Abstract: The present application relates to a Corynebacterium sp. microorganism producing a purine nucleotide and a method for producing a purine nucleotide by using the same.
Microorganisms in Corynebacterium producing purine nucleotides and production method of purine nucleotides using the same
Technology field
[1]
The present application relates to a microorganism of the genus Corynebacterium producing purine nucleotides and a method for producing purine nucleotides using the same.
[2]
Background
[3]
5'-inosine monophosphate (hereinafter referred to as IMP), 5'-xanthosine monophosphate (hereinafter referred to as XMP), 5'-guanosine monophosphate (hereinafter referred to as GMP), 5'- Purine nucleotides such as adenylic acid (5'-adenylic acid; AMP) are intermediates in the nucleic acid biosynthesis metabolic system. They play a physiologically important role in the body and are widely used in food and medicine. Among them, IMP that tastes like beef and GMP that tastes like mushrooms are widely used as food seasoning additives, and when two substances are mixed with monosodium glutamic acid (MSG), it is known that the flavor is further enhanced. Seasoning is used a lot.
[4]
[5]
On the other hand, the methods for producing the purine nucleotides include (1) a method for enzymatically decomposing ribonucleic acid (RNA) extracted from yeast cells, and (2) culturing microorganisms producing the same and directly recovering the purine nucleotides in the culture medium. Fermentation methods, (3) chemically phosphorylating nucleosides produced by fermentation, and (4) enzymatic phosphorylation of nucleosides produced by fermentation (Korea Patent Registration No. 10-1049023 No. 4,304,304, Korean Patent Registration No. 10-1210704, Agri. Biol. Chem., 36(9),1511-1522). Among these, the method (1) has problems in raw material supply and demand, and the method (2) is widely used because it is economically and environmentally advantageous. On the other hand, in the case of GMP production, one of the purine nucleotides, there is a disadvantage in that the yield is low due to a problem of cell membrane permeability, and thus a method for producing GMP by enzymatically converting XMP produced through microbial fermentation has been utilized.
[6]
[7]
However, during fermentative production of purine nucleotides using microorganisms, the microorganisms undergo stress due to temperature, pH, osmotic pressure, malnutrition, and oxidative factors. Among these, in particular, oxidative stress is the main cause of reactive oxygen species (ROS), which is an inevitable element generated during fermentation production, and may cause abnormal growth of microorganisms.
[8]
Detailed description of the invention
Technical challenges
[9]
The present inventors have studied in earnest efforts to increase the productivity of purine nucleotides by overcoming oxidative stress that may be caused during the fermentation process of microorganisms. This application was completed by confirming the improvement of productivity.
[10]
Task resolution
[11]
One object of the present application is to provide a microorganism of the genus Corynebacterium that produces a purine nucleotide in which a protein composed of the amino acid sequence of SEQ ID NO: 1 is inactivated.
[12]
Another object of the present application is to provide a method for producing purine nucleotides using the microorganism.
[13]
Another object of the present application is to provide a method for increasing purine nucleotide production in Corynebacterium, comprising the step of inactivating a protein of the present application in a microorganism of the genus Corynebacterium.
[14]
Another object of the present application is to provide the use of such microorganisms to produce purine nucleotides.
[15]
Effects of the Invention
[16]
Microorganisms producing purine nucleotides of the present application can produce purine nucleotides with high efficiency. In addition, the prepared purine nucleotides can be applied to various products such as human food or food additives, seasonings, pharmaceuticals as well as animal feed or animal feed additives.
[17]
Best mode for carrying out the invention
[18]
Specifically, it is as follows. Meanwhile, each description and embodiment disclosed in the present application may be applied to each other description and embodiment. That is, all combinations of the various elements disclosed in this application fall within the scope of this application. In addition, the scope of the present application is not considered to be limited by the specific descriptions described below.
[19]
[20]
In order to achieve the above object, one aspect of the present application provides a microorganism of the genus Corynebacterium that produces a purine nucleotide in which a protein composed of the amino acid sequence of SEQ ID NO: 1 is inactivated.
[21]
In one embodiment, a protein consisting of the amino acid sequence of SEQ ID NO: 1 is inactivated, providing Corynebacterium conditioner to produce purine nucleotides.
[22]
[23]
In this application, the term "purine nucleotide" (purine nucloetide) refers to a compound having a purine nucleoside and phosphoric acid ester-bonded to the sugar portion of the nucleoside.
[24]
Specifically, the purine nucleotide is any one or more purine nucleotides selected from 5'-inosine monophosphate (IMP), 5'-xanthosine monophosphate (XMP), 5'-xanthosine monophosphate (GMP) and 5'-adenosine monophosphate (AMP) Although it may be, a protein composed of the amino acid sequence of SEQ ID NO: 1 is inactivated, and purine nucleotides capable of increasing productivity are included without limitation.
[25]
[26]
In the present application, the term, "protein consisting of the amino acid sequence of SEQ ID NO: 1" means a protein encoded by a gene of the WhiB-family group, and may specifically be a WhiB transcriptional regulator (B WhiB). The protein contains four conserved cysteine residues that form oxygen and nitrogen oxide-sensitive clusters (4Fe-4S) and is known to play an important role in exhibiting various biological properties of Actinomycetes. The functions known to date are known to be involved in overall cellular functions such as pathogenesis, antibiotic resistance, and cell growth, but their detailed functions and mechanisms are not well studied.
[27]
[28]
The protein having the amino acid sequence of SEQ ID NO: 1 of the present application may be a protein comprising the amino acid sequence of SEQ ID NO: 1, a protein consisting essentially of the amino acid sequence of SEQ ID NO: 1, or a protein consisting of the amino acid sequence of SEQ ID NO: 1 However, it is not limited thereto.
[29]
In addition, the protein of the present application may be a protein composed of the amino acid sequence set forth in SEQ ID NO: 1, but includes a sequence having the same activity as the protein without limitation, and those skilled in the art can obtain sequence information from known databases such as NCBI GenBank, etc. Can be. In addition, the protein having the amino acid sequence of SEQ ID NO: 1 of the present application, SEQ ID NO: 1 and at least 60%, 70%, 80%, 83%, 84%, 85%, 86%, 87% of SEQ ID NO: 1, It may be a protein comprising an amino acid sequence having 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 97%, 98% or 99% homology or identity. In addition, if the amino acid sequence having such homology or identity and exhibiting biological activity corresponding to the protein, it is obvious that a protein having an amino acid sequence in which some sequences are deleted, modified, substituted, or added is also included in the scope of the present application.
