Abstract: The present application pertains to a Corynebacterium sp. microorganism producing L-arginine and a method using the same for producing L-arginine.
Name of the invention: a method of producing L- arginine using microorganism of the genus Corynebacterium, and this producing L- arginine
Art
[1]
The present application relates to a method of producing L- arginine to the genus Corynebacterium microorganism and use them to produce L- arginine.
[2]
BACKGROUND
[3]
L- arginine is contained in the glass state in the plant seeds or garlic, amino acids strengthening agent is also used, and is also widely used in medicine, food or the like. For medicines are used such as liver function promoters, brain enhancer, male infertility treatment, comprehensive amino acid preparations, food is a substance which under the spotlight recently for saengseonmuk additives, health beverage additives, salt substitute for hypertension patients.
[4]
[5]
Corynebacterium ( Corynebacterium ) in microorganisms, in particular Corynebacterium glutamicum ( Corynebacterium glutamicum ) is a Gram-positive microorganism which is widely used in production of L- amino acids. Specific target compound, such as removal of unnecessary genes in the biosynthesis of either for the production of L- arginine in Corynebacterium sp primarily increasing the expression of the gene coding for the enzyme involved in arginine biosynthesis of L- or L- arginine this approach is mainly used (Patent No. 10-1102263 No. Korea). But still, efficient and there is a need for research on how to produce L- arginine in a high yield and emerging.
[6]
Detailed Description of the Invention
SUMMARY
[7]
The present inventors have for a result of intensive study to develop a microorganism capable of producing L- arginine in high efficiency, the gene encoding the Corynebacterium protein of unknown function in the microorganism of the genus Solarium deficient microorganism producing L- arginine yield the completion of the present application, check that increase.
[8]
Problem solving means
[9]
One object of the present application is to provide a microorganism of the genus Corynebacterium having an L- arginine-producing ability of the protein is inactivated, which comprises the amino acid sequence of SEQ ID NO: 1.
[10]
Another object of the present application is to provide an L- arginine production method using the microorganism.
[11]
Effects of the Invention
[12]
Microorganism producing L- arginine in the present application can produce L- arginine in high efficiency. In addition, the manufacturing L- arginine may be applied to various products such as animal feed or animal feed additives, as well as human food or food additives, pharmaceutical products.
[13]
Best Mode for Carrying Out the Invention
[14]
If it described in detail below. On the other hand, each of the descriptions and embodiments disclosed in this application may be applied to other embodiments and description of each. That is, any combination of various elements disclosed in the present application within the scope of the present application. In addition, it is impossible to see that the scope of the present application limited by the specific description technology.
[15]
[16]
In order to achieve the above object, the present application provides a genus Corynebacterium microorganism producing L- arginine, a protein comprising the amino acid sequence of SEQ ID NO: 1 In some embodiments the deactivation.
[17]
[18]
The term in the present application, "L- arginine" (L-Arginine) is a conditionally essential amino acids present in all organisms, C 6 H 14 N 4 O 2 means a L- amino acid having the formula. L- arginine is primarily Corynebacterium (particular microorganism Corynebacterium , but known to be produced by a) in the microorganism, and these cells it is known that receives the feedback inhibition (feedback inhibition) by the inner arginine (Vehary Sakanyan, et al, Microbiology, 142: 9-108, 1996), and there are known to have limitations in producing L- arginine in high yield. The present inventors have surprisingly determined that by increasing the production of L- arginine to function when the light is unknown protein comprising the amino acid sequence of SEQ ID NO: 1 activation, was to provide a new microorganism for producing L- arginine.
[19]
[20]
Terms, in this application "protein comprising the amino acid sequence of SEQ ID NO: 1" refers to a Corynebacterium protein putative protein or that inherently present in the microorganism of the genus Solarium, this function is unknown (hypothetical protein). For example, a protein comprising the amino acid sequence of SEQ ID NO: 1 is the amino acid sequence of SEQ ID NO: 1 (essentially), but may be composed of, but is not limited thereto.
[21]
In addition, even if it is described as "protein consisting of a particular sequence number" in the present application and has the protein with the same or equivalent activity consisting of the amino acid sequence of the SEQ ID NO: If the added irrelevant sequence before and after the amino acid sequence of the SEQ ID NO: or not to exclude a natural mutation, or its potential mutations (silent mutation) that may occur, it is apparent that within the scope of the present application, even if having more such sequences or mutations.
[22]
[23]
For example a sphere, a protein comprising the amino acid sequence of SEQ ID NO: 1 may comprise an amino acid sequence having at least 80% homology with the SEQ ID NO: 1. The SEQ ID NO: protein 1, comprising the amino acid sequence and amino acid sequence having at least 80% homology is at least 80% with respect to the amino acid sequence of SEQ ID NO: 1, specifically, at least 83%, at least 84%, 88% above, it may include a protein comprising an amino acid sequence having more than 90%, at least 93%, at least 95%, or 97% homology. If the amino acid sequence having a biological activity substantially the same as or corresponding to the amino acid sequence of SEQ ID NO: 1 as a sequence having homology with said sequence, if some sequence having a deletion, modified, substituted or added in the amino acid sequence also present application included in the scope of it is obvious.
