Abstract: Methods are described for determining whether a subject suffering from or suspected of suffering from an infectious disease caused by a microbe is infected with a strain of the microbe that is susceptible to an antimicrobial agent where there exist different strains of the microbe that are resistant to the antimicrobial agent. The methods comprise determining whether nucleic acid of the strain of the microbe infecting the subject comprises wild type nucleotide sequence at a conserved nucleotide position at which mutation is associated with resistance to the antimicrobial agent in nucleic acid of the different resistant strains. The methods are particularly applicable for determining whether a subject suffering from or suspected of suffering from Gonorrhoea is infected with a strain of Neisseria gonorrhoeae that is susceptible to an antimicrobial agent. Kits for use in the methods are described as well as methods for treatment of infectious disease. Methods for reducing the prevalence of resistance of microbes causing infectious disease to antimicrobial agents are also described.
This invention relates to methods for diagnosis and treatment of infectious disease, for example sexually transmitted disease, such as Gonorrhoea, and to kits for use in such methods. The invention also relates to methods for reducing the prevalence of resistance of microbes causing infectious disease to antimicrobial agents.
Neisseria gonorrhoeae is a gram-negative bacterium and the aetiological agent of
Gonorrhoea, a sexually transmitted infection that is of significant public health concern. Infection with Gonorrhoea is on the increase. The World Health Organisation (WHO) estimates that there are 106 million new cases of Gonorrhoea among adults globally per annum, a 21 % increase upon the rate of infection in 2005. Gonorrhoea infection is often asymptomatic in females (≥50% of cases). This is a significant issue, as undiagnosed infection can lead to endometritis and pelvic inflammatory disease, which can result in infertility or loss of life through ectopic pregnancy. Infection in males is more commonly symptomatic (in≥90% of cases), with symptoms including epididymitis, penile discharge, swelling and pain. Extra-genital infection is common, particularly in men who have sex with men, however it can be found in heterosexuals as well, depending on sexual history. Extragenital infections are frequently asymptomatic, but contribute significantly to the
transmission of Gonorrhoea infection between sexual partners.
Diagnosis of infection with Gonorrhoea is critical to reduce complications and limit onward transmission. However, delays inherent in current clinical pathways, as a result of centralised Chlamydia/Gonorrhoea diagnosis, mean that significant numbers of
symptomatic patients are treated empirically according to their sexual history and symptoms in the absence of a positive diagnosis. Given that Gonorrhoea infection shares symptoms with a number of other sexually transmitted infections, overtreatment is a significant issue as symptomatic patients are treated with cocktails of several antibiotics, with no knowledge of the aetiology of infection. Such injudicious antibiotic use has been a significant contributing factor to the development of antimicrobial resistance in Gonorrhoea, which has led to its evolution to superbug status.
Over time, a wide range of antibiotics has been used for the treatment of Gonorrhoea infection. However, N. gonorrhoeae has proven to be exceedingly adept at developing antimicrobial resistance mechanisms, even in the absence of antimicrobial selection pressure. Azithromycin, a chemical derivative of Erythromycin, was used for the treatment of Gonorrhoea since the early 1980s (Erythromycin was not sufficiently effective for
treatment). However, the development of resistance to Azithromycin developed quickly following its implementation and it is no longer used in antibiotic mono-therapy.
Ciprofloxacin was widely used to treat Gonorrhoea infection from the mid-1980s. Initially, low doses were used but reduced susceptibility was observed by 1990. The minimum recommended dose was increased. However, resistance developed and spread quickly to the point where Ciprofloxacin had been abandoned as a treatment option by the mid-2000s. Two extended spectrum Cephalosporins (ESCs) have been widely used for treatment of Gonorrhoea infection: Cefixime and Ceftriaxone. Cefixime was the only oral ESC that was recommended by the World Health Organisation (WHO) for first-line therapy as it met the criteria for >95% cure rate. However, since reduced susceptibility to Cefixime was first observed in the late 2000s, recommended treatment was switched to Ceftriaxone and Azithromycin dual therapy.
The spectre of multi-drug resistant Gonorrhoea has been exacerbated by the liberal application of broad ranges of antibiotics to treat infection. Development of N. gonorrhoeae drug resistance has quickly followed the introduction of new antibiotics for treatment. A large proportion of Gonorrhoea types circulating worldwide are now only a few resistance markers away from developing into extensively drug resistant (XDR) strains (strains that are resistant to at least two commonly used antimicrobials). Indeed, two XDR strains have recently been identified in Japan and Europe; the H041 and F89 strains, respectively. Both strains are resistant to the extended spectrum Cephalosporin (ESC) Ceftriaxone, the last fully effective antimicrobial for Gonorrhoea treatment that can be used in mono-therapy.
In general, widespread use of particular antibiotics decreases their efficacy over time by promoting resistance through selective pressures. Conversely, decreasing the use of antibiotics could reduce prevalence of resistance to particular drugs over time. Thus, it is possible to slow the development of multi-drug resistant Gonorrhoea by limiting treatment to the narrowest range of antibiotics to which N. gonorrhoeae is susceptible. This is known as antimicrobial stewardship.
To facilitate reduction of antibiotic usage, it would be beneficial to be able to diagnose infection with Gonorrhoea rapidly, as this would reduce overtreatment as a result of syndromic management in symptomatic patients. For patients who are Gonorrhoea positive, it would be of significant benefit to know whether they are infected with a strain of N. gonorrhoeae that is susceptible or resistant to antibiotic treatment. This would guide prescription of the narrowest possible range of antibiotics to treat the infection effectively, thus extending the utility of the drugs that are currently available for the treatment of Gonorrhoea.
Nucleic acid amplification testing is now the 'gold-standard' for diagnosis of Gonorrhoea infection, so many clinical laboratories no longer receive samples that are suitable for determination of antibiotic susceptibility by Gonorrhoea culture techniques. Instead, surveillance of antimicrobial resistant strains is undertaken by random sampling of the population at 'sentinel' locations, where a full resistance profile is established by culture/agar dilution. This information is used to modify treatment guidelines, but may not be representative of the whole population. If molecular testing could be performed for each patient when they attend the clinic, effective treatments could be administered on a case-by-case basis, improving antimicrobial stewardship and treatment outcomes.
Currently, there is no reliable technology that allows for antibiotic susceptibility testing from non-culture specimens. Whilst a number of diagnostic assays for antimicrobial resistance determinants have been described in the literature (for penicillin, tetracycline, macrolides, fluoroquinolones and extended spectrum cephalosporins), their sensitivity/specificity is often suboptimal. There are also many different mutations that are responsible for antibiotic resistance, so it is not practicable to test for each different mutation to determine which resistant strain is present. There are currently no commercially available diagnostic platforms to establish the antibiotic resistance/susceptibility pattern of Gonorrhoea.
There is a need, therefore, for a test that can be used to determine rapidly whether a subject suffering from, or suspected of suffering from, Gonorrhoea is infected with a strain of N. gonorrhoeae that is susceptible or resistant to treatment with antibiotics.
Rather than carry out susceptibility testing by standard culture techniques, or carry out several different nucleic acid tests to determine the identity of the strain infecting the subject, the Applicant has appreciated that it is only necessary to determine whether the nucleic acid of the infecting strain comprises wild-type nucleotide sequence. In particular, it can simply be determined whether nucleic acid of the infecting strain comprises wild-type nucleotide sequence in a region of the nucleic acid with which mutation is known to be associated with resistance to the antimicrobial agent. If the subject is infected with a strain that comprises the wild-type nucleotide sequence, the subject can be administered with the antimicrobial agent as a monotherapy. If the subject is infected with a strain that does not comprise the wild-type sequence, the subject can be administered with a different antimicrobial agent, or with a combination of antimicrobial agents.
Use of such methods will limit the development and/or spread of antimicrobial resistance because the antimicrobial agent will be administered only to those subjects likely to be effectively treated by the antimicrobial agent, and not to those subjects infected with resistant strains.
The Applicant has recognised that, for each different antibiotic for which resistant strains of N. gonorrhoeae have developed, some positions in the nucleotide sequence are mutated in most, or almost all, strains that are resistant to that antibiotic. The Applicant has
appreciated that it can readily be determined whether a particular strain is susceptible to an antibiotic by assessing whether one or more of these conserved nucleotide positions contain wild-type nucleotide sequence or not. This can be done by nucleic acid testing, without any need to perform Gonorrhoea culture techniques.
The Applicant has also recognised that such methods are applicable to other infectious diseases caused by microbes where there exist strains of the microbe that are susceptible to an antimicrobial agent, and different strains of the microbe that are resistant to the antimicrobial agent.
According to the invention, there is provided a method of determining whether a subject suffering from, or suspected of suffering from, an infectious disease caused by a microbe is infected with a strain of the microbe that is susceptible to an antimicrobial agent, wherein there exist one or more different strains of the microbe that are resistant to the antimicrobial agent, wherein the method comprises determining whether nucleic acid of the strain of the microbe infecting the subject comprises wild-type nucleotide sequence.
In particular, methods of the invention may comprise determining whether nucleic acid of the strain of the microbe infecting the subject comprises wild-type nucleotide sequence in a region of the nucleic acid with which mutation is known to be associated with resistance to the antimicrobial agent.
The region may be any length region of nucleic acid of the infecting strain, for example a gene, or a portion of a gene, for example an exon or intron of a gene, or several continuous nucleotides, or a single nucleotide, such as a single nucleotide polymorphism (SNP) associated with resistance to the antimicrobial agent.