[30]
In addition, probes that can be prepared from known gene sequences, such as polypeptides encoded by polynucleotides that hybridize under stringent conditions with complementary sequences for all or part of the base sequence encoding the polypeptide, wherein the sequence Polypeptides having the same activity as the protein consisting of the amino acid sequence of No. 1 may also be included without limitation.
[31]
In other words, in the present application,'a protein or polypeptide comprising an amino acid sequence described by a specific sequence number','a protein or polypeptide consisting of an amino acid sequence represented by a specific sequence number' or'a protein having an amino acid sequence described by a specific sequence number, or Polypeptide, even if it has the same or corresponding activity as the polypeptide consisting of the amino acid sequence of the corresponding sequence number, some sequences are also deleted, modified, substituted, conservative substitution or protein having an added amino acid sequence It is obvious that it can be used in the present application. For example, when the amino acid sequence N-terminal and/or C-terminal is added with a sequence that does not alter the function of the protein, a naturally occurring mutation, a potential mutation thereof, a silent mutation or a conservative substitution .
[32]
The term "conservative substitution" means to replace one amino acid with another amino acid having similar structural and/or chemical properties. Such amino acid substitutions can generally occur based on the similarity in residue polarity, charge, solubility, hydrophobicity, hydrophilicity, and/or amphipathic nature. For example, positively charged (basic) amino acids include arginine, lysine, and histidine; Negatively charged (acidic) amino acids include glutamic acid and aspartic acid; Aromatic amino acids include phenylalanine, tryptophan and tyrosine, and hydrophobic amino acids include alanine, valine, isoleucine, leucine, methionine, phenylalanine, tyrosine and tryptophan.
[33]
The term "polynucleotide" in the present application has the meaning of comprehensively including a DNA or RNA molecule, and a nucleotide which is a basic structural unit in a polynucleotide may include not only natural nucleotides, but also sugar or base site modified analogs ( Scheit, Nucleotide Analogs, John Wiley, New York (1980); see Uhlman and Peyman, Chemical Reviews, 90:543-584 (1990)).
[34]
The polynucleotide sequence of the gene encoding the protein having the amino acid sequence of SEQ ID NO: 1 can be obtained from a known database, for example, NCBI GenBank, but is not limited thereto.
[35]
The polynucleotide is 60%, 70%, 80%, 83%, 84%, 85%, 86%, 87 with the polynucleotide encoding the protein having the amino acid sequence of SEQ ID NO: 1 of the present application or the protein of the present application %, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 97%, 98% or 99% polynucleotides encoding proteins with homology or identity.
[36]
Specifically, the protein having the amino acid sequence of SEQ ID NO: 1 is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% of the polynucleotide sequence of SEQ ID NO: 2. It may be a polynucleotide having the same identity or identity. However, a polynucleotide sequence encoding a protein having an activity corresponding to a protein consisting of the amino acid sequence of SEQ ID NO: 1 is not limited thereto and is included in the scope of the present application. It is self-evident.
[37]
In addition, it is obvious that a polynucleotide that can be translated into a protein having the same amino acid sequence or a protein having homology thereto may be included due to the genetic code degeneracy. In addition, probes that can be prepared from known gene sequences, for example, proteins having the activity of a protein consisting of the amino acid sequence of SEQ ID NO: 1 by hybridizing with complementary sequences to all or part of the base sequence under stringent conditions If it is a sequence encoding the can be included without limitation. The term “strict conditions” refers to conditions that enable specific hybridization between polynucleotides. These conditions are described in J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; FM Ausubel et al., Current Protocols in Molecular Biology , John Wiley & Sons, Inc., New York). For example, genes with high homology, 40% or more, specifically 70% or more, 80% or more, 85% or more, 90% or more, more specifically 95% or more, more specifically 97% or more, Specifically, hybridization between genes having a homology of 99% or more, and hybridization between genes with lower homology than that, or 60°C, 1×SSC, 0.1% SDS, which is a washing condition for normal Southern hybridization , Specifically, at a salt concentration and temperature corresponding to 60° C., 0.1×SSC, 0.1% SDS, and more specifically 68° C., 0.1×SSC, and 0.1% SDS, one time, specifically two to three times washing is performed. Conditions can be enumerated. Hybridization requires that two nucleic acids have complementary sequences, although mismatches between bases are possible depending on the stringency of hybridization. The term “complementary” is used to describe the relationship between nucleotide bases that are hybridizable to each other. For example, with respect to DNA, adenosine is complementary to thymine and cytosine is complementary to guanine. Accordingly, the present application can also include isolated nucleic acid fragments complementary to the entire sequence as well as substantially similar nucleic acid sequences.
[38]
Specifically, polynucleotides having homology or identity can be detected using hybridization conditions including a hybridization step at a Tm value of 55° C. and using the above-described conditions. In addition, the Tm value may be 60°C, 63°C or 65°C, but is not limited thereto, and may be appropriately adjusted by a person skilled in the art according to the purpose.
[39]
The appropriate stringency to hybridize a polynucleotide depends on the length and degree of complementarity of the polynucleotide, and variables are well known in the art (see Sambrook et al., supra, 9.50-9.51, 11.7-11.8).
[40]
[41]
In the present application, the term "homology" or "identity" refers to the degree to which two given amino acid sequences or nucleotide sequences match and may be expressed as a percentage. The terms homology and identity can often be used interchangeably. Herein, a homologous sequence thereof having the same or similar activity as a given amino acid sequence or polynucleotide sequence is designated as "% homology".
[42]
The sequence homology or identity of a conserved polynucleotide or polypeptide is determined by standard alignment algorithms, and default gap penalties established by the program used can be used together. Substantially, homologous or identical (identical) sequences are typically at least about 50%, 60%, 70%, 80% of the entire or full-length sequence in medium or high stringent conditions. Or it can hybridize to 90% or more. Hybridization also contemplates polynucleotides containing degenerate codons instead of codons in the polynucleotide.
[43]
Whether any two polynucleotide or polypeptide sequences have homology, similarity or identity, see, eg, Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: Using the default parameters as in 2444, it can be determined using known computer algorithms such as the "FASTA" program. Or, as performed in the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later), It can be determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453). (GCG program package (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215] : 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego, 1994, and [CARILLO ETA/.] (1988) SIAM J Applied Math 48: 1073) For example, homology, similarity or identity can be determined using BLAST, or ClustalW from the National Center for Biotechnology Information.
