Abstract: Dehydrin- and late embryogenic abundant (LEA) protein-encoding polynucleotides from coffee plants are disclosed. Also disclosed are a promoter sequence from a coffee dehydrin gene, and methods for using these polynucleotides and promoter sequences for gene regulation and manipulation of flavor, aroma, stress tolerance and other features of coffee beans.
1. 2. A nucleic acid molecule isolated from coffee (Coffea spp.), having a coding sequence that encodes a dehydrin or a late embryogenic abundant (LEA) protein.
3. The nucleic acid molecule of claim 1, wherein the coding sequence encodes a dehydrin having a molecular weight of between about 17 kDa and about 26 kDa.
4. The nucleic acid molecule of claim 2, wherein the dehydrin or LEA protein has an amino acid sequence that is 46% or more identical to any one of SEQ ID NOS: 7-12.
5. The nucleic acid molecule of claim 3, wherein the dehydrin or LEA protein has an amino acid sequence of any one of SEQ ID NOS: 7-12.
6. The nucleic acid molecule of claim 1, wherein the coding sequence is 50% or more identical to any one of the coding sequences set forth in SEQ ED NOS: 1-6.
7. The nucleic acid molecule of claim 5, wherein the coding sequence comprises any one of SEQ ID NOS: 1-6.
8. The nucleic acid molecule of claim 1, which is a gene having an open reading frame that comprises the coding sequence.
9. A mRNA molecule produced by transcription of the gene of claim 7.
10. A cDNA molecule produced by reverse transcription of the mRNA molecule of claim 8.
10. An oligonucleotide between 8 and 100 bases in length, which is complementary to a segment of the nucleic acid molecule of claim 1.
11. A vector comprising the nucleic acid molecule of claim 1.
12. The vector of claim 11, which is an expression vector selected from the group of vectors consisting of plasmid, phagemid, cosmid, baculovirus, bacmid, bacterial, yeast and viral vectors.
13. The vector of claim 11, wherein the coding sequence of the nucleic acid molecule is operably linked to a constitutive promoter.
14. The vector of claim 11, wherein the coding sequence of the nucleic acid molecule is operably linked to an inducible promoter.
15. The vector of claim 11, wherein the coding sequence of the nucleic acid molecule is operably linked to a tissue specific promoter.
16. The vector of claim 15, wherein the tissue specific promoter is a seed specific promoter.
17. The vector of claim 16, wherein the seed specific promoter is a coffee seed specific promoter.
18. The vector of claim 17, wherein the coffee seed specific promoter is a dehydrin gene promoter.
19. The vector of claim 18, wherein the dehydrin gene promoter comprises SEQ ID NO: 13.
20. A host cell transformed with the vector of claim 11.
21. The host cell of claim 20, selected from the group consisting of plant cells, bacterial cells, fungal cells, insect cells and mammalian cells.
22. The host cell of claim 21, which is a plant cell selected from the group of plants consisting of coffee, tobacco, Arabidopsis, maize, wheat, rice, soybean barley, rye, oats, sorghum, alfalfa, clover, canola, safflower, sunflower, peanut, cacao, tomato toinatillo, potato, pepper, eggplant, sugar beet, carrot, cucumber, lettuce, pea, aster, begonia, chrysanthemum, delphinium, zinnia, and turfgrasses.
23. A fertile transgenic plant produced by regenerating the host cell of claim 22.
24. The fertile transgenic plant of claim 23, which is Coffea spp.
25. A method to modulate flavor or aroma of coffee beans, comprising modulating production of one or more dehydrins or LEA proteins within coffee seeds.
26. The method of claim 25, comprising increasing production of the one or more dehydrins or LEA proteins.
27. The method of claim 26, comprising increasing expression of one or more endogenous dehydrin- or LEA protein-encoding genes within the coffee seeds.
28. The method of claim 27, comprising introducing a dehydrin- or LEA protein-encoding transgene into the plant.
29. The method of claim 25, comprising decreasing production of the one or more dehydrins or LEA proteins.
30. The method of claim 29, comprising introducing a nucleic acid molecule into the coffee that inhibits the expression of one or more of the dehydrin-or LEA protein-encoding genes.
31. A method to increase resistance to osmotic stress in a plant comprising increasing production of one or more dehydrins or LEA proteins within the plant.
32. The method of claim 31, comprising introducing a dehydrin- or LEA protein-encoding transgene into the plant.
33. A promoter isolated from a coffee plant gene that encodes a dehydrin.
34. The promoter of claim 33, wherein (he gene encodes a dehydrin having a molecular weight of between about 17 kDa and about 26 kDa.
35. The promoter of claim 34, wherein the gene encodes a dehydrin having an amino acid sequence that is 50% or more identical to any one of SEQ ID NOS: 7-11.
36. The promoter of claim 35, wherein the gene encodes a dehydrin having any amino acid sequence of any one of SEQ ID NOS: 7-11.
37. The promoter of claim 33, wherein the gene comprises an open reading frame that is 50% or more identical to any one of the sequences set forth in SEQ ID NOS: 1-5.
38. The promoter of claim 37, wherein the gene comprises an open reading frame having any one of SEQ ID NOS: 1-5.
39. The promoter of claim 33, comprising one or more regulatory sequences selected from the group consisting of a TATA box, an abscisic acid responsive element, an RY repeat (CATGCA(T/a)(A/g) of a leguminin box for regulating expression of leguminin-type proteins, at least one dehydration responsive element/C-repeat cis-acting sequence motif (G/ACCGAC and at least one E-box motif (CANNTG).
40. The promoter of claim 39, comprising SEQ ID NO: 13.
41. A chimeric gene comprising the promoter of claim 33, operably linked to one or more coding sequences.
42. A vector for transforming a cell, comprising the chimeric gene of claim 41.
43. A cell transformed with the vector of claim 42.
44. The transformed cell of claim 43, which is a plant cell.
45. The transformed plant cell of claim 44, which is a cell ofCoffea spp.
46. A fertile transgenic plant produced by regenerating the transformed plant cell of claim 44.
47. The fertile transgenic plant of claim 46, which is Coffea spp.
DEHYDRIN GENES AND PROMOTERS FROM COFFEE
FIELD OF THE INVENTION
The present invention relates to the field of agricultural biotechnology. In particular, the invention features dehydrin-encoding polynucleotides from coffee plants, promoter sequences from coffee dehydrin genes, and methods for using these polynucleotides and promoters for gene regulation and manipulation of flavor, aroma and other features of coffee beans.
BACKGROUND OF THE INVENTION
Various publications, including patents, published applications and scholarly articles, are cited throughout the specification. Each of these publications is incorporated by reference herein, in its entirely. Citations not folly set forth within the specification may be found at the end of the specification.
Coffee aroma and flavor are key components in consumer preference for coffee varieties and brands. Coffee's characteristic aroma and flavor stems from a complex series of chemical reactions involving flavor precursors (Maillard reactions) that occur during the roasting of the bean. Flavor precursors include chemical compounds and biomolecules present in the green coffee bean. To date, over 800 chemicals and biomolecules have been identified as contributing to coffee flavor and aroma. (Montavon et al., J. Agric. Food Chem., 51:2328-34 (2003)).
Because coffee consumers are becoming increasingly sophisticated, it is desirable to produce coffee with improved aroma and flavor in order to meet consumer preferences. Both aroma and flavor may be artificially imparted into coffee products through chemical means. See, for example, U.S. Pat. No. 4,072,761 (aroma) and U.S. Pat. No. 3,962,321 (flavor). However, to date, there is little data concerning the influence of natural coffee grain components such as polysaccharides, proteins, and lipids on coffee aroma and flavor.' One approach is to select varieties from the existing germplasm that have superior flavor characteristics. A disadvantage to this approach is that, frequently, the highest quality varieties also possess significant negative agronomics traits, such as poor yield and low resistance to diseases and environmental stresses. It is also possible to select new varieties from breeding trials in which varieties with different industrial and agronomic traits are crossed and their progeny are screened for both high quality
and good agronomic performance. However, this latter approach is very time consuming, with one crossing experiment and selection over three growing seasons taking a minimum of 7-8 years. Thus, an alternative approach to enhancing coffee quality would be to use techniques of molecular biology to enhance those elements responsible for the flavor and aroma that are naturally found in the coffee bean, or to add aroma and flavor-enhancing elements that do not naturally occur in coffee beans. Genetic engineering is particularly suited to achieve these ends. For example, coffee proteins from different coffee species may be swapped. In the alternative, the expression of genes encoding naturally occurring coffee proteins that positively contribute to coffee flavor may be enhanced. Conversely, the expression of genes encoding naturally occurring coffee proteins that negatively contribute to coffee flavor may be suppressed. Another application of modern techniques is to use molecular information concerning the association of high quality with specific alleles to screen new varieties for the presence or absence of such using marker assisted breeding.
Coffees from different varieties and origins exhibit significant flavor and aroma quality variations when the green grain samples are roasted and processed in the same manner. The quality differences are a manifestation of chemical and physical variations within the grain samples that result mainly from differences in growing and processing conditions, and also from differences in the genetic background of both the maternal plant and the grain. At the level of chemical composition, at least part of the flavor quality can be associated with variations in the levels of small metabolites, such as sugars, acids, phenolics, and caffeine found associated with grain from different varieties. It is accepted that there are other less well characterized flavor and flavor-precursor molecules. In addition, it is likely that structural variations within the grain probably also contribute to differences in coffee quality. One approach to finding new components in the coffee grain linked to coffee quality is to study the genes and proteins differentially expressed during the maturation of grain samples in different varieties that possess different quality characteristics.
A group of proteins called the late embryogenesis abundant proteins (LEA), have been shown to accumulate in a coordinated fashion during the latter stages of cotton seed development (Dure, L, et al. Biochemistry 20: 4162-4178 (1981)). Dehydrin proteins (DHN) are a sub-group of the LEA proteins that have also been called the "LEA D-l 1 family" or LEA type 2 proteins (Close.T, Physiol.Plant 97: 795-803 (1996); Ingram, J, Annu.Rev.Plant Physiology Plant Mol Biol 47: 377-403 (1996)). Expression of the DHN proteins has been associated with the protection of various types of plant cells from osmotic stresses, such as those caused by
desiccation, salt, and low temperature. (Skriver,K, et al. Plant Cell 2: 503-512 (1990); Allagulova,CR, etal. Biochemistry-Moscow 68: 945-951 (2003)).
In recent years, direct experimental evidence has linked increased expression of dehydrins with protection from osmotic stress. For example, Arabidopsis plants engineered to over-express a dehydrin fusion protein were found to have improved survival when exposed to low temperature (Puhakainen,T, et al. Plant Molecular Biology 54: 743-753 (2004)). Similarly, expression of a citrus dehydrin protein in transgenic tobacco has been shown to give increased tolerance to low temperature (Hara,M, et al. Planta 217: 290-298 (2003)). Other supporting evidence for the linkage of dehydrins and tolerance to low temperature induced stress are the observations that QTL loci for freezing tolerance and winterhardiness map very closely to dehydrins (Close T, 1996; Zhu,B, et al. Molecular and General Genetics 264: 145-153 (2000)). DHN genes are also expressed robustly in seeds toward the end of maturation, a period when the seed undergoes a developmentally programmed reduction in water content (Nylander,M, et al. Plant Molecular Biology 45: 263-279 (2001); Choi,DW, et al Theoretical and Applied Genetics 100: 1274-1278 (2000)). The LEA/dehydrin proteins have been estimated to comprise up to 4% of the total seed protein, and are thought to be involved in protecting the embryo and/or other seed tissues from the osmotic stresses associated with the low water content of the mature seed (Roberts,J, etal. Plant Cell 5: 769-780 (1993); Wise,M, etal. Trends Plant Sci. 9: 13-17 (2004)).
Dehydrins are widely perceived to participate, with other LEA proteins, in the dehydration process that occurs during the late stages of seed maturation by assisting the acclimatization of seed tissues to the lower water content found in mature seeds (Close, Tm 1996); Nylander M, 2001). In addition, it is believed that the dehydrins synthesized seeds during maturation also continue to stabilize the associated cellular structures during seed quiescence. In this latter context, it has recently been proposed that dehydrins may also possess a radical-scavenging capability (Hara, M, 2003) and metal-binding properties (Alsheikh.MK, et al. J.Biol.Chem. 278: 40882-40889 (2003)), both characteristics that are likely to be useful during long periods of seed storage.
A considerable number of dehydrin proteins have been isolated and studied, and the precise physiochemical and/or structural mechanism (s) whereby these proteins function to protect cells from osmotic stress in-vivo is under investigation. The dehydrins are very hydrophilic proteins and exhibit an unusually low level of recognizable structure (Close T, 1996; Soulages,JL, et al. Plant Physiology 131: 963-975 (2003)). A key element of the dehydrins is believed to be the presence of one or more 15 amino acid, lysine rich, stretches called the "K
motifs," which are predicted to form class A amphipathic alpha-helices (Close, T, 1996; Close.TJ Physiol.Plant 100: 291-296 (1997)). Dehydrins can also contain two other motifs, an N-terminal "Y segment" (consensus V/TDE/QYGNP) and a serine rich "S segment," the latter of which can be phosphorylated and is thought to participate in nuclear localization (Close TJ, 1997; GodoyJA, et al. Plant Mol.Biol. 1921-1934 (1994)). It has been proposed that the short amphipathic K segments of dehydrin polypeptides functionally interact with the solvent-exposed hydrophobic patches of proteins that are undergoing partial denaturation, and thereby block protein aggregate formation (Close T, 1996). Amphipathic K helixes may also be involved hi binding membrane lipids, and thus could play a more specific role in protecting lipoproteins, proteins located in membranes, and/or membrane structure itself (Close T, 1996; Koag,MC, et al. Plant Physiology 131: 309-316 (2003)). An alternative proposal for at least part of the protective effect of dehydrins is the ability of these very stable, but relatively unstructured, proteins to tightly bind and organize water molecules (Soulages JL, 2003). This latter effect could lead to reduced water loss from cells, and could also improve the stability of certain macromolecules by the development of dehydrin based region of more tightly bound "ordered" water around these molecules.
Despite the involvement of dehydrin proteins in plant resistance to osmotic stresses such as drought and salt stress, and the probable importance of the dehydrins during grain development, little information is available on these genes in coffee. In coffee, little is understood about the number of dehydrins, their protein structure, their expression levels and distribution in different tissues of the coffee plant and among coffee species, as well as during coffee grain and pericarp maturation, and the regulation of their expression on the molecular level. Thus, there is a need to identify, isolate and characterize coffee dehydrin proteins, genes, and genetic regulatory elements. Such information will enable coffee dehydrin proteins to be genetically manipulated, with the goal of improving the aroma and flavor of the coffee, as well as imparting other phenotypic advantages associated with improved osmotic stress resistance. Dehydrins, which are expressed at relatively high levels at the end of grain maturation, are of interest because of the potentially important roles they have in organizing water molecules in the coffee grain and in stabilizing macromolecules and organelles within the mature dehydrated grain. At least part of this protective effect is believed to be due to the ability of the dehydrins and other LEA proteins to stabilize different water/protein/lipid interfaces. Because water levels can influence the spectrum of products formed in the Maillaid reaction (Turner, J, et al. J.Agric.Food Chem 50: 5400-5404 (2002)), the availability and organization of water
molecules in the coffee grain may influence the flavor generating Maillard reaction occurring during the roasting of coffee.
SUMMARY OF THE INVENTION
The invention described herein features dehydrin-encoding polynucleotides from coffee plants, their encoded polypeptides, promoter sequences from coffee dehydrin genes, and methods for using these polynucleotides, polypeptides and promoters for gene regulation and manipulation of flavor, aroma and other features of coffee beans.
One aspect of the invention features a nucleic acid molecule isolated from coffee (Coffea spp.), having a coding sequence that encodes a dehydrin or a late embryogenic abundant (LEA) protein. In certain embodiments, the encoded dehydrin has a molecular weight of between about 17 kDa and about 26 kDa. In certain embodiments, the encoded dehydrin or LEA protein has an amino acid sequence that is 46% or more identical to any one of SEQ ID NOS: 7-12. In some embodiments, the coding sequence is 45% or more identical to any one of the coding sequences set forth in SEQ ID NOS: 1-6.