[24]
In addition, the protein comprising the amino acid sequence of SEQ ID NO: 1 may be encoded by a gene comprising the polynucleotide sequence of SEQ ID NO: 2. In addition, essentially it consists of a polynucleotide sequence of SEQ ID NO: 2, or, but may be encoded by a gene consisting of, but not limited thereto.
[25]
In addition, the proteins of the present application may be encoded by a gene comprising a polynucleotide sequence having at least 80% homology as well as the polynucleotide sequence described in the SEQ ID NO: 2, and SEQ ID NO: 2.
[26]
Specifically, if a polynucleotide sequence capable of encoding a protein comprising an amino acid sequence having at least 80% homology with the SEQ ID NO: 1, but included within the scope of this application, the proteins in the polynucleotide sequence of SEQ ID NO: 2 for at least 80% or more, specifically, by the gene comprising the polynucleotide sequence having at least 83%, 84%, at least 88%, at least 90%, at least 93%, at least 95%, or 97% or more homology It can be encrypted. Further, due to the degeneracy of the genetic code axis (genetic code degeneracy) Further variants of the sequence coding for the same amino acid sequence may be included in the present application.
[27]
[28]
The term "homology" in the present application refers to the degree of matching the given amino acid sequence or nucleotide sequence and can be expressed as a percentage. In this specification, it is represented by its sequence homology to the "% homology" has the same or similar activity with a given amino acid sequence or polynucleotide sequence.
[29]
Homologous to the amino acid or nucleotide sequence castle for example, the algorithm BLAST according to the literature [see: Karlin and Altschul, Pro. Natl. Acad. Sci. USA, 90, 5873 (1993)] or FASTA by Pearson: can be determined using a (see. Methods Enzymol, 183, 63, 1990). On the basis of this algorithm BLAST, BLASTN or BLASTX have called program has been developed (see: http://www.ncbi.nlm.nih.gov).
[30]
[31]
The term "inactivation" in this application means that this does not at all even though the expression or expression as compared to expression of the protein parent strain, wild-type strain, or strain before the strain is reduced or its activity. In this case, the loss variation of the gene encoding the protein, and when the defect such as the activity of the protein decreased as compared to the protein activity in the original microorganisms have, inhibit expression of a gene encoding the same, or translated (translation) inhibition, etc. If the activity level of total protein in the cell lower than the pre-strain a wild type strain or a strain, a combination thereof is also a concept including.
[32]
In this application, the inactivation of the protein were identified the first time that the connection with the productivity of L- arginine.
[33]
[34]
In the present application, the deactivation may be accomplished by application of various methods well-known in the art. An example of the method, 1) a method for deleting the entire or part of the gene coding for the protein; 2) transformation of the expression control sequence to reduce the expression of the gene coding for the protein, 3) modification of the gene sequence encoding the protein so that the activity of the protein removed or weakened, and 4) the gene coding for the protein the antisense oligonucleotide of binding to complementary to the transcripts of the introduced nucleotide (e.g., antisense RNA); 5) signs of the gene coding for the protein-dalga Renault (Shine-Dalgarno) on the front end sequence sign - in addition to the dalga Renault sequence complementary to a sequence to form a secondary structure that makes possible the attachment of the ribosomes (ribosome) Way; 6) a 3 'a combination thereof is, and a method of adding the promoter to be transferred in the opposite direction at the terminal (Reverse transcription engineering, RTE) in ORF (open reading frame) of the polynucleotide sequence of the gene coding for the protein can be achieved, but, this, is not particularly limited.
[35]
[36]
Specifically, the method of modifying the expression control sequence can be accomplished by application of various methods well-known in the art. An example of the method, carried out by the polynucleotide sequence so as to further weaken the activity of the expression control sequence deletions induce insertion, Vivo wholly or conservative substitution or a mutation on the expression control sequence as a combination thereof, or having a weaker activity It can be carried out by replacing a polynucleotide sequence. The expression control sequence is one containing the sequence for controlling the sequence, and a transcription and termination of the decryption coding for the promoter, operator sequence, a ribosome binding site, and the like.
[37]
Further, the method of modifying the gene sequence is carried out by inducing a sequence variation on the gene sequence to further weaken the activity of the enzyme by deletion, insertion, Vivo wholly or conservative substitution or a combination thereof, or so as to have a weaker activity but can be performed by replacing into the gene sequence is improved so that an improved gene sequence or activity, and the like.
[38]
In addition, a method for deleting a part or all of the gene coding for the protein, a polynucleotide encoding an in intrinsic target protein chromosome via microbial vector For chromosomal insertion in part the nucleotide sequence is a deletion polynucleotides or marker gene It can be accomplished by replacing. In one example of a method for deleting a part or all of these polynucleotide by homologous recombination, but can use the method of deleting a polynucleotide, but it is not limited to this.