[44]
The homology, similarity or identity of a polynucleotide or polypeptide is, for example, Smith and Waterman, Adv. Appl. As known in Math (1981) 2:482, for example, Needleman et al. (1970), J Mol Biol. 48: 443 can be determined by comparing sequence information using a GAP computer program. In summary, the GAP program defines the total number of symbols in the shorter of the two sequences, divided by the number of similar aligned symbols (i.e., nucleotides or amino acids). The default parameters for the GAP program are (1) a binary comparison matrix (contains values of 1 for identity and 0 for non-identity) and Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979), Gribskov et al (1986) Nucl. Acids Res. 14: Weighted comparison matrix of 6745 (or EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix); (2) a penalty of 3.0 for each gap and an additional 0.10 penalty for each symbol in each gap (or gap open penalty 10, gap extension penalty 0.5); And (3) no penalty for the end gap. Thus, as used herein, the term “homology” or “identity” refers to relevance between sequences.
[45]
[46]
In the present application, the microorganism of the genus Corynebacterium producing the purine nucleotide may be an inactivated protein comprising the amino acid sequence of SEQ ID NO: 1.
[47]
At this time, the inactivation of the protein comprising the amino acid sequence of SEQ ID NO: 1 is a protein encoded by a gene comprising the polynucleotide sequence of SEQ ID NO: 2 or inactivation of WhiB-family protein, inactivation of WhiB transcriptional regulators It can be used interchangeably in the same sense as the inactivation of.
[48]
[49]
In the present application, the term “protein inactivated with the amino acid sequence of SEQ ID NO: 1” is not expressed at all compared to the parent strain or the protein with the amino acid sequence of SEQ ID NO: 1 is unmodified strain. Even if it is expressed or expressed, it means that the activity is absent or reduced. In addition, it means that the activity of the protein (WhcEDBA) encoded by the gene of the WhiB-family group is inactive or reduced compared to the parent strain or unmodified strain. At this time, the reduction is due to the mutation or deletion of the gene encoding the protein, the activity of the protein is reduced compared to the activity of the protein originally possessed by the microorganism, and the expression of the gene encoding it or the inhibition of translation (translation), etc. If the overall activity of the protein in the cell is lower than that of the native strain or the strain before modification, it is a concept that also includes a combination of these.
[50]
In this application, it was first identified that the inactivation of the protein is related to the productivity of the purine nucleotide.
[51]
[52]
In the present application, the inactivation can be achieved by application of various methods well known in the art. Examples of the method include: 1) a method of deleting all or part of the gene encoding the protein; 2) modification of the expression control sequence so that the expression of the gene encoding the protein decreases, 3) modification of the gene sequence encoding a protein such that the activity of the protein is removed or weakened, 4) the gene encoding the protein Introduction of an antisense oligonucleotide (eg, antisense RNA) that complementarily binds to the transcript of the; 5) Adding a sequence complementary to the sine-Dalgarno sequence to the front of the sine-Dalgarno sequence of the gene encoding the protein to form a secondary structure, making it impossible to attach the ribosome Way; 6) There is a method of adding a promoter transcribed in the opposite direction to the 3'end of the open reading frame (ORF) of the polynucleotide sequence of the gene encoding the protein (Reverse transcription engineering, RTE). It can also be achieved, but is not particularly limited.
[53]
[54]
Specifically, a method of deleting a part or all of the gene encoding the protein is a polynucleotide or a marker gene in which some nucleotide sequences are deleted from a polynucleotide encoding an intrinsic target protein in a chromosome through a vector for inserting a chromosome in a microorganism. It can be done by replacing with. As an example of a method of deleting some or all of these polynucleotides, a method of deleting polynucleotides by homologous recombination may be used, but is not limited thereto.
[55]
In addition, a method of deleting a part or all of the gene may be performed by inducing a mutation using light or a chemical such as ultraviolet rays, and selecting a strain in which the target gene is deleted from the obtained mutant. The gene deletion method includes a method by DNA recombination technology. The DNA recombination technique may be achieved, for example, by injecting a nucleotide sequence or a vector containing a nucleotide sequence homologous to a target gene into the microorganism to cause homologous recombination. In addition, the injected nucleotide sequence or vector may include a dominant selection marker, but is not limited thereto.
[56]
In addition, the method of modifying the expression control sequence can be achieved by applying various methods well known in the art. As an example of the method, a polynucleotide sequence is deleted, inserted, non-conservative or conservative substitution, or a combination thereof to induce variation in the expression control sequence to further weaken the activity of the expression control sequence, or has a weaker activity. This can be done by replacing the polynucleotide sequence. The expression control sequence includes, but is not limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence that controls termination of transcription and translation.
[57]
In addition, the method of modifying the gene sequence is performed by inducing a variation in the sequence by deleting, inserting, non-conservative or conservative substitution, or a combination thereof, to further weaken the activity of the enzyme, or to have a weaker activity. It can be performed by replacing the modified gene sequence so that there is no improved gene sequence or activity, but is not limited thereto.
[58]
[59]
In the present application, the term "microorganisms producing purine nucleotides" or "microorganisms having a purine nucleotide production capacity" is a microorganism having natural purine nucleotide production capacity or a parent strain having no production capacity of purine nucleotide, to which the production capacity of purine nucleotide is given Means microorganisms. Specifically, a protein comprising the amino acid sequence of SEQ ID NO: 1, WhiB-family protein or WhiB transcriptional regulator may be inactivated and may be a microorganism having a purine nucleotide production capacity.
[60]
In the present application, "microorganisms of the genus Corynebacterium" may include all microorganisms of the genus Corynebacterium. Specifically, Corynebacterium stationis , Corynebacterium glutamicum , Corynebacterium phocae , Corynebacterium flavescens , Corynebacterium flavescens Corynebacterium Hugh Miele dew sense ( Corynebacterium humireducens ), Corynebacterium halo Toledo lance ( Corynebacterium halotolerans ), Corynebacterium pole Ruti Solid ( Corynebacterium pollutisoli ), Corynebacterium grains over ( Corynebacterium marinum ) or Corynebacterium Leeum presentation punished Regensburg ( of Corynebacterium freiburgense ), Corynebacterium Sistine display ( of Corynebacterium cystitidis ), Corynebacterium durum wheat ( Corynebacterium durum ), Corynebacterium pilosum or Corynebacterium testudinoris , and more specifically, Corynebacterium statinis, but is not limited thereto.
[61]
On the other hand, it has been known that the microorganism of the genus Corynebacterium can produce purine nucleotides, but its production capacity is remarkably low, and the gene or mechanism of action acting on the production mechanism is unknown. Accordingly, the microorganism of the genus Corynebacterium producing the purine nucleotide of the present application is a genus of Corynebacterium that has enhanced purine nucleotide production capacity by enhancing or inactivating the activity of the gene associated with the natural microorganism itself, the purine nucleotide production mechanism. Refers to microorganisms in Corynebacterium that have improved purine nucleotide production capacity by introducing or enhancing the activity of microorganisms or external genes. Specifically, the microorganism of the genus Corynebacterium may be Corynebacterium conditioner with enhanced biosynthetic pathway of purine nucleotide, and the enhancement may be enhanced with activity of a protein involved in the biosynthetic pathway. Alternatively, the microorganism of the genus Corynebacterium may be Corynebacterium conditioner with the activity of a protein involved in the decomposition pathway of a purine nucleotide or its precursor inactivated.