In certain embodiments, the nucleic acid molecule is a gene having an open reading frame that comprises the coding sequence. Alternatively, it may comprise an mRNA molecule produced by transcription of that gene, or a cDNA molecule produced by reverse transcription of the mRNA molecule. The invention also features an oligonucleotide between 8 and 100 bases in length, which is complementary to a segment of the aforementioned nucleic acid molecule.
Another aspect of the invention features a vector comprising the above described dehydrin- or LEA-encoding nucleic acid molecule. In certain embodiments, the vector is an expression vector selected from the group of vectors consisting of plasmid, phagemid, cosmid, baculovirus, bacmid, bacterial, yeast and viral vectors. In certain embodiments, the vector contains the coding sequence of the nucleic acid molecule operably linked to a constitutive
promoter. In other embodiments, the coding sequence of the nucleic acid molecule is operably
promoter. In other embodiments, the coding sequence of the nucleic acid molecule is operably linked to a tissue specific promoter, such as a seed specific promoter, preferably a coffee seed specific promoter. In specific embodiments, the seed specific promoter is a coffee dehydrin gene promoter, such as the promoter contained in SEQ ID NO: 13.
According to another aspect of the invention, a host cell transformed with the aforementioned vector is provided. The host cell may be a plant, bacterial, fungal, insect or mammalian cell. In certain embodiments, the host cell is a plant cell selected from any one of
coffee, tobacco, Arabidopsis, maize, wheat, rice, soybean barley, rye, oats, sorghum, alfalfa, clover, canola, safflower, sunflower, peanut, cacao, tomato tomatillo, potato, pepper, eggplant, sugar beet, carrot, cucumber, lettuce, pea, aster, begonia, chrysanthemum, delphinium, zinnia, and turfgrasses. The invention also features a fertile transgenic plant produced by regenerating the transformed plant cell. In a specific embodiment, the fertile transgenic plant is a Coffea species.
Another aspect of the invention features a method to modulate flavor or aroma of coffee beans. The method comprises modulating production of one or more dehydrins or LEA proteins within coffee seeds. In some embodiments, the method comprises increasing production of the one or more dehydrins or LEA proteins, e.g., by increasing expression of one or more endogenous dehydrin- or LEA protein-encoding genes within the coffee seeds, or by introducing a dehydrin- or LEA protein-encoding transgene into the plant. In other embodiments, the method comprises decreasing production of the one or more dehydrins or LEA proteins, e.g., by introducing a nucleic acid molecule into the coffee that inhibits the expression of one or more of the dehydrin-or LEA protein-encoding genes.
Another aspect of the invention features a method to increase resistance to osmotic stress in a plant. This method comprisese increasing production of one or more dehydrins or LEA proteins within the plant, e.g., by introducing a dehydrin- or LEA protein-encoding transgene into the plant.
According to another aspect of the invention, a promoter isolated from a dehydrin-encoding coffee plant gene is provided. In certain embodiments, the dehydrin-encoding coffee gene encodes a dehydrin protein having the one or more of the features described above. In certain embodiments, the promoter comprises one or more regulatory sequences selected from the group consisting of a TATA box, an abscisic acid responsive element, an RY repeat (CATGCA(T/a)(A/g) of a leguminin box for regulating expression of leguminin-type proteins, at least one dehydration responsive element/C-repeat cis-acting sequence motif (G/ACCGAC and at least one E-box motif (CANNTG). In a specific embodiment, the promoter comprises SEQ ID NO:13.
The invention also features a chimeric gene comprising a promoter of a coffee dehydrin-encoding gene, operably linked to one or more coding sequences. A vector for transforming a cell, comprising the chimeric gene, is also provided, as well as cells transformed with the vector and fertile transgenic plants produced by regenerating a plant cell transformed with the vector.
Other features and advantages of the present invention will be understood from the drawings, detailed description and examples that follow.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1. Optimal alignment of Coffea canephora YaSKj-type dehydrins with several close plant homologs. The alignment was generated using the Clustal W program in the MegAlign software (DNASTAR) and then further optimized manually. Identical amino acids are boxed. The solid bars demarcate the Y-segments, the single dark rectangles demarcate the S-segments, and the rectangles with broken lines demarcate the K-segments. The black circle represents the amino acid different between CcDH2a and CcDH2b. Accession numbers: Lycopersicon esculentum dehydrin TAS14 (AAC49618)(SEQ ID NO: 14); Solanum commersonii dehydrin Dhnl (CAA75798) (SEQ ID NO: 15); Ardbidopsis thaliana dehydrin RAB18 (NP_201441) (SEQ IDNO:16).
Figure 2. Optimal alignment of the Coffea canephora SKa-type dehydrin with several close plant homologs. The alignment was generated as described for Figure 1. Identical amino acids are boxed. The single dark rectangles demarcate the S-segments, and the rectangles with broken lines demarcate the K-segments. Accession numbers: Nicotiana tabacum dehydrin (BAD13499) (SEQ ID NO: 17); Solanum tuberosum dehydrin homolog CI7 (T07779) ('SEQ ID NO: 18); Arabidopsis thaliana dehydrin (CAA62449) (SEQ ID NO: 19).
Figure 3. Optimal alignment of the Coffea canephora late embryogenesis abundant protein CcLEAl with several close plant homologs. The alignment was generated as described for Figure 1. Identical amino acids are boxed. Conserved cysteines are marked by an asterisk, and the position of two less highly conserved cysteines are marked by a circle. Accession numbers: Arabidopsis thaliana late embryogenesis abundant related protein (NP_200248) (SEQ ID NO:20), Picea glauca late embryogenesis abundant protein EMB7 (T09288) (SEQ ID N0:21), Zea mays root cap protein 2 (BAA75477) (SEQ ID NO:22).
Figure 4. RT-PCR expression analysis of the coffee dehydrins and CcLEAl transcripts in different organs of Coffea arabica and Coffea canephora. lOObp represents lOObp molecular weight marker ladder; SG, LG, YG, RG, represent small green, large green, yellow green and red for the grain and pericarp respectively; R, S, L, F represent root, stems, leaves and flowers.
Figure 5. Quantitative RT-PCR expression analysis of CcDH2 in different organs of Coffea canephora and Coffea arabica. GSG, GLG, GYG, GRG represent small green, large
green, yellow and red grain respectively; PSG, PLG, PYG, PRG represent small green, large green, yellow and red pericarp respectively; R, S, L, F represents root, stem, leaves and flowers. The standard deviations are reported on the graph for each reaction.
Figure 6. Southern blot analysis of CcDH2 dehydrin. The autoradiogram was exposed for three days.
Figure 7. DNA sequence of the CcDH2a promoter and transcribed sequence from Coffea canephora. The nucleic acid sequence of pVCl insert is presented, along with the corresponding amino sequence. The first base in the cDNA (C) is marked by a circle. The putative TATA box is underlined. The RY repeat sequences are marked with a double underline, the ABA responsive elements are boxed, and the DRE/CRT sequence is boxed with heavy lines.
Figure 8. Kyte-Doolittle hydrophilicity plots of encoded polypeptides. CcDHl a (173 aa, SEQ ID N0:7); CcDHlb (176 aa, SEQ ID NO:8); CcDH2a (163 aa, SEQ ID NO:9); CcDH2b (163 aa, SEQ ID NO:10); CcDH3 (228 aa, SEQ ED NO:11); CcLEAl (358 aa, SEQ ID NO: 12).
Figure 9. Real Time Quantitative RT-PCR expression analysis of CcDHl expression in the leaves of control and drought stressed plants. Plants 1-3 were regularly watered control plants; plants 4-6 were given no water from the initiation of the experiment ("0") through week 6.
Figure 10. Real Time Quantitative RT-PCR expression analysis of CcDHl expression in the leaves of control and drought stressed plants. Plants 1-3 were regularly watered control plants; plants 4-6 were given no water from the initiation of the experiment ("0") through week 6.
DETAILED DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS
Definitions:
Various terms relating to the biological molecules and other aspects of the present invention are used throughout the specification and claims.
"Isolated" means altered "by the hand of man" from the natural state. If a composition or substance occurs in nature, it has been "isolated" if it has been changed or removed from its original environment, or both. For example, a polynucleotide or a polypeptide naturally present in a living plant or animal is not "isolated," but the same polynucleotide or polypeptide
separated from the coexisting materials of its natural state is "isolated", as the term is employed herein.
"Polynucleotide", also referred to as "nucleic acid molecule", generally refers to any polyribonucleotide or polydeoxribonucleotide, which may be unmodified KNA or DNA or modified RNA or DNA. "Polynucleotides" include, without limitation single- and double-stranded DNA, DNA that is a mixture of single- and double-stranded regions, single- and double-stranded RNA, and RNA mat is mixture of single- and double-stranded regions, hybrid molecules comprising DNA and RNA that may be single-stranded or, more typically, double-stranded or a mixture of single- and double-stranded regions. In addition, "polynucleotide" refers to triple-stranded regions comprising RNA or DNA or both RNA and DNA. The term polynucleotide also includes DNAs or RNAs containing one or more modified bases and DNAs or RNAs with backbones modified for stability or for other reasons. "Modified" bases include, for example, tritylated bases and unusual bases such as inosine. A variety of modifications can be made to DNA and RNA; thus, "polynucleotide" embraces chemically, enzymatically or metabolically modified forms of polynucleotides as typically found in nature, as well as the chemical forms of DNA and RNA characteristic of viruses and cells. "Polynucleotide" also embraces relatively short polynucleotides, often referred to as oligonucleotides.
"Polypeptide" refers to any peptide or protein comprising two or more amino acids joined to each other by peptide bonds or modified peptide bonds, i.e., peptide isosteres. "Polypeptide" refers to both short chains, commonly referred to as peptides, oligopeptides or oligomers, and to longer chains, generally referred to as proteins. Polypeptides may contain amino acids other than the 20 gene-encoded amino acids. "Polypeptides" include amino acid sequences modified either by natural processes, such as post-translational processing, or by chemical modification techniques which are well known in the art. Such modifications are well described in basic texts and in more detailed monographs, as well as in a voluminous research literature. Modifications can occur anywhere in a polypeptide, including the peptide backbone, the amino acid side-chains and the amino or carboxyl termini. It will be appreciated that the same type of modification may be present in the same or varying degrees at several sites in a given polypeptide. Also, a given polypeptide may contain many types of modifications. Polypeptides may be branched as a result of ubiquitination, and they may be cyclic, with or without branching. Cyclic, branched and branched cyclic polypeptides may result from natural posttranslational processes or may be made by synthetic methods. Modifications include acetylation, acylatiqn, ADP-ribosylation, amidation, covalent attachment of flavin, covatent attachment of a heme moiety, covalent
attachment of a nucleotide or nucleotide derivative, covalent attachment of a lipid or lipid derivative, covalent attachment of phosphotidylinositol, cross-linking, cyclization, disulfide bond formation, demethylation, formation of covalent cross-links, formation of cystine, formation of pyroglutamate, formylation, garnma-carboxylation, glycosylation, GPI anchor formation, hydroxylation, iodination, methylation, myristoylation, oxidation, proteolytic processing, phosphorylation, prenylation, racemization, selenoylation, sulfation, transfer-RNA mediated addition of amino acids to proteins such as arginylation, and ubiquitination. See, for instance, Proteins - Structure and Molecular Properties, 2nd Ed., T. E. Creighton, W. H. Freeman and Company, New York, 1993 and Wold, F., Posttranslational Protein Modifications: Perspectives and Prospects, pgs. 1-12 in Posttranslational Covalent Modification of Proteins, B. C. Johnson, Ed., Academic Press, New York, 1983; Seifter et al, "Analysis for Protein Modifications and Nonprotein Cofactors", Meth Enzymol (1990) 182:626-646 and Rattan etal, "Protein Synthesis: Posttranslational Modifications and Aging", Ann NY Acad Sci (1992) 663:48-62.
"Variant" as the term is used herein, is a polynucleotide or polypeptide that differs from a reference polynucleotide or polypeptide respectively, but retains essential properties. A typical variant of a polynucleotide differs in nucleotide sequence from another, reference polynucleotide. Changes in the nucleotide sequence of the variant may or may not alter the amino acid sequence of a polypeptide encoded by the reference polynucleotide. Nucleotide changes may result in amino acid substitutions, additions, deletions, fusions and truncations in the polypeptide encoded by the reference sequence, as discussed below. A typical variant of a polypeptide differs in amino acid sequence from another, reference polypeptide. Generally, differences are limited so that the sequences of the reference polypeptide and the variant are closely similar overall and, in many regions, identical. A variant and reference polypeptide may differ in amino acid sequence by one or more substitutions, additions or deletions in any combination. A substituted or inserted amino acid residue may or may not be one encoded by the genetic code. A variant of a polynucleotide or polypeptide may be naturally occurring, such as an allelic variant, or it may be a variant that is not known to occur naturally. Non-naturally occurring variants of polynucleotides and polypeptides may be made by mutagenesis techniques or by direct synthesis.
In reference to mutant plants, the terms "null mutant" or "loss-of-function mutant" are used to designate an organism or genomic DNA sequence with a mutation that causes a gene product to be non-functional or largely absent. Such mutations may occur in the coding and/or regulatory regions of the gene, and may be changes of individual residues, or insertions or
deletions of regions ot nucleic acids. These mutations may also occur in the coding and/of regulatory regions of other genes which may regulate or control a gene and/or encoded protein, so as to cause the protein to be non-functional or largely absent.
The term "substantially the same" refers to nucleic acid or amino acid sequences having sequence variations mat do not materially affect the nature of the protein (i.e., the structure, stability characteristics, substrate specificity and/or biological activity of the protein). With particular reference to nucleic acid sequences, the term "substantially the same" is intended to refer to the coding region and to conserved sequences governing expression, and refers primarily to degenerate codons encoding the same amino acid, or alternate codons encoding conservative substitute amino acids in the encoded polypeptide. With reference to amino acid sequences, the term "substantially the same" refers generally to conservative substitutions and/or variations in regions of the polypeptide not involved in determination of structure or function.
The terms "percent identical" and "percent similar" are also used herein in comparisons among amino acid and nucleic acid sequences. When referring to amino acid sequences, "identity" or "percent identical" refers to the percent of the amino acids of the subject amino acid sequence that have been matched to identical amino acids in the compared amino acid sequence by a sequence analysis program. "Percent similar" refers to the percent of the amino acids of the subject amino acid sequence that have been matched to identical or conserved amino acids. Conserved amino acids are those which differ in structure but are similar in physical properties such that the exchange of one for another would not appreciably change the tertiary structure of the resulting protein. Conservative substitutions are defined in Taylor (1986, J. Theor. Biol. 119:205). When referring to nucleic acid molecules, "percent identical" refers to the percent of the nucleotides of the subject nucleic acid sequence that have been matched to identical nucleotides by a sequence analysis program.
"Identity" and "similarity" can be readily calculated by known methods. Nucleic acid sequences and amino acid sequences can be compared using computer programs that align the similar sequences of the nucleic or amino acids and thus define the differences. In preferred methodologies, the BLAST programs (NCBI) and parameters used therein are employed, and the DNAstar system (Madison, WI) is used to align sequence fragments of genomic DNA sequences. However, equivalent alignments and similarity/identity assessments can be obtained through the use of any standard alignment software. For instance, the GCG Wisconsin Package version 9.1, available from the Genetics Computer Group in Madison, Wisconsin, and the default
parameters used (gap creation penalty=12, gap extension penalty=4) by that program may also be used to compare sequence identity and similarity.
"Antibodies" as used herein includes polyclonal and monoclonal antibodies, chimeric, single chain, and humanized antibodies, as well as antibody fragments (e.g., Fab, Fab', F(ab')a and Fv), including the products of a Fab or other immunoglobulin expression library. With . respect to antibodies, the term, "immunologically specific" or "specific" refers to antibodies that bind to one or more epitopes of a protein of interest, but which do not substantially recognize and bind other molecules in a sample containing a mixed population of antigenic biological molecules. Screening assays to determine binding specificity of an antibody are well known and routinely practiced in the art. For a comprehensive discussion of such assays, see Harlow et al. (Eds.), ANTIBODIES A LABORATORY MANUAL; Cold Spring Harbor Laboratory; Cold Spring Harbor, NY (1988), Chapter 6.
