split into 6-cm dishes at 30% confluence. The dishes were infected directly with Ad-ANS06 plaques #1-2-3-4 harvested earlier. On day 4 post-infection, the dish of 293 cells infected with Ad-ANS06 clone 3 showed complete cytopathic effect (CPE). Cells and medium were harvested, frozen/thawed three times (3x), clarified by centrifugation and aliquoted into sterile 1-mL vials. On day 6 post-infection, the dishes of 293 cells infected with Ad-ANS06 clones 1,2 and 4 showed complete CPE. Cells and medium were harvested, frozen/thawed 3x, clarified by centrifugation and aliquoted into sterile 1-mL vials.
ii. Amplification (second round of expansion): Confluent 10-cm dishes of 293 cells were infected with the crude lysates of Ad-ANS06 clones harvested. On day 3 post-infection, all dishes showed strong CPE. Cells and medium were harvested in the following way. 1.5 mL infected cell suspension was centrifuged for 2 min at 3,000 rpm, RT. The cell pellets were washed twice with PBS, then frozen at -70°C. These cell pellets were used for Western Blot testing for expression studies (for both candidate vaccines). Viral DNA (vDNA) was extracted from 4 mL infected cells suspension following the Hirt method. The remaining infected cell suspension was frozen/thawed 3x, clarified by centrifugation and aliquoted into sterile 1-mL vials.

2. Characterization of the candidate vaccine:
i. Genome Restriction Analysis: vDNA was extracted from Ad-ANS06-infected 293 cells according to the Hirt method. The DNAs were resuspended into 50 µL TE pH 7.5. The identity of the virus was confirmed by restriction digestion with HindIII, Acc65I and SpeI (5 µL DNA per lane) (see Fig 17). All 3 clones show identical restriction patterns, similar to the cosmid DNA restriction pattern. This indicate that the virus is stable. The presence of the 4155 bp HindIII fragment, 1313 bp Acc65I fragment and the 1024 bp SpeI fragment demonstrates the presence of the EF1a-RBD expression cassette in the vector. The presence of the 3982 bp and 2849 bp HindIII fragments, the 3321 bp and 2250 bp Acc65I fragments and the 3747 bp SpeI fragment demonstrates the presence of the CMV-S1FD expression cassette in the vector. The presence of the 4149 bp HindIII fragment, the 4353 bp Acc65I fragment and the 1193 bp SpeI fragment demonstrates the presence of the RSV-OPT-RBD expression cassette in the vector.
ii. Physical titer: The OD260-SDS method was used to determine the concentration of virus particles in the purified stocks of Ad-ANS06. The concentration of VP in the preparations was calculated given the extinction coefficient of 1.1 x 10e12 virus particles (VP) per Abs260 unit in presence of SDS. Ad-ANS06 physical quantity from one batch was calculated as 1.4 x 10e13 at a concentration of 1.6 x 10e12 vp/ml.
iii. Infectious Titer: Titration of the ANS06 adenovirus was conducted by using the hexon detection immune-histochemistry using an Adeno-X Rapid Titer kit. The CsCl-purified virus stock of Ad-ANS06 was diluted 10-fold serially in DMEM/FBS (10e1 to 10e6). The 293 cells from one 15-cm dish (passage 44) were trypsinized, washed once in DMEM/FBS and resuspended in 30 mL DMEM/FBS. 300 µL of cell suspension were added to tubes containing 50 µL of virus dilutions 10e3 to 10e6. The infected cells were then transferred to a well of a 24-well plate. After 3 days culture at 37 °C, the infected cell monolayers were fixed with ice-cold methanol, stained with an anti-Ad5 hexon primary antibody, a HRP-conjugated secondary antibody and DAB as substrate. Positive cells were counted under the microscope (10x10 magnification). The infectious titer (IU/mL) was calculated using the following formula: (average # of infected cells/field) x 47.4 x dilution factor / (volume of virus used for the infection in mL) = infectious titer.
iv. VP/IU Ratio: VP/IU (viral particle/ infectious units) ratio for AD-ANS06 was calculated to be 20.
v. Genome sequencing: The entire genomes of Ad-ANS06 was sequenced by NGS on an Illumina iSEQ100 instrument.
a. vDNA purification: vDNA was extracted from purified VP of Ad-ANS06 using proteinase K. The DNA was resuspended in 30 µl TE pH 7.5. vDNA concentration of 0.48 µg/ µl from 3.9 10e12 VP/ml of stock concentration of virus.
b. The sequencing and analysis confirmed the presence of the 3 intact expression cassettes: the EF1a-RBD-ßglobin pA cassette in the E1 region, the CMV-S1FD-SV40pA cassette in the E3 region and the RSV-OPT-RBD-bGHpA cassette between the L5 and E4 polyA signals.
vi. Transgene expression:
Expression of vaccine antigen coronavirus spike glycoprotein subunit S1 was confirmed by western blot assay conducted under non-reducing and reducing conditions. Expression of the antigen was confirmed where monomeric, dimeric and trimeric forms of the S1 subunit as well as receptor binding domain were seen on the western blot (see FIG 18). Primary antibodies against the Receptor Binding Domain and S1 subunit were used to detect the protein. Results showed detectable RBD protein in the ANS06 infected cells from present from 1.17 mg/ml to 1.46 mg/ml).
vii. RCA assay: The presence of replication-competent adenovirus (RCA) in the purified preparations of Ad-ANS06 was assessed using a modified infectivity/PCR method, which combines the amplification of infectious RCA by cell culture with the sensitivity of detection of E1-specific sequences by PCR. For each construct, 10 x 15-cm dishes of A549 cells (~ 2.5 10e8 cells) were infected with 3 x 10e10 VP. Five days after the infection, the infected cells were harvested, pooled, and frozen/thawed 3 times in order to release the virus particles. New monolayers of A549 cells seeded in 10-cm dishes were infected with these crude virus lysates and cultured for another 5 days. Cells were harvested and viral DNA was purified according to the Hirt method. It was used as template for the detection of a 220 bp-long E1-specific sequence by PCR. As controls, two dishes of A549 cells were infected with a RCA-free control virus spiked with 10 and 100 VP of WT Ad5. The results showed the absence of detectable E1-specific sequence in the DNA extracted from A549 cells infected with Ad-ANS04, Ad-ANS06 and Ad-ANS12. Thus, no RCA was detected in 3 x 10e10 VP of the purified preparations of Ad-ANS06 (see Fig 19).