[62]
At this time, examples of proteins involved in the purine nucleotide biosynthesis pathway, when the purine nucleotide is IMP, amidophosphoribosyltransferase (PurF), phosphoribosylamine-glycine ligase (phosphoribosylamine-glycine ligase; PurD ), phosphoribosylglycinamide formyltransferase (PurN), phosphoribosylformylglycinamidine synthase (PurL), AIR synthetase (FGAM cyclase), phosphoryase Bosylaminoimidazole carboxylase, phosphoribosylaminoimidazolesuccinocarboxamide synthase, adenylosuccinate lyase (ADSL), phosphoribosylcarboximidase It may include one or more proteins selected from the group consisting of phosphoribosylaminoimidazolecarboxamide formyltransferase and inosine monophosphate synthase.
[63]
In addition, when the purine nucleotide is XMP, an example of the protein having enhanced activity may further include IMP dehydrogenase in the group consisting of the proteins.
[64]
In addition, when the purine nucleotide is GMP, examples of the protein with enhanced activity may include IMP dehydrogenase or/and GMP synthase in addition to the group consisting of the proteins. have.
[65]
In addition, when the purine nucleotide is AMP, an example of the protein having enhanced activity may include adenylosuccinate synthase (purA) in addition to the group consisting of the proteins.
[66]
Most specifically, the protein involved in the purine nucleotide biosynthetic pathway may be amidophosphoribosyltransferase (PurF), but is not limited thereto.
[67]
[68]
Another aspect of the present application provides a method for producing a purine nucleotide, comprising culturing the microorganism according to the present application in a medium.
[69]
The production method may further include the step of recovering the purine nucleotide,
[70]
The microorganisms and purine nucleotides are as described above.
[71]
[72]
In the present application, the term "cultivation" means to grow microorganisms under environmental conditions artificially controlled. In the present application, the method of culturing microorganisms of the genus Corynebacterium can be performed using methods well known in the art. Specifically, the culture may be continuously cultured in a batch process, an injection batch or a repeated fed batch process, but is not limited thereto.
[73]
The step of culturing the microorganism is not particularly limited, but may be performed by a known batch culture method, a continuous culture method, a fed-batch culture method, and the like. The medium and other culture conditions used for cultivation of the microorganisms of the present application can be any medium as long as it is a medium used for the cultivation of ordinary microorganisms. It can be cultured under aerobic conditions in an ordinary medium containing amino acids and/or vitamins while controlling temperature, pH, and the like. . Culture media for Corynebacterium strains are known (e.g., Manual of Methods for General Bacteriology by the American Society for Bacteriology, Washington DC, USA, 1981). Sugars that can be used in the medium include sugars and carbohydrates such as glucose, saccharose, lactose, fructose, maltose, starch, cellulose, oils and fats such as soybean oil, sunflower oil, castor oil, coconut oil, palmitic acid, and stearic acid. , Fatty acids such as linoleic acid, alcohols such as glycerol and ethanol, and organic acids such as acetic acid. These materials may be used individually or as a mixture, but are not limited thereto.
[74]
Nitrogen sources that can be used include peptone, yeast extract, gravy, malt extract, corn steep liquor, soybean wheat and urea or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate. The nitrogen source may also be used individually or as a mixture, but is not limited thereto.
[75]
Personnel that can be used may include potassium dihydrogen phosphate or dipotassium phosphate or a salt containing the corresponding sodium. In addition, the culture medium may contain a metal salt such as magnesium sulfate or iron sulfate necessary for growth. Finally, in addition to the above materials, essential growth materials such as amino acids and vitamins can be used. In addition, precursors suitable for the culture medium may be used. The above-mentioned raw materials may be added batchwise or continuously in an appropriate manner to the culture during the culture process.
[76]
During the cultivation of the microorganism, the pH of the culture can be adjusted by using a basic compound such as sodium hydroxide, potassium hydroxide or ammonia or an acid compound such as phosphoric acid or sulfuric acid in an appropriate manner. In addition, anti-foaming agents such as fatty acid polyglycol esters can be used to suppress the formation of bubbles. To maintain aerobic conditions, oxygen or oxygen-containing gas (eg, air) can be injected into the culture. The temperature of the culture may be usually 20°C to 45°C, specifically 25°C to 40°C. Incubation time may be continued until a desired amount of L-amino acid is obtained, but specifically, it may be 10 to 160 hours.
[77]
Purine nucleotides produced by the culture may be secreted into the medium or remain in cells.
[78]
[79]
The production method of the present application may further include a step of recovering purine nucleotides from the microorganism or medium after the culture step.
[80]
The purine nucleotide can be recovered by conventional methods known in the art. As such a recovery method, methods such as centrifugation, filtration, ion exchange chromatography, and crystallization can be used. For example, the culture may be centrifuged at low speed to remove biomass and the obtained supernatant may be separated through ion exchange chromatography, but is not limited thereto, and microorganisms cultured using a suitable method known in the art Alternatively, the desired purine nucleotide can be recovered from the medium.
[81]
The recovery step may further include a separation process and/or a purification process.
[82]
[83]
Another aspect of the present application provides a use for increasing purine nucleotide production of a microorganism of the genus Corynebacterium, wherein a protein comprising the amino acid sequence of SEQ ID NO: 1 of the present application is inactivated.
[84]
Another aspect of the present application provides a method of increasing purine nucleotide production, comprising inactivating a protein comprising SEQ ID NO: 1 of the present application in a microorganism of the genus Corynebacterium.
[85]
The terms, "purine nucleotide", "protein comprising amino acid sequence of SEQ ID NO: 1", "inactivation" and "microorganism in Corynebacterium" are as described above.
[86]
Mode for carrying out the invention
[87]
Hereinafter, the present application will be described in more detail through examples. However, these examples are for illustrative purposes only, and the scope of the present application is not limited to these examples.
[88]
[89]
Example 1: Construction of a recombinant vector aimed at inactivation of WhiB-family proteins
[90]
[91]
WhiB-family protein was selected as an inactivation target protein to increase purine nucleotide production capacity.
[92]
[93]
Example 1-1: Corynebacterium conditioner WhiB-family protein selection
[94]
[95]
The genome of wild-type Corynebacterium stationis (ATCC 6872) was searched for, and one of the genes considered to be effective was selected. Based on this, it was confirmed that the Transcriptional regulator WhiB.