The term "substantially pure" refers to a preparation comprising at least 50-60% by weight the compound of interest (e.g., nucleic acid, oligonucleotide, protein, etc.). More preferably, the preparation comprises at least 75% by weight, and most preferably 90-99% by weight, the compound of interest Purity is measured by methods appropriate for the compound of interest (eg., chromatographic methods, agarose or polyacrylamide gel electrophoresis, HPLC analysis, and the like).
With respect to single-stranded nucleic acid molecules, the term "specifically hybridizing" refers to the association between two single-stranded nucleic acid molecules of sufficiently complementary sequence to permit such hybridization under pre-determined conditions generally used in the art (sometimes termed "substantially complementary"). In particular, the term refers to hybridization of an oligonucleotide with a substantially complementary sequence contained within a single-stranded DNA or RNA molecule, to the substantial exclusion of hybridization of the oligonucleotide with single-stranded nucleic acids of non-complementary sequence.
A "coding sequence" or "coding region" refers to a nucleic acid molecule having sequence information necessary to produce a gene product, such as an amino acid or polypeptide, when the sequence is expressed. The coding sequence may comprise untranslated sequences (e.g., introns or 5' or 3' untranslated regions) within translated regions, or may lack such intervening untranslated sequences (e.g., as in cDNA).
"Intron" refers to polynucleotide sequences in a nucleic acid that do not code information related to protein synthesis. Such sequences are transcribed into mKNA, but are removed before translation of the mKNA into a protein.
The term "operably linked" or "operably inserted" means that the regulatory sequences necessary for expression of the coding sequence are placed in a nucleic acid molecule in the appropriate positions relative to the coding sequence so as to enable expression of the coding sequence. By way of example, a promoter is operably linked with a coding sequence when the promoter is capable of controlling the transcription or expression of that coding sequence. Coding sequences can be operably linked to promoters or regulatory sequences in a sense or antisense orientation. The term "operably linked" is sometimes applied to the arrangement of other transcription control elements (e.g., enhancers) in an expression vector.
Transcriptional and translational control sequences are DNA regulatory sequences, such as promoters, enhancers, polyadenylation signals, terminators, and the like, that provide for the expression of a coding sequence in a host cell.
The terms "promoter", "promoter region" or "promoter sequence" refer generally to transcriptiona! regulatory regions of a gene, which may be found at the 5' or 3" side of the coding region, or within the coding region, or within introns. Typically, a promoter is a DNA regulatory region capable of binding RNA polymerase in a cell and initiating transcription of a downstream (3' direction) coding sequence. The typical 5' promoter sequence is bounded at its 3' terminus by the transcription initiation site and extends upstream (5' direction) to include the minimum number of bases or elements necessary to initiate transcription at levels detectable above background. Within the promoter sequence is a transcription initiation site (conveniently defined by mapping with nuclease SI), as well as protein binding domains (consensus sequences) responsible for the binding of RNA polymerase.
A "vector" is a replicon, such as plasmid, phage, cosmid, or virus to which another nucleic acid segment may be operably inserted so as to bring about the replication or expression of the segment.
The term "nucleic acid construct" or "DNA construct" is sometimes used to refer to a coding sequence or sequences operably linked to appropriate regulatory sequences and inserted into a vector for transforming a cell. This term may be used interchangeably with the term "transforming DNA" or "transgene". Such a nucleic acid construct may contain a coding sequence for a gene product of interest, along with a selectable marker gene and/or a reporter gene.
A "marker gene" or "selectable marker gene" is a gene whose encoded gene product confers a feature that enables a cell containing the gene to be selected from among cells not containing the gene. Vectors used for genetic engineering typically contain one or more selectable marker genes. Types of selectable marker genes include (1) antibiotic resistance genes, (2) herbicide tolerance or resistance genes, and (3) metabolic or auxotrophic marker genes that enable transformed cells to synthesize an essential component, usually an amino acid, which the cells cannot otherwise produce.
A "reporter gene" is also a type of marker gene. It typically encodes a gene product that is assayable or detectable by standard laboratory means (e.g., enzymatic activity, fluorescence).
The term "express," "expressed," or "expression" of a gene refers to the biosynthesis of a gene product. The process involves transcription of the gene into mRNA and then translation of the mRNA into one or more polypeptides, and encompasses all naturally occurring post-translational modifications.
"Endogenous" refers to any constituent, for example, a gene or nucleic acid, or polypeptide, that can be found naturally within the specified organism.
A "heterologous" region of a nucleic acid construct is an identifiable segment (or segments) of the nucleic acid molecule within a larger molecule that is not found in association with the larger molecule in nature. Thus, when the heterologous region comprises a gene, the gene will usually be flanked by DNA that does not flank the genomic DNA in the genome of the source organism. In another example, a heterologous region is a construct where the coding sequence itself is not found in nature (e.g., a cDNA where the genomic coding sequence contains introns, or synthetic sequences having codons different than the native gene). Allelic variations or naturally-occurring mutational events do not give rise to a heterologous region of DNA as defined herein. The term "DNA construct", as defined above, is also used to refer to a heterologous region, particularly one constructed for use in transformation of a cell.
A cell has been "transformed" or "transfected" by exogenous or heterologous DNA when such DNA has been introduced inside the cell. The transforming DNA may or may not be integrated (covalently linked) into the genome of the cell. In prokaryotes, yeast, and mammalian cells for example, the transforming DNA may be maintained on an episomal element such as a plasmid. With respect to eukaryotic cells, a stably transformed cell is one in which the transforming DNA has become integrated into a chromosome so that it is inherited by daughter cells through chromosome replication. This stability is demonstrated by the ability of the eukaryotic cell to establish cell lines or clones comprised of a population of daughter cells
containing the transforming DNA. A "clone" is a population of cells derived from a single cell or common ancestor by mitosis. A "cell line" is a clone of a primary cell that is capable of stable growth in vitro for many generations.
"Grain," "seed," or "bean," refers to a flowering plant's unit of reproduction, capable of developing into another such plant. As used herein, especially with respect to coffee plants, the terms are used synonymously and interchangeably.
As used herein, the term "plant" includes reference to whole plants, plant organs (e.g., leaves, stems, shoots, roots), seeds, pollen, plant cells, plant cell organelles, and progeny thereof. Parts of transgenic plants are to be understood within the scope of the invention to comprise, for example, plant cells, protoplasts, tissues, callus, embryos as well as flowers, stems, seeds, pollen, fruits, leaves, or roots originating in transgenic plants or their progeny.
• The term "osmotic stress" refers to any stress on the plant that disrupts the normal water, sugar, or electrolyte concentration in a plant cell or plant on the whole. Osmotic stress may be environmentally related, such as conditions of prolonged low water or drought, low temperatures, frost, freezing temperatures, high salt content in the soil, and the like. Osmotic stress may also occur naturally, as would be expected for seed development and maturation.
Description:
In one of its aspects the present invention features nucleic acid molecules from coffee that encode a variety of dehydrin proteins, as well as one other LEA (late embryogenic abundant) protein. Representative examples of dehydrin- and LEA-encoding nucleic acid molecules were identified from databases of over 47,000 expressed sequence tags (ESTs) from several Coffea canephora (robusta) cDNA libraries made with RNA isolated from young leaves and from the grain and pericarp tissues of cherries harvested at different stages of development. Overlapping ESTs were identified and "clustered" into unigenes (contigs) comprising complete coding sequences. The unigene sequences were annotated by performing a BLAST search of each individual sequence against the NCBI (National Center for Biotechnology Information) non-redundant protein database. DNA sequence analysis revealed five unique sequences representing three different dehydrin genes and one LEA gene. These cDNAs are referred to herein as CcDHla (SEQ ID NO: 1), CcDHlb (SEQ ID NO:2), CcDH2a (SEQ ID NO:3), CcDH2b (SEQ ID NO:4) and CcDH3 (SEQ ID NO:5). CcDHla and CcDHlb were found to be allelic variants of each other, while two distinct unigenes were found to encode the open reading frame for CcDH2. In addition, analysis of a cDNA library constructed from RNA isolated from coffee
grains at 30 weeks post-fertilization revealed a full-length cDNA clone encoding a coffee LEA protein. This cDNA is referred to herein as CcLEAl (SEQ ID NO:6).
The deduced amino acid sequences of CcDHla-CcDHS are set forth herein as SEQ NOS: 741. The proteins have molecular masses of approximately 17.8 kDa (CcDHla, SEQ ID N0:7), 18.1 kDa (CcDHlb SEQ ID NO:8), 17.4 kDa (CcDH2a and CcDH2b, SEQ ID NOS: 9 and 10), and 21.5 kDa (CcDHS, SEQ ID NO: 11). These proteins were found to contain signature dehydrin ammo acid motifs, and were classified according to those motifs. CcDHla, CcDHlb, and CcDH2 (a and b) have the structure YsSKa, and CcDHS has the structure SK3. CcDHla and CcDHlb show absolute conservation in each of the three motifs, and in the two conserved regions that precede each of the two K motifs. In contrast, CcDH2 shows punctual differences in all but one of the Y, S, and K motifs, and more significant differences outside these dehydrin-specific motifs, Hydrophilicity plotting revealed mat all of the coffee dehydrin proteins identified herein are very hydrophilic throughout (See Figure 8).
The deduced amino acid sequence encoded by CcLEAl is set forth herein as SEQ ID NO: 12. This protein has a molecular mass of approximately 39.5 kDa. Hydrophilicity plotting of this protein indicates that this protein is less hydrophilic man the dehydrin molecules, and that there are two small hydrophobic regions, one of which is located in its first 30 N-terminal residues. The N-terminus of CcLEAl was also found to contain a striking proline-rich segment.
Another aspect of the invention features promoter sequences and related elements that control expression of dehydrin genes in coffee. As described in greater detail in the examples, a promoter sequence (contained in SEQ ID NO: 13), from CcDH2a was identified by PCR-assisted primer walking. The CcDH2 promoter was shown to contain several regulatory elements analogous to those previously characterized in other species to be involved in the regulation of gene expression during seed development. These CcDH2 regulatory elements are shown in Fig. 7 and described in the examples. Using this promoter linked to the GUS reporter gene, it has been determined that the promoter is specific to seeds, siliques, cotyledons, hypocotyls and first true leaves of developing seedlings. Moreover, as described in the Examples, expression of the CcDHl and CcDH2 genes has also been shown to be induced by drought stress and other stress conditions.
Although polynucleotides encoding dehydrins and LEA proteins from Coffea canephora are described and exemplified herein, this invention is intended to encompass nucleic acids and encoded proteins from other Coffea species that are sufficiently similar to be used interchangeably with the C. canephora polynucleotides and proteins for the purposes described
below. Accordingly, when the terms "dehydrin" or "late embfyogenesis abundant (LEA) proteins" are used herein, they are intended to encompass all Coffea dehydrins or LEA proteins that have the general physical, biochemical, and functional features described herein, as well as the polynucleotides that encode them.
Considered in terms of their sequences, dehydrin- and late embryogenesis abundant protein-encoding polynucleotides of the invention include allelic variants and natural mutants of SEQ ID NOs: 1-6, which are likely to "be found in different varieties of C. canephora, and homologs of SEQ ED NOs: 1-6 likely to be found in different coffee species. Because such variants and homologs are expected to possess certain differences in nucleotide and amino acid sequence, this invention provides isolated dehydrin- or LEA protein-encoding nucleic acid molecules that encode respective polypeptides having at least about 40%, 45%, 50%, or 55%, preferably at least about 60,65, or 70%, more preferably at least about 71%, 72%, 73%, 74%, 75%, 76%, 77%. 78%, 79%, or 80%, even more preferably 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, and even more preferably 90%, 91%, 92%, 93%, 94%, 95%, and most preferably 96%, 97%, 98% and 99% or more identity with any one of SEQ ID NOs:7-12, and comprising a nucleotide sequence having equivalent ranges of identity to any one of SEQ ID NOs: 1-6. Because of the natural sequence variation likely to exist among dehydrins and LEA proteins, and the genes encoding them in different coffee varieties and species, one skilled in the art would expect to find this level of variation, while still maintaining the unique properties of the polypeptides and polynucleotides of the present invention. Such an expectation is due in part to the degeneracy of the genetic code, as well as to the known evolutionary success of conservative amino acid sequence variations, which do not appreciably alter the nature of the encoded protein. Accordingly, such variants and homologs are considered substantially the same as one another and are included within the scope of the present invention.
As mentioned, the inventors have demonstrated that expression of certain of the dehydrin or LEA protein genes is seed, silique and seedling specific in coffee, as well as being inducible by drought and other forms of stress. Accordingly, the gene regulatory sequences associated with dehydrin- and LEA protein-encoding genes are of practical utility and are considered within the scope of the present invention. The C. canephora DH2 promoter is exemplified herein. The upstream region of the C. canephora DH2 genomic sequence is set forth herein as SEQ ID NO: 13, and contains part or all of an exemplary promoter of the invention, though other portions of the promoter may be found at other locations in the gene, as explained in the definition of "promoter" set forth hereinabove. However, promoters and other gene regulatory sequences of
dehydrin and LEA protein genes from any coffee species may be obtained by the methods described below, and may be utilized in accordance with the present invention. The promoters and regulatory elements governing tissue specificity and temporal specificity of dehydrin and LEA protein gene expression may be used to advantage to alter or modify the osmotic stress tolerance of various coffee species, among other utilities.
The following sections set form the general procedures involved in practicing the present invention. To the extent that specific materials are mentioned, it is merely for the purpose of illustration, and is not intended to limit the invention. Unless otherwise specified, general biochemical and molecular biological procedures, such as those set forth in Sambrook et al, Molecular Cloning, Cold Spring Harbor Laboratory (1989) or Ausubel et al. (eds), Current Protocols in Molecular Biology, John Wiley & Sons (2005) are used.
Nucleic Acid Molecules, Proteins and Antibodies:
Nucleic acid molecules of the invention may be prepared by two general methods: (1) they may be synthesized from appropriate nucleotide triphosphates, or (2) they may be isolated from biological sources. Both methods utilize protocols well known in the art.
The availability of nucleotide sequence information, such as the cDNA having SEQ ID NOs: 1-6, or the regulatory sequence of SEQ ID NO:13, enables preparation of an isolated nucleic acid molecule of the invention by oligonucleotide synthesis. Synthetic oligonucleotides may be prepared by the phosphoramidite method employed in the Applied Biosystems 38A DNA Synthesizer or similar devices. The resultant construct may be purified according to methods known in the art, such as high performance liquid chromatography (HPLC). Long, double-stranded polynucleotides, such as a DNA molecule of the present invention, must be synthesized in stages, due to the size limitations inherent in current oligonucleotide synthetic methods. Thus, for example, a long double-stranded molecule may be synthesized as several smaller segments of appropriate complementarity. Complementary segments thus produced may be annealed such that each segment possesses appropriate cohesive termini for attachment of an adjacent segment. Adjacent segments may be ligated by annealing cohesive termini in the presence of DNA ligase to construct an entire long double-stranded molecule. A synthetic DNA molecule so constructed may then be cloned and amplified in an appropriate vector.
In accordance with the present invention, nucleic acids having the appropriate level sequence homology with part or all of the coding and/or regulatory regions of dehydrin- or LEA protein-encoding polynucleotides may be identified by using hybridization and washing
conditions of appropriate stringency. It will be appreciated by those skilled in the art that the aforementioned strategy, when applied to genomic sequences, will, in addition to enabling isolation of dehydrin or LEA protein coding sequences, also enable isolation of promoters and other gene regulatory sequences associated with dehydrin or LEA protein genes, even though the regulatory sequences themselves may not share sufficient homology to enable suitable hybridization. Moreover, the annotation of at least a partial coding sequence will enable the skilled artisan to determine the remaining coding sequence, as well the promoter or other gene regulatory sequences associated with the dehydrin or LEA protein of interest by the technique of upstream or downstream genome walking. Such techniques are established in the art. (Mishra RN et al., 2002; Rishi AS et at., 2004).