Animal Study: The candidate vaccine Ad-ANS06 was tested in an animal study, dosing outline and groups of the animal study are shown in Figures 38 and 29 respectively. The candidate vaccine was given intranasally at a dose of 2x10e10 vp per dose given at day 0, day 14 and day 28. The vaccine was safe with no safety concerns revealed in rats. Day 28 (after 2 doses) immunogenicity results showed presence of neutralizing antibodies against the Coronavirus as shown in FIG. 30. The figures show results of detection of SARS-CoV-2 antibodies by bio layer interferometry. The curves show that high rate of antigen antibody binding was present in the sera of the tested rats.

Example 2:
Construction of candidate vaccine ANS12; an Adenoviral vaccine candidate comprised of chimpanzee serotype with small serotype 5 sequences, with single gene insert with codon-optimized sequence of the receptor binding domain (RBD) for more expression, is prepared.
AD-ANS12:
1. Construction of the adenoviral candidate vaccines:
a. Creation of shuttle plasmids: Four plasmids were created for creation of ANS12.
i. pAD1144-ANS15 (E1/pIX) (see FIG 20) which has CMV promoter driving the expression of codon-optimized RBD leading to expression of 193 amino acids
ii. pAD1145 (see FIG 21) (E2/ late genes)
iii. pAD1146-01 (see FIG 22) (E3/ fiber genes) with 4.4 kb deletion in E3 gene
iv. pAD1147 (see FIG 23)
The importance of codon-optimized sequence of antigen provides an advantage because of creation of only neutralizing antibodies against the receptor binding domain of the coronavirus.
b. Cosmid Construction Ad-ANS12:
The entire genome of Ad-ANS12 was reconstituted in a cosmid using the four shuttle plasmids mentioned above namely; pAD1144-ANS15 (E1/pIX shuttle), pAD1145 (E2/late shuttle), pAD1146-01 (E3/ fiber shuttle) and pAD1147 (E4 shuttle). These four plasmids were used to create a cosmid with restriction enzyme digestion and ligation with T4 DNA ligase. The ligation product was packaged into lambda phage heads which were subsequently used to infect competent E. Coli. E. coli were selected with the help of ampicillin and kanamycin selection and cosmid DNA was purified using the alkaline lysis method and confirmed with restriction enzyme digestion to be correct.
c. Rescue:
i. Transfection: Two 6-cm dishes of 293 cells were transfected with PacI-digested pAd5-ANS12 using the calcium phosphate-DNA co-precipitation method. Ad5.CMV-GFP DNA (a known GFP insert) was used as positive control. Cells were rinsed twice with DMEM about 12 hours after the transfection.
ii. Harvest: First plaque was detected on day 5 after the transfection. Virus plaque harvest (day 10 post-transfection) was conducted from the dishes of the HEK293 cells transfected with pAD5-ANS12; four plaques were harvested.
d. Amplification:
i. Pre-amplification (first round of expansion): A confluent 15-cm dish of 293 cells was split into 6-cm dishes at 30% confluence. The dishes were infected directly with Ad-ANS12 plaques #1-2-3-4 harvested earlier. On day 6 post-infection, the dish of 293 cells infected with Ad-ANS12 showed complete cytopathic effect (CPE). Cells and medium were harvested, frozen/thawed three times (3x), clarified by centrifugation and aliquoted into sterile 1-mL vials.
ii. Amplification (second round of expansion): Confluent 10-cm dishes of 293 cells were infected with the crude lysates of Ad-ANS12 clones harvested. On day 2 post-infection, all dishes showed strong CPE. Cells and medium were harvested in the following way. 1.5 mL infected cell suspension was centrifuged for 2 min at 3,000 rpm, RT. The cell pellets were washed twice with PBS, then frozen at -70°C. These cell pellets were used for Western Blot testing for expression studies (for both candidate vaccines). Viral DNA (vDNA) was extracted from 4 mL infected cells suspension following the Hirt method. The remaining infected cell suspension was frozen/thawed 3x, clarified by centrifugation and aliquoted into sterile 1-mL vials.