[39]
Further, the method of defect part or all of the gene may be induced mutations using light or chemicals such as ultraviolet rays, and the process from the obtained mutant body to the desired gene sorting the defect strain. The gene-deficient methods include the method according to the DNA recombinant technology. The recombinant DNA technology include, for example, can be done by injecting the gene of interest and a nucleotide sequence or a vector that contains a nucleotide sequence homologous to the microorganism occurs homologous recombination (homologous recombination). In addition, nucleotide sequences or vectors that the implant may include a dominant selectable marker.
[40]
[41]
"Microorganism producing L- arginine" term in the present application, or "micro-organisms having an L- arginine-producing ability" naturally L- arginine to the parent strain without producing ability of the microorganism or L- arginine which has the L- arginine-producing ability ability of production means a given microorganism. For example, the producing ability of the L- arginine can be provided to enhance expression of the gene coding for the active inactivation and / or L- arginine biosynthetic enzyme of protein comprising the amino acid sequence of SEQ ID NO: 1.
[42]
In this case, examples of the L- arginine biosynthetic enzyme is N- acetyl-glutamyl phosphate reductase (argC), ornithine acetyltransferase (argJ), N- acetyl glutamate kinase (argB), acetyl ornithine transaminase (argD), ornithine carbamoyl transferase and including (argF), Guinea are homeless acid synthetase (argG), Guinea are homeless acid lyase (argH), and carbamoyl phosphate synthetase. These arginine biosynthetic enzyme are present on the Arg operon (argCJBDFRGH) and controlled by an arginine repressor encoded by argR (. J Bacteriol 2002Dec; 184 (23):. 6602-14). Thus, weakening of the arginine repressor (US2002-0045223), or by over-expressing one or more genes of the biosynthetic genes can be assigned an L- arginine producing ability.
[43]
[44]
In this application, the proteins of the microorganism producing L- arginine, as the protein is inactivated micro-organisms comprising the amino acid sequence of SEQ ID NO: 1, the purposes of the microorganism of the present application comprises the amino acid sequence of SEQ ID NO: 1 the deactivation is possible if all microorganisms capable of producing L- arginine. Specifically, for example, Escherichia ( Escherichia ) genus, Serratia marcescens ( Serratia ), An air Winiah ( Erwinia ) genus, Enterobacter bacteria ( Enterobacteria ) genus, Salmonella ( Salmonella ) genus Streptomyces ( Streptomyces ) genus Pseudomonas ( Pseudomonas ) genus Brevibacterium ( Brevibacterium ) in or Corynebacterium ( Corynebacterium can contain microorganism strain, etc.), a may be a specifically Corynebacterium spp. For the purpose, the microorganism of the present application may be a genus Corynebacterium microorganism producing L- arginine.
[45]
[46]
The "genus Corynebacterium microorganisms to produce L- arginine" refers to the genus Corynebacterium microorganism with L- arginine-producing ability through natural type or mutant. In the genus Corynebacterium microorganism capable of producing L- arginine it is known but is significantly lower and the status unknown genetic mechanisms and principles that applied to the production mechanism of its production capability. Thus, the stiffness of producing L- arginine of the present application is a microorganism of the genus Corynebacterium have the L- arginine-producing ability to increase or enhance the activity of the inert enhanced genes associated with wild-type microorganism itself or external L- arginine producing mechanism Corey It refers to Corynebacterium spp.
[47]
"Corynebacterium spp." In the present application may include all of Corynebacterium spp. Specifically, Corynebacterium glutamicum ( Corynebacterium glutamicum ), Corynebacterium ammoniagenes to Ness ( Corynebacterium ammoniagenes ), Corynebacterium thermo amino to Ness ( Corynebacterium thermoaminogenes ), Brevibacterium Plastic boom ( Brevibacterium flavum ) , Corynebacterium EfficientDynamics City Enschede ( of Corynebacterium efficiens ), Corynebacterium Maris ( of Corynebacterium maris ), Corynebacterium Ruby Khan Tees ( of Corynebacterium lubricantis ), Corynebacterium dusa nenseu ( of Corynebacterium doosanense ), Corynebacterium Philo island ( of Corynebacterium pilosum ), Corynebacterium Sistine display ( of Corynebacterium cystitidis ), Corynebacterium right Therese keys ( of Corynebacterium uterequi ), Corynebacterium Lee nalre ( of Corynebacterium renale ) or Brevibacterium lactofermentum ( Brevibacterium lactofermentum ) may be, more specifically, Corynebacterium glutamicum ( Corynebacterium glutamic um it may be).
[48]
[49]
The present application, provides, L- arginine producing method comprising the microorganism being cultivated in a culture medium according to the present application.
[50]
The microorganism of the present application are as described above.
[51]
In the method of the present application, the stiffness of four tumefaciens cultured in the microorganism may be used any method and culture conditions, the culture is known in the art.