As a typical illustration, hybridizations may be performed, according to the method of Sambrook et al, using a hybridization solution comprising: 5X SSC, 5X Denhardt's reagent, 1.0% SDS, 100 ^g/ml denatured, fragmented salmon sperm DNA, 0.05% sodium pyrophosphate and up to 50% formamide. Hybridization is carried out at 37-42°C for at least six hours. Following hybridization, filters are washed as follows: (1) 5 minutes at room temperature in 2X SSC and 1% SDS; (2) 15 minutes at room temperature in 2X SSC and 0.1% SDS; (3) 30 minutes-1 hour at 37°C in 2X SSC and 0.1% SDS; (4) 2 hours at 45-55°C in 2X SSC and 0.1% SDS, changing the solution every 30 minutes.
One common formula for calculating the stringency conditions required to achieve hybridization between nucleic acid molecules of a specified sequence homology (Sambrook et al, 1989):
Tm = 81.5CC + 16.6Log [Na+] + 0.41(% G+C) - 0.63 (% formamide) - 600/#bp in duplex
As an illustration of the above formula, using [Na+] = [0.368] and 50% formamide, with GC content of 42% and an average probe size of 200 bases, the Tm is 57°C. The Tm of a DNA duplex decreases by 1 -1.5 °C with every 1% decrease in homology. Thus, targets with greater than about 75% sequence identity would be observed using a hybridization temperature of 42°C. In one embodiment, the hybridization is at 37°C and the final wash is at 42°C; in another embodiment the hybridization is at 42°C and the final wash is at 50°C; and in yet another embodiment the hybridization is at 42°C and final wash is at 65°C, with the above hybridization and wash solutions. Conditions of high stringency include hybridization at 42°C in the above hybridization solution and a final wash at 65°C in 0.1X SSC and 0.1% SDS for 10 minutes.
Nucleic acids of the present invention may be maintained as DNA in any convenient cloning vector. In a preferred embodiment, clones are maintained in plasmid cloning/expression vector, such as pGEM-T (Promega Biotech, Madison, WI), pBluescript (Stratagene, La Jolla, CA), pCR4-TOPO (Invitrogen, Carlsbad, CA) or pET28a+ (Novagen, Madison, WI), all of which can be propagated in a suitable E. coli host cell.
Nucleic acid molecules of the invention include cDNA, genomic DNA, RNA, and fragments thereof which may be single-, double-, or even triple-stranded. Thus, this invention provides oligonucleotides (sense or antisense strands of DNA or RNA) having sequences capable of hybridizing with at least one sequence of a nucleic acid molecule of the present invention. Such oligonucleotides are useful as probes for detecting dehydrin- or LEA protein-encoding genes or mRNA in test samples of plant tissue, e.g., by PCR amplification, or for the positive or negative regulation of expression of dehydrin- or LEA protein-encoding genes at or before translation of the mRNA into proteins. Methods in which dehydrin- or LEA protein-encoding oligonucleotides or polynucleotides may be utilized as probes for such assays include, but are not limited to: (1) in situ hybridization; (2) Southern hybridization (3) northern hybridization; and (4) assorted amplification reactions such as polymerase chain reactions (PCR, including RT-PCR) and ligase chain reaction (LCR).
Polypeptides encoded by nucleic acids of the invention may be prepared in a variety of ways, according to known methods. If produced in situ the polypeptides may be purified from appropriate sources, e.g., seeds, pericarps, or other plant parts.
Alternatively, the availability of nucleic acid molecules encoding the polypeptides enables production of the proteins using in vitro expression methods known in the art. For example, a cDNA or gene may be cloned into an appropriate in vitro transcription vector, such a pSP64 or pSP65 for in vitro transcription, followed by cell-free translation in a suitable cell-free translation system, such as wheat germ or rabbit reticulocytes. In vitro transcription and translation systems are commercially available, e.g., from Promega Biotech, Madison, WI, BRL, Rockville, MD or Invitrogen, Carlsbad, CA.
According to a preferred embodiment, larger quantities of dehydrins or LEA protein polypeptides may be produced by expression in a suitable prokaryotic or eukaryotic system. For example, part or all of a DNA molecule, such as the cDNAs having SEQ ID NOs: 1-6, may be inserted into a plasmid vector adapted for expression in a bacterial cell (such as E. coli) or a yeast cell (such as Saccharomyces cerevisiae), or into a baculovirus vector for expression in an insect cell. Such vectors comprise the regulatory elements necessary for expression of the DNA
in the host cell, positioned in such a manner as to permit expression of the DNA in the host cell. Such regulatory elements required for expression include promoter sequences, transcription initiation sequences and, optionally, enhancer sequences.
The dehydrins or LEA proteins produced by gene expression in a recombinant prokaryotic or eukaryotic system may be purified according to methods known in the art. In a preferred embodiment, a commercially available expression/secretion system can be used, whereby the recombinant protein is expressed and thereafter secreted from the host cell, to be easily purified from the surrounding medium. If expression/secretion vectors are not used, an alternative approach involves purifying the recombinant protein by affinity separation, such as by immunological interaction with antibodies that bind specifically to the recombinant protein. Such methods are commonly used by skilled practitioners.
The dehydrins and LEA proteins of the invention, prepared by the aforementioned methods, may be analyzed according to standard procedures.
Dehydrins and LEA proteins purified from coffee or recombinantly produced, may be used to generate polyclonal or monoclonal antibodies, antibody fragments or derivatives as defined herein, according to known methods. Antibodies that recognize and bind fragments of the dehydrins or LEA proteins of the invention are also contemplated, provided that the antibodies are specific for dehydrins or LEA proteins. For example, if analyses of the proteins or Southern and cloning analyses (see below) indicate that the cloned genes belongs to a multigene family, then member-specific antibodies made to synthetic peptides corresponding to nonconserved regions of the protein can be generated.
Kits comprising an antibody of the invention for any of the purposes described herein are also included within the scope of the invention. In general, such a kit includes a control antigen for which the antibody is immunospecific.
The dehydrins, and likely the LEA proteins as well, are involved in protecting cellular components from osmotic stresses (dehydration, low temperatures/freezing, salt). Accordingly, the coffee dehydrins and LEA proteins described and exemplified herein are expected to find utility in a variety of food and cosmetic applications. For example, the dehydrins or LEA proteins may be utilized to alter ice nucleation in frozen foods, or to facilitate the drying of proteins in a manner that enables rapid rehydration at a later stage. As another example, the dehydrins or LES proteins may be utilized for in hydrating skin cream products. In addition, the recently discovered antioxidant and ion-binding properties of dehydrins may prove advantageous in both food and cosmetic products. In connection with food applications, it is noteworthy that
the dehydrins are highly soluble, very unstructured protein and they are not known to have disulflde bonds. As a result, these proteins are likely exhibit very low antigenicity and will likely be easily digested by proteases in the gut
One or more of the aforementioned applications for the dehydrins or LEA proteins may be pursued by exploiting the availability of the dehydrin- and LEA protein-encoding polynucleotides described herein to generate significant quantities of pure protein using recombinant organisms (e.g., in the yeast Picia pastoris or in food compatible Lactobacilli, or in plant cells), and then testing the proteins in already established assays for ice formation, effects on drying, rehydration, and antioxidant potential. If specific purified proteins were found to be particularly useful, natural versions of those proteins also maybe isolated from coffee grains determined to be rich in those particular dehydrins or LEA proteins.
Vectors, Cells, Tissues and Plants:
Also featured hi accordance with the present invention are vectors and kits for producing transgenic host cells that contain a dehydrin- or LEA protein-encoding polynucleotide or oligonucleotide, or homolog, anaolog or variant thereof in a sense or antisense orientation, or a reporter gene and other constructs under control of dehydrin or LEA protein-encoding gene promoters and other regulatory sequences. Suitable host cells include, but are not limited to, plant cells, baqterial cells, yeast and other fungal cells, insect cells and mammalian cells. Vectors for transforming a wide variety of these host cells are well known to those of skill in the art. They include, but are not limited to, plasmids, phagemids, cosmids, baculoviruses, bacmids, bacterial artificial chromosomes (BACs), yeast artificial chromosomes (YACs), as well as other bacterial, yeast and viral vectors. Typically, kits for producing transgenic host cells will contain one or more appropriate vectors and instructions for producing the transgenic cells using the vector. Kits may further include one or more additional components, such as culture media for culturing the cells, reagents for performing transformation of the cells and reagents for testing the transgenic cells for gene expression, to name a few.
The present invention includes transgenic plants comprising one or more copies of a dehydrin- or LEA protein-encoding gene, or nucleic acid sequences that inhibit the production or function of a plant's endogenous dehydrins or LEA proteins. This is accomplished by transforming plant cells with a transgene that comprises part of all of a dehydrin or LEA protein coding sequence, or mutant, antisense or variant thereof, including KNA, controlled by either native or recombinant regulatory sequences, as described below. Transgenic plants coffee
species are preferred, including, without limitation, C. abeokutae, C. arabica, C. arnoldiana, C. aruwemiensis, C. bengalensis, C. caneplwra, C. congensis C. dewevrei, C. excelsa, C. eugenioides ,and C. heterocalyx, C. kapakata, C. khasiana, C. liberica, C. moloundou, C. rasemosa, C. salvatrix, C.sessiflora, C. stenophylla, C. travencorensis, C. wightiana and C. zanguebariae. Plants of any species are also included in the invention; these include, but are not limited to, tobacco, Arabidopsis and other "laboratory-friendly" species, cereal crops such as maize, wheat, rice, soybean barley, rye, oats, sorghum, alfalfa, clover and the like, oil-producing plants such as canola, safflower, sunflower, peanut, cacao and the like, vegetable crops such as tomato tomatillo, potato, pepper, eggplant, sugar beet, carrot, cucumber, lettuce, pea and the like, horticultural plants such as aster, begonia, chrysanthemum, delphinium, petunia, zinnia, lawn and turfgrasses and the like.
Transgenic plants can be generated using standard plant transformation methods known to those skilled in the art. These include, but are not limited to, Agrobacterium vectors, polyethylene glycol treatment of protoplasts, biolistic DNA delivery, UV laser microbeam, gemini virus vectors or other plant viral vectors, calcium phosphate treatment of protoplasts, electroporation of isolated protoplasts, agitation of cell suspensions in solution with microbeads coated with the transforming DNA, agitation of cell suspension in solution with silicon fibers coated with transforming DNA, direct DNA uptake, liposome-mediated DNA uptake, and the like. Such methods have been published in the art. See, e.g., Methods for Plant Molecular Biology (Weissbach & Weissbach, eds., 1988); Methods in Plant Molecular Biology (Schuler & Zielinski, eds., 1989); Plant Molecular Biology Manual (Gelvin, Schilperoort, Verma, eds., 1993); and Methods in Plant Molecular Biology - A Laboratory Manual (Maliga, Klessig, Cashmere, Gruissem & Varner, eds., 1994).
The method of transformation depends upon the plant to be transformed. Agrobacterium vectors are often used to transform dicot species. Agrobacterium binary vectors include, but are not limited to, BIN19 and derivatives thereof, the pBI vector series, and binary vectors pGA482, pGA492, pLHTOOO (GenBank Accession AY234330) and any suitable one of the pCAMBIA vectors (derived from the pPZP vectors constructed by Hajdukiewicz, Svab & Maliga, (1994) Plant Mol Biol 25: 989-994, available from GAMBIA, GPO Box 3200, Canberra ACT 2601, Australia or via the worldwide web at CAMBIA.org). For transformation of monocot species, biolistic bombardment with particles coated with transforming DNA and silicon fibers coated with transforming DNA are often useful for nuclear transformation. Alternatively,
Agrobacterium "superbinary" vectors have been used successfully for the transformation of rice, maize and various other monocot species.
DNA constructs for transforming a selected plant comprise a coding sequence of interest operably linked to appropriate 5' regulatory sequences (eg., promoters and translational regulatory sequences) and 3' regulatory sequences (e.g., terminators). In a preferred embodiment, a dehydrin or LEA protein coding sequence under control of its natural 5' and 3" regulatory elements is utilized. In other embodiments, dehydrin or LEA protein coding and regulatory sequences are swapped (e.g., CcLEAl coding sequence operably linked to CcDH2 promoter) to alter the water or protein content of the seed of the transformed plant for a phenotypic improvement, e.g., in flavor, aroma or other feature.
In an alternative embodiment, the coding region of the gene is placed under a powerful constitutive promoter, such as the Cauliflower Mosaic Virus (CaMV) 35S promoter or the figwort mosaic virus 35S promoter. Other constitutive promoters contemplated for use in the present invention include, but are not limited to: T-DNA mannopine synthetase, nopaline synthase and octopine synthase promoters. In other embodiments, a strong monocot promoter is used, for example, the maize ubiquirin promoter, the rice actin promoter or the rice tubulin promoter (Jeon etal, Plant Physiology. 123: 1005-14, 2000).
Transgenic plants expressing dehydrin or LEA protein coding sequences under an inducible promoter are also contemplated to be within the scope of the present invention. Inducible plant promoters include the tetracycline represser/operator controlled promoter, the heat shock gene promoters, stress (e.g., wounding)-induced promoters, defense responsive gene promoters (e.g. phenylalanine ammonia lyase genes), wound induced gene promoters (e.g., hydroxyproline rich cell wall protein genes), chemically-inducible gene promoters (e.g., nitrate reductase genes, glucanase genes, chitinase genes, etc.) and dark-inducible gene promoters (e.g,, asparagine synthetase gene) to name only a few.
Tissue specific and development-specific promoters are also contemplated for use in the present invention, in addition to the seed-specific dehydrin or LEA protein promoters of the invention. Non-limiting examples of other seed-specific promoters include Ciml (cytokinin-induced message), cZ19Bl (maize 19 kDa zein), milps (myo-inositol-1-phosphate synthase), and celA (cellulose synthase) (U.S. application Ser. No. 09/377,648), bean beta-phaseolin, napin, beta-conglycinin, soybean lectin, cruciferin, maize 15 kDa zein, 22 kDa zein, 27 kDa zein, g-zein, waxy, shrunken 1, shrunken 2, and globulin 1, soybean 1 IS legumin (BSumlein et al, 1992), and C. canephora 1 IS seed storage protein (Marraccini et al, 1999, Plant Physiol.
Biochem. 37: 273-282). See also WO 00/12733, where seed-preferred promoters from endl and end2 genes are disclosed. Other Coffea seed specific promoters may also be utilized, including but not limited to the oleosin gene promoter described m commonly-owned, co-pending PCX Application No. [NOT YET ASSIGNED]. Examples of other tissue-specific promoters include, but are not limited to: the ribulose bisphosphate carboxylase (RuBisCo) small subunit gene promoters (e.g., the coffee small subunit promoter as described by Marracini et al, 2003) or chlorophyll a/b binding protein (CAB) gene promoters for expression in photosynthetic tissue; and the root-specific glutamine synthetase gene promoters where expression hi roots is desired.
The coding region is also operably linked to an appropriate 3' regulatory sequence. In embodiments where the native 3' regulatory sequence is not use, the nopaline synthetase polyadenylation region may be used. Other useful 3' regulatory regions include, but are not limited to the octopine synthase polyadenylation region.
The selected coding region, under control of appropriate regulatory elements, is operably linked to a nuclear drug resistance marker, such as kanamycin resistance. Other useful selectable marker systems include genes that confer antibiotic or herbicide resistances (e.g., resistance to hygromycin, sulfonylurea, phosphinothricin, or glyphosate) or genes conferring selective growth (e.g., phosphomannose isomerase, enabling growth of plant cells on mannose). Selectable marker genes include, without limitation, genes encoding antibiotic resistance, such as those encoding neomycin phosphotransferase II (NEO), dihydrofolate reductase (DHFR) and hygromycin phosphotransferase (HPT), as well as genes that confer resistance to herbicidal compounds, such as glyphosate-resistant EPSPS and/or glyphosate oxidoreducatase (GOX), Bromoxynil nitrilase (BXN) for resistance to bromoxynil, AHAS genes for resistance to imidazolinones, sulfonylurea resistance genes, and 2,4-dichlorophenoxyacetate (2,4-D) resistance genes.