In particular, methods of the invention may comprise determining whether nucleic acid of the strain of the microbe infecting the subject comprises wild-type nucleotide sequence at a conserved nucleotide position at which mutation is associated with resistance to the antimicrobial agent in nucleic acid of different resistant strains.
The term 'conserved nucleotide position' is used herein to mean that, for a resistant strain, the nucleotide sequence at that position is different from the nucleotide sequence at the corresponding position in a susceptible strain, so the sequence at that nucleotide position is associated with resistance to the antimicrobial agent. In some instances, a conserved nucleotide position may be a single nucleotide polymorphism (SNP), for example a SNP that results in a change in the amino acid sequence encoded by the nucleotide sequence in which the conserved nucleotide position is found (a non-synonymous SNP), or a SNP that does not result in a change in the encoded amino acid sequence (a synonymous SNP). It is also possible that there may be two or more consecutive conserved nucleotide positions associated with resistance to the antimicrobial agent.
In some embodiments, a conserved nucleotide position may be mutated in all known strains of the microbe that are resistant to the antimicrobial agent, and not mutated in all known strains that are susceptible to the antimicrobial agent. If all known strains of the microbe that are resistant to the antimicrobial agent are mutated at the conserved nucleotide position, then determining the presence of a wild-type sequence at that conserved nucleotide position alone will enable a determination that the strain infecting the subject is susceptible to the antimicrobial agent.
For some antimicrobial agents, however, there may not be a conserved nucleotide position that is mutated in all known strains of the microbe that are resistant to that antimicrobial agent. In such circumstances, it may be necessary to determine whether nucleic acid of the strain infecting the subject comprises wild-type nucleotide sequence at a combination of different conserved nucleotide positions, wherein each known resistant strain of the microbe comprises a mutation at one or other of the conserved nucleotide positions of the combination, so that a reliable determination can be made regarding whether the infecting strain is resistant to that antimicrobial agent. For example, a first conserved nucleotide position may be mutated in a first subset of the known strains of the microbe that are resistant to the antimicrobial agent, and a second conserved nucleotide position may be mutated in a different, second subset of the known strains of the microbe that are resistant to the antimicrobial agent. If all the known strains of the microbe that are resistant to the antimicrobial agent are included in the first and the second subsets combined, then determining whether nucleic acid of the strain infecting the subject comprises wild-type nucleotide sequence at the first and second conserved nucleotide positions will be required to determine whether the subject is infected with a strain of the microbe that is susceptible to treatment with the antimicrobial agent.
Alternatively, if there is no conserved nucleotide position that is mutated in all known strains of the microbe that are resistant to the antimicrobial agent, or if there is no combination of conserved nucleotide positions, at least one of which is mutated in each known resistant strain of the microbe, for example only in each of a majority (or in at least 60%, 70%, 80%, or 90%) of the known resistant strains, it can be determined whether it is likely that the strain infecting the subject will be susceptible to the antimicrobial agent by determining whether nucleic acid of the infecting strain comprises wild-type nucleotide sequence at that position, or at that combination of positions.
It can be determined whether a nucleotide position is a conserved nucleotide position by aligning nucleotide sequence of one or more strains of the microbe that are known to be susceptible to the antimicrobial agent with nucleotide sequence of one or more strains of the microbe that are known to be resistant to the antimicrobial agent. Any nucleotide position at which mutations are present in the resistant strains, but not in the susceptible strains, will be a conserved nucleotide position that is associated with resistance. Similar methods can be used to determine whether longer regions of nucleotide sequence are associated with resistance.
Nucleic acid sequence alignment programs are well-known to the skilled person. Examples of suitable programs include multiple sequence alignment programs such as BLAST, Clustal Omega, and Multiple Sequence Comparison by Log-Expectation (MUSCLE).
It can be determined whether a strain of a microbe is susceptible to an antimicrobial agent by exposing a culture of the strain to different dilutions of the antimicrobial agent, for example on agar culture dishes, to determine the minimum concentration of the
antimicrobial agent that inhibits growth of the strain (the minimum inhibitory concentration (MIC)). Such techniques are well known to the skilled person. A strain of the microbe that is susceptible to the antimicrobial agent will have a lower MIC than a resistant strain.
Microbes can be categorised into susceptible, intermediately susceptible, and resistant for the relevant antimicrobial agent. The concentration that separates susceptible from non-susceptible microbes is called the S-breakpoint and is expressed as S≤Xmg/L (where X is a MIC value), and the concentration that separates resistant microbes from non-resistant (for example, susceptible or intermediately susceptible) microbes is called the R-breakpoint and is expressed as R>Ymg/L (where Y may be the same or a higher MIC value than X). Clinical breakpoints refer to those MICs that separate strains where there is a high likelihood of treatment success from those where treatment is more likely to fail. In Europe, the European Committee on Antimicrobial Susceptibility Testing (EUCAST), together with the European Medicines Agency (EMA), determines clinical breakpoints for antimicrobial agents (Kahlmeter, Upsala Journal of Medical Sciences, 2014; 1 19:78-86). These are published, and available on the EUCAST website (www.eucast.org). In the US, breakpoints are determined by the Clinical & Laboratory Standards Institute (CLSI) (www.clsi.org).
It will be appreciated that a 'wild-type nucleotide sequence' means a sequence that is present in one or more strains of the microbe that are susceptible to the antimicrobial agent, but not in one or more strains that are resistant to the antimicrobial agent, wherein mutation of the wild-type sequence is associated with resistance to the antimicrobial agent.
The antimicrobial agent may be any antimicrobial agent that prevents or inhibits growth, or replication of a strain of the microbe that is susceptible to the antimicrobial agent, and which may be used for the treatment of an infectious disease caused by the strain in a subject. Examples include an antibiotic, an antiviral agent, or an anti-fungal agent. An antibiotic, for example, may be bacteriostatic or bactericidal.
Examples of infectious diseases caused by microbes for which there are known to exist different strains of the microbe that are resistant to one or more antimicrobial agents are set out in Table 1 below:
Resistance determinants and mechanisms in Neisseria gonorrhoeae for antimicrobials previously or currently recommended for treatment of gonorrhoea are described by Unemo and Shafer, Clinical Microbiology Reviews, 2014, Vol. 27(3):587-613, particularly in Table 1 of that document. Known mutations associated with resistance of Neisseria gonorrhoeae to antimicrobial treatment are summarised in Table 2 below.
The infectious disease may be a sexually transmitted disease. In particular embodiments, the infectious disease is Gonorrhoea. In such embodiments, the antimicrobial agent may be an antibiotic, such as Cephalosporin, Ciprofloxacin, or Azithromycin. The Cephalosporin may be an extended spectrum Cephalosporin (ESC), such as Cefixime or Ceftriaxone.
The EUCAST MIC breakpoints (valid from 1 st January 2015) for Neisseria gonorrhoeae are: Cefixime: S≤0.125 mg/L; R>0.125 mg/L; Ceftriaxone: S≤0.125 mg/L; R>0.125 mg/L;
Ciprofloxacin: S≤0.03125 mg/L; R>0.0625 mg/L; Azithromycin: S≤0.25 mg/L; R>0.5 mg/L
In other embodiments, in which the infectious disease is Gonorrhoea, the antimicrobial agent may be a sulphonamide, a penicillin (e.g. penicillin G or ampicillin), a tetracycline (e.g. tetracycline or doxycycline), spectinomycin, a quinolone (e.g. ciproflaxin or ofloxacin), a macrolide (e.g. erythromycin or azithromycin), or a cephalosporin (e.g. ceftibuten, cefpodoxime, cefixime, cefotaxime, or ceftriaxone). In such embodiments, a method of the invention may comprise determining whether nucleic acid of the strain of Neisseria gonorrhoeae infecting the subject comprises wild-type nucleotide sequence of any of the genes recited in Table 2 above, or in any of the regions or conserved nucleotide positions (in particular, SNPs) of the genes recited in Table 2 above, with which mutation is known to be associated with resistance to the antimicrobial agent.
Several mutations in the penA gene (encoding penicillin-binding protein 2, PBP2) have been implicated in ESC resistance in Gonorrhoea, of which the penA mosaic allele is thought to be of significant relevance. Mosaic penA comprises several regions from a number of different Neisseria species, likely acquired by Neisseria gonorrhoeae through
genetic transformation. Over 30 mosaic alleles are in circulation, each of which varies in the number and identity of mutations relative to the wild type Gonorrhoea sequence.
However, certain mutations are conserved amongst the majority of penA mosaic alleles.
Mosaic penA appears to be the only significant determinant in the development of Cefixime resistance. There is, though, no single mosaic allele that definitively confers resistance.
However, the Applicant has appreciated that by identifying patients with wild-type penA sequences, it is possible to identify all patients that are susceptible to Cefixime treatment.
Ceftriaxone resistance mechanisms are significantly more complex than those for Cefixime.
The presence of any one of the more than 30 penA mosaic alleles is a major factor in the development of resistance, but does not guarantee resistance. Rather, resistance is dependent on a complex synergy of mutations in the penA, mtrR and porB genes.
However, all Gonorrhoea strains identified to date with high-level Ceftriaxone resistance have a mosaic penA. Determination of which subjects are infected with strains of N.
gonorrhoeae comprising wild-type penA allows the identification of subjects with
Gonorrhoea infections that are susceptible to treatment with Ceftriaxone.