[96]
[97]
Example 1-2: Preparation of coding gene fragment for WhiB-family protein inactivation
[98]
[99]
The chromosomal gene of the ATCC 6872 strain, which is a wild type of Corynebacterium strainis, was extracted using a G-spin total DNA extraction kit (Intron, Cat. No. 17045). Subsequently, a polymerase chain reaction (PCR) was performed using the chromosomal gene as a template.
[100]
Then, in order to inactivate the WhiB-family protein, the gene encoding the protein was deleted to completely remove the intrinsic activity, or the gene was attenuated to minimize the expression level of the protein encoding.
[101]
Specifically, the intrinsic activity of the gene was removed using the vector prepared according to Example 1-2-1, and the intrinsic initiation codon of the strain using the vector prepared according to Example 1-2-2. ATG was replaced by GTG or TTG. It is known that the GTG or TTG codon has a lower protein expression efficiency than the ATG codon.
[102]
[103]
Example 1-2-1: Construction of a vector encoding a gene encoding a WhiB-family protein
[104]
[105]
To produce a vector for the purpose of deletion of a gene encoding a WhiB-family protein, the ATCC 6872 strain was used as a template, and primer pairs of SEQ ID NO: 3 and SEQ ID NO: 4 and primer pairs of SEQ ID NO: 5 and SEQ ID NO: 6 were used. Gene fragments (deletion-A, deletion-B) were obtained, respectively. At this time, the conditions for PCR is denaturation at 94°C for 5 minutes, followed by denaturation at 94°C for 30 seconds; Annealing at 55° C. for 30 seconds; And after repeating the polymerization for 120 seconds at 72 ℃ 25 times, the polymerization reaction was performed at 72 ℃ for 7 minutes.
[106]
As a result, deletion-A was 1026 bp and deletion-B was able to obtain a polynucleotide having a size of 1044 bp. Overlapping PCR was performed using the two fragments as a template using SEQ ID NO: 3 and SEQ ID NO: 6 to obtain a PCR result of 2050 bp (hereinafter referred to as "deletion fragment").
[107]
The obtained deletion fragment was treated with restriction enzyme XbaI (New England Biolabs, Beverly, MA), and then ligated using pDZ vector and T4 ligase (New England Biolabs, Beverly, MA) treated with the same restriction enzyme. After transforming the produced gene into E. coli DH5α, it was selected from LB medium containing kanamycin, and DNA was obtained using the entire DNA-spin plasmid DNA kit (iNtRON).
[108]
The vector produced by the method described above for the purpose of deletion of the gene encoding the WhiB-family protein was named as'pDZ-deletion'.
[109]
[110]
Example 1-2-2: Construction of vector with weak expression of WhiB-family protein
[111]
[112]
In order to construct a vector aimed at attenuating the gene encoding the WhiB-family protein, ATG, the initiation codon of the ATCC 6872 strain, was modified with TTG or GTG.
[113]
First, in order to prepare a strain in which the initiation codon is modified with TTG, the ATCC 6872 strain is used as a template, and the primer pair of SEQ ID NO: 7 and SEQ ID NO: 8 and the primer pair of SEQ ID NO: 9 and SEQ ID NO: 10 are used as TTG or GTG. Modified gene fragments (a1t-A and a1t-B) were obtained, respectively. As a result, a1t-A was able to obtain a polynucleotide having a size of 974bp for a1t-A and 982bp for a1t-B, and PCR of 1955bp was performed by overlapping PCR using SEQ ID NO: 7 and SEQ ID NO: 10 as the template. The result (hereinafter referred to as'a1t fragment') was obtained.
[114]
In addition, in order to produce a strain in which the start codon is modified with GTG, the ATCC 6872 strain is used as a template, and a gene fragment (a1g) using a primer pair of SEQ ID NO: 7 and SEQ ID NO: 11 and a primer pair of SEQ ID NO: 12 and SEQ ID NO: 10 -A and a1g-B) were obtained, respectively. As a result, polynucleotides having a size of 974 bp for a1g-A and 982 bp for a1g-B were obtained. Overlapping PCR was performed using the two fragments as a template using SEQ ID NO: 7 and SEQ ID NO: 10 to obtain a PCR result of 1955 bp (hereinafter referred to as "a1g fragment").
[115]
Meanwhile, the conditions of each PCR are all the same, and after denaturation at 94°C for 5 minutes; After denaturation at 94°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 120 seconds were repeated 25 times; The polymerization reaction was performed at 72°C for 7 minutes.
[116]
After the fragment of the obtained gene was treated with restriction enzyme XbaI (New England Biolabs, Beverly, MA), it was ligated using a pDZ vector treated with the same restriction enzyme and T4 ligase (New England Biolabs, Beverly, MA). After transforming the produced gene into E. coli DH5α, it was selected from LB medium containing kanamycin, and DNA was obtained using the entire DNA-spin plasmid DNA kit (iNtRON).
[117]
Vectors for the purpose of attenuating the gene encoding the WhiB-family protein, produced by the above-described method, were named as'pDZ-a1t' or'pDZ-a1g', respectively.
[118]
On the other hand, the sequences of the primers used for vector production are listed in Table 1 below.
[119]
[120]
[Table 1]
SEQ ID NO: 3 TGCTCTAGA GATCTAGCACGCCTAAAGAGTCG
SEQ ID NO: 4 GTAGGTGTCCGCCTGAGTTG
SEQ ID NO: 5 CAACTCAGGCGGACACCTAC TCACTAACTGGGCTGATTATCTCG
SEQ ID NO: 6 TGCTCTAGAGGTGCCCTTCATCATCAGGT
SEQ ID NO: 7 CGC GGA TCC CAGCCATTAGGTAAGGTGCTTG
SEQ ID NO: 8 AGAGGCGTATTCACGCTCTG
SEQ ID NO: 9 CAGAGCGTGAATACGCCTC TTGAGATTATGTGTGGATAAGCAGAAG
SEQ ID NO: 10 CGC GGA TCC CGAGGATACAAAGCCCACGA
SEQ ID NO: 11 CGAGGCGTATTCACGCTCTG
SEQ ID NO: 12 CAGAGCGTGAATACGCCTC GTGAGATTATGTGTGGATAAGCAGAAG
[121]
[122]
Example 2: Construction of WhiB-family protein inactivated strain using wild type strain producing purine nucleotide and evaluation of purine nucleotide production capacity thereof
[123]
[124]
Example 2-1: Preparation of WhiB-family protein inactivated strain using wild type derived strain producing XMP among purine nucleotides
[125]
[126]
Corynebacterium strain KCCM-10530 strain (Republic of Korea Patent No. 10-0542568) the two vectors produced according to Example 1 above (pDZ-a1t and pDZ-a1g) were independently independent by electroporation After transformation, the colonies grown in a selection medium containing kanamycin 25 mg/L were first selected.