2. Characterization of the candidate vaccine:
i. Genome restriction analysis: vDNA was extracted from Ad-ANS12-infected 293 cells according to the Hirt method. The identity of the virus was assessed by restriction digestion with MfeI, AflIII and XcmI (see FIG. 24). The insertion of the 5’ UTR-optimized CMV-OPT-RBD cassette in the virus is demonstrated by the presence of the 1249- and 2634-bp MfeI fragments, the 1353- and 3020-bp AflIII fragments and the 1224- and 1675-bp XcmI fragments (green bars in the gel pictures) (see Fig 29). All 3 clones show identical restriction patterns, which indicates that the virus is stable.
ii. Physical titer: The OD260-SDS method was used to determine the concentration of virus particles in the purified stocks of Ad-ANS12. The concentration of VP in the preparations was calculated given the extinction coefficient of 1.1 x 10e12 virus particles (VP) per Abs260 unit in presence of SDS. Ad-ANS12 physical titer from one batch was calculated as 1.1 x 10e13 at a concentration of 2.7 10e12 vp/ml.
iii. Infectious Titer: The concentration of infectious particles in the purified stocks of Ad-ANS12 was determined by end-point dilution assay (TCID50), using virus growth as indicator. The infectious units per ml ratio was determined to be 1 x 10e11/ml.
iv. VP/IU Ratio: VP/IU (viral particle/ infectious units) ratio for AD-ANS12 was calculated to be 27.
v. Genome sequencing: The entire genomes of Ad-ANS12 was sequenced by NGS on an Illumina iSEQ100 instrument.
a. vDNA purification: vDNA was extracted from purified VP of Ad-ANS12 using proteinase K. The DNA was resuspended in 30 µl TE pH 7.5. vDNA concentration of 0.35 µg/ µl from 2.7 x 10e12 VP/ml of stock concentration of virus.
b. The sequencing and analysis confirmed the presence of the intact CMV-OPT-RBD-SV40pA expression cassette in the E1 region.
vi. Transgene expression: Expression of vaccine antigen coronavirus spike glycoprotein subunit S1 was confirmed by western blot assay conducted under non-reducing and reducing conditions. Expression of the antigen was confirmed where monomeric, dimeric and trimeric forms of the RBD were seen on the western blot (see FIG. 18). Primary antibodies against the Receptor Binding Domain were used to detect the protein. Results showed detectable RBD protein in the Ad-ANS12 infected cells from 3.7 mg/ml to 4.48 mg/ml).
vii. RCA assay: The presence of replication-competent adenovirus (RCA) in the purified preparations of Ad-ANS12 was assessed using a modified infectivity/PCR method, which combines the amplification of infectious RCA by cell culture with the sensitivity of detection of E1-specific sequences by PCR. For each construct, 10 x 15-cm dishes of A549 cells (~ 2.5 x10e8 cells) were infected with 3 x 10e10 VP. Five days after the infection, the infected cells were harvested, pooled, and frozen/thawed 3 times in order to release the virus particles. New monolayers of A549 cells seeded in 10-cm dishes were infected with these crude virus lysates and cultured for another 5 days. Cells were harvested and viral DNA was purified according to the Hirt method. It was used as template for the detection of a 220 bp-long E1-specific sequence by PCR. As controls, two dishes of A549 cells were infected with a RCA-free control virus spiked with 10 and 100 VP of WT Ad5. The results showed the absence of detectable E1-specific sequence in the DNA extracted from A549 cells infected with Ad-ANS04, Ad-ANS06 and Ad-ANS12. Thus, no RCA was detected in 3 x 10e10 VP of the purified preparations of Ad-ANS12 (see FIG. 19).