Quinolones such as Ciprofloxacin act by inhibiting the activity of two enzymes, DNA gyrase and topoisomerase IV, required for DNA metabolism. Resistance to quinolones developed through the acquisition of single nucleotide polymorphisms (SNPs) in the genes encoding DNA gyrase and topoisomerase IV {gyrA and parC, respectively). Specific SNPs (at S91 and D95) in gyrA alone are sufficient to elicit low- to intermediate-level resistance. High-level resistance requires mutations in both gyrA and parC. Determination of which subjects are infected with strains of N. gonorrhoeae comprising wild-type gyrA allows the
identification of subjects with Gonorrhoea that are susceptible to treatment with
Ciprofloxacin. This is likely to account for around 50% of subjects suffering from
Gonorrhoea, and will enable the use of cheaper antibiotics, whilst preserving use of drugs such as the ESCs as treatment options for as long as possible.
Azithromycin acts by binding to the 23S ribosomal RNA (rRNA), part of the 50S subunit, which leads to inhibition of bacterial protein synthesis. Resistance to Azithromycin can occur by: methylase modification of 23S rRNA; overexpression of efflux pumps, which can act to increase the removal of antibiotics from the cell; or single nucleotide polymorphism (SNP) of particular nucleotides of the 23S rRNA. Azithromycin is the recommended treatment for Chlamydia infection, which is frequently found in Gonorrhoea positive patients. It is administered in conjunction with Ceftriaxone in many developed countries to ensure treatment is successful. Knowing whether subjects are infected with Azithromycin
susceptible Gonorrhoea allow it to be used as a monotherapy for those subjects, thus preserving ESCs as a treatment option for other subjects infected with strains of Neisseria gonorrhoeae that are resistant to Azithromycin. Nucleic acid testing is only able to detect resistance that arises as a result of SNPs in the 23S rRNA sequence. However, methylase modifications are very rare in Azithromycin strains. Nucleic acid testing can also be used to detect resistance to Azithromycin that arises as a result of overexpression of efflux pumps.
According to the invention, there is provided a method of determining whether a subject suffering from Gonorrhoea is infected with an antibiotic-susceptible strain of Neisseria gonorrhoeae, which comprises determining whether the strain of Neisseria gonorrhoeae comprises wild-type nucleotide sequence encoding the penA mosaic gene, the gyrA gene, or 23S ribosomal RNA.
According to the invention, there is also provided a method of determining whether a subject suffering from, or suspected of suffering from, Gonorrhoea is infected with a strain of Neisseria gonorrhoeae that is susceptible to an antimicrobial agent, which comprises determining whether nucleic acid of the strain of N. gonorrhoeae infecting the subject comprises wild-type nucleotide sequence at a conserved nucleotide position at which mutation is associated with resistance to the antimicrobial agent in nucleic acid of different strains of N. gonorrhoeae that are resistant to the antimicrobial agent.
According to some embodiments of the invention, mutations at one or more conserved nucleotide positions in the penA mosaic gene are associated with resistance to
Cephalosporin. In particular, mutations at nucleotide sequence encoding position F504 and A510 of the penA mosaic gene are conserved in strains that are resistant to Cephalosporin in almost all mosaic alleles, whilst mutations at nucleotide sequence encoding position A501 and A516 of the penA mosaic gene are conserved in strains that are resistant to Cephalosporin in a smaller subset of mosaic alleles.
Thus, in some embodiments of the invention, there is provided a method of determining whether a subject suffering from, or suspected of suffering from, Gonorrhoea is infected with a strain of Neisseria gonorrhoeae that is susceptible to Cephalosporin, which comprises determining whether the strain of N. gonorrhoeae comprises wild-type nucleotide sequence encoding position F504 and/or A510 of the penA mosaic gene.
Alternatively, or additionally the method may comprise determining whether the strain of Neisseria gonorrhoeae comprises wild-type nucleotide sequence encoding position A501 and/or A516 of the penA mosaic gene.
In other embodiments, mutation at nucleotide sequence encoding position A501 of a non-mosaic penA gene (in particular, A501V) is conserved in strains that are resistant to Cephalosporin (especially ceftriaxone and cefixime) (Unemo & Shafer, Clinical
Microbiology Reviews, 2014, 27(3):587-613). Accordingly, there is also provided according to the invention a method of determining whether a subject suffering from, or suspected of suffering from, Gonorrhoea is infected with a strain of Neisseria gonorrhoeae that is susceptible to Cephalosporin, which comprises determining whether the strain of N.
gonorrhoeae comprises wild-type nucleotide sequence encoding position A501 of the penA non-mosaic gene.
According to other embodiments of the invention, mutations at one or more conserved nucleotide positions in the gyrA gene are associated with resistance to Ciprofloxacin. In particular, mutations at nucleotide sequence encoding position S91 and/or D95 of the gyrA gene are conserved in strains that are resistant to Ciprofloxacin.
Thus, in some embodiments of the invention, there is provided a method of determining whether a subject suffering from, or suspected of suffering from, Gonorrhoea is infected with a strain of Neisseria gonorrhoeae that is susceptible to Ciprofloxacin, which comprises determining whether the strain of N. gonorrhoeae comprises wild-type nucleotide sequence encoding position S91 and/or D95 of the gyrA gene.
According to further embodiments of the invention, mutations at one or more conserved nucleotide positions in 23S ribosomal RNA are associated with resistance to Azithromycin. In particular, mutations at nucleotide sequence encoding position C261 1 and/or A2059 of 23S ribosomal RNA are conserved in strains that are resistant to Azithromycin.
Specific point mutations of 23S ribosomal RNA can result in varying degrees of resistance. For example, C261 1T is associated with strains that have low-level resistance, whereas A2059G is associated with strains that have high-level resistance. The level of resistance to Azithromycin is also linked to the number of mutated 23S alleles. N. gonorrhoeae has four copies of the 23S ribosomal RNA gene. If mutation is observed in only one of the alleles, even if the mutation is A2059G, low levels of resistance will be observed. However, strains with a single mutated allele, while susceptible to treatment with Azithromycin, will quickly develop high-level resistance.
Thus, in some embodiments of the invention, there is provided a method of determining whether a subject suffering from, or suspected of suffering from, Gonorrhoea is infected with a strain of Neisseria gonorrhoeae that is susceptible to Azithromycin, which comprises determining whether the strain of N. gonorrhoeae comprises wild-type nucleotide sequence encoding position C2611 and/or A2059 of 23S ribosomal RNA. Optionally, the method may further comprise determining whether the strain of N. gonorrhoeae does not include mutant nucleotide sequence encoding position C261 1 and/or A2059 of 23S ribosomal RNA.
If the strain does not include detectable mutant nucleotide sequence encoding position C261 1 and/or A2059 of 23S ribosomal RNA, it can be concluded that all four copies of the 23S ribosomal RNA gene are wild-type, and that the subject is infected with a strain of Neisseria gonorrhoeae that is susceptible to Azithromycin.
It may be determined whether the strain includes mutant nucleotide sequence encoding position C261 1 and/or A2059. If any mutant sequence is present (for example, even if only a single copy of the 23S ribosomal RNA gene comprises the mutant sequence) treatment with Azithromycin should be avoided so as not to select for Azithromycin resistance.
Determination of whether the strain of N. gonorrhoeae comprises wild-type nucleotide sequence encoding position C261 1 and/or A2059 of 23S ribosomal RNA (and optionally does not include mutant nucleotide sequence encoding position C261 1 and/or A2059) may be carried out by detecting for the wild-type (and optionally the mutant) encoding sequence itself, or by detecting for the wild-type (and optionally the mutant) 23S ribosomal RNA sequence encoded by such sequence.
Ng et al. (Antimicrobial Agents and Chemotherapy, 2002, 46(9):3020-3025) describe specific amplification of the four alleles of Neisseria gonorrhoeae 23S ribosomal RNA by PGR using a PGR forward primer of sequence: ACG AATG G CGTAACG ATG G CCAC A (SEQ ID NO:9) paired with a specific primer for each of the 23S rRNA alleles:
The allele-specific primers prime downstream of the 23S rRNA.
The PGR conditions used by Ng et al were 1 min of denaturation at 94°C, 1.5 min at 66°C (for alleles 2 and 3) or 68°C (for alleles 1 and 4) for annealing, and 2.5 min at 72°C for elongation for 30 cycles.
The amplicons obtained were then used as templates in a second PGR reaction using a the PCR forward primer of SEQ ID NO:9, and a reverse primer of sequence:
TTCGTCCACTCCGGTCCTCTCGTA (SEQ ID NO: 14). The conditions for this second PCR reaction were 1 min of denaturation at 94°C, 1 min at 59°C for annealing, and 1 min at 72°C for elongation for 35 cycles.
Similar methods may be used according to the invention to determine whether the strain of Neisseria gonorrhoeae infecting the subject comprises wild-type nucleotide sequence encoding position C261 1 and/or A2059 of 23S rRNA and, optionally, does not include mutant nucleotide sequence encoding position C2611 and/or A2059 of 23S rRNA. For example, the products of the second PCR reaction may be sequenced, or incubated under hybridizing conditions with a labelled oligonucleotide probe that is able to distinguish between PCR products comprising the wild-type and mutant sequences.