[127]
Thereafter, through a second cross-linking process using homology between the intrinsic gene of the strain and the polynucleotide included in the vector, the gene encoding the WhiB-family protein is deleted, or the form in which the initiation codon is weakened (ATG→TTG , Or ATG→GTG).
[128]
On the other hand, the strain that deleted the gene encoding the WhiB-family protein was selected using primers of SEQ ID NO: 13 and SEQ ID NO: 6. When PCR is performed with the primer, a fragment having a size of 1680 bp appears in the wild-type strain, but a fragment with a size of 1414 bp is detected in the case of a gene-deficient strain.
[129]
In addition, strains with weakened genes encoding WhiB-family proteins were selected based on mismatch PCR. The ATG→TTG mutation was selected using SEQ ID NO: 14 and SEQ ID NO: 6, and the ATG→GTG mutation was selected using SEQ ID NO: 15 and SEQ ID NO: 6. The SEQ ID NOs: 14 and 15 each contained T or G instead of the base sequence A of the wild-type strain at the 3'end, so that PCR fragments were detected only when there was a mutation. The strains first identified by mismatch PCR were finally confirmed through gene sequencing.
[130]
Finally, the strain that deleted the gene encoding the WhiB-family protein obtained by the above method was named'CN02-1545', and the strain where the initiation codon was replaced with TTG form and the gene was weakened was'CJX-1546. ', and the strain in which the gene was attenuated by replacing the starting codon with GTG was designated as'CJX-1547'.
[131]
Meanwhile, the sequences of the primers used for the production of the strains are listed in Table 2 below.
[132]
[133]
[Table 2]
SEQ ID NO: 13 CATGTTGTTGCCCTCGGAATC
SEQ ID NO: 14 CGTGAATACGCCTCT
SEQ ID NO: 15 CGTGAATACGCCTCG
[134]
Meanwhile, the CN02-1545 strain was internationally deposited with the Korea Microbiological Conservation Center (KCCM), a depository organization under the Budapest Treaty on November 7, 2017, and was assigned a deposit number of KCCM12152P.
[135]
[136]
Example 2-2: Evaluation of XMP production capacity of strain in which WhiB-family protein is inactivated
[137]
[138]
Corynebacterium Stability KCCM-10530 producing XMP among purine nucleotides and CN02-1545, CJX-1546, and CJX-1547 strains prepared through Example 2-1 were used to measure XMP production capacity as follows. The same culture method was used.
[139]
5 ml of the following seed medium was dispensed into a test tube with a diameter of 18 mm, autoclaved according to the conventional method, inoculated with the strain used, and cultured by shaking at 30°C for 18 hours at 180 rpm to use as a seed culture solution. Of the fermentation medium, the main medium and the separate sterilization medium were autoclaved according to a commercial method, respectively, and dispensed 29 ml and 10 ml into 500 ml volume Erlenmeyer flasks pre-sterilized, and 1 ml of the seed culture solution was inoculated and cultured for 72 hours. . The rotation speed was adjusted to 200 rpm and the temperature to 30°C.
[140]
The medium composition used was as follows. After the culture was completed, the production amount of XMP was measured by a method using HPLC, and the results are shown in Table 3 below. The XMP accumulation concentration was expressed as '5'-sodium xanthate·7H 2 O'.
[141]
[142]
XMP Flask Medium
[143]
Glucose 30 g/L, peptone 15 g/L, yeast extract 15 g/L, sodium chloride 2.5 g/L, urea 3 g/L, adenine 150 mg/L, guanine 150 mg/L, pH 7.2
[144]
[145]
XMP Flask Production Badge (Main Badge)
[146]
Glucose 60 g/L, magnesium sulfate 10 g/L, calcium chloride 10 mg/L, iron sulfate 20 mg/L, manganese sulfate 10 mg/L, zinc sulfate 10 mg/L, copper sulfate 1 mg/L, biotin 100 ug/ L, Thiamine 5 mg/L, Adenine 30 mg/L, Guanine 30 mg/L, pH 7.2
[147]
[148]
XMP flask production medium (separate sterilization medium)
[149]
Potassium Phosphate 10 g/L, Potassium Phosphate 10 g/L, Urea 7 g/L, Ammonium Sulfate 5 g/L
[150]
[151]
[Table 3]
Strain number XMP(g/L) Productivity (g/L/hr)
KCCM10530 11.8 0.148
CN02-1545 13.1 0.191
CJX-1546 12.3 0.188
CJX-1547 12.5 0.198
[152]
At this time, in Table 3, the productivity represents the amount of XMP produced per unit time at 48 hours after incubation.
[153]
As shown in Table 3, the strain KCCM10530 of the parent strain produced 11.8 g/L of XMP after completion of the flask culture, and CN02-1545 produced 1.3 g/L of XMP compared to the parent strain KCCM10530 and 0.5 of CJX-1546. It was confirmed that g/L and CJX-1547 increased by 0.7 g/L. This confirmed that the XMP production was improved by 11%, 4%, and 6%, respectively, compared to the parent strain.
[154]
In addition, the strain KCCM10530 of the parent strain showed a productivity of 0.148 g/L/hr, but 0.102 g/L/hr for CN02-1545, 0.188 g/L/hr for CJX-1546, and 0.198 g/L for CJX-1547. /hr was confirmed. This confirmed that the XMP productivity was improved by 29%, 27%, and 34%, respectively, compared to the parent strain.
[155]
These results suggest that inactivation of the WhiB-family protein of the present application increases the production of purine nucleotides.
[156]
[157]
Example 3: Preparation of a WhiB-family protein-inactivated strain using a mutant strain that produces a purine nucleotide enriched in the purine biosynthetic pathway gene and evaluation of its ability to produce purine nucleotides
[158]
[159]
Example 3-1: Construction of WhiB-family protein-inactivated strains using mutant strains producing XMP in purine nucleotides
[160]
[161]
A strain in which the gene encoding the WhiB-family protein was inactivated was produced using the XMP-producing strain having the purine biosynthetic pathway gene enhanced. Specifically, the XMP-producing strain in which the purine biosynthetic pathway gene is enhanced is a strain in which PurF is enhanced in KCCM-10530, and the initiation codon GTG of the purF gene is changed to ATG. The purine biosynthetic pathway gene purF-enhanced KCCM-10530 strain was named CJX-1544 [KCCM-10530_purF(g1a)]. After transforming the recombinant vector pDZ-deletion vector prepared in Example 1 into the CJX-1544 [KCCM-10530_purF(g1a)] strain by electroporation, grown in a selective medium containing 25 mg/L of kanamycin. Colonies were selected first.