Animal Study: The candidate vaccine Ad-ANS12 was tested in an animal study, dosing outline and groups of the animal study are shown in FIG. 28 and FIG. 29 respectively. The candidate vaccine was given intranasally at a dose of 2x10e10 vp per dose given at day 0, day 14 and day 28 and intramuscularly in a different group of animals at a dose of 3x10e10 vp per dose given at day 0, day 14 and day 28. The vaccine was safe with no safety concerns revealed in rats. Day 28 immunogenicity (after 2 doses) results showed presence of neutralizing antibodies against the Coronavirus as shown in FIG. 31 (for intranasal dose) and FIG. 32 respectively (for intramuscular dose). The figures show results of detection of SARS-CoV-2 antibodies by bio layer interferometry. The curves show that high rate of antigen antibody binding was present in the sera of the tested rats.
The embodiments herein above and the various features and advantageous details thereof are explained with reference to the non-limiting embodiments in the following description. Descriptions of well-known components and processing techniques are omitted to not unnecessarily obscure the embodiments herein. The examples used herein are intended merely to facilitate an understanding of ways in which the embodiments herein may be practiced and to further enable those of skilled in the art to practice the embodiments herein. Accordingly, the examples should not be construed as limiting the scope of the embodiments herein.
While considerable emphasis has been placed herein on the components and component parts of the preferred embodiments, it will be appreciated that many embodiments can be made and that many changes can be made in the preferred embodiments without departing from the principles of the disclosure. These and other changes in the preferred embodiment as well as other embodiments of the disclosure will be apparent to those skilled in the art from the disclosure herein, whereby it is to be distinctly understood that the foregoing descriptive matter is to be interpreted merely as illustrative of the disclosure and not as a limitation.
,CLAIMS:CLAIMS
We Claim,
1. A composition of constructs of modified DNA sequences coding specific peptides for vaccine against covid-19 and method of preparation of adenoviral vaccines thereof comprising of atleast one or a combination of components as follows;
a. S1 subunit of the S protein or RBD domain of the S protein,
b. S1 subunit of the S protein or RBD domain of the S protein both tagged with an adjuvant peptide,
c. S1 subunit of the S protein or RBD domain of the S protein or multiple proteins of SARS Co-2 for vaccination or all such proteins tagged with a FLAG peptide,
d. specific DNA sequences in combination such that the size of an adenoviral vaccine genome will exceed the packaging capacity in case of homologous recombination event during expansion of virus in HEK-293 cells during manufacturing; where one sequence is naturally occurring variant of the RBD or S1 subunit, another sequence is codon-optimized version of the RBD or S1 subunit and third sequence is also a variant of the RBD or S1 subunit sequence such that none of the three sequences share a length over 20 to 30 bp which would increase the chance of homologous recombination within the added sequences,
e. specific sequences of Chimpanzee Serotype 68 adenovirus such that they include minor sequences of serotype 5 adenovirus and include a variation of above mentioned one to three sequences of the coronavirus,
f. RBD and/or S1 subunit sequences where the natural signal peptide is replaced by a synthetic signal peptide such that the antigen is secreted out of the cells and is made available for antibody generation and or a Foldon domain is attached at the 3’ terminal of the coding region such that that a trimer is formed after ribosomal synthesis of the peptide,
wherein, composition of DNA constructs of a tricistronic adenoviral vaccine candidate of serotype 5 as shown in SEQ ID NO: 6 and FIG. 11 comprises of three DNA sequences encoding;
a.) the receptor binding domain (RBD) by using codon optimized RBD sequence (as shown in Sequence 1 and FIG. 1),
b.) natural sequence of the RBD SARS Cov-2 (as shown in Sequence 18 and FIG. 27), and,
c.) S1 subunit of Coronavirus fused with a Foldon tag (as shown in Sequence 17 and FIG. 26) formulated for intranasal, intramuscular or subcutaneous administration for prevention against covid-19, using plasmids shown in FIG. 13, FIG. 14, FIG. 15, FIG. 16 (as presented in sequences 8,9,10 and 11),
such that the adenovirus generates immunity due to virtue of secreted synthetic secretory peptide used in combiation with tall antigens such that the signal peptide is cleaved after translation and the S1 subunit and RBD are secreted in the extracellular space for the generation of neutralizing antibodies of IgA and IgG types mainly; and
wherein composition of DNA constructs of a monocistronic adenoviral vaccine of serotype Chimpanzee 68 with minor sequences from Serotype 5 as shown in SEQ ID NO: 7 and FIG. 12 comprises of; a single DNA sequence encoding the receptor binding domain (RBD) by using codon optimized RBD sequence (as shown in Sequence 1 and FIG. 1 using plasmids shown in FIG. 20, FIG.21, FIG.22 and FIG. 23 (as presented in sequences 12, 13, 14 and 15).