[52]
[53]
The term "culture" in this application means that the growth in the environmental conditions which control the microorganisms with artificially appropriately. How to culture the L- arginine by using a microorganism of the genus Corynebacterium in the present application can be carried out using methods well known in the art. Specifically, the culture is not however be cultured in a continuous manner to the injection batch process a batch process, a batch or repeated injection (fed batch or repeated fed batch process), this limit.
[54]
The medium used to culture should meet the requirements of the particular strains in a suitable manner. It is known the culture medium for Corynebacterium strains (e. G., Manual of Methods for General Bacteriology by the American Society for Bacteriology, Washington DC, USA, 1981).
[55]
A Party that can be used in the medium are glucose, saccharose, lactose, fructose, maltose, starch, cellulose and and carbohydrates, soybean oil, sunflower oil as per, castor oil, oils and fats such as coconut oil, palmitic acid, stearic acid, , an alcohol such as a fatty acid, glycerol and ethanol, such as linoleic acid, include organic acids such as acetic acid. These materials may be used separately or as mixtures, and the like.
[56]
The nitrogen source which can be used include a peptone, yeast extract, gravy, malt extract, corn steep liquor, soybean meal and urea or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate. In addition, sources of nitrogen can be used separately or as mixtures, and the like.
[57]
Personnel to that may be used are phosphoric acid may contain a salt which contains potassium or potassium phosphate or the corresponding sodium susoyi. Also, culture media may contain metal salts such as magnesium sulfate or iron sulfate needed for growth. Finally, the required growth substances such as amino acids and vitamins can be used in addition to the above materials. Also may be used, suitable precursors to the culture medium. The above described material may be added in a batch or continuous system by a suitable method to the culture in culture.
[58]
With an acid compound such as phosphoric acid or sulfuric acid or a basic compound such as culture, sodium hydroxide, potassium hydroxide, ammonia in the microorganism in a suitable manner it is possible to adjust the pH of water culture. It is also possible to use anti-foaming agents such as fatty acid polyglycol ester can suppress foam generation. To maintain aerobic conditions, oxygen or oxygen into the culture-containing gas can be injected (for example, air). Incubation temperature of water is usually 20 ℃ to 45 ℃, it may be specifically 25 ℃ to 40 ℃. Incubation time, but can continue until is obtained the production of the desired L- amino acid, and specifically may be from 10 to 160 hours.
[59]
In the method of the present application, the culture may be made by continuous or batch type, such as a batch process, the batch injection and infusion repeated batch process. Such culture methods are well known in the art, any method selected by one of ordinary skill in the art may be used.
[60]
Separation of L- arginine from the culture can be separated by a conventional method known in the art. This separation method, there is a method such as centrifugation, filtration, ion exchange chromatography and crystallization can be used. For example, low speed centrifugation to separate the culture to remove the biomass, and the resulting supernatant was separated through ion exchange chromatography, but is not limited to this.
[61]
In the method of the present application, it may include a subsequent step of the incubation, the further step of recovering the L- arginine from the medium or the microorganism.
[62]
The recovering step may comprise a step of purification.
[63]
Mode for the Invention
[64]
The present application in more detail described below through an embodiment. It is, however, not intended that the scope of the present application are for explaining the present application by way of example only to the examples.
[65]
[66]
Example 1: Production random mutant libraries using the transposon
[67]
To prepare a vector library by the following method to obtain the L- arginine producing strain with increased capability.
[68]
First, EZ-Tn5 ™ Tnp Transposome ™ Kit electric pulse method using a plasmid obtained from Corynebacterium glutamicum KCCM10741P (Republic of Korea Patent Registration No. 0791659) as the parent strain using (Epicentre) (Appl .. Microbiol Biothcenol (1999) 52:. 541-545) transformed with, and kanamycin (25 ㎎ / ℓ) were obtained from about 20,000 colonies were plated on the plate culture medium containing the compound.
[69]
[70]
[71]
Glucose 10 g, peptone 10 g, beef extract 5 g, yeast extract 5 g, brain heart leachate (Brain Heart Infusion) 18.5 g, NaCl 2.5 g, urea 2 g, sorbitol 91 g, agar 20 g (in 1 liter of distilled water)
[72]
[73]
Example 2: random mutation screening using a transposon library
[74]
Example 1 In to the inoculated to about 20,000 colonies on selection medium the ㎕ 300 respectively secured at 30 ℃ in 96 deep well plates (96-deep well plate), and cultured for about 24 hours with 1000 rpm.
[75]
[76]
[77]
Glucose 10 g, 5.5 g ammonium sulfate (ammonium sulfate), MgSO 4 7H 2 O 1.2 g, KH 2 PO 4 0.8 g, K 2 HPO 4 16.4 g, biotin 100 ㎍, Thiamine HCl 1 ㎎, calcium pantothenate 2 ㎎, nicotinamide 2 ㎎ (in 1 liter of distilled water)
[78]
[79]
To analyze the production of L- arginine production in the culture medium was used for ninhydrin method (Moore, S., Stein, WH, Photometric ninhydrin method for use in the chromatography of amino acids. J. Biol. Chem.1948, 176, 367-388).