Nucleic acid testing can also be used to detect resistance to Azithromycin that arises as a result of overexpression of efflux pumps. The MtrCDE efflux pump can export structurally diverse hydrophobic antimicrobials. Gonococcal strains showing intermediate-level resistance to substrates of the MtrCDE efflux pump typically have missense mutations in a DNA-binding domain coding region of the mtrR gene (commonly a G45D substitution in the helix-turn-helix domain of amino acid residues 32 to 53), which encodes the MtrR repressor that binds to the mtrCDE promoter. Strains expressing high-level resistance have mutations (most frequently a single 'A' nucleotide deletion in a 13-base pair inverted repeat sequence between hexamer sequences at -10 and -35) in the mtrR promoter. Such mutations result in overexpression of, and increased efflux from, the MtrCDE efflux pump (Unemo & Shafer, Clinical Microbiology Reviews, 2014, 27(3):587-613).
Thus, in some embodiments of the invention, a method of determining whether a subject suffering from, or suspected of suffering from, Gonorrhoea is infected with a strain of Neisseria gonorrhoeae that is susceptible to Azithromycin may further comprise
determining whether the strain of N. gonorrhoeae comprises a wild-type mtrR promoter sequence (in particular a wild-type 13-base pair repeat sequence between hexamer sequences -10 and -35), and/or a wild-type nucleotide sequence encoding position G45 in the helix-turn-helix domain of amino acid residues 32 to 53 of the mtrR gene.
Zarantonelli et at (Antimicrobial Agents and Chemotherapy, 1999 43(10):2468-2472) and and Ng et al (Antimicrobial Agents and Chemotherapy, 2002, 46(9):3020-3025) describe methods for PCR amplification of the mtrR gene, including the promoter region, using
primers: ACTG AAG CTTATTTCCG G CG C AG G CAG G G (SEQ ID NO: 15) and G ACG AC AGTG CCAATG C AACG (SEQ ID NO:16). Such methods may be used according to the invention to determine whether the strain of Neisseria gonorrhoeae infecting the subject comprises wild-type mtrR promoter sequence and/or a wild-type nucleotide sequence encoding position G45 of the mtrR gene. For example, the products of the PGR reaction may be sequenced, or incubated under hybridizing conditions with a labelled oligonucleotide probe that is able to distinguish between PGR products comprising the wild-type and mutant sequences.
Genome sequences for several strains of Neisseria gonorrhoeae have been determined. See, for example: Lewis et al., The Complete Genome Sequence of Neisseria gonorrhoeae (GenBank accession no. AE004969, Neisseria gonorrhoeae FA 1090, complete genome); Chung et al., Complete Genome Sequence of Neisseria gonorrhoeae NCCP11945, Journal of Bacteriology, 2008, 6035-6036 (GenBank accession no. CP001050); Hess ef al., Genome Sequence of a Neisseria gonorrhoeae Isolate of a Successful International Clone with Decreased Susceptibility and Resistance to Extended-Spectrum Cephalosporins, Antimicrobial Agents and Chemotherapy, 2012, 56(1 1 ):5633-5641 (strain SM-3).
Sequence of the penicillin-binding protein 2 (pen A) gene for Neisseria gonorrhoeae strain LM306, based on NCBI GenBank accession number M32091 (version M32091.1 ; Spratt, Nature (1988) 332 (6160), 173-176), and sequences of the gyrA, and mtrR genes, and the 23S ribosomal RNA alleles, for Neisseria gonorrhoeae strain FA 1090, based on NCBI Reference Sequence NC_002946.2, are provided below. These sequences (or other available Neisseria gonorrhoeae sequences) can be used to design suitable
oligonucleotide primers and probes to determine whether a particular wild-type sequence (or combination of wild-type sequences) is present in the strain of Neisseria gonorrhoeae infecting the subject.
If the strain of Neisseria gonorrhoeae comprises wild-type nucleotide sequence encoding the penA mosaic gene, it is expected that the subject can be treated effectively with Cephalosporin as a monotherapy. If the strain of Neisseria gonorrhoeae comprises wild-type nucleotide sequence encoding the gyrA gene, it is expected that the subject can be treated effectively with Ciprofloxacin as a monotherapy. If the strain of Neisseria
gonorrhoeae comprises wild-type nucleotide sequence encoding 23S ribosomal RNA (and optionally does not include mutant nucleotide sequence encoding position C261 1 and/or A2059 of 23S ribosomal RNA), it is expected that the subject can be treated effectively with Azithromycin as a monotherapy. Similarly, if the strain of Neisseria gonorrhoeae also
comprises a wild-type mtrR promoter sequence and/or a wild-type nucleotide sequence encoding position G45 of the mtrR gene, it is expected that the subject can be treated effectively with Azithromycin as a monotherapy.
In some embodiments of the invention, it may be determined whether the subject is infected by a strain of the microbe that is susceptible to any of a plurality of different antimicrobial agents. In such embodiments, the determinations in respect of the different antimicrobial agents may be made at the same time, for example, in a single test. For example, it may be determined whether a subject suffering from, or suspected of suffering from, Gonorrhoea is infected with a strain of Neisseria gonorrhoeae that is susceptible to each of: Ciprofloxacin, Azithromycin, and Cephalosporin; Ciprofloxacin and Azithromycin; Ciprofloxacin and Cephalosporin; or Azithromycin and Cephalosporin.
In other embodiments, it may first be determined for one of the antimicrobial agents whether a subject suffering from, or suspected of suffering from, the infectious disease is infected with a strain of the microbe that is susceptible to that antimicrobial agent. If the subject is found to be infected with a strain of the microbe that is susceptible to the antimicrobial agent, the subject may then be administered with, or prescribed for administration with, the antimicrobial agent as a monotherapy. If the subject is found to be infected with a strain of the microbe that is resistant to the antimicrobial agent, it may then be determined whether the subject is infected with a strain of the microbe that is susceptible to a second antimicrobial agent. If the subject is found to be infected with a strain of the microbe that is susceptible to the second antimicrobial agent, the subject may then be administered with, or prescribed for administration with, the second antimicrobial agent as a monotherapy. If the subject is found to be infected with a strain of the microbe that is resistant to the second antimicrobial agent, and further antimicrobial agents against the microbe are known, it may be determined whether the subject is infected with a strain of the microbe that is susceptible to a third antimicrobial agent, and so on, until an antimicrobial agent is found to which the strain infecting the subject is susceptible. If there is no antimicrobial agent to which the strain infecting the subject is susceptible, the subject may then be administered with, or prescribed for administration with, a combination of two or more of the antimicrobial agents to which the strain is resistant.
For example, in some embodiments of the invention, it may first be determined whether a subject suffering from, or suspected of suffering from, Gonorrhoea is infected with a strain of N. gonorrhoeae that is susceptible to any of the antimicrobial agents selected from Ciprofloxacin, Azithromycin, and Cephalosporin. If it is found that the subject is infected with a strain that is susceptible to the selected antimicrobial agent, the subject can then be administered with that antimicrobial agent as a monotherapy. If it is found that the subject is infected with a strain that is resistant to the selected antimicrobial agent, it may then be determined whether the subject is infected with a strain of N. gonorrhoeae that is susceptible to one of the remaining antimicrobial agents. If it is found that the subject is infected with a strain that is susceptible to the second selected antimicrobial agent, the subject can then be administered with that antimicrobial agent as a monotherapy. If it is found that the subject is infected with a strain that is resistant to the second selected antimicrobial agent, it may then be determined whether the subject is infected with a strain of N. gonorrhoeae that is susceptible to the remaining antimicrobial agent. If it is found that the subject is infected with a strain that is susceptible to the third selected antimicrobial agent, the subject may then be administered with that antimicrobial agent as a
monotherapy. If it is found that the subject is infected with a strain that is resistant to the third selected antimicrobial agent, the subject may then be administered with a combination of the first and the second selected antimicrobial agent, the first and the third selected antimicrobial agent, or the second and the third selected antimicrobial agent, or with all three antimicrobial agents.
By such methods, use of antimicrobial agents is limited to treatment of infections caused by strains that are known to be susceptible to the selected antimicrobial agent as a
monotherapy, and use of antimicrobial agents against strains that are resistant to the antimicrobial agent is minimised, thereby reducing the amount of selection for such resistant strains. Such methods reduce the prevalence of resistance to antimicrobial agents, as well as the development or spread of resistance, and the development of resistance to multiple antimicrobial agents (multi-drug resistance).
For example, the susceptibility determinations for Ciprofloxacin, Azithromycin, and
Cephalosporin may be made in any of the following orders: Cephalosporin, then
Azithromycin, then Ciprofloxacin; Cephalosporin, then Ciprofloxacin, then Azithromycin; Azithromycin, then Ciprofloxacin, then Cephalosporin; Azithromycin, then Cephalosporin, then Ciprofloxacin; Ciprofloxacin, then Cephalosporin, then Azithromycin; Ciprofloxacin, then Azithromycin, then Cephalosporin.
For example, in some embodiments of the invention, it may first be determined whether a subject suffering from, or suspected of suffering from, Gonorrhoea is infected with a strain of N. gonorrhoeae that is susceptible to Ciprofloxacin. If it is found that the subject is infected with a strain that is susceptible to Ciprofloxacin, the subject may then be
administered with Ciprofloxacin as a monotherapy. If it is found that the subject is infected with a strain that is resistant to Ciprofloxacin, it may then be determined whether the subject is infected with a strain of N. gonorrhoeae that is susceptible to Azithromycin. If it is found that the subject is infected with a strain that is susceptible to Azithromycin, the subject may then be administered with Azithromycin as a monotherapy. If it is found that the subject is infected with a strain that is resistant to Azithromycin, it may then be determined whether the subject is infected with a strain of N. gonorrhoeae that is susceptible to Cephalosporin. If it is found that the subject is infected with a strain that is susceptible to Cephalosporin, the subject may then be administered with Cephalosporin as a monotherapy. If it is found that the subject is infected with a strain that is resistant to Cephalosporin, the subject may then be administered with Azithromycin and
Cephalosporin, or with Ciprofloxacin and Azithromycin, or with Ciprofloxacin and
Cephalosporin.