In certain embodiments, promoters and other expression regulatory sequences encompassed by the present invention are operably linked to reporter genes, Reporter genes contemplated for use in the invention include, but are not limited to, genes encoding green fluorescent protein (GFP), red fluorescent protein (DsRed), Cyan Fluorescent Protein (CFP), Yellow Fluorescent Protein (YFP), Cerianthus Orange Fluorescent Protein (cOFP), alkaline phosphatase (AP), 3-lactamase, chloramphenicol acetyltransferase (CAT), adenosine deaminase (ADA), aminoglycoside phosphotransferase (neor, G418") dihydrofolate reductase (DHFR), hygromycin-B-phosphotransferase (HPH), thymidine kinase (TK), lacZ (encoding a-galactosidase), and xanthine guanine phosphoribosyltransferase (XGPRT), Beta-Glucuronidase
(gus), Placental Alkaline Phosphatase (FLAP), Secreted Embryonic Alkaline Phosphatase (SEAP), or Firefly or Bacterial Luciferase (LUC). As with many of the standard procedures associated with the practice of the invention, skilled artisans will be aware of additional sequences that can serve the function of a marker or reporter.
Additional sequence modifications are known in the art to enhance gene expression in a cellular host. These modifications include elimination of sequences encoding superfluous polyadenylation signals, exon-imton splice site signals, transposon-like repeats, and other such well-characterized sequences that may be deleterious to gene expression. Alternatively, if necessary, the G/C content of Hie coding sequence may be adjusted to levels average for a given coffee plant cell host, as calculated by reference to known genes expressed in a coffee plant cell. Also, when possible, the coding sequence is modified to avoid predicted hairpin secondary mRNA structures. Another alternative to enhance gene expression is to use 5' leader sequences. Translation leader sequences are well known in the art, and include the cis-actmg derivative (omega1) of the 5' leader sequence (omega) of the tobacco mosaic virus, the 5' leader sequences from brome mosaic virus, alfalfa mosaic virus, and turnip yellow mosaic virus.
Plants are transformed and thereafter screened for one or more properties, including the presence of the transgene product, the transgene-encoding mRNA, or an altered phenotype associated with expression of the transgene. It should be recognized that the amount of expression, as well as the tissue- and temporal-specific pattern of expression of the transgenes in transformed plants can vary depending on the position of their insertion into the nuclear genome. Such positional effects are well known in the art. For this reason, several nuclear transformants should he regenerated and tested for expression of the transgene.
Methods:
The nucleic acids and polypeptides of the present invention can be used in any one of a number of methods whereby the protein products can be expressed in coffee plants in order that the proteins may play a role in stress tolerance in the plant, and in the enhancement of flavor and/or aroma of the coffee beverage or coffee products ultimately produced ftom the bean of the coffee plant expressing the protein.
With respect to stress tolerance, it is now well established thai dehydrin proteins participate in protecting plants from osmotic or environmental stresses such as dehydration and freezing (Allagulova et al, 2003). For example, dehydrins play a role in water retention and osmotic regulation to protect the plant against the loss of water, especially in drought conditions.
Furthermore, given that dehydrins exhibit the capacity to interact with cations, dehydrin proteins may serve to bind excess salts during periods of limited water, and may serve a chelating function. Dehydrins also play a role in the structural integrity of nuclear material such as chromatin during cell desiccation in the developing seed, and have been found to play a role in protection against ice crystal formation and starch degradation in freezing temperatures. Hie function of a given dehydrin protein may be related to the location of the protein within the cell. For example, dehydrins localized to the exterior of the cell membrane may serve to stabilize lipids and membrane proteins. (Allagulova et al, 2003). Therefore, the ability to manipulate dehydrin or LEA protein production in a plant, or even to use the polynucleotides and proteins of the invention to monitor such gene expression, will enable study and manipulation of drought, cold or salt, i.e., osmotic tolerance in coffee. Such manipulation may extend from the germinating seedling to the growing plant and developing fruit and seeds, to the post-harvest storage stability of coffee beans. This knowledge enables the generation of modified coffee plants that are better equipped for healthy growth and crop production under conditions of acute or prolonged osmotic or environmental stresses such as those encountered under dry periods, drought, frost, or prolonged freezing conditions. Thus, one aspect of the invention features methods to protect plants, preferably coffee plants, by enhancing osmotic stress resistance by modulating the expression of dehydrins or LEA proteins in the plant.
With respect to flavor and aroma of roasted coffee grain, it is expected that the dehydrins and related LEA proteins exert some influence on the generation of coffee flavors via the Maillard reaction that occurs during roasting. Proteins, and particularly protein degradation products (peptides and amino acids), represent an important group of flavor precursors (Spanier et al., 2004). Therefore, relatively abundant proteins such as the dehydrins and LEA proteins can be expected to make some contribution to the flavor generating reactions that occur during coffee roasting. In this context, it is possible that these relatively unstructured, and very hydrophilic and highly soluble proteins react differently from other cellular proteins during a Maillard reaction, either due to their unusual structure, and/or due to their unusual interaction(s) with water molecules. It is well known that the levels of water present during cooking reactions, such as the roasting step of coffee, can also strongly influence the pathway(s) of heat induced chemical reactions (Turner et al., 2002). Because the dehydrins contribute to the organization of water molecules in the grain, a variety of specific differences in the levels and distribution of the dehydrins could influence the development of flavor during the roasting process. The ability to monitor (e.g., through marker-assisted breeding) or manipulate dehydrin and LEA protein
expression profiles is provided by the polynucleotides of the present invention, in accordance with the methods described herein.
Thus, one aspect of the present invention features methods to alter the dehydrin or LEA protein profile in a plant, preferably coffee, comprising increasing or decreasing an amount or activity of one or more dehydrins or LEA proteins in the plant. For instance, in one embodiment of the invention, a dehydrin-encoding gene under control of its own expression-controlling sequences is used to transform a plant for the purpose of increasing production of that dehydrin in the plant. Alternatively, a dehydrin or LEA protein coding region is operably linked to heterologous expression controlling regions, such as constitutive or inducible promoters.
The organization of water molecules or the stabilization or macromolecules or organelles in the grain of a plant may also be altered by decreasing production of one or more dehydrins or LEA proteins in the plant, or by screening naturally-occurring variants for decreased dehydrin or LEA protein expression. For instance, loss-of-function (null) mutant plants may be created or selected from populations of plant mutants currently available. It will also be appreciated by those of skill in the art that mutant plant populations may also be screened for mutants that over-express a particular dehydrin, utilizing one or more of the methods described herein. Mutant populations can be made by chemical mutagenesis, radiation mutagenesis, and transposon or T-DNA insertions, or targeting induced local lesions in genomes (TILLING, see, e.g., Henikoff et al, 2004, Plant Physiol. 135(2): 630-636; Gilchrist & Haughn, 2005, Curr. Opin. Plant Biol. 8(2): 211-215). The methods to make mutant populations are well known in the art.
The nucleic acids of the invention can be used to identify dehydrin or LEA protein mutants in various plant species. In species such as maize or Arabidopsis, where transposon insertion lines are available, oligonucleotide primers can be designed to screen lines for insertions in the dehydrin or LEA protein genes. Through breeding, a plant line may then be developed that is heterozygous or homozygous for the interrupted gene.
A plant also may be engineered to display a phenotype similar to that seen in null mutants created by mutagenic techniques. A transgenic null mutant can be created by a expressing a mutant form of a selected dehydrin or LEA protein to create a "dominant negative effect." While not limiting the invention to any one mechanism, this mutant protein will compete with wild-type protein for interacting proteins or other cellular factors. Examples of this type of "dominant negative" effect are well known for both insect and vertebrate systems (Radke et al., 1997, Genetics 145: 163-171; Kolch et al., 1991, Nature 349:426-428).
Another kind of transgenic null mutant can be created by inhibiting the translation of dehydrin- or LEA protein-encoding mRNA by "post-transcriptional gene silencing." The dehydrin- or LEA protein-encoding gene from the species targeted for down-regulation, or a fragment thereof, may be utilized to control the production of the encoded protein. Full-length antisense molecules can be used for this purpose. Alternatively, antisense oligonucleotides targeted to specific regions of the mRNA that are critical for translation may be utilized. The use of antisense molecules to decrease expression levels of a pre-determined gene is known in the art. Antisense molecules may be provided in situ by transforming plant cells with a DNA construct which, upon transcription, produces the antisense RNA sequences. Such constructs can be designed to produce full-length or partial antisense sequences. This gene silencing effect can be enhanced by transgenically over-producing both sense and antisense RNA of the gene coding sequence so that a high amount of dsRNA is produced (for example see Waterhouse et al, 1998, Proc. Natl. Acad. Sci. U.S.A. 95: 13959-13964). In this regard, dsRNA containing sequences that correspond to part or all of at least one intron have been found particularly effective. In one embodiment, part or all of the dehydrin or LEA protein coding sequence antisense strand is expressed by a transgene. In another embodiment, hybridizing sense and antisense strands of part or all of the dehydrin or LEA protein coding sequence are transgenically expressed.
In another embodiment, dehydrin or LEA genes may be silenced through the use of a variety of other post-transcriptional gene silencing (RNA silencing) techniques that are currently available for plant systems. RNA silencing involves the processing of double-stranded RNA (dsRNA) into small 21-28 nucleotide fragments by an RNase H-based enzyme ("Dicer" or "Dicer-like"). The cleavage products, which are siRNA (small interfering RNA) or miRNA (micro-RNA) are incorporated into protein effector complexes that regulate gene expression in a sequence-specific manner (for reviews of RNA silencing in plants, see Horiguchi, 2004, Differentiation 72: 65-73; Baulcombe, 2004, Nature 431: 356-363; Herr, 2004, Biochem. Soc. Trans. 32: 946-951).
Small interfering RNAs may be chemically synthesized or transcribed and amplified in vitro, and then delivered to the cells. Delivery may be through microinjection (Tuschl T et al., 2002), chemical transfection (Agrawal N et al., 2003), electroporation or cationic liposome-mediated transfection (Brummelkamp TR et al., 2002; Elbashir SM et al, 2002), or any other means available in the art, which will be appreciated by the skilled artisan. Alternatively, the siRNA may be expressed intracellularly by inserting DNA templates for siRNA into the cells of
interest, for example, by means of a plasmid, (Tuschl T et al, 2002), and may be specifically targeted to select cells. Small interfering KNAs have been successfully introduced into plants. (KlahreUe/c/.,2002).
A preferred method of RNA silencing in the present invention is the use of short hairpin RNAs (shRNA), A vector containing a DNA sequence encoding for a particular desired siRNA sequence is delivered into a target cell by an common means. Once in the cell, the DNA sequence is continuously transcribed into RNA molecules that loop back on themselves and form hairpin structures through intramolecular base pairing. These hairpin structures, once processed by the cell, are equivalent to siRNA molecules and are used by the cell to mediate RNA silencing of the desired protein. Various constructs of particular utility for RNA silencing in plants are described by Horiguchi, 2004, supra. Typically, such a construct comprises a promoter, a sequence of the target gene to be silenced hi the "sense" orientation, a spacer, the antisense of the target gene sequence, and a terminator.
Yet another type of synthetic null mutant can also be created by the technique of "co-suppression" (Vaucheret et a/., 1998, Plant J. 16(6): 651-659). Plant cells are transformed with a copy of the endogenous gene targeted for repression. In many cases, this results in the complete repression of the native gene as well as the transgene. In one embodiment, a dehydrin-or LEA protein-encoding gene from the plant species of interest is isolated and used to transform cells of that same species.
Mutant or transgenic plants produced by any of the foregoing methods are also featured in accordance with the present invention. Preferably, the plants are fertile, thereby being useful for breeding purposes. Thus, mutant or plants that exhibit one or more of the aforementioned desirable phenotypes can be used for plant breeding, or directly in agricultural or horticultural applications. They will also be of utility as research tools for the further elucidation of the participation of dehydrins and LEA proteins in flavor, aroma and other features of coffee seeds associated with water content and organization. Plants containing one transgene or a specified mutation may also be crossed with plants containing a complementary transgene or genotype in order to produce plants with enhanced or combined phenotypes.
The present invention also features compositions and methods for producing, in a seed-preferred or seed-specific manner, any selected heterologous gene product in a plant. A coding sequence of interest is placed under control of a seed-specific coffee dehydrin or LEA protein promoter or other seed-specific promoter and other appropriate regulatory sequences, to produce a seed-specific chimeric gene. The chimeric gene is introduced into a plant cell by any of the
transformation methods described herein or known in the art. These chimeric genes and methods may be used to produce a variety of gene products of interest in the plant, including but not limited to: (1) detectable gene products such as GFP or GUS, as enumerated above; (2) gene products conferring an agronomic or horticultural benefit, such as those whose enzyme activities result in production of micronutrients (e.g., pro-vitamin A, also known as beta-carotene) or antioxidants (e.g., ascorbic acid, omega fatty acids, lycopene, isoprenes, terpenes); or (3) gene products for controlling pathogens or pests, such as described by Mourgues et al., (1998), TibTech 16: 203-210 or others known to be protective to plant seeds or detrimental to pathogens.
Moreover, certain of the dehydrin or LEA-gene promoters can be used to produce recombinant proteins in both the seeds and in siliques. In addition, given that certain of the dehydrin genes are also activated under drought and other stress conditions, these promoters should prove useful to direct gene expression in other tissues, such as mature leaves, when they are osmotically stressed. This latter feature indicates that it is feasible to use these promoters to express recombinant proteins specifically in the leaves of plants (for example tobacco) at the end of maturation as they undergo senescence and begin to dry.
It is believed that the dehydrins are part of a plant's defense against dehydration. Therefore, the induction of the CcDHl and CcDH2 genes can be used as a measure of dehydration stress existing in a plant; both the time of induction of the water stress as well as the level of water stress. Thus, dehydrin expression can be used to screen populations of plants for their osmotic stress response capabilities.
The following examples are provided to describe the invention in greater detail. The examples are intended illustrate, not to limit, the invention.
Example 1 Plant Material for RNA Extraction
Freshly harvested roots, young leaves, stems, flowers and fruit at different stages of development were harvested from Coffea arabica L. cv. Caturra T-2308 and Coffea canephora var. BP409 grown under greenhouse conditions (25 °C, 70 RH) and also from Coffea canephora BP-409 grown in the field in East Java, Indonesia. The development stages are defined as follows: small green fruit (SG), large green fruit (LG), yellow fruit (Y) and red fruit (R). Fresh tissues were frozen immediately in liquid nitrogen, then stored at -80°C until used for RNA extraction.
Example 2
Protocols for Extraction of total RNA, Generation of cDNA. and PCR Reaction Conditions
The tissue samples stored at -80°C were ground into a powder and total RNA was extracted from mis powder using the method described previously (Rogers et al. 1999). Samples were treated with DNase using the kit "Qiagen RNase-Free DNase" according to the manufacturer's instructions to remove DNA contamination. All RNA samples were analysed by formaldehyde agarose gel electrophoresis and visual inspection of (he ribosomal RNA bands upon ethidium bromide staining. Using oligo (dTao) as a primer, cDNA was prepared from approximately 4 (j,g total RNA according to the protocol in the Superscript EL Reverse Transcriptase kit (Invitrogen, Carlsbad, CA). To test for the presence of contaminating genomic DNA in the cDNA preparations, a primer pair was designed spanning a known inrron of a specific ubiquitously expressed cDNA, chalcone isomerase. The absence of the genomic fragment in the PCR reactions indicated the absence of detectable genomic DNA contamination. The PCR reactions were carried out using the Coffea arabica and Coffea canephora cDNA prepared as described above. The gene-specific primers are set forth in Table 1.