[162]
Thereafter, through a second cross-linking process using homology between the intrinsic gene of the strain and the polynucleotide included in the vector, a strain in which the gene encoding the WhiB-family protein was deleted was obtained. On the other hand, the strain that deleted the gene encoding the WhiB-family protein was confirmed using SEQ ID NO: 13 and SEQ ID NO: 6 in the same manner as in Example 2.
[163]
Finally, the strain that deleted the gene encoding the WhiB-family protein obtained by the above method was designated as'CJX-1553'.
[164]
[165]
Example 3-2: Evaluation of XMP production capacity among purine nucleotides of a strain in which a gene encoding WhiB-family protein is inactivated
[166]
[167]
In order to measure the XMP production capacity of the purine biosynthetic pathway gene purF-enhanced CJX-1544 and the CJX-1553 strain produced through Example 3-1, the same culture method as Example 2-2 was used. After the incubation was completed, XMP production was measured by a method using HPLC, and the results are shown in Table 4 below.
[168]
[169]
[Table 4]
Strain number XMP(g/L) Productivity (g/L/hr)
CJX-1544 14.0 0.183
CJX-1553 15.5 0.212
[170]
At this time, in Table 4, the productivity represents the amount of XMP produced per unit time at 48 hours after incubation.
[171]
As shown in Table 4, it was confirmed that the CJX-1553 strain increased the amount of XMP by 1.5 g/L compared to the parental strain CJX-1544, which was purF, a purine biosynthetic pathway factor. This confirmed that the XMP production was improved by 10.7% compared to the parent strain CJX-1544.
[172]
In addition, it was confirmed that the parent strain CJX-1544 strain showed a productivity of 0.183 g/L/hr, and CJX-1553 showed 0.212 g/L/hr. This confirmed that the XMP productivity was improved by 16% compared to the parent strain CJX-1544.
[173]
[174]
Example 4: Construction of WhiB-family protein inactivated strain using wild-type strain producing purine nucleotide and evaluation of purine nucleotide production capacity thereof
[175]
[176]
Example 4-1: Construction of WhiB-family protein inactivated strain using wild type derived strain producing IMP among purine nucleotides
[177]
[178]
Corynebacterium stashness KCCM-10610 (Republic of Korea Patent No. 10-0588577) two vectors produced according to Example 1 above (pDZ-a1t and pDZ-a1g) were independently independently electroporated After transformation, colonies grown in a selection medium containing kanamycin 25 mg/L were first selected.
[179]
Subsequently, through a second cross-linking process using homology between the intrinsic gene of the strain and the polynucleotide included in the vector, a form in which the start codon of the gene encoding the WhiB-family protein is weakened (ATG→TTG, or ATG→ GTG) strains were obtained.
[180]
Strains with weakened genes encoding WhiB-family proteins were selected based on mismatch PCR. The ATG→TTG mutation was selected using SEQ ID NO: 14 and SEQ ID NO: 6, and the ATG→GTG mutation was selected using SEQ ID NO: 15 and SEQ ID NO: 6. The SEQ ID NOs: 14 and 15 each contained T or G instead of the base sequence A of the wild-type strain at the 3'end, so that PCR fragments were detected only when there was a mutation. The strains first identified by mismatch PCR were finally confirmed through gene sequencing.
[181]
Finally, the start codon of the gene encoding the WhiB-family protein obtained by the above method is replaced with TTG form, and the strain where the gene is attenuated is'CJI-2078', and the start codon is replaced with GTG form. The weakened strain was designated as'CJI-2077'.
[182]
[183]
Example 4-2: Evaluation of IMP production capacity in purine nucleotide of WhiB-family protein inactivated strain
[184]
[185]
Corynebacterium strain KCCM-10610, an IMP-producing strain of purine nucleotides, and the following culture method were used to measure the IMP production capacity of CJI-2078 and CJI-2077 strains prepared through Example 4-1. Did.
[186]
5 ml of the seed medium was inoculated into a pressure-sterilized test tube (diameter 18 mm) and shaken and cultured at a temperature of 30° C. for 24 hours to be used as a seed culture solution. 29 ml of the production medium was dispensed into an Erlenmeyer flask for 250 ml shaking, autoclaved at 121°C for 15 minutes, inoculated with 2 ml of a seed culture solution, and cultured for 4 to 5 days. The culture conditions were adjusted to a rotation speed of 170 rpm, a temperature of 30°C, and pH 7.5.
[187]
The medium composition used was as follows, and after the culture was completed, the yield of IMP was measured by a method using HPLC, and the results are shown in Table 5 below.
[188]
[189]
IMP bell medium
[190]
Glucose 10 g/L, peptone 10 g/L, juicy 10 g/L, yeast extract 10 g/L, sodium chloride 2.5 g/L, adenine 100 mg/L, guanine 100 mg/L, pH7.2
[191]
[192]
IMP flask production medium
[193]
Sodium glutamate 1 g/L, ammonium chloride 10 g/L, magnesium sulfate 12 g/L, calcium chloride 0.1 g/L, iron sulfate 20 mg/L, manganese sulfate 20 mg/L, zinc sulfate 20 mg/L, copper sulfate 5 ㎎/L, L-cysteine 23 ㎎/L, alanine 24 ㎎/L, nicotinic acid 8 ㎎/L, biotin 45 ㎍/L, thiamine hydrochloride 5 ㎎/L, adenine 30 ㎎/L, phosphoric acid (85%) 19 g /L, glucose 26g/L, fructose 14g/L addition
[194]
[195]
[Table 5]
Strain number IMP(g/L)
KCCM-10610 11.2
CY-2078 11.7
CY-2077 11.4
[196]
As shown in Table 5, it was confirmed that the CJI-2078 strain increased IMP production by 0.5 g/L and CJI-2077 by 0.2 g/L compared to the parent strain KCCM-10610. This confirmed that the IMP production was improved by 4.5% and 1.8%, respectively, compared to the parent strain.
[197]
[198]
Example 5: Production of a WhiB-family protein-inactivated strain using a mutant strain producing a purine nucleotide enriched in a purine biosynthetic pathway gene, and evaluation of its purine nucleotide production capacity
[199]
[200]
Example 5-1: Preparation of WhiB-family protein inactivated strain using mutant strain producing IMP among purine nucleotides
[201]
[202]
Using the IMP-producing strain having the enhanced purine biosynthetic pathway gene, a strain in which the WhiB-family protein was inactivated was prepared. Specifically, the IMP-producing strain in which the purine biosynthetic pathway gene is enhanced is a strain in which purC biosynthetic pathway gene purF is enhanced in KCCM-10610, and the initiation codon GTG of the purF gene is changed to ATG. The purine biosynthetic pathway gene purF-enhanced KCCM-10610 strain was named CJI-1964 [KCCM-10610_purF(g1a)]. After transforming the two vectors (pDZ-a1t and pDZ-a1g) prepared in Example 1 into the CJI-1964 [KCCM-10610_purF(g1a)] strain by electroporation, Example 4-1 and In the same way, strains in which the start codon of the gene encoding the WhiB-family protein was changed to a weakened form (ATG→TTG, or ATG→GTG) were obtained.