In other embodiments, it may first be determined whether a subject suffering from, or suspected of suffering from, Gonorrhoea is infected with a strain of N. gonorrhoeae that is susceptible to Azithromycin. If it is found that the subject is infected with a strain that is susceptible to Azithromycin, the subject may then be administered with Azithromycin as a monotherapy. If it is found that the subject is infected with a strain that is resistant to Azithromycin, it may then be determined whether the subject is infected with a strain of N. gonorrhoeae that is susceptible to Ciprofloxacin. If it is found that the subject is infected with a strain that is susceptible to Ciprofloxacin, the subject may then be administered with Ciprofloxacin as a monotherapy. If it is found that the subject is infected with a strain that is resistant to Ciprofloxacin, it may then be determined whether the subject is infected with a strain of N. gonorrhoeae that is susceptible to Cephalosporin. If it is found that the subject is infected with a strain that is susceptible to Cephalosporin, the subject may then be administered with Cephalosporin as a monotherapy. If it is found that the subject is infected with a strain that is resistant to Cephalosporin, the subject may then be administered with Azithromycin and Cephalosporin, or with Ciprofloxacin and Azithromycin, or with
Ciprofloxacin and Cephalosporin.
Alternatively, susceptibility determinations may be made for two of Ciprofloxacin,
Azithromycin, and Cephalosporin in any order, for example Ciprofloxacin then
Azithromycin; Ciprofloxacin then Cephalosporin; Azithromycin then Cephalosporin;
Azithromycin then Ciprofloxacin; Cephalosporin then Ciprofloxacin; or Ciprofloxacin then Cephalosporin.
There is also provided according to the invention a method for treating a subject infected with N. gonorrhoeae, which comprises:
determining whether the subject is infected with an antibiotic-susceptible strain of N. gonorrhoeae by determining whether the strain of N. gonorrhoeae comprises wild-type nucleotide sequence encoding the penA mosaic gene, the gyrA gene, or 23S ribosomal RNA; and
administering Cephalosporin to the subject as a monotherapy if it is determined that the strain of N. gonorrhoeae comprises wild-type nucleotide sequence encoding the penA mosaic gene; or
administering Ciprofloxacin to the subject as a monotherapy if it is determined that the strain of N. gonorrhoeae comprises wild-type nucleotide sequence encoding the gyrA gene; or
administering Azithromycin to the subject as a monotherapy if it is determined that the strain of N. gonorrhoeae comprises wild-type nucleotide sequence of 23S ribosomal RNA.
It may be determined whether the subject is infected with a Cephalosporin-susceptible strain of N. gonorrhoeae by determining whether the strain of N. gonorrhoeae comprises wild-type nucleotide sequence encoding position F504 and/or A510 of the penA mosaic gene. Optionally, it may be further determined whether the strain of N. gonorrhoeae comprises wild-type nucleotide sequence encoding position A501 and/or A516 of the penA mosaic gene. In other embodiments, it may be determined whether the subject is infected with a Cephalosporin-susceptible strain of N. gonorrhoeae by determining whether the strain of N. gonorrhoeae comprises wild-type nucleotide sequence encoding position A501 of the penA non-mosaic gene.
It may be determined whether the subject is infected with a Ciprofloxacin-susceptible strain of N. gonorrhoeae by determining whether the strain of N. gonorrhoeae comprises wild-type nucleotide sequence encoding position S91 and/or D95 of the gyrA gene.
It may be determined whether the subject is infected with an Azithromycin-susceptible strain of N. gonorrhoeae by determining whether the strain of N. gonorrhoeae comprises nucleic acid with wild-type nucleotide sequence encoding position C261 1 and/or A2059 of 23S ribosomal RNA. Optionally, it may also be determined whether the strain of N.
gonorrhoeae does not include mutant nucleotide sequence encoding position C261 1 and/or A2059 of 23S ribosomal RNA. Optionally, it may be determined whether the strain of N. gonorrhoeae also comprises a wild-type mtrR promoter sequence (in particular, a wild-type 13-base pair repeat sequence between hexamer sequences -10 and -35) and/or a wild-type nucleotide sequence encoding position G45 of the mtrR gene.
Some methods of the invention for treating a subject infected with N. gonorrhoeae comprise:
i) determining whether a subject suffering from, or suspected of suffering from, Gonorrhoea is infected with a strain of N. gonorrhoeae that is susceptible to a first antimicrobial agent;
ii) if it is found that the subject is infected with a strain that is susceptible to the first antimicrobial agent, administering the first antimicrobial agent as a monotherapy to the subject;
iii) if it is found that the subject is infected with a strain that is resistant to the first antimicrobial agent, then determining whether the subject is infected with a strain of N. gonorrhoeae that is susceptible to a second antimicrobial agent;
iv) if it is found that the subject is infected with a strain that is susceptible to the second antimicrobial agent, administering the second antimicrobial agent as a
monotherapy to the subject;
v) if it is found that the subject is infected with a strain that is resistant to the second antimicrobial agent, administering the first and the second antimicrobial agents as a combination therapy to the subject.
The first and second antimicrobial agents may be selected from Ciprofloxacin,
Azithromycin, and Cephalosporin. For example, the first and second antimicrobial agents may be respectively: Ciprofloxacin and Azithromycin; Ciprofloxacin and Cephalosporin; Azithromycin and Cephalosporin; Azithromycin and Ciprofloxacin; Cephalosporin and Ciprofloxacin; or Ciprofloxacin and Cephalosporin.
In other embodiments, the first and second antimicrobial agents may be selected from any of the antimicrobial agents listed in Table 2 above.
In some embodiments, where there are three antimicrobial agents to test, methods of the invention for treating a subject infected with N. gonorrhoeae may comprise:
i) determining whether a subject suffering from, or suspected of suffering from, an infectious disease is infected with a strain of N. gonorrhoeae that is susceptible to a first antimicrobial agent;
ii) if it is found that the subject is infected with a strain that is susceptible to the first antimicrobial agent, administering the first antimicrobial agent as a monotherapy to the subject;
iii) if it is found that the subject is infected with a strain that is resistant to the first antimicrobial agent, then determining whether the subject is infected with a strain of N. gonorrhoeae that is susceptible to a second antimicrobial agent;
iv) if it is found that the subject is infected with a strain that is susceptible to the second antimicrobial agent, administering the second antimicrobial agent as a
monotherapy to the subject;
v) if it is found that the subject is infected with a strain that is resistant to the second antimicrobial agent, then determining whether the subject is infected with a strain of N. gonorrhoeae that is susceptible to a third antimicrobial agent;
vi) if it is found that the subject is infected with a strain that is susceptible to the third antimicrobial agent, administering the third antimicrobial agent as a monotherapy to the subject;
vii) if it is found that the subject is infected with a strain that is resistant to the third antimicrobial agent, administering the first and the second, the first and the third, the second and the third, or the first, second, and the third, antimicrobial agents as a combination therapy to the subject.
For example, the first, second, and third antimicrobial agents may be, respectively:
Cephalosporin, Azithromycin, and Ciprofloxacin; Cephalosporin, Ciprofloxacin, and Azithromycin; Azithromycin, Ciprofloxacin, and Cephalosporin; Azithromycin,
Cephalosporin, and Ciprofloxacin; Ciprofloxacin, Cephalosporin, and Azithromycin; or Ciprofloxacin, Azithromycin, and Cephalosporin.
In other embodiments, the first, second, and third antimicrobial agents may be selected from any of the antimicrobial agents listed in Table 2 above.
For example, methods of the invention for treating a subject infected with N. gonorrhoeae may comprise:
i) determining whether a subject suffering from, or suspected of suffering from,
Gonorrhoea is infected with a strain of N. gonorrhoeae that is susceptible to Ciprofloxacin;
ii) if it is found that the subject is infected with a strain that is susceptible to
Ciprofloxacin, administering Ciprofloxacin as a monotherapy to the subject;
iii) if it is found that the subject is infected with a strain that is resistant to
Ciprofloxacin, determining whether the subject is infected with a strain of N. gonorrhoeae that is susceptible to Azithromycin;
iv) if it is found that the subject is infected with a strain that is susceptible to Azithromycin, administering Azithromycin as a monotherapy to the subject;
v) if it is found that the subject is infected with a strain that is resistant to
Azithromycin, determining whether the subject is infected with a strain of N. gonorrhoeae that is susceptible to Cephalosporin;
vi) if it is found that the subject is infected with a strain that is susceptible to Cephalosporin, administering Cephalosporin as a monotherapy to the subject;
vii) if it is found that the subject is infected with a strain that is resistant to
Cephalosporin, administering Azithromycin and Cephalosporin, Ciprofloxacin and
Azithromycin, or Ciprofloxacin and Cephalosporin as a combination therapy to the subject.