Table 1. List of primers used for RT-PCR and quantitative RT-PCR
(Table removed)
PCR reactions (50 |xL) were set up containing 10 uL of a one hundred-fold dilution of the cDNAs, except for CcDH2 where lOul of a one thousand-fold dilution of the cDNA set was used. 1 uM each primer, 5 uL of 10X ThermoPol Buffer (New England Biolabs Beverly, MA), 1 uL of DMSO, 200 uM of dNTPs and 2 units of Taq polymerase (New England Biolabs
Beverly, MA). The cycling conditions were 2 min at 94°C, 35 cycles (except for CcDHl where 40 cycles was used) of 94°C for 1 min, 60°C for 1 min and 72°C for 1.5 min. The final extension step was for 7 min at 72°C. The RT-PCR products were resolved on 2% (w/v) agarose gels and stained with ethidium bromide. The CcRL39 gene, which encodes the constitutively expressed coffee L39 protein (a 60S ribosomal large subunit protein) was used as a semi-quantitative control to verify that each RNA sample was transcribed into cDNA at relatively similar efficiencies. Amplification of the RPL39 gene was used as a positive control for the reverse transcription with the primers shown in Table 1.
Quantitative TaqMan-PCR of CcDH2 and CcRPL139 was carried out according to the manufacturer's protocol (Applied Biosystems, Perkin-Elmer) using the Coffea arabica and Coffea canephora cDNA and the TaqMan probes shown in Table 1. 25 uL reactions containing 12.5 uL of TaqMan® Universal Master Mix 2X, 20 nM of TaqMan®-MGB probe, 80 nM of TaqMan® specific primers and 5 uL of the 1000 fold diluted cDNAs. The cycling conditions were 50°C for 2 minutes, 95°C for 10 minutes, then 40 cycles of 94°C for 15 seconds, and 60°C for 1 minute. Each reaction was repeated 3 times. The expression of the DH2 gene in each cDNA sample was normalized to the expression of the RPL39 gene in the same sample.
Example 3 Protocol for Isolation of DEB Promoter Region
The promoter sequence of CcDH2 was isolated using the Genome Walker kit according to the manufacturer's specifications (BD Sciences-Clontech). Genomic DNA was isolated from Coffea canephora var. BP409 as described (Crouzillat et al., 1996). The CcDH2 specific forward Genome Walker primer used was: DH2a primer 1 -5"
TGTGCTCCTGATGCTCTCTGTCCTTGTGC 3' (SEQ ID NO.:39). An approximately 2.1 kb fragment was isolated using HindlH-digested Coffea canephora var. BP409 genomic DNA ligated to the Genome Walker adaptor sequence. PCR amplification was carried out in a 50 ul reaction using the Clontech Advantage 2 PCR kit according to the manufacturer's protocol using 0.5 uM final concentrations of DH2a primerl and the Genome Walker API primer. The PCR reaction was carried out with following conditions: 94°C for 2 seconds and 72°C 3 minutes (7 cycles), 94°C for 2 seconds and 67°C 3 minutes (32 cycles), followed by 4 minutes at 67°C. The major PCR fragment obtained was then cloned into the plasmid pCR4-TOPO (Invitrogen).
A plasmid pJMcl containing the appropriate insert was purified and its insert was completely sequenced. To verify that the inserts in pJMcl and (pcccs30w8a4) were from the
same gene, the corresponding overlapping sequence of these two clones was re-amplified from genomic DNA using the primers DH2a geneup 5' ATAGTGACCTTAATAGCGATCTTGTTGC 3' (SEQ ID NO..-40) and DH2a genelow 5' CCAAATCAAATCAAACCAAGCAAATC 3' (SEQ ID NO.:41). The PCR reaction was performed with Coffea canephora var. BP409 genomic DNA and using Taq (New England Biolabs) and 1 uM of the specific primers (DH2a geneup and DH2a genelow). The PCR reaction was carried out with the following conditions: 94°C 1 minute, then 35 cycles of 94°C 1 minute, 58°C 1.5 minutes, and 72°C 3 minutes, followed by 7 minutes at 72°C. The main PCR fragment produced was then cloned into pCR4-TOPO. A plasmid pVCl (Figure 7) containing the appropriate insert was purified and its insert was completely sequenced. There were 5 base changes between the genomic fragments of pJMcl and pVCl. One change was in the promoter region, two changes were in the intron, and two changes were in the protein coding sequence. Of these changes in the protein coding sequence, one change was neutral, the other resulted in a different amino acid.
Example 4 Southern Blot Protocol
Genomic DNA was prepared as described previously (Crouzillat et al., 1996). Five micrograms of genomic DNA from C. canephora BP 409 DNA was digested overnight with the appropriate enzymes (lOU/ug) according to the supplier's recommendations and the products were separated on 0.8% agarose gels. Southern blotting and hybridizations were carried out as described previously (Crouzillat et al., 1996). The probe was generated by first PCR amplifying the insert of the CcDH2 clone cccs30w8a4 with the primers T3 + T7. This PCR product was then labeled with [32P]dCTP using the "rediprime™ II random prime labeling system" kit (Amersham).
Example 5 Identification and Characterization of Coffee Pehydrin cDNA
More than 47,000 EST sequences were generated from several coffee libraries made with RNA isolated from young leaves and from the grain and pericarp tissues of cherries harvested at different stages of development. Overlapping ESTs were subsequently "clustered" into "unigenes" (i.e., contigs) and the unigene sequences were annotated by doing a BLAST search of each individual sequence against the NCBI non-redundant protein database. The unigenes were
screened for dehydrin sequences using various approaches, including a search of the unigene annotations with the keyword "dehydrin" and by using various Arabidopsis and tomato dehydrin protein sequences in a tBlastn search of the coffee unigene set The various search protocols yielded several candidate dehydrin unigenes, and the potentially longest cDNA clone for each of these unigenes was isolated from the library and completely sequenced (Table 2).
Table 2. Full length Coffea canephora cDNA encoding dehydrin and LEA proteins and the number of ESTs found for each sequence. Unigene numbers and the molecular weights are given in parentheses for each plasmid: ccc!26i7 (Unigene 121870; 17.8kDa); cccs30w27m8 (Unigene 121870; IS.lkDa); cccs30w8a4 (Unigene 123406; 17.4kDa); cccs46w30pl (Unigene 123405; 17.4kDa); cccwc22wlla5 (Unigene 123385; 25.1kDa); Davl-59 (Unigene 119994; 39.5kDa).
(Table Removed)
DNA sequence analysis of the selected full length cDNA clones revealed four unique sequences representing three different dehydrin genes. The corresponding genes were named CcDHl, CcDH2, and CcDH3. Two apparently allelic sequences of the gene CcDHl were identified by sequencing two of the longest cDNA in unigene #121870. The cDNA clones CcDHla and CcDHlb were 836 and 896 bp long respectively. The two ORF sequences exhibited 5 single base changes, and CcDHlb had an insertion of 9 bases. These differences translated into sk amino acid differences. CcDHla and CcDHlb encode proteins of 172 amino acids and 175 amino acids which have predicted molecular weights of approximately 17.8kDa and IS.lkDa, respectively. Two distinct unigenes, #123406 and #123405, were found to encode the ORF for CcDH2. Unigene #123405 (CcDH2b) is composed of 2 ESTs and differs from the unigene sequence #123406 (CcDH2a) by the presence of an intron sequence. When the intron/exon borders of the cDNA for DH2b (cccs46w30pl) were examined in more detail, it was observed that the 3' junction had the sequence ttatgg/TCG while other genomic sequences obtained by genome walking (see below) had the sequence ttatag/T(A)CGG. Overall, the intron sequences of the cDNA cccs46w30pl and the intron sequences in the genomic DNA were nearly
identical. Because none of the single base changes appeared in all three of the genomic intron sequences available, it appears that an alteration of the 3' splice site sequence of CcDH2b may be the cause of the aberrant splicing of this cDNA. The 756 bp cDNA pcccs30w8a4 (CcDH2a) encodes a protein of 162 amino acids long with the predicted molecular weight of 17.4kDa. One unigene was found for CcDHS (#123385). The protein sequence encoded by CcDEB demonstrates that this 833 bp cDNA encodes a protein of 227 amino acids with the predicted approximate molecular weight of 25.1 kDa.
The protein sequences of the coffee dehydrins were aligned with the most homologous protein sequences found in the non-redundant protein database and also analyzed for the presence of the dehydrin specific amino acid motifs Y, S, and K. Figures 1 and 2 show that the three dehydrins fall into two classes, with CcCDHla, CcDHlb and CcDH2a having the structure ¥38X3 and CcDH3 having the structure SKj. Of those protein sequences with the YaSfo structure, CcDHla and CcDHlb show absolute conservation in each of the three motifs, as well as in the two conserved regions that proceed each of the two K motifs. This observation, and the fact that the small sequence differences that exist occur in the least conserved regions of the aligned sequences, is consistent with the idea that CcDHla and CcDHlb are allelic. In contrast, CcDH2a is clearly different from CcDHl. While CcDH2a has the structure Y3SK2, it also exhibits punctual differences in all but one of the Y, S and K motifs, as well as more significant differences outside these dehydrin specific motifs. The CcDHl and CcDH2 encode proteins with calculated pi that are near neutral, and their hydrophilicity plots indicate that these proteins are very hydrophilic throughout. The calculated pi of the protein encoded by CcDH3 is slightly acidic (5.47), and this protein is also very hydrophilic, as shown by the Kyte-Doolittle hydrophilicity plot in Figure 8.
Example 6 Characterization of a cDNA Encoding a Coffee LEA Protein
A cDNA library was constructed from RNA prepared from coffee grain 30 weeks after fertilization. From this library, a full length cDNA clone (Davl-59) encoding an LEA protein was isolated and sequenced. This cDNA clone was renamed CcLEAl. In addition, the EST database was searched for "unigenes" annotated as LEA proteins. This search produced 9 unigene sequences, one of which (unigene #119994) corresponded to the previously isolated sequence of CcLEAl. (Table 3). The EST analysis indicated that CcLEAl is strongly and exclusively expressed during only one period of grain development (30 weeks after flowering).
Table 3. Coffea canephora unigene sequences annotated as LEA proteins
(Table Removed)
The protein encoded by CcLEAl is 358 amino acids and has a predicted molecular weight of 39.5kDa. The calculated pi for CcLEAl is slightly basic (8.17), and a hydrophilicity plot shows that while this protein does not have significant regions of hydrophobicity, it is less hydrophilic than the three coffee dehydrins. The first 30 N-terminal residues of CcLEAl form one of two small hydrophobic regions in this protein. Figure 3 shows the alignment of CcLEAl with the 3 most homologous sequences found in the non-redundant Genbank protein database. The overall identity values of these aligned sequences only ranged from 34.7% for the Arabidopsis sequence to 47.9% for the Picea (white spruce) sequence. However, there are short, highly conserved regions in these proteins. All of the related protein sequences had relatively similar hydrophilicity profiles to CcLEAl, and generally, the most significant hydrophobic patch of the proteins could be found in the N-terminal 1-25 amino acids. CcLEAl was also found to contain a proline rich segment in the N-terminal region, which is absent from the other proteins in Figure 3.
Example 7
RT-PCR Expression of CcDHl, CcDH2, CcDH3 and CcLEA-1 Genes in Different Coffee Tissues and Durlne Coffee Grain Development
Because the EST libraries were not normalized, and were deeply sampled, the number of ESTs found in each unigene gives a rough estimation of the expression level of that gene in each tissue sampled. Table 2 (above) shows that CcDHl and CcDH2 are strongly expressed in the grain at 30 and 46 weeks after fertilization, but were not detected in the pericarp library, nor were they detected in whole cherries (developing grain + pericarp) at 22 weeks after fertilization. Both CcDHl and CcDH2 are expressed in the leaf, although CcDHl may be expressed in young leaf at a higher level than CcDH2. Expression of CcDH3 was detected in the grain at 46 weeks after
fertilization, and in the young leaf, although 2 ESTs were also observed in the 22 week whole cherry samples.
To extend the expression data, RT-PCR analysis was carried out for each of the three coffee dehydrin genes. The results of flu's analysis are shown in Figure 4. CcDHl was expressed significantly in arabica grain at all Hie stages examined, and in the three last stages examined for robusta. CcDHl expression could also be detected in other tissues tested, although no signal was detected for arabica in the small green pericarp and yellow pericarp samples, or for robusta in the root or leaf samples. Among the tissues having expression of CcDHl, the arabica flower sample appeared to have the highest level of transcripts.
A relatively high level of CcDH2 transcripts was detected in all the grain development stages of arabica and the last three stages of the robusta grain (Figure 4). In contrast to CcDHl, no CcDH2 transcripts were detected by RT-PCR in the other tissues studied. The absence of significant levels of CcDH2 transcripts in tissues other than the grain, as well as the later induction of this gene in robusta, was confirmed by TaqMan quantitative RT-PCR (Figure 5). The expression of CcDH2 was compared to the constitutively expressed transcript of the CcRPL39 gene (RPL39 encodes large ribosomal subunit protein #39). The comparison demonstrated that the expression of CcDH2 increased gradually in robusta, beginning from the large green stage up to the mature red stage. In contrast, the quantitative RT-PCR data for arabica showed that the highest level of CcDH2 transcripts was detected at the large green stage and that the transcript levels fell somewhat as maturation progressed.
RT-PCR analysis of CcDH3 gene expression demonstrated that significant levels of these transcripts were also detected in all the arabica grain samples, as well as in the last three stages of robusta gram development (Figure 4). The levels of CcDH3 transcripts in some of the other tissues, such as the red pericarp, stem, and flowers, were nearly as high as in the grain. Examination of the original data showed that CcDH3 transcripts could be detected in all of the other arabica and robusta tissues examined. However, a significant difference is noted between the transcript levels for the first three pericarp stages of robusta and arabica.
The expression of CcLEAl was also evaluated by RT-PCR. The data obtained confirms that this gene has a very unique expression pattern, with transcripts being detected only in the small green stage of arabica and the large green stage of robusta grain (Figure 4). No expression was detected in any of the other arabica or robusta tissues sampled. This data is consistent with the distribution pattern of ESTs for this gene seen in Table 3, which indicates that this gene is
expressed in robusta grain at 30 WAF but not in any other grain, cherry, pericarp, or leaf EST libraries.
Example 8 Sequence Analysis of the CcDH2 Promoter
CcDH2 is a moderately expressed, grain specific gene. Southern blotting was carried out to determine if the level of expression was obtained from a gene with a single/low copy number or a multicopy gene. As shown in Figure 6, each digestion produced only one band, suggesting that CcDH2 is likely to be encoded by a single gene in the C. canephora genome.
The technique of primer walking was used to isolate a genomic fragment incorporating the CcDH2 promoter. PCR amplification of the DNA was carried out using a CcDH2 specific Genome Walker primer designed from the center of the cDNA cccs30w8a4 (DH2a primer 1), and the API primer of the Genome Walker kit. A 2.1 kb genomic fragment that stretched 1.43 kb upstream of the cccs30w8a4 cDNA sequence (C. canephora) was generated and cloned. Sequence analysis of the composite sequence obtained from the overlapping plasmids containing both genomic and cDNA sequences showed that the CcDH2 gene contains a single intron (231 bp) located within the ORF region (Figure 7). Further analysis of the promoter region of this gene indicates the presence of a putative TATA sequence 30 bp upstream of the 5' end of the cDNA sequence.
Several potential regulatory elements previously shown to be involved in the regulation of gene expression during seed development were also identified in the 5' upstream region of the CcDH2 gene. For example, three regions with similarity to the Arabidopsis ABA responsive element RYACGTGGYR (SEQ ID N0,:42) were found. Two elements were found that shared significant similarity with the RY repeat (CATGCA(T/a)(A/g) of the core region in the "legumin" box that is involved in regulating the expression of legumin type storage proteins. The presence of two dehydration-responsive element/C-Repeat (DRE/CRT) cis-acting sequence motifs (G/ACCGAC) were also identified. The DRE/CRT motifs have been shown previously to interact with DREBs/CBF transcription factors to control the response of linked genes to dehydration and other stresses in arabidopsis and rice. (Dubouzet JG, Plant J. 33: 751-763 (2003)). In addition, several E-box motifs (CANNTG), which are well defined components in storage protein promoters such as the 2S protein, (Chatthai M, Plant Physiol Biochem 42:417-423 (2004)), were identified in the CcDH2 promoter region.