[80]
After the incubation is completed, the culture supernatant 10 ㎕ and non-high then gave the reaction solution was reacted for 190 ㎕ at 65 ℃ 30 minutes and measuring the absorbance with a spectrophotometer (spectrophotometer) at wavelength 570 nm, the control of Corynebacterium glutamicum compared to the KCCM10741P strains were selected from about 60 different colonies as the mutant strains showing high absorbance. Other colonies were confirmed to show a similar or decreased absorbance and the Corynebacterium glutamicum strain KCCM10741P used as a control.
[81]
By the strain of the selected 60 different performed after cultured in the same manner as described above repeatedly ninhydrin reaction, as a result, the parental strain of Corynebacterium glutamicum KCCM10741P L- arginine producing ability improved compared to the parent strain 10 a kind of mutants were screened.
[82]
[83]
Example 3: L- arginine producing ability analysis of randomly selected mutants
[84]
To Example 2 to a final selection of the target the mutants of the 10 kinds of starter increased ability reproducibly producing L- arginine strain was subjected to flask culture using the medium described below. After incubation is complete by HPLC analysis were within the L- arginine concentration culture medium, it is shown for the production of L- arginine concentration of each mutant are shown in Table 1.
[85]
[86]
[87]
Glucose 6%, ammonium sulfate, 3%, the first 0.1% of potassium phosphate, magnesium sulfate 0.2%, heptahydrate, CSL (corn steep liquor) 1.5%, NaCl 1%, 0.5% yeast extract, biotin 100 ㎎ / ℓ, CaCO 3 3 %, (in 1 liter of distilled water).
[88]
[89]
[Table 1] 10 kinds of screening random mutant L- arginine producing a concentration of
Strain L- arginine (g / ℓ)
Placed one Placed second Placed third Average
Controls KCCM10741P 3 3.1 3.1 3.07
1 KCCM10741P/mt-1 2.8 3 2.7 2.83
2 KCCM10741P/mt-2 3.1 3 3.2 3.10
3 KCCM10741P/mt-3 3.3 3.2 3.4 3.30
4 KCCM10741P/mt-4 2.5 2.2 2.1 2.27
5 KCCM10741P/mt-5 2.9 3 3.2 3.03
6 KCCM10741P/mt-6 3.5 3.2 3.2 3.30
7 KCCM10741P/mt-7 3.2 3.3 3.3 3.27
8 KCCM10741P/mt-8 3.4 3 3.2 3.20
9 KCCM10741P/mt-9 2.7 2.7 3 2.80
10 KCCM10741P/mt-10 3.6 3.9 3.5 3.67
[90]
[91]
Of one of the selected 10 kinds of mutant strains significantly improved as L- arginine producing ability was selected for final KCCM10741P / mt-10.
[92]
[93]
Example 4: attribution L- arginine increase production capacity at the end of the week selection
[94]
In the present embodiment it was to identify the genetic defect by the random insertion of a transposon into the target end-selected mutant from Example 3.
[95]
KCCM10741P / mt-10 genomic DNA by extracting the connection was cut and transformed into E. coli DH5α, and kanamycin (25 ㎎ / ℓ) were plated on the LB solid medium containing the. After transfection screening the colonies 20 switch species, was obtained the plasmid contain all genes of unknown, EZ-Tn5 ™ Tnp Transposome ™ Kit of primer 1 (SEQ ID NO: 3) and primer 2 ( using SEQ ID NO: 4) was sequenced. As a result, the deletion inactivated gene was confirmed that the sequence of nucleotide of SEQ ID NO: 2 encoding the amino acid sequence of SEQ ID NO: 1.
[96]
[97]
Primer 1 (SEQ ID NO: 3): ACCTACAACAAAGCTCTCATCAACC
[98]
Primer (SEQ ID NO: 4): CTACCCTGTGGAACACCTACATCT
[99]
[100]
Accordingly, at the time of inactivation of the protein comprising the amino acid sequence of SEQ ID NO: 1, were selected for the gene defect candidate genes in order to ensure that the impact neunge L- arginine production.
[101]
[102]
Example 5: Production of recombinant vector for gene defect comprising a nucleotide sequence of SEQ ID NO: 2
[103]
In this embodiment, on the Example 4 L- arginine-producing strain Corynebacterium chromosome of the selected gene in order to determine the effect of inactivation of the gene and producing L- arginine, including the nucleotide sequence of SEQ ID NO: 2 the recombinant plasmid was prepared for deletion.
[104]
First, a primer was synthesized from 3 to 6, such as on the stiffness of four chromosome tumefaciens in microorganisms, as shown in, the following Table 2 to produce a recombinant vector which may be deficient for the gene.