In an alternative example, methods of the invention for treating a subject infected with N. gonorrhoeae may comprise:
i) determining whether a subject suffering from, or suspected of suffering from, Gonorrhoea is infected with a strain of N. gonorrhoeae that is susceptible to Azithromycin;
ii) if it is found that the subject is infected with a strain that is susceptible to
Azithromycin, administering Azithromycin as a monotherapy to the subject;
iii) if it is found that the subject is infected with a strain that is resistant to
Azithromycin, determining whether the subject is infected with a strain of N. gonorrhoeae that is susceptible to Ciprofloxacin;
Claims
1. A method for determining whether a subject suffering from, or suspected of suffering from, an infectious disease caused by a microbe is infected with a strain of the microbe that is susceptible to an antimicrobial agent, wherein there exist different strains of the microbe that are resistant to the antimicrobial agent, wherein the method comprises determining whether nucleic acid of the strain of the microbe infecting the subject comprises wild-type nucleotide sequence at a conserved nucleotide position at which mutation is associated with resistance to the antimicrobial agent in nucleic acid of the different resistant strains.
2. A method according to claim 1 , wherein it is determined whether nucleic acid of the strain infecting the subject comprises wild-type nucleotide sequence at a first conserved nucleotide position, and at a second, different conserved nucleotide position, wherein the first conserved nucleotide position is mutated in a first subset of strains of the microbe that are resistant to the antimicrobial agent, and the second conserved nucleotide position is mutated in a second subset of strains of the microbe that are resistant to the antimicrobial agent.
3. A method according to claim 1 or 2, wherein the antimicrobial agent is a first antimicrobial agent, and the method further comprises determining whether the subject is infected with a strain of the microbe that is susceptible to a second antimicrobial agent, wherein there exist different strains of the microbe that are resistant to the second antimicrobial agent, and wherein the method comprises determining whether nucleic acid of the strain of the microbe infecting the subject comprises wild-type nucleotide sequence at a conserved nucleotide position at which mutation is associated with resistance to the second antimicrobial agent in nucleic acid of the different resistant strains.
4. A method according to claim 3, wherein it is determined whether the subject is infected with a strain of the microbe that is susceptible to the second antimicrobial agent if it is determined that the subject is infected with a strain of the microbe that is resistant to the first antimicrobial agent.
5. A method according to any preceding claim, which comprises determining whether the strain of the microbe infecting the subject comprises the wild-type nucleotide sequence by specifically detecting for the wild-type nucleotide sequence.
6. A method according to claim 5, which comprises specifically detecting for the wild-type nucleotide sequence using a method that comprises amplification of nucleic acid of the strain infecting the subject that has been obtained from the subject.
7. A method according to claim 6, which further comprises detecting for product resulting from amplification of the nucleic acid using a dipstick.
8. A method according to any of claims 5 to 7, which comprises specifically detecting for the wild-type nucleotide sequence using an oligonucleotide that hybridizes under stringent conditions to nucleic acid comprising sequence that is the same sequence as, or complementary to, the wild-type nucleotide sequence, but which does not hybridize under stringent conditions to nucleic acid comprising sequence that is the same sequence as, or complementary to, nucleotide sequence comprising a mutation at the conserved nucleotide position that is associated with resistance to the antimicrobial agent.
9. A method according to any preceding claim, wherein the infectious disease is a sexually transmitted disease.
10. A method according to any preceding claim, wherein the infectious disease is Gonorrhoea.
1 1. A method according to claim 10, for determining whether a subject suffering from Gonorrhoea is infected with an antibiotic-susceptible strain of Neisseria gonorrhoeae, which comprises determining whether the strain of Neisseria gonorrhoeae comprises wild-type nucleotide sequence at a conserved nucleotide position of the penA mosaic gene, the gyrA gene, or 23S ribosomal RNA.
12. A method according to claim 11 for determining whether the subject is infected with a Cephalosporin-susceptible strain of Neisseria gonorrhoeae, wherein it is determined whether the strain of Neisseria gonorrhoeae comprises wild-type nucleotide sequence encoding position F504 and/or A510 of the penA mosaic gene.
13. A method according to claim 12, which further comprises determining whether the strain of Neisseria gonorrhoeae comprises wild-type nucleotide sequence encoding position A501 and/or A516 of the penA mosaic gene.
14. A method according to claim 10, for determining whether a subject suffering from Gonorrhoea is infected with a Cephalosporin-susceptible strain of Neisseria gonorrhoeae, which comprises determining whether the strain of Neisseria gonorrhoeae comprises wild-type nucleotide sequence encoding a conserved position of the penA non-mosaic gene, preferably position A501 of the penA non-mosaic gene.
15. A method according to any of claims 1 1 to 14, for determining whether the subject is infected with a Ciprofloxacin-susceptible strain of Neisseria gonorrhoeae, wherein it is determined whether the strain of Neisseria gonorrhoeae comprises wild-type nucleotide sequence encoding position S91 and/or D95 of the gyrA gene.
16. A method according to any of claims 11 to 15, for determining whether the subject is infected with an Azithromycin-susceptible strain of Neisseria gonorrhoeae, wherein it is determined whether the strain of Neisseria gonorrhoeae comprises wild-type nucleotide sequence encoding position C2611 and/or A2059 of 23S ribosomal RNA, and optionally whether the strain of Neisseria gonorrhoeae does not comprise mutant nucleotide sequence encoding position C2611 and/or A2059 of 23S ribosomal RNA.
17. A method according to claim 16, which further comprises determining whether the strain of N. gonorrhoeae comprises a wild-type mtrR promoter sequence and/or a wild-type nucleotide sequence encoding position G45 of the mtrR gene.
18. A method according to claim 11 , which comprises:
i) determining whether the subject is infected with a strain of Neisseria gonorrhoeae that is susceptible to a first antimicrobial agent selected from Cephalosporin, Ciprofloxacin, and Azithromycin, using a method according to any of claims 1 1 to 17; and, if it is determined that the subject is infected with a strain of Neisseria gonorrhoeae that is resistant to the first antimicrobial agent,
ii) determining whether the subject is infected with a strain of Neisseria gonorrhoeae that is susceptible to a second, different antimicrobial agent selected from Cephalopsorin, Ciprofloxacin, and Azithromycin, using a method according to any of claims 1 1 to 17; and, if it is determined that the subject is infected with a strain of Neisseria gonorrhoeae that is resistant to the second antimicrobial agent,
iii) determining whether the subject is infected with a strain of Neisseria gonorrhoeae that is susceptible to a third, different antimicrobial agent selected from Cephalopsorin,
Ciprofloxacin, and Azithromycin, using a method according to any of claims 11 to 17.
19. A method of treating, or prescribing treatment of, a subject suffering from, or suspected of suffering from, an infectious disease caused by a microbe, which comprises:
determining whether the subject is infected with a strain of the microbe that is susceptible to an antimicrobial agent, wherein there exist different strains of the microbe that are resistant to the antimicrobial agent, using a method according to any of claims 1 to
8; and
administering, or prescribing for administration, to the subject an effective amount of the antimicrobial agent as a monotherapy if it is determined that the subject is infected with a strain of the microbe that is susceptible to the antimicrobial agent.
20. A method according to claim 19, which comprises:
determining whether the subject is infected with a strain of the microbe that is susceptible to a first antimicrobial agent, wherein there exist different strains of the microbe that are resistant to the first antimicrobial agent, using a method according to any of claims 1 to 8; and
administering, or prescribing for administration, to the subject an effective amount of the first antimicrobial agent as a monotherapy if it is determined that the subject is infected with a strain of the microbe that is susceptible to the first antimicrobial agent; or
if it is determined that the subject is infected with a strain of the microbe that is resistant to the first antimicrobial agent, determining whether the subject is infected with a strain of the microbe that is susceptible to a second, different antimicrobial agent, wherein there exist different strains of the microbe that are resistant to the second antimicrobial agent, using a method according to any of claims 1 to 8; and
administering, or prescribing for administration, to the subject an effective amount of the second antimicrobial agent as a monotherapy if it is determined that the subject is infected with a strain of the microbe that is susceptible to the second antimicrobial agent; or
if it is determined that the subject is infected with a strain of the microbe that is resistant to the second antimicrobial agent, administering, or prescribing for administration, to the subject an effective amount of the first and the second antimicrobial agent as a combination therapy.
21. A method according to claim 19, wherein the infectious disease is Gonorrhoea, and wherein the method comprises:
determining whether the subject is infected with an antibiotic-susceptible strain of Neisseria gonorrhoeae by determining whether the strain of N. gonorrhoeae comprises wild-type nucleotide sequence encoding the penA mosaic gene, the gyrA gene, or 23S ribosomal RNA; and
administering, or prescribing for administration, Cephalosporin to the subject as a monotherapy if it is determined that the strain of N. gonorrhoeae comprises wild-type nucleotide sequence encoding the penA mosaic gene;
administering, or prescribing for administration, Ciprofloxacin to the subject as a monotherapy if it is determined that the strain of N. gonorrhoeae comprises wild-type nucleotide sequence encoding the gyrA gene; or
administering, or prescribing for administration, Azithromycin to the subject as a monotherapy if it is determined that the strain of N. gonorrhoeae comprises wild-type nucleotide sequence of 23S ribosomal RNA.