Example 9 Functional analysis of the coffee dehydrin promoter CcDH2 in Arabidopsis thaliana
Expression in Arabidopsis thaliana of a reporter gene encoding beta-glucuronidase (GUS), under control of the CcDH2 promoter, was examined.
Materials and Methods:
The dehydrin DH2 promoter sequence from pVCl was amplified using the polymerase Pful under the conditions described by the supplier (Stratagene) and the primers: TG - TG698 ttgaagcttGTGGACATGACGGAAGAGGT (SEQ ID N0,:43) and TG - TG743 gcagatctaccatggAGGACTCCTGTTATTAGAAAA (SEQ ID NO,:44).
The PCR fragment thus obtained was then cut with HindHI and Bglll and cloned into the Hindin/Bgin sites of the plant transformation vector pCAMBIAlSOl. This places the approximately 1.3 kb fragment containing the dehydrin promoter sequence and the complete 5' untranslated region of the dehydrin cDNA (approximately 80 bp) within 2 bp of the ATG for the GUS (first exon of GUS). The correct positioning of the promoter was verified by sequencing. The new dehydrin CcDH2 promoter containing vector was named pCAMBIA1301UCD2.4
Plant transformation. The transformation vector pCAMBIA1301UCD2.4 was then transformed into Agrobacterium tumefaciens strain EHA105 using standard procedures. The hygromycin resistance gene, driven by a 2 x 35S promoter, was the plant selectable marker in pCAMBIA1301. Agrobacterium tumefaciens mediated transformation of Arabidopsis (with the plasmid pCAMBIAl 301UCD2.4) was performed by floral-dip method (Clough and Bent, 1998).
Transformed plants were identified by plating seed on 0.8% agar containing 1 mM sodium nitrate and 50 (j,g perml hygromycin. Transformed seedlings were identified 7 days after plating as plants with an extended primary root. Seedlings were transferred to 0.8% agar containing 0.5X M&S salts. Plants were thereafter transferred to soil when the second leaf pair developed, and allowed to mature and set seed (Tl). In some cases, the Tl seeds were germinated, and then allowed to grow and to set seeds (T2).
GUS Staining. The seedlings and siliques examined for GUS staining were either from Tl or T2 seeds, and were at different stages of development. The GUS staining solution was prepared by dissolving 5mg X-Gluc in 50 fJ dimethyl formamide, and then adding this to 10ml 50mM NaPC>4 pH 7.0. With a fine forceps, the seedlings were transferred from the germination plates into a 1.5 ml microfuge tube containing 1.0 ml of GUS stain. The tubes were transferred
to a desiccator and placed under vacuum for 10 minutes and incubated at 37°C (in Hie dark) for 24 or 48 hours. The stain was removed and replaced with the destaining solution (70% EtOH). Clearing was accelerated by placing the tubes at 37°C. Depending on the amount of pigment in the tissue, several changes of 70% EtOH were required. The stained seedlings and other tissues were viewed under a dissecting microscope and images were digitally recorded. In the case of siliques, the silques were removed from plants and opened with a scalpel to permit penetration of stain. The GUS stain used in the procedure was modified to include 0.5% Triton X100. Following staining, the siliques were destained by incubating in EtOH:Acetic Acid (2:1) and then incubating in Hoyer's Light medium (100 g Chloral hydrate in 60 ml water). Siliques with younger seeds were preincubated in the Ethanol:Acetic Acid solution for 4 hours, and with older seeds for 8 hours. Siliques were cleared in Hoyer's Light medium for 24 hours to several days.
Results:
GUS expression in Arabidopsis thaliana transformed with pCam!301UCD2-4 was observed. GUS expression was found to be abundant in cotyledons and in the hypocotyl of one week old seedlings. In two week old seedlings, GUS staining was still abundant in the first two cotyledons, and at a lower level hi the first true leaves. GUS activity was not significantly detected in the root or in the second pair of developing leaves. No expression was detected in mature leaves. GUS expression was also detected in the silique wall and in developing seeds. A 48-hour GUS staining of seeds of a Tl line resulted in some seeds being positive for GUS activity and others being negative.
In summary, the data presented in this example confirm that the coffee dehydrin promoter CcDH2 drives the expression of the linked gene (in this case GUS) strongly in seeds, siliques, and in the first cotyledons and hypocotyls of the germinating seeds. This result demonstrates that the CcDH2 promoter sequence described here contains all the functional elements required to drive seed specific gene expression in plants. The data obtained also indicates that the CcDH2 promoter can be used to drive the expression of genes in immature tissues such the embryo derived first two cotyledons of seedlings. In addition, the data indicate that the CcDH2 promoter is activated in other tissues destined to undergo desiccation, such as the siliques. Finally, given the relatively large evolutionary distance between Arabidopsis and Coffee, the data presented here showing that the coffee CcDH2 promoter functions in arabidopsis, implies that this promoter should be active in a relatively wide variety of plants.
Example 10 Osmotic Stress-induced expression of genes encoding coffee dehvdrins CcDHl and CcDH2
Dehydrin genes are known to be induced under different forms of osmotic stress. Therefore, an evaluation was conducted to determine whether the coffee CcDHl and CcDH2 genes were induced by different osmotic stresses.
Materials and Methods:
Dehydration experiments were carried out using small clonally propagated, Coffea arabica catimor trees grown in a greenhouse. The trees were approximately 3 years old and were growing in soil. Several weeks prior to the experiments, the trees were cultivated together in the greenhouse with a temperature of approximately 25°C, with a relative humidity of approximately 70%, and were watered daily using automatic irrigation. At the start of the experiment, three trees acted as controls and were watered daily. The other three trees were not watered and thus underwent a progressive dehydration. Sampling of two young leaves (5-8 cm in size and taken from the emerging growth at the top of plant) was carried out every week for each tree and the samples were frozen directly in liquid nitrogen.
RNA extraction and synthesis of cDNA. The extraction of tissue samples subjected to the various stress treatments and the controls, was done using the RNEASY® Plant mini kit of Qiagen GmbH (Hilden, Germany). The frozen tissue samples were initially ground in a mortar and pestle using liquid nitrogen in order to obtain a powder. The RNA in this frozen powder was then extracted according to the protocol of the RNEASY® Plant mini kit In brief, a maximum of lOOmg frozen powder was mixed with the cellular lysis buffer and beta-mercaptoethanol. For tissues that showed significant necrosis, 2 |oM PMSF was also added. In order to eliminate low levels of contaminating genomic DNA, a treatment using DNase free-RNase contained in the RNEASY® Plant mini kit was used (as described by the supplier), that is, a 15 min treatment at room temperature on the column. At the end, the RNA was eluted from the column in 50uL RNase free water. The RNA quantity was determined by spectrophotometric measurement at 260nm and the RNA quality was estimated by calculating the absorbance ratio 260nm/280nm. The quality of RNAs was also verified by electrophoresis on 1% agarose gels. The reverse transcription reactions for these RNA samples were carried out as follows; approximately 1 ug total RNA and 12.4uM of oligo-dT [2.3 ul of 70uM oligo-dT (Proligo)] with Rnase free water to a final volume of 13uL. This mixture was incubated at 65°C for 5 min. Then, 7uL of a mix of 5X buffer (TRANSCRIPTOR® RT reaction buffer), 20U of RNase inhibitor, ImM of the four
dNTPs (250 um each) and 10U of TRANSCRIPTOR® reverse transcriptase (Roche, Nutley, NJ) was added. This mixture was incubated at 55°C for 40 min. Lastly, 0.5 uL of RNaseH (Invitrogen, Carlsbad, CA) was then added to the 20uL of mixture and the reaction was further incubated for 30min at 37°C. The cDNAs generated were purified using the SNAP™ Gel Purification Kit of Invitrogen (Carlsbad, CA) according to the protocol provided by the supplier.
Primers and MGB-probe design. The primers and MGB-probe sets were designed using the PRIMER EXPRESS™ software (Applied Biosystems, Foster City, CA). The temperatures of hybridisation of the primers were around 60°C whereas that of MGB-probe was close to 70°C. The size of the amplicons was approximately 80 bp. The primers were synthesized by PROLIGO and the MGB probes were synthesized in accordance with supplier's instructions (Applied Biosystems, Foster City, CA). The sequences of the primers and probes for CcDH2 and Ccrpl39 have been presented above in Table 1. The primers for CcDHl were 5' CACTGGCACTACTGGAGCCTATG 3' (SEQ ID NO,:45) and 5' GCTGGGTGGCGTATGCA 3'. The MGB probe for CcDHl was 5' CTGGAGCACATGGGA 3' (SEQ ID N0,:46).
Real-time Quantitative RT- PCR. The cDNA used for these experiments was prepared as described above. TaqMan-PCR was performed as recommended by the manufacturer (Applied Biosystems, Perkin-Elmer) and as described hereinabove. Briefly, all reactions were 25uL volume and contained 5ul cDNA, Ix TaqMan buffer (Applied Biosystems), 5mM MgCli, 200uM each of dATP, dCTP, dGTP and dUTP, and 0.625 units of AmpliTaq Gold DNA polymerase. The Applied Biosystems reaction buffer contains AmpErase® UNG (Uracil-N-glycosylase) and Passive reference dye (ROX TM), and optimised buffer components. The PCR reactions were carried out using SOOnM of the gene specific primers, forward and reverse, and with 200nM of the TaqMan probe and 5uL of 100-fold dilution cDNA, which corresponds to approximately 0.0 lug of total RNA. The reactions were incubated for 2 min at 50°C, then 10 min at 95°C, followed by 40 amplification cycles of 15 sec at 95°C/1 min at 60°C. The reactions were run and analysed using a GeneAmp 7500 Sequence Detection System (Applied Biosystems). Each sample was run 3 times and the average value calculated. Quantification was carried out using the method of relative quantification, with the constitutively expressed mRNA for the ribosomal protein rp!39 acting as the internal reference for each sample. In order to use the method of relative quantification, it was necessary to show that the amplification efficiency for the different test gene sequences were roughly equivalent to the amplification efficiency of the reference sequence (rpl39 cDNA sequence) using the specifically defined primer and probe sets. To determine this relative equivalence, plasmid DNA containing the appropriate cDNA
sequences were diluted 1/1000,1/10,000,1/100,000, and 1/1,000,000 fold, and'using the Q-PCR conditions described above, the slope of the curve Ct = f(Log quantity of DNA) was calculated for each plasmid/primer/TaqMan probe set. Plasmid/primer/TaqMan probe sets giving curves with slopes close to 3.32, which represents an efficiency of 100%, were considered acceptable. The plasmid/primer/TaqMan probe sets used all gave acceptable values for Ct = f(Log quantity ofDNA).
The absence of any significant level of residual genomic DNA in the cDNA preparations was verified by measuring the level of quantitative PCR amplification signal for a genomic specific primer/probe set for GOS gene versus the signal for a GOS gene cDNA probe.
Results:
Figure 9 shows the induction of CcDHl gene expression in the leaves of small green house grown trees when watering is stopped (drought conditions). After two weeks, DH1 expression is significantly induced in one of the water stressed plants (plant #4). After three weeks, CcDHl expression has been induced in all three of the water stressed plants (plants # 4-6). The induction is very significant, reaching an RQ of over 50 for plant #4. Considering the control gene rp!39 is relatively highly expressed, an RQ of 50 represents a very high level of gene expression induction, and strongly suggests that CcDHl plays an important role in the drought response of coffee leaves. Figure 10 shows the induction of CcDH2 gene expression in the same set of samples. The induction of CcDH2 shows several differences to the response of CcDHl. The first difference is that CcDH2 is clearly induced later than CcDHl, with the apparently most stressed plant (plant #4) showing induction at week 3, one week later than for CcDHl. By week 4, CcDH2 has been induced in all three water stressed plants. The second difference between CcDH2 versus CcDHl induction is that the level of CcDH2 induction is significantly lower than observed for CcDHl. Overall, these results indicate that CcDHl and CcDH2 are not induced in precisely the same manner, although the signals are probably overlapping, ie. the signal(s) needed for CcDHl induction are needed for CcDH2, but, CcDH2 may need additional signal(s) that appear only as the water stress increases. Supporting the argument that CcDH2 is induced by conditions approaching extreme water loss, the expression in plants #5 and #6 continued to increase as the water stress worsened with time without water. Alternatively, it may be that CcDH2 is expressed more significantly than indicated in Figure 10, but this induction is localized to specific tissues. It is important to note that the three control
plants that were regularly watered showed no induction of CcDHl or CcDH2 (Figures 9, 10;-plant #1-3).
The results presented above indicate that the promoters associated with CcDHl and CcDH2 can be useful for inducing and driving gene expression in osmotically stressed tissues. For example, these promoters can be used to drive expression of genes that are capable of affording some protection from osmotic stress at the precise period when this stress occurs, but not in most tissues under normal conditions. It is also apparent from the work above that, if the goal is to induce a gene at low water stress, the promoter for CcDHl would optimally be used, while for gene induction at higher water stress, the use of the CcDH2 would be more ideal when the object is to induce a recombinant gene only under relatively high water stress conditions. To further examine the effect of different osmotic stress conditions we examined the effect of cold temperature and elevated levels of NaCl on CcDHl and CcDHZ expression. We have also tested the effect of a hormone associated with osmotic stress signalling (abscisic acid -ABA). For these experiments, we used microcuttings of coffee growing on solid media in-vitro (solid media B0.3 in petri dish plates). For the experiment with cold and ABA we generated microcuttings for robusta variety ThB4 on B0.3 plates (16 hour photoperiod). When these microcuttings were sufficiently large, they were transferred to new media/plates and incubated a further 7 days at 24°C (16 hour photoperiod). At T=0, one set of plates were transferred to 5°C for 7 days (16 hour photoperiod). Another set of these microcuttings were put on media with ABA (media B0.3 + 100 uM ABA) for 7 days at 24°C (16 hour photoperiod). The samples taken at T=0 and T=7 days (5°C and ABA), were frozen at -80°C and men the RNA was extracted for QRT-PCR analysis as described above. The expression results obtained for the T=0 sample of the starting material indicate that CcDHl had an RQ =1.17. Other experiments have shown the basal levels of CcDHl can vary from RQ 0.05 to approximately RQ 1 in microcuttings. Such a relatively broad spread suggests that the higher level represents the detection of a slight osmotic stress in the starting material for this experiments (possibly related to how well the material has fixed to the solid media and/or how well the plates are sealed which affects the relative humidity, and the precise age of the starting material). Nonetheless, the samples kept at 5°C for 7 days showed no induction of CcDHl, and, in fact, the levels of CcDHl actually fell to an RQ = 0.16, a level closer to expression level more ofter seen in unstressed microcuttings).
In contrast to the data presented above for CcDHl, no CcDH2 expression was detected in the T=0. However, after 7 days at 5°C, an RQ = 0.022 was detected for CcDH2. This latter
observation suggests that CcDH2 is induced very slightly by cold conditions. It is noted that 5°C is a very low temperature for coffee, and thus it is possible that if the temperature of the cold stress was slightly higher (8-15°C), the induction of CcDH2 could be more significant. Finally, the microcuttings treated with 100 um ABA for 7 days showed a significant increase in CcDHl expression (RQ, 6.99). This latter result demonstrates that ABA is involved in the signalling for CcDHl induction. In contrast, ABA did not produce any detectable expression of CcDH2 indicating this hormone alone is not sufficient to induce CcDH2 to any detectable extent.
To test the effect of salt, we added 250 mM NaCl into the solid medium B0.3. At T=O, a set of microcuttings from Robusta FRT 35 were placed on B0.3 media or B0.3 media with 250 mM NaCl and placed at 24°C (16 hour photoperiod). At T=0 and at days 4 and 7 samples were taken and frozen at -80°C for later QRT-PCR analysis as described above. The results obtained show that, in the controls, the levels of CcDHl were quite low at the start and stayed low throughout the experiment (Control - T=0, RQ= 0.2; T=4 days, RQ= 0.07; T=7 days, RQ= 0.38). In the test treatment, the level of CcDHl rose significantly at days 4 and 7 of the treatment (250 mM NaCl - T=4 days, RQ= 3.31; T=7 days, RQ=4.46). This experiment shows that raising the salt concentration can induce DH1 expression to significant levels, although not as high as seen in the leaves of plants under water stress. No significant induction was seen for CcDH2 expression in the presence of 250 mM NaCl in either the the T=4 or T=7 day samples.