[105]
[106]
TABLE 2
The primers used Base sequence
Primer 3 (SEQ ID NO: 5) CCGCTCGAGACATCGAAATCGTAAGGGTA
Primer 4 (SEQ ID NO: 6) CAGCATTGACAAGCAGTTCT
Primer 5 (SEQ ID NO: 7) AGAACTGCTTGTCAATGCTGGGCCCTTTCCCAGGTGGCAT
Primer 6 (SEQ ID NO: 8) CCGCTCGAGAAGGCCACCGCTGCAGACCG
[107]
[108]
Specifically, ORF region of the gene (SEQ ID NO: 2) the 5 'end and 3' to have a XhoI restriction site at the terminal primer 3 to deletion (SEQ ID NO: 5), primer 4 (SEQ ID NO: 6), primers 5 (SEQ ID NO: 7), was synthesized with primers 6 (SEQ ID NO: 8). By the PCR with the chromosomal DNA of Corynebacterium glutamicum KCCM10741P as a template using the primer 3 and primer 4, a primer 5 and primer 6 were carried out. As a result, it was confirmed that the gene encoded protein is for the front and rear portions of the encoded DNA fragments are amplified by 500 bp to each. At this time, PCR conditions were the then denatured for 5 minutes in the modified 95 ℃, after the 94 ℃ / 30 cho denaturation, 56 ℃ / 30 cho annealing, 72 ℃ / 1 bun polymerization was repeated 30 times, in 72 ℃ polymerization 7 minutes of reaction It was carried through. Then, Corynebacterium PCR products obtained above after XhoI restriction enzyme digestion and cloned in fusion Tommy glutamicum pDZ vector replication can not be in the (Republic of Korea Patent No. 10-0924065 call). In-Fusion cloning Fusion® was performed using HD Cloning Kit (Clontech), it was transformed them in E. coli DH5α and plated on LB solid medium containing kanamycin (25 ㎎ / ℓ).
[109]
After the object gene is selected for the converted colonies transfected with the insertion plasmid via PCR, using a plasmid extraction was obtained the plasmid, this plasmid was named pDZ-ΔRS1.
[110]
[111]
Example 6: Preparation of the Corynebacterium glutamicum KCCM10741P gene defect comprising a nucleotide sequence of SEQ ID NO: 2 and its L- arginine producing ability evaluation
[112]
Making an exemplary L- arginine producing strain of the genus Corynebacterium the KCCM10741P based on the strain, a gene comprising a nucleotide sequence of SEQ ID NO: 2 and deletion strain was to evaluate its L- arginine producing ability.
[113]
Specifically, the above embodiment was a recombinant plasmid prepared in 5 by the pDZ- △ RS1 homologous recombination on the chromosome is transformed to the L- arginine-producing strain of Corey four tumefaciens glutamicum KCCM10741P (van der Rest et al., appl Microbiol Biotechnol 52: 541-545, 1999).
[114]
It was then recombined in a second solid plate medium containing 4% of sucrose. The second recombinant is complete Corynebacterium glutamicum was confirmed Solarium transformed with the said gene-deficient strain by PCR method using primer 3 and primer 6 to target the main switch. The recombinant strain was named Corynebacterium glutamicum 'KCCM10741P-RS1'.
[115]
In order to analyze the L- arginine-producing ability as a parent strain was cultured in Corynebacterium glutamicum KCCM10741P strain and the produced Corynebacterium glutamicum the following ways: a KCCM10741P-RS1 strain.
[116]
250 containing a seed medium 25 ㎖ below ㎖ corner-bapeul the mother strain of Corynebacterium glutamicum KCCM10741P as in Example 6, a strain of Corynebacterium glutamicum KCCM10741P-RS1 the inoculation, and 30 produced in the flask for 20 h at ℃, then this was cultured with shaking in 200 rpm. Then, 250 ㎖ corner containing a production medium 24 ㎖ - at 30 ℃ and inoculated with the seed culture of the 1㎖ bapeul flask for 72 hours, then this was cultured with shaking at 200 rpm. Composition of the seed medium and the production medium was as follows, respectively.
[117]
[118]
[119]
Glucose 20 g, peptone 10 g, yeast extract 5 g, urea 1.5 g, KH 2 PO 4 4 g, K 2 HPO 4 8 g, MgSO 4 · 7H 2 O 0.5 g, biotin 100 ㎍, Thiamine HCl 1 ㎎, calcium pantothenate 2 ㎎, nicotinamide 2 ㎎ (in 1 liter of distilled water)
[120]
[121]
[122]
Glucose 6%, 3% ammonium sulfate, the first 0.1% of potassium phosphate, magnesium sulfate 0.2%, heptahydrate, CSL (corn steep liquor) 1.5%, NaCl 1%, 0.5% yeast extract, biotin, 100 mg / L (per liter of distilled water standard).
[123]
[124]
After the completion of the culture was measured by the HPLC yields of L- arginine, L- arginine to the concentration of the analysis are shown in Table 3 below.