2) The composition as claimed in claim 1, wherein DNA construct of SEQ ID NO: 1, comprises of;
i) a DNA sequence encoding the codon optimized receptor binding domain (RBD) of the SARS Cov-2, formulated for adenovorial or adeno-associated viral delivery via intranasal intramuscular or subcutaneous administration, such that the DNA constructs of SEQ ID NO: 1 leads to a biologically expressed RBD, secreted by use of a synthetic secretory peptide used in combiation with the RBD such that the signal peptide is cleaved after translation and the RBD is secreted in the extracellular space for the generation of neutralizing antibodies,
ii) The above DNA sequences being expressed in CHO cells or HEK-293 cells such that the proteins are expressed for purification and futher injection into a human for generation of immunogenicity, wherein these sequences after combining them in the form an adenoviral genome (Cosmid) are expressed in HEK-293 cells and tested by Western Blot.

3) The composition as claimed in claim 1, wherein DNA construct of SEQ ID NO: 2, comprises of, a DNA sequence encoding the codon optimized S1 subunit of the SARS Cov-2, formulated for adenovorial or adeno-associated viral delivery via intranasal, intramuscular or subcutaneous administration, such that the DNA constructs of SEQ ID NO: 2 leads to a biologically expressed S1 subunit, secreted by use of a synthetic secretory peptide used in combiation with the S1 subunit such that the signal peptide is cleaved after translation and the S1 subunit is secreted in the extracellular space for the generation of neutralizing antibodies.

4) The composition as claimed in claim 1, wherein DNA construct of SEQ ID NO: 3 comprises of, a DNA sequence encoding a triplicate of the codon optimized receptor binding domain (RBD) of the SARS Cov-2, formulated for adenovorial or adeno-associated viral delivery via intranasal, intramuscular or subcutaneous administration, such that the DNA constructs of SEQ ID NO: 3 leads to a biologically expressed receptor binding domain (RBD) of the SARS Cov-2, whrein each unit in the triplicate is generated at the same time and cleaved at the P2A sequence after translation, leaving the synthetic signal peptide in fusion with the RBD epitope and each RBD epitope is then secreted by virtue of the synthetic secretory peptide such that the signal peptide is cleaved after translation and the RBD domain is secreted in the extracellular space for the generation of neutralizing antibodies.

5) The composition as claimed in claim 1, wherein DNA construct of SEQ ID NO: 4 comprises of, a DNA sequence encoding the codon optimized RBD domain of the SARS Cov-2, formulated for adenovorial or adeno-associated viral delivery via intranasal, intramuscular or subcutaneous administration, such that the DNA constructs of SEQ ID NO: 4 leads to a biologically expressed RBD domain secreted by use of a synthetic secretory peptide used in combiation with the RBD domain such that the signal peptide is cleaved after translation and the S1 subunit is secreted in the extracellular space for the generation of neutralizing antibodiesin addition to a P2A peptide (which is cleaved after translation) for release of a fusion protein of synthetic signal peptide and an adjuvant peptide of sequence
gatccgaacgcgccgaaacgcccgccgagcgcgttttttctgttttgcagcgaa.

6) The composition as claimed in claim 1, wherein DNA construct of SEQ ID NO: 5 comprises of, a DNA sequence encoding the codon optimized RBD domain of the SARS Cov-2, formulated for adenovorial or adeno-associated viral delivery via intranasal, intramuscular or subcutaneous administration, such that the DNA constructs of SEQ ID NO: 5 leads to a biologically expressed RBD domain secreted by use of a synthetic secretory peptide used in combiation with the a S1 subunit domain such that both S1 subunit and RBD domain are released after their signal peptides are cleaved after translation, and both RBD and S1 subunit are secreted in the extracellular space for generation of neutralizing antibodies.