22. A method according to claim 19, wherein the infectious disease is Gonorrhoea, and wherein the method comprises:
determining whether the subject is infected with an antibiotic-susceptible strain of Neisseria gonorrhoeae by determining whether the strain of N. gonorrhoeae comprises wild-type nucleotide sequence encoding the penA mosaic gene, the penA non-mosaic gene, the gyrA gene, or 23S ribosomal RNA and, optionally, the mtrR gene and/or the mtrR promoter; and
administering, or prescribing for administration, Cephalosporin to the subject as a monotherapy if it is determined that the strain of N. gonorrhoeae comprises wild-type nucleotide sequence encoding the penA mosaic gene, or the penA non-mosaic gene;
administering, or prescribing for administration, Ciprofloxacin to the subject as a monotherapy if it is determined that the strain of N. gonorrhoeae comprises wild-type nucleotide sequence encoding the gyrA gene; or
administering, or prescribing for administration, Azithromycin to the subject as a monotherapy if it is determined that the strain of N. gonorrhoeae comprises wild -type nucleotide sequence of 23S ribosomal RNA and, optionally, the mtrR gene and/or the mtrR promoter.
23. A method according to claim 20, wherein the infectious disease is Gonorrhoea, and the first and the second antimicrobial agent are each selected from Cephalosporin, Ciprofloxacin, and Azithromycin, and wherein it is determined whether the subject is infected with a Cephalosporin-susceptible strain by determining whether the strain of N. gonorrhoeae comprises wild -type nucleotide sequence encoding the penA mosaic gene, a Ciprofloxacin-resistant strain by determining whether the strain of N. gonorrhoeae comprises wild-type nucleotide sequence encoding the gyrA gene, and an Azithromycin-resistant strain by determining whether the strain of N. gonorrhoeae comprises wild-type nucleotide sequence of 23S ribosomal RNA.
24. A method according to claim 20, wherein the infectious disease is Gonorrhoea, and the first and the second antimicrobial agent are each selected from Cephalosporin,
Ciprofloxacin, and Azithromycin, and wherein it is determined whether the subject is infected with a Cephalosporin-susceptible strain by determining whether the strain of N. gonorrhoeae comprises wild-type nucleotide sequence encoding the penA mosaic gene or the penA non-mosaic gene, a Ciprofloxacin-resistant strain by determining whether the strain of N. gonorrhoeae comprises wild-type nucleotide sequence encoding the gyrA gene, and an Azithromycin-resistant strain by determining whether the strain of N. gonorrhoeae comprises wild-type nucleotide sequence of 23S ribosomal RNA and, optionally, the mtrR gene and/or the mtrR promoter.
25. A method according to any of claims 21 to 24, which comprises determining whether the subject is infected with a Cephalosporin-susceptible strain of Neisseria gonorrhoeae by determining whether the strain of Neisseria gonorrhoeae comprises wild-type nucleotide sequence encoding position F504 and/or A510 of the penA mosaic gene, and administering, or prescribing for administration, an effective amount of Cephalosporin to the subject as a monotherapy if it is determined that the strain of N. gonorrhoeae comprises wild-type nucleotide sequence encoding position F504 and/or A510 of the penA mosaic gene.
26. A method according to claim 25, which further comprises determining whether the strain of Neisseria gonorrhoeae comprises wild-type nucleotide sequence encoding
position A501 and/or A516 of the penA mosaic gene, and administering, or prescribing for administration, an effective amount of Cephalosporin to the subject as a monotherapy if it is determined that the strain of N. gonorrhoeae comprises wild-type nucleotide sequence encoding position F504 and/or A510 of the penA mosaic gene.
27. A method according to claim 22 or 24, which comprises determining whether the subject is infected with a Cephalosporin-susceptible strain of Neisseria gonorrhoeae by determining whether the strain of Neisseria gonorrhoeae comprises wild-type nucleotide sequence encoding position A501 of the penA non-mosaic gene, and administering, or prescribing for administration, an effective amount of Cephalosporin to the subject as a monotherapy if it is determined that the strain of N. gonorrhoeae comprises wild -type nucleotide sequence encoding position A501 of the penA non-mosaic gene.
28. A method according to any of claims 21 to 27, which comprises determining whether the subject is infected with a Ciprofloxacin-susceptible strain of Neisseria gonorrhoeae by determining whether the strain of Neisseria gonorrhoeae comprises wild-type nucleotide sequence encoding position S91 and/or D95 of the gyrA gene, and administering, or prescribing for administration, an effective amount of Ciprofloxacin to the subject as a monotherapy if it is determined that the strain of N. gonorrhoeae comprises wild-type nucleotide sequence encoding position S91 and/or D95 of the gyrA gene.
29. A method according to any of claims 21 to 28, which comprises determining whether the subject is infected with an Azithromycin-susceptible strain of Neisseria gonorrhoeae by determining whether the strain of Neisseria gonorrhoeae comprises wild-type nucleotide sequence encoding position C261 1 and/or A2059 of 23S ribosomal RNA, and administering, or prescribing for administration, an effective amount of Azithromycin as a monotherapy if it is determined that the strain of N. gonorrhoeae comprises wild-type nucleotide sequence of 23S ribosomal RNA.
30. A method according to claim 29, which further comprises determining whether the strain of Neisseria gonorrhoeae does not comprise mutant nucleotide sequence encoding position C261 1 and/or A2059 of 23S ribosomal RNA, and administering, or prescribing for administration, an effective amount of Azithromycin as a monotherapy if it is determined that the strain of N. gonorrhoeae comprises wild-type nucleotide sequence of 23S ribosomal RNA and does not comprise mutant nucleotide sequence of 23S ribosomal RNA.
31. A method according to claim 29 or 30, which further comprises determining whether the strain of N. gonorrhoeae comprises a wild-type mtrR promoter sequence and/or a wild-type nucleotide sequence encoding position G45 of the mtrR gene, and administering, or prescribing for administration, an effective amount of Azithromycin as a monotherapy if it is determined that the strain of N. gonorrhoeae comprises wild-type nucleotide sequence of 23S ribosomal RNA, and optionally does not comprise mutant nucleotide sequence of 23S ribosomal RNA, and that the strain of N. gonorrhoeae comprises a wild-type mtrR promoter sequence and/or a wild-type nucleotide sequence encoding position G45 of the mtrR gene.
32. A kit for determining whether a subject suffering from Gonorrhoea is infected with an antibiotic-susceptible strain of Neisseria gonorrhoeae, which comprises:
i) an oligonucleotide that hybridizes under stringent conditions to N. gonorrhoeae nucleic acid comprising sequence that is the same sequence as, or complementary to, wild-type nucleotide sequence of the penA mosaic gene, wherein the oligonucleotide comprises nucleotide sequence that is complementary to, or the same sequence as, wild-type nucleotide sequence encoding position F504 and/or A510 of the penA mosaic gene, and wherein the oligonucleotide does not hybridize under stringent conditions to N.
gonorrhoeae nucleic acid comprising sequence that is the same sequence as, or complementary to, nucleotide sequence of a resistant strain of N. gonorrhoeae encoding a mutation at position F504 and/or A510 of the penA mosaic gene; and/or
is) an oligonucleotide that hybridizes under stringent conditions to N. gonorrhoeae nucleic acid comprising sequence that is the same sequence as, or complementary to, wild-type nucleotide sequence of the penA mosaic gene, wherein the oligonucleotide comprises nucleotide sequence that is complementary to, or the same sequence as, wild-type nucleotide sequence encoding position A501 and/or A516 of the penA mosaic gene, and wherein the oligonucleotide does not hybridize under stringent conditions to N.
gonorrhoeae nucleic acid comprising sequence that is the same sequence as, or complementary to, nucleotide sequence of a resistant strain of N. gonorrhoeae encoding a mutation at position A501 and/or A516 of the penA mosaic gene; and/or
iii) an oligonucleotide that hybridizes under stringent conditions to N. gonorrhoeae nucleic acid comprising sequence that is the same sequence as, or complementary to, wild-type nucleotide sequence of the gyrA gene, wherein the oligonucleotide comprises nucleotide sequence that is complementary to, or the same sequence as, wild-type nucleotide sequence encoding position S91 and/or D95 of the gyrA gene, and wherein the
oligonucleotide does not hybridize under stringent conditions to N. gonorrhoeae nucleic acid comprising sequence that is the same sequence as, or complementary to, nucleotide sequence of a resistant strain of N. gonorrhoeae encoding a mutation at position S91 and/or D95 of the gyrA gene; and/or
iv) an oligonucleotide that hybridizes under stringent conditions to N. gonorrhoeae nucleic acid comprising sequence that is the same sequence as, or complementary to, wild-type nucleotide sequence of 23S ribosomal RNA, wherein the oligonucleotide comprises nucleotide sequence that is complementary to, or the same sequence as, wild-type nucleotide sequence encoding position C261 1 and/or A2059 of 23S ribosomal RNA, and wherein the oligonucleotide does not hybridize under stringent conditions to N.
gonorrhoeae nucleic acid comprising sequence that is the same sequence as, or complementary to, nucleotide sequence of a resistant strain of N. gonorrhoeae encoding a mutation at position C2611 and/or A2059 of 23S ribosomal RNA.
33. A kit according to claim 32, which comprises the oligonucleotide of (i) and/or (ii) and/or (iii) and/or (iv), and/or:
v) an oligonucleotide that hybridizes under stringent conditions to N. gonorrhoeae nucleic acid comprising sequence that is the same sequence as, or complementary to, wild-type nucleotide sequence of the penA non-mosaic gene, wherein the oligonucleotide comprises nucleotide sequence that is complementary to, or the same sequence as, wild-type nucleotide sequence encoding position A501 of the penA non-mosaic gene, and wherein the oligonucleotide does not hybridize under stringent conditions to N. gonorrhoeae nucleic acid comprising sequence that is the same sequence as, or complementary to, nucleotide sequence of a resistant strain of N. gonorrhoeae encoding a mutation at position A501 of the penA non-mosaic gene.