[203]
Finally, the start codon of the gene encoding the WhiB-family protein obtained by the above method is replaced with TTG form, and the strain where the gene is attenuated is'CJI-2081', and the start codon is replaced with GTG form. The weakened strain was designated as'CJI-2080'.
[204]
[205]
Example 5-2: Evaluation of IMP production capacity in purine nucleotide of WhiB-family protein inactivated strain
[206]
[207]
In order to measure the IMP production capacity of the CJI-1964 strain and the CJI-2081 and CJI-2080 strains produced through Example 5-1, the purine biosynthetic pathway gene is enhanced, the culture method as in Example 4-2 was used. Was used. After completion of the culture, the production amount of IMP was measured by a method using HPLC, and the results are shown in Table 6 below.
[208]
[209]
[Table 6]
Strain number IMP(g/L)
CY-1964 11.4
CY-2081 12.3
CY-2080 12.1
[210]
As shown in Table 6, CJI-2081 strain was confirmed that the IMP production was increased by 0.9 g/L and CJI-2080 by 0.7 g/L compared to the parent strain CJI-1964. This confirmed that IMP production was improved by 7.8% and 6.1%, respectively, compared to the parent strain CJI-1964.
[211]
[212]
That is, when the WhiB-family protein transcription regulator is inactivated, it was confirmed that purine nucleotides can be produced in a higher yield than parental strains or unmodified microorganisms. In addition, this result suggests that when the WhiB-family protein is inactivated, purine nucleotides can be produced in a higher yield than the parent strain or unmodified microorganism.
[213]
[214]
From the above description, those skilled in the art to which the present application pertains will understand that the present application may be implemented in other specific forms without changing its technical spirit or essential characteristics. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of the present application should be construed as including all changes or modified forms derived from the meaning and scope of the following claims rather than the detailed description and equivalent concepts thereof.
[215]
Claim
[Claim 1]
Corynebacterium conditioner to produce a purine nucleotide in which a protein composed of the amino acid sequence of SEQ ID NO: 1 is inactivated.
[Claim 2]
The purine nucleotide according to claim 1, wherein the purine nucleotide is selected from 5'-inosine monophosphate (IMP), 5'-xanthosine monophosphate (XMP), 5'-guanosine monophosphate (GMP), and 5'-adenylic acid (AMP). Corynebacterium conditioner, one or more purine nucleotides.
[Claim 3]
The Corynebacterium conditioner of claim 1, wherein the Corynebacterium conditioner is further enhanced by a biosynthetic pathway of purine nucleotides.
[Claim 4]
According to claim 3, Enhancement of the biosynthetic pathway of the purine nucleotide is that the activity of the PurF (amidophosphoribosyltransferase) protein is enhanced, Corynebacterium status.
[Claim 5]
A method for producing purine nucleotides, comprising culturing Corynebacterium conditioner according to any one of claims 1 to 4 in a medium.
[Claim 6]
The purine nucleotide according to claim 5, wherein the purine nucleotide is selected from 5'-inosine monophosphate (IMP), 5'-xanthosine monophosphate (XMP), 5'-guanosine monophosphate (GMP), and 5'-adenylic acid (AMP). A method of producing one or more purine nucleotides, purine nucleotides.
[Claim 7]
The method of claim 5, further comprising recovering purine nucleotides from the cultured Corynebacterium conditioner or medium after the culturing step.
[Claim 8]
A method of increasing purine nucleotide production, comprising inactivating a protein consisting of the amino acid sequence of SEQ ID NO: 1 in a microorganism of the genus Corynebacterium.
| # | Name | Date |
|---|---|---|
| 1 | 202037027600.pdf | 2020-06-29 |
| 2 | 202037027600-STATEMENT OF UNDERTAKING (FORM 3) [29-06-2020(online)].pdf | 2020-06-29 |
| 3 | 202037027600-SEQUENCE LISTING(PDF) [29-06-2020(online)].pdf | 2020-06-29 |
| 4 | 202037027600-SEQUENCE LISTING [29-06-2020(online)].txt | 2020-06-29 |
| 5 | 202037027600-REQUEST FOR EXAMINATION (FORM-18) [29-06-2020(online)].pdf | 2020-06-29 |
| 6 | 202037027600-PRIORITY DOCUMENTS [29-06-2020(online)].pdf | 2020-06-29 |
| 7 | 202037027600-FORM 18 [29-06-2020(online)].pdf | 2020-06-29 |
| 8 | 202037027600-FORM 1 [29-06-2020(online)].pdf | 2020-06-29 |
| 9 | 202037027600-DECLARATION OF INVENTORSHIP (FORM 5) [29-06-2020(online)].pdf | 2020-06-29 |
| 10 | 202037027600-COMPLETE SPECIFICATION [29-06-2020(online)].pdf | 2020-06-29 |
| 11 | 202037027600-Certified Copy of Priority Document [14-07-2020(online)].pdf | 2020-07-14 |
| 12 | 202037027600-Proof of Right [03-08-2020(online)].pdf | 2020-08-03 |
| 13 | 202037027600-FORM-26 [15-09-2020(online)].pdf | 2020-09-15 |
| 14 | 202037027600-FORM 3 [30-12-2020(online)].pdf | 2020-12-30 |
| 15 | 202037027600-FER.pdf | 2022-11-28 |
| 16 | 202037027600-FORM 3 [26-04-2023(online)].pdf | 2023-04-26 |
| 17 | 202037027600-FORM 3 [27-04-2023(online)].pdf | 2023-04-27 |
| 18 | 202037027600-OTHERS [11-05-2023(online)].pdf | 2023-05-11 |
| 19 | 202037027600-FER_SER_REPLY [11-05-2023(online)].pdf | 2023-05-11 |
| 20 | 202037027600-CLAIMS [11-05-2023(online)].pdf | 2023-05-11 |
| 21 | 202037027600-PatentCertificate23-01-2024.pdf | 2024-01-23 |
| 22 | 202037027600-IntimationOfGrant23-01-2024.pdf | 2024-01-23 |
| 1 | SEQSEARCHE_25-11-2022.pdf |