[125]
[126]
Table 3 gene is deficient the Corey four L- arginine-producing ability of the analysis tumefaciens glutamicum KCCM10741P comprising a nucleotide sequence of SEQ ID NO: 2
Strain L- arginine (g / ℓ)
Placed one Placed second Placed third Average
KCCM10741P 3.0 3.1 3.1 3.06
KCCM10741P-RS1 3.8 3.9 3.8 3.83
[127]
[128]
As the result, in the case of a defect in which the gene KCCM10741P-RS1 from L- arginine-producing strain of Corynebacterium glutamicum KCCM10741P, confirmed that the average increase of 25% L- arginine producing ability compared to the parent strain.
[129]
The KCCM10741P-RS1 named the strain as CA06-2830, and on December 15th 2017 and accession to the international deposit under the Budapest Treaty on microorganisms organization Conservation Center Korea (Korea Culture Center of Microorganisms, KCCM) were given an accession number KCCM12187P.
[130]
[131]
Thus, by deletion of the gene comprising the nucleotide sequence of SEQ ID NO: 2 in the genus Corynebacterium microorganism was found that to improve the L- arginine-producing ability.
[132]
[133]
Example 7: Production of recombinant vector for gene weakening comprising a nucleotide sequence of SEQ ID NO: 2
[134]
The genus Corynebacterium was for the production of a recombinant vector that can weaken the gene comprising a nucleotide sequence of SEQ ID NO: 2 on the chromosome of the strain, so as to weaken by substituting an initiation codon of the gene from the ATG to TTG fragment therefor the primer 3 and primer 7 to 9 as shown in the following Table 4 were synthesized in order to manufacture.
[135]
[136]
TABLE 4
gene The primers used Base sequence
SEQ ID NO: 2 Primer 3 (SEQ ID NO: 5) CCGCTCGAGACATCGAAATCGTAAGGGTA
Primer 7 (SEQ ID NO: 9) GATCCACAGTCCCAATATTCTCGCTTCTTC
Primer 8 (SEQ ID NO: 10) GAAGAAGCGAGAATATTGGGACTGTGGATC
Primer 9 (SEQ ID NO: 11) CCGCTCGAGCAGCATTGACAAGCAGTTCT
[137]
[138]
ORF region of the gene (SEQ ID NO: 2), a to amplification, the 5 'end and 3' to have a XhoI restriction site at the terminal primer 3 (SEQ ID NO: 5) and primer 7 (SEQ ID NO: 9) and primer 8 (SEQ ID NO: No. 10), was synthesized with primers 9 (SEQ ID NO: 11). Using primers 3, 7 primers, 8 primers, 9 primers, and PCR was performed using the chromosomal DNA of Corynebacterium glutamicum as a template KCCM10741P. At this time, PCR conditions over after 5 min denaturation at denaturation 95 ℃, the 94 ℃ / 30 cho denaturation, 56 ℃ / 30 cho annealing, 72 ℃ / 1 bun polymerization was repeated 30 times, in 72 ℃ polymerization 7 minutes of reaction It was performed. Then, the fusion was cloned from Corynebacterium glutamicum in the replication is not possible in pDZ vector (Republic of Korea Patent No. 10-0924065 call) the XhoI restriction enzyme then treated obtained in the PCR products. In-Fusion cloning Fusion® was performed using HD Cloning Kit (Clontech), it was transformed them in E. coli DH5α and plated on LB solid medium containing kanamycin (25 ㎎ / ℓ).
[139]
After the object gene is selected for the converted colonies transfected with the insertion plasmid via PCR, using a plasmid extraction was obtained the plasmid, this plasmid was named pDZ-ΔRS2.
[140]
[141]
Example 8: Preparation of a Corynebacterium glutamicum gene KCCM10741P weakness comprising a nucleotide sequence of SEQ ID NO: 2 and its L- arginine producing ability evaluation
[142]
The embodiment was a recombinant plasmid prepared in 7 by the pDZ- △ RS2 homologous recombination on the chromosome is transformed to the L- arginine-producing strain of Corynebacterium glutamicum KCCM10741P (van der Rest et al., Appl Microbiol Biotechnol 52: 541-545, 1999).
[143]
It was then recombined in a second solid plate medium containing 4% of sucrose. The second recombinant substitution is complete to the Corynebacterium glutamicum transformed the TTG start codon of the gene containing the nucleotide sequence of SEQ ID NO: 2 by analyzing the nucleotide sequence using a primer 3 and primer 9, intended for switching the main It identified the strain. The recombinant strain was named Corynebacterium glutamicum KCCM10741P-RS2.
[144]
After culturing the L- arginine producing Cory four parent strain to analyze the performance tumefaciens glutamicum KCCM10741P and the production of Corynebacterium glutamicum strain KCCM10741P-RS2 in the same manner as in Example 6, the HPLC used was measured by the production of L- arginine, L- arginine to the concentration of the analysis are shown in Table 5.