7) The composition as claimed in claim 1, wherein SEQ ID NO.- 16 as shown in FIG. 25 is map of plasmid pAD1129-ANS10-modified with DNA sequence created for vaccination against the South African strain B.1.351 which carries mutations from both UK and South African Strain (mutations shown in the black box).

8) The DNA constructs as claimed in claim 1, wherein the adenoviral vaccine candidates (SEQ ID NO.-6 and SEQ ID NO.-7) as produced are such that:
i. RBD antigen produces neutralizing antibody only, and does not lead to disease enhancement,
ii. Signal peptide attached to the RBD sequence helps extracellular secretion of the antigen once adenoviral particle produces the antigen in the cells, thus increasing the chances of formation of antibodies,
iii. S1 subunit attached to foldon trimerization domain is expressed as well in the same viral particle increasing the range of antibodies produced and increasing chance to produce antibodies in the natural trimer form,
iv. Adenoviral genome is made such that homologous recombination is not viable and this eliminates the risk of producing replication competent virus even in HEK 293 cell line,
v. Intranasal delivery of the vaccine candidates overcomes the drawbacks of thrombosis as the candidate vaccine does not enter the blood and provides high quality mucosal immunity,
vi. Chimpanzee Adeno candidate vaccine using the RBD sequence is also able to be given intranasally and thus provides mucosal immunity against the coronavirus without side effects of thrombosis as it never enters the bloodstream,
vii. Using natural sequence of the Coronavirus RBD in the same viral genome where the codon-optimized sequence of the Coronavirus RBD is used, prevents any homologous recombination and yet produces the same protein the double amount (two sequences for the same peptide, one natural and one codon-optimized, increasing the overall protein production).

9) The DNA constructs as claimed in claim 1, wherein the method of preparation of Adeno viral vaccine comprises the steps of:
1. Construction of the adenoviral candidate vaccines which includes the steps of:
a. Creation of shuttle plasmids,
b. Cosmid Construction,
c. Rescue,
d. Amplification, and,
2. Characterization of the candidate vaccine which includes the steps of:
i. Genome Restriction Analysis,
ii. Physical titer,
iii. Infectious titer,
iv. VP/ IU ratio,
v. Genome sequencing,
vi. Transgene expression,
vii. RCA assay.

Documents

Application Documents

# Name Date
1 202021012913-STATEMENT OF UNDERTAKING (FORM 3) [25-03-2020(online)].pdf 2020-03-25
2 202021012913-SEQUENCE LISTING(PDF) [25-03-2020(online)].pdf 2020-03-25
3 202021012913-SEQUENCE LISTING [25-03-2020(online)].txt 2020-03-25
4 202021012913-PROVISIONAL SPECIFICATION [25-03-2020(online)].pdf 2020-03-25
5 202021012913-POWER OF AUTHORITY [25-03-2020(online)].pdf 2020-03-25
6 202021012913-FORM 1 [25-03-2020(online)].pdf 2020-03-25
7 202021012913-DRAWINGS [25-03-2020(online)].pdf 2020-03-25
8 202021012913-DECLARATION OF INVENTORSHIP (FORM 5) [25-03-2020(online)].pdf 2020-03-25
9 202021012913-SEQUENCE LISTING (.txt) [24-03-2021(online)].txt 2021-03-24
10 202021012913-FORM-26 [24-03-2021(online)].pdf 2021-03-24
11 202021012913-FORM 3 [24-03-2021(online)].pdf 2021-03-24
12 202021012913-ENDORSEMENT BY INVENTORS [24-03-2021(online)].pdf 2021-03-24
13 202021012913-DRAWING [24-03-2021(online)].pdf 2021-03-24
14 202021012913-CORRESPONDENCE-OTHERS [24-03-2021(online)].pdf 2021-03-24
15 202021012913-COMPLETE SPECIFICATION [24-03-2021(online)].pdf 2021-03-24
16 Abstract1.jpg 2021-10-19
17 202021012913-FORM 18 [28-12-2022(online)].pdf 2022-12-28
18 202021012913-CORRESPONDENCE-120224.pdf 2024-02-19
19 202021012913-CORRESPONDENCE-150425.pdf 2025-04-19