References:
Agrawal N, Dasaradhi PVN, Mohmmed A, Malhotra P, Bhatnagar RK, Mukherjee SK: RNA interference: Biology, mechanism, and applications. Microbiol. Mol Biol. Rev. 67:657-685 (2003).
Allagulova,CR, Gimalov,FR, Shakirova.FM, Vakhitov,VA: The plant dehydrins: Structure and putative functions. Biochemistry-Moscow 68: 945-951 (2003).
Alsheikh,MK, Heyen,BJ, Randall.SK: Ion binding properties of the dehydrin ERD14 are dependent upon phosphorylation. J.Biol.Chem. 278: 40882-40889 (2003).
Baumlein H,NIVRIDWU: Cis-analysis of a seed protein gene promoter: the conservative RY repeat CATGCATG within the legumin box is essential for tissue-specific expression of a legumin gene. Plant J. 2: 233-239 (1992).
Brummelkamp TR, Bernards R, Agami R: A system for stable expression of short interfering RNAs in mammalian cells. Science 296:550-553 (2002).
Chatthai M.FBYDSIOLOMMS: 2S storage protein gene of Douglas-fir: characterization and activity of promoter in transgenic tobacco seeds. Plant Physiol Biochem 42:417-423 (2004).
Choi,DW, Close.TJ: A newly identified barley gene, Dhnl2 encoding a YSK2 DHN, is located on chromosome 6H and has embryo-specific expression. Theoretical and Applied Genetics 100: 1274-1278 (2000).
Close,T: Dehydrins: emergence of a biochemical role of a family of plant dehydration proteins. PhysiolPlant 97: 795-803 (1996).
Close.TJ: Dehydrins: a commonality in the response of plants to dehydration and low temperature. Physiol.Plant 100:291-296 (1997).
dough, SJ and Bent AF: Floral dip: a simplified method for Agrobacterium-mediaied transformation of Arabidopsis thalicma. Plant Journal 16; 735-743 (1998).
Crouzillat,D, Lerceteau,E, Petiard,V, Morera,J, Rodriguez,H, Walker,D, Philips.WRR, Schnell,J, OseiJ, Fritz,P: Theobroma cacao L.: a genetic linkage map and quantitative trait loci analysis. Theor.Appl.Genet. 93: 205-214 (1996).
Dubouzet JG.SYIYKMDEMSSMSKY-SK: OsDREB genes in rice, Oryza sativa L, encode transcription activators that function in drought-, high-salt- and cold-responsive gene expression. Plant 133:751-763(2003).
Dure,L, Greenway.S, Galau,G: Biochemistry 20: 4162-4178 (1981).
Dure,L: Structural motifs in LEA proteinsof higher plants. In: Close, T. J., Bray, E, and A. (eds), Response of Plants to Cellular Dehydration During Environmental Stress, pp. 91-103. American Society of Plant-Physiologists, Rockville, MD. (1993).
Elbashir SM, Harborth J, Weber K, Tuschl T: Analysis of gene function in somatic mammalian cells using small interfering RNAs. Methods 26:199-213 (2002).
Godoy,JA, Lunar,R, Torres-Schumann.S, MorenoJ, Rodrigo,M, Pintor-Toro,JA: Expression, tissue distribution and subcellular localization of dehydrin TAS14 in salt-stressed tomato plants. Plant MoLBiol. 1921-1934 (1994).
Hara,M, Terashima.S, Fukaya,T, Kuboi.T: Enhancement of cold tolerance and inhibition of lipid peroxidation by citrus dehydrin in transgenic tobacco. Planta 217: 290-298 (2003).
Hara,M, Fujinaga,M, Kuboi.T: Radical scavenging activity and oxidative modification of citrus dehydrin. Plant Physiology and Biochemistry 42: 657-662 (2004).
Iida,K, Seki.M, Sakurai,T, Satou,M, Akiyama,K, Toyoda,T, Konagaya,A, Sinozaki,K: Genome-wide analysis of alternative pre-mRNA splicing in Arabidopsis thaliana based on full-length cDNA sequences. Nucleic Acids Research 32: 5096-5103 (2004).
Ingram,J, Bartels,D: The molecular basis of dehydration tolerance in plants, Annu.Rev.Plant Physiology Plant Mol Biol 47: 377-403 (1996).
Iwasald,T, Yamaguchi-Shinozaki,K, Shinozaki,K: Identification of a cis-regulatory region of a gene in Arabidopsis thaliana whose introduction by dehydration is mediated by abscisic acid and requires protein synthesis. Molecular and General Genetics 247: 391-398 (1995).
Klahie U, Crete P, Leuenberger AS, Iglesias VA, Meins F: High molecular weight RNAs and small interfering RNAs induce systemic post-transcriptional gene silencing in plants. Proc. Natl. Acad. Sci. USA 99:11981-11986 (2002).
Koag,MC, Fenton,RD, Wilkens,S, Close.TJ: The binding of maize DHN1 to lipid vesicles. Gain of structure and lipid specificity. Plant Physiology 131: 309-316 (2003).
Marraccini P., Deshayes A., Pe'tiard V. and Rogers W.J. 1999. Molecular cloning of the complete 1 IS seed storage protein gene of Coffea arabica and promoter analysis in the transgenic tobacco plants. Plant Physiol. Biochem. 37:273-282.
Marraccini P, Courjault C, Caillet V, Lausanne F, LePage B, Rogers W, Tessereau S, and Deshayes A. 2003. Rubisco small subunit of Coffea arabica: cDNA sequence, gene cloning and promoter analysis in transgenic tobacco plants. Plant Physiol. Biochem. 41:17-25.
Matsuyama,T, Yasumura,N, Funakoshi,M, Yamada,Y, Hashimoto.T: Maize genes specifically expressed in the outermost cells of the root cap. Plant Cell Physiol. 40:469-476 (1999).
Mishra RN, Singla-Pareek SL, Nair S, Sopory SK, Reddy MK: Directional genome walking using PCR. Biotechniques. 33:830-834 (2002).
Moore,R, McClelen,C: Ultrastructural aspects of cellular differentiation in the root cap of Zea . mays. Can.J.Bot. 61: 1566-1572 (1983).
Nylander,M, SvenssonJ, Palva,ET, Welin,BV: Stress-induced accumulation and tissue-specific localization of dehydrins in Arabidopsis thaliana. Plant Molecular Biology 45: 263-279 (2001).
Puhakainen,T, Hess,MW, Makela,P, Svensson,J, Heino.P, Palva,ET: Overexpression of multiple dehydrin genes enhances tolerance to freezing stress in Arabidopsis. Plant Molecular Biology 54: 743-753 (2004).
Rishi AS, Nelson ND, Goyal A: Genome walking of large fragments: an improved method. J. Biotechnol. 111:9-15 (2004).
Roberts,J, DeSimone.N, Lingle,W, Dure,L: Cellular concentrations and unifomity of cell-type accumulation of two LEA proteins in cotton embryos. Plant Cell 5: 769-780 (1993).
Rogers, WJ., Bezard, G., Deshayes, A., Meyer, I., Pe'tiard, V., Marraccini, P. (1999). Biochemical and molecular characterisation and expression of the 1 IS-type storage protein from Coffea arabica endosperm. Plant Physiol. Biochem. 37(4): 261-272.
Shirsat A.WNCRBD: Sequences responsible for the tissue specific promoter activity of a pea legumin gene in tobacco. Molecular and General Genetics 215: 326-331 (1989).
Skriver,K, Mundy,J: Gene expression in response to abscisic acid and osmotic stress. Plant Cell 2:503-512(1990).
Soulages.JL, Kim,K, Arrese,EL, Wafters,C, CushmanJC: Conformation of a group 2 late embryogenesis abundant protein from soybean. Evidence of poly (L-proline)-type II structure. Plant Physiology 131: 963-975 (2003).
Spanier,AM, Flores,M, Toldra,F, Aristoy,MC, Bett,KL, Bystricky,P, Bland,J: Meat flavor: contribution of proteins and peptides to the flavor of beef. Adv.Exp.Med.Biol. 542: 33-49 (2004).
Turner,!, Linfbrth,R, Taylor,A: Real-time monitoring of thermal flavor generation in skim milk powder using atmospheric pressure chemical ionization mass spectrometry. JAgric.Food Chem 50: 5400-5404 (2002).
Tuschl T, Borkhardt A: Small interfering RNAs: A revolutionary tool for the analysis of gene function and gene therapy. Mol. Interventions. 2:158-167 (2002).
Wise,M, Tunnacliffe,A: POPP the question: what do LEA proeins do? Trends Plant Sci. 9: 13-17 (2004).
Zhu,B, Choi,DW, Fenton,R, Close.TJ: Expression of the barley dehydrin multigene family and the development of freezing tolerance. Molecular and General Genetics 264: 145-153 (2000).
SEQUENCES of Claimed Nucleic Acids and Polypeptides
(Sequence Removed)
We Claims:-
1.
2. A nucleic acid molecule isolated from coffee (Coffea spp.), having a coding sequence
that encodes a dehydrin or a late embryogenic abundant (LEA) protein.
3. The nucleic acid molecule of claim 1, wherein the coding sequence encodes a dehydrin
having a molecular weight of between about 17 kDa and about 26 kDa.
4. The nucleic acid molecule of claim 2, wherein the dehydrin or LEA protein has an amino
acid sequence that is 46% or more identical to any one of SEQ ID NOS: 7-12.
5. The nucleic acid molecule of claim 3, wherein the dehydrin or LEA protein has an amino
acid sequence of any one of SEQ ID NOS: 7-12.
6. The nucleic acid molecule of claim 1, wherein the coding sequence is 50% or more
identical to any one of the coding sequences set forth in SEQ ED NOS: 1-6.
7. The nucleic acid molecule of claim 5, wherein the coding sequence comprises any one of
SEQ ID NOS: 1-6.
8. The nucleic acid molecule of claim 1, which is a gene having an open reading frame that
comprises the coding sequence.
9. A mRNA molecule produced by transcription of the gene of claim 7.
10. A cDNA molecule produced by reverse transcription of the mRNA molecule of claim 8.
10. An oligonucleotide between 8 and 100 bases in length, which is complementary to a
segment of the nucleic acid molecule of claim 1.
11. A vector comprising the nucleic acid molecule of claim 1.
12. The vector of claim 11, which is an expression vector selected from the group of vectors
consisting of plasmid, phagemid, cosmid, baculovirus, bacmid, bacterial, yeast and viral
vectors.
13. The vector of claim 11, wherein the coding sequence of the nucleic acid molecule is
operably linked to a constitutive promoter.
14. The vector of claim 11, wherein the coding sequence of the nucleic acid molecule is
operably linked to an inducible promoter.
15. The vector of claim 11, wherein the coding sequence of the nucleic acid molecule is
operably linked to a tissue specific promoter.
16. The vector of claim 15, wherein the tissue specific promoter is a seed specific promoter.
17. The vector of claim 16, wherein the seed specific promoter is a coffee seed specific
promoter.
18. The vector of claim 17, wherein the coffee seed specific promoter is a dehydrin gene
promoter.
19. The vector of claim 18, wherein the dehydrin gene promoter comprises SEQ ID NO: 13.
20. A host cell transformed with the vector of claim 11.
21. The host cell of claim 20, selected from the group consisting of plant cells, bacterial
cells, fungal cells, insect cells and mammalian cells.
22. The host cell of claim 21, which is a plant cell selected from the group of plants
consisting of coffee, tobacco, Arabidopsis, maize, wheat, rice, soybean barley, rye, oats,
sorghum, alfalfa, clover, canola, safflower, sunflower, peanut, cacao, tomato toinatillo, potato, pepper, eggplant, sugar beet, carrot, cucumber, lettuce, pea, aster, begonia, chrysanthemum, delphinium, zinnia, and turfgrasses.
23. A fertile transgenic plant produced by regenerating the host cell of claim 22.
24. The fertile transgenic plant of claim 23, which is Coffea spp.
25. A method to modulate flavor or aroma of coffee beans, comprising modulating
production of one or more dehydrins or LEA proteins within coffee seeds.
26. The method of claim 25, comprising increasing production of the one or more dehydrins
or LEA proteins.
27. The method of claim 26, comprising increasing expression of one or more endogenous
dehydrin- or LEA protein-encoding genes within the coffee seeds.
28. The method of claim 27, comprising introducing a dehydrin- or LEA protein-encoding
transgene into the plant.
29. The method of claim 25, comprising decreasing production of the one or more dehydrins
or LEA proteins.
30. The method of claim 29, comprising introducing a nucleic acid molecule into the coffee
that inhibits the expression of one or more of the dehydrin-or LEA protein-encoding
genes.
31. A method to increase resistance to osmotic stress in a plant comprising increasing
production of one or more dehydrins or LEA proteins within the plant.
32. The method of claim 31, comprising introducing a dehydrin- or LEA protein-encoding
transgene into the plant.
33. A promoter isolated from a coffee plant gene that encodes a dehydrin.
34. The promoter of claim 33, wherein (he gene encodes a dehydrin having a molecular
weight of between about 17 kDa and about 26 kDa.
35. The promoter of claim 34, wherein the gene encodes a dehydrin having an amino acid
sequence that is 50% or more identical to any one of SEQ ID NOS: 7-11.
36. The promoter of claim 35, wherein the gene encodes a dehydrin having any amino acid
sequence of any one of SEQ ID NOS: 7-11.
37. The promoter of claim 33, wherein the gene comprises an open reading frame that is 50%
or more identical to any one of the sequences set forth in SEQ ID NOS: 1-5.
38. The promoter of claim 37, wherein the gene comprises an open reading frame having any
one of SEQ ID NOS: 1-5.
39. The promoter of claim 33, comprising one or more regulatory sequences selected from
the group consisting of a TATA box, an abscisic acid responsive element, an RY repeat
(CATGCA(T/a)(A/g) of a leguminin box for regulating expression of leguminin-type
proteins, at least one dehydration responsive element/C-repeat cis-acting sequence motif
(G/ACCGAC and at least one E-box motif (CANNTG).
40. The promoter of claim 39, comprising SEQ ID NO: 13.
41. A chimeric gene comprising the promoter of claim 33, operably linked to one or more
coding sequences.
42. A vector for transforming a cell, comprising the chimeric gene of claim 41.
43. A cell transformed with the vector of claim 42.
44. The transformed cell of claim 43, which is a plant cell.
45. The transformed plant cell of claim 44, which is a cell ofCoffea spp.
46. A fertile transgenic plant produced by regenerating the transformed plant cell of claim 44.
47. The fertile transgenic plant of claim 46, which is Coffea spp.
| # | Name | Date |
|---|---|---|
| 1 | 10170-delnp-2007-pct-304.pdf | 2011-08-21 |
| 2 | 10170-delnp-2007-pct-237.pdf | 2011-08-21 |
| 3 | 10170-delnp-2007-pct-210.pdf | 2011-08-21 |
| 4 | 10170-delnp-2007-form-5.pdf | 2011-08-21 |
| 5 | 10170-delnp-2007-form-3.pdf | 2011-08-21 |
| 6 | 10170-delnp-2007-form-2.pdf | 2011-08-21 |
| 7 | 10170-delnp-2007-form-1.pdf | 2011-08-21 |
| 8 | 10170-delnp-2007-drawings.pdf | 2011-08-21 |
| 9 | 10170-delnp-2007-description (complete).pdf | 2011-08-21 |
| 10 | 10170-delnp-2007-correspondence-others.pdf | 2011-08-21 |
| 11 | 10170-delnp-2007-claims.pdf | 2011-08-21 |
| 12 | 10170-delnp-2007-abstract.pdf | 2011-08-21 |