[145]
[146]
Table 5 gene is weakened Corynebacterium glutamicum L- arginine-producing ability of the analysis KCCM10741P comprising a nucleotide sequence of SEQ ID NO: 2
Strain L- arginine (g / ℓ)
Placed one Placed second Placed third Average
KCCM10741P 4.2 4.2 4.1 4.17
KCCM10741P-RS2 4.6 4.8 4.6 4.67
[147]
[148]
If sikyeoteul weakening a gene comprising the nucleotide sequence of SEQ ID NO: 2 as the destination of the L- arginine-producing strain KCCM10741P as the result, it was confirmed that the average increase of 12% L- arginine producing ability.
[149]
Thus, by weakening the Corynebacterium expression of a gene comprising a nucleotide sequence of SEQ ID NO: 2 in the microorganisms was confirmed that this can improve the L- arginine-producing ability.
[150]
[151]
Taken together, the above results, SEQ ID NO: strain gene defect or weakness, including nucleotide sequences of the two can be seen that the increase in production capability L- arginine, which is to inactivate the activity of the protein which the gene in a microorganism encryption to suggest that mass production of L- arginine.
[152]
[153]
From the above description, those skilled in the present application will appreciate that the present application without changing the technical spirit or essential features may be embodied in other specific forms. In this regard, the embodiments described above are only to be understood as exemplary rather than limiting in all aspects. Scope of the present application is to be the meaning and scope, and all such modifications as derived from the equivalent concepts of the claims to be described later, rather than the foregoing description be construed as included within the scope of the present application.
[154]
Claims
[Claim 1]
Corynebacterium spp that produce proteins inactivated, L- arginine comprising the amino acid sequence of SEQ ID NO: 1.
[Claim 2]
The method of claim 1 wherein said Yes protein is encoded by a gene comprising the nucleotide sequence of SEQ ID NO: 2, Corey tumefaciens spp.
[Claim 3]
The method of claim 1, wherein the microorganism is Corynebacterium glutamicum of, Corynebacterium spp.
[Claim 4]
Any one of claims 1 to A method of producing L- arginine, comprising the step of culturing in a medium a microorganism according to any one of items (3).
[Claim 5]
The method of claim 4, wherein after the step of the incubation, the method of producing, L- arginine, including the further step of recovering the L- arginine from the medium or the microorganism.
| # | Name | Date |
|---|---|---|
| 1 | 201937026262.pdf | 2019-07-01 |
| 2 | 201937026262-STATEMENT OF UNDERTAKING (FORM 3) [01-07-2019(online)].pdf | 2019-07-01 |
| 3 | 201937026262-SEQUENCE LISTING(PDF) [01-07-2019(online)].pdf | 2019-07-01 |
| 4 | 201937026262-SEQUENCE LISTING [01-07-2019(online)].txt | 2019-07-01 |
| 5 | 201937026262-REQUEST FOR EXAMINATION (FORM-18) [01-07-2019(online)].pdf | 2019-07-01 |
| 6 | 201937026262-PRIORITY DOCUMENTS [01-07-2019(online)].pdf | 2019-07-01 |
| 7 | 201937026262-FORM 18 [01-07-2019(online)].pdf | 2019-07-01 |
| 8 | 201937026262-FORM 1 [01-07-2019(online)].pdf | 2019-07-01 |
| 9 | 201937026262-DECLARATION OF INVENTORSHIP (FORM 5) [01-07-2019(online)].pdf | 2019-07-01 |
| 10 | 201937026262-COMPLETE SPECIFICATION [01-07-2019(online)].pdf | 2019-07-01 |
| 11 | 201937026262-Certified Copy of Priority Document (MANDATORY) [16-07-2019(online)].pdf | 2019-07-16 |
| 12 | 201937026262-Proof of Right (MANDATORY) [05-09-2019(online)].pdf | 2019-09-05 |
| 13 | 201937026262-FORM-26 [14-09-2019(online)].pdf | 2019-09-14 |
| 14 | 201937026262-FORM 3 [31-12-2019(online)].pdf | 2019-12-31 |
| 15 | 201937026262-RELEVANT DOCUMENTS [09-09-2020(online)].pdf | 2020-09-09 |
| 16 | 201937026262-MARKED COPIES OF AMENDEMENTS [09-09-2020(online)].pdf | 2020-09-09 |
| 17 | 201937026262-FORM 13 [09-09-2020(online)].pdf | 2020-09-09 |
| 18 | 201937026262-AMMENDED DOCUMENTS [09-09-2020(online)].pdf | 2020-09-09 |
| 19 | 201937026262-FER.pdf | 2021-12-07 |
| 20 | 201937026262-FER_SER_REPLY [05-05-2022(online)].pdf | 2022-05-05 |
| 21 | 201937026262-CLAIMS [05-05-2022(online)].pdf | 2022-05-05 |
| 22 | 201937026262-PatentCertificate07-11-2023.pdf | 2023-11-07 |
| 23 | 201937026262-IntimationOfGrant07-11-2023.pdf | 2023-11-07 |
| 1 | SS2E_07-12-2021.pdf |
| 2 | SS1E_07-12-2021.pdf |
| 3 | SearchstrategyE_07-12-2021.pdf |