34. A kit according to claim 32 or 33 which comprises the oligonucleotide of (iv), and wherein the kit further comprises:
vi) an oligonucleotide that hybridizes under stringent conditions to N. gonorrhoeae nucleic acid comprising sequence that is the same sequence as, or complementary to, wild-type nucleotide sequence from position -10 to -35 of the mtrR promoter, wherein the
oligonucleotide comprises nucleotide sequence that is complementary to, or the same sequence as, wild-type nucleotide sequenc from -10 to -35 of the mtrR promoter, and wherein the oligonucleotide does not hybridize under stringent conditions to N.
gonorrhoeae nucleic acid comprising sequence that is the same sequence as, or complementary to, nucleotide sequence of a resistant strain of N. gonorrhoeae comprising a mutation at a position from -10 to -35 of the mtrR promoter; and/or
vii) an oligonucleotide that hybridizes under stringent conditions to N. gonorrhoeae nucleic acid comprising sequence that is the same sequence as, or complementary to, wild-type nucleotide sequence encoding position G45 of the mtrR gene, wherein the oligonucleotide comprises nucleotide sequence that is complementary to, or the same sequence as, wild-type nucleotide sequence encoding position G45 of the mtrR gene, and wherein the oligonucleotide does not hybridize under stringent conditions to N. gonorrhoeae nucleic acid comprising sequence that is the same sequence as, or complementary to, nucleotide sequence of a resistant strain of N. gonorrhoeae encoding a mutation at position G45 of the mtrR gene.
35. A kit according to any of claims 32 to 34, wherein the oligonucleotides are selected from oligonucleotides that hybridize under stringent conditions to nucleic acid comprising sequence that is the same sequence as, or complementary to, the nucleotide sequence of:
AAACCGGCACGGCGCGCAAGTTCGTCAACGGGCGT (SEQ ID NO:1 );
TATG CCG ACAAC AAAC ACGTCG CTACCTTTATCG G (SEQ ID NO:2);
AAATACCACCCCCACGGCGATTCCGCAGTTTACGAC (SEQ ID NO:3);
ACC ATCGTC CGTATG G CG C AAAATTTCG CTATG CGT (SEQ ID NO:4);
GAAGATGCAATCTACCCGCTGCTAGACGGAAAGACCCCGTGAACCTTTACTGTAGCTT TGC (SEQ ID NO:5); or
CATTTAAAGTGGTACGTGAGCTGGGTTTAAAACGTCGTGAGACAGTTTGGTCCCTATC TGCAGTGGG (SEQ ID NO:6).
36. A kit according to any of claims 32 to 34, wherein the kit comprises oligonucleotides selected from oligonucleotides that hybridize under stringent conditions to nucleic acid comprising sequence that is the same sequence as, or complementary to, the nucleotide sequence of:
AAACCGGCACGGCGCGCAAGTTCGTCAACGGGCGT (SEQ ID NO:1 );
38. A kit according to any of claims 32 to 37, which further comprises oligonucleotide primers for amplification of Neisseria gonorrhoeae nucleic acid that comprises the wild-type nucleotide sequence encoding position: A501 and/or A516 of the penA mosaic gene; S91 and/or D95 of the gyrA gene; or C261 1 and/or A2059 of 23S ribosomal RNA.
39. A kit according to any of claims 32 to 37, which further comprises oligonucleotide primers for amplification of Neisseria gonorrhoeae nucleic acid that comprises the wild-type nucleotide sequence encoding position: F504 and/or A510 of the penA mosaic gene and optionally, A501 and/or A516 of the penA mosaic gene; S91 and/or D95 of the gyrA gene; or C2611 and/or A2059 of 23S ribosomal RNA.
40. A kit according to any of claims 32 to 38, which further comprises oligonucleotide primers for amplification of Neisseria gonorrhoeae nucleic acid that comprises the wild-type nucleotide sequence encoding position: F504 and/or A510 of the penA mosaic gene and optionally, A501 and/or A516 of the penA mosaic gene; A501 of the penA non-mosaic gene; S91 and/or D95 of the gyrA gene; C2611 and/or A2059 of 23S ribosomal RNA and, optionally, -10 to -35 of the mtrR promoter and/or G45 of the mtrR gene.
| Section | Controller | Decision Date |
|---|---|---|
| # | Name | Date |
|---|---|---|
| 1 | 201717046465-IntimationOfGrant12-12-2023.pdf | 2023-12-12 |
| 1 | 201717046465-TRANSLATIOIN OF PRIOIRTY DOCUMENTS ETC. [23-12-2017(online)].pdf | 2017-12-23 |
| 2 | 201717046465-PatentCertificate12-12-2023.pdf | 2023-12-12 |
| 2 | 201717046465-STATEMENT OF UNDERTAKING (FORM 3) [23-12-2017(online)].pdf | 2017-12-23 |
| 3 | 201717046465-SEQUENCE LISTING(PDF) [23-12-2017(online)].pdf | 2017-12-23 |
| 3 | 201717046465-Response to office action [11-12-2023(online)].pdf | 2023-12-11 |
| 4 | 201717046465-SEQUENCE LISTING [23-12-2017(online)].pdf | 2017-12-23 |
| 4 | 201717046465-Response to office action [08-12-2023(online)].pdf | 2023-12-08 |
| 5 | 201717046465-Written submissions and relevant documents [27-09-2023(online)].pdf | 2023-09-27 |
| 5 | 201717046465-FORM 1 [23-12-2017(online)].pdf | 2017-12-23 |
| 6 | 201717046465-FORM 3 [14-09-2023(online)].pdf | 2023-09-14 |
| 6 | 201717046465-DRAWINGS [23-12-2017(online)].pdf | 2017-12-23 |
| 7 | 201717046465-DECLARATION OF INVENTORSHIP (FORM 5) [23-12-2017(online)].pdf | 2017-12-23 |
| 7 | 201717046465-Correspondence to notify the Controller [12-09-2023(online)].pdf | 2023-09-12 |
| 8 | 201717046465-FORM-26 [12-09-2023(online)].pdf | 2023-09-12 |
| 8 | 201717046465-COMPLETE SPECIFICATION [23-12-2017(online)].pdf | 2017-12-23 |
| 9 | 201717046465-US(14)-ExtendedHearingNotice-(HearingDate-14-09-2023).pdf | 2023-08-29 |
| 9 | abstract.jpg | 2018-01-17 |
| 10 | 201717046465-FORM-26 [01-03-2018(online)].pdf | 2018-03-01 |
| 10 | 201717046465-REQUEST FOR ADJOURNMENT OF HEARING UNDER RULE 129A [18-08-2023(online)].pdf | 2023-08-18 |
| 11 | 201717046465-Power of Attorney-060318.pdf | 2018-03-15 |
| 11 | 201717046465-US(14)-ExtendedHearingNotice-(HearingDate-23-08-2023).pdf | 2023-07-31 |
| 12 | 201717046465-Correspondence-060318.pdf | 2018-03-15 |
| 12 | 201717046465-REQUEST FOR ADJOURNMENT OF HEARING UNDER RULE 129A [29-07-2023(online)].pdf | 2023-07-29 |
| 13 | 201717046465-FORM 3 [18-06-2018(online)].pdf | 2018-06-18 |
| 13 | 201717046465-US(14)-HearingNotice-(HearingDate-02-08-2023).pdf | 2023-07-11 |
| 14 | 201717046465-FORM 3 [03-10-2022(online)].pdf | 2022-10-03 |
| 14 | 201717046465-FORM 3 [29-01-2019(online)].pdf | 2019-01-29 |
| 15 | 201717046465-FORM 18 [15-06-2019(online)].pdf | 2019-06-15 |
| 15 | 201717046465-FORM 3 [05-04-2022(online)].pdf | 2022-04-05 |
| 16 | 201717046465-FER.pdf | 2021-10-18 |
| 16 | 201717046465-FORM 3 [03-12-2019(online)].pdf | 2019-12-03 |
| 17 | 201717046465-FORM 4(ii) [30-03-2021(online)].pdf | 2021-03-30 |
| 17 | 201717046465-FORM 3 [12-10-2021(online)].pdf | 2021-10-12 |
| 18 | 201717046465-ABSTRACT [29-06-2021(online)].pdf | 2021-06-29 |
| 18 | 201717046465-FORM 3 [16-04-2021(online)].pdf | 2021-04-16 |
| 19 | 201717046465-CLAIMS [29-06-2021(online)].pdf | 2021-06-29 |
| 19 | 201717046465-PETITION UNDER RULE 137 [29-06-2021(online)].pdf | 2021-06-29 |
| 20 | 201717046465-COMPLETE SPECIFICATION [29-06-2021(online)].pdf | 2021-06-29 |
| 20 | 201717046465-PETITION UNDER RULE 137 [29-06-2021(online)]-1.pdf | 2021-06-29 |
| 21 | 201717046465-DRAWING [29-06-2021(online)].pdf | 2021-06-29 |
| 21 | 201717046465-OTHERS [29-06-2021(online)].pdf | 2021-06-29 |
| 22 | 201717046465-FER_SER_REPLY [29-06-2021(online)].pdf | 2021-06-29 |
| 23 | 201717046465-DRAWING [29-06-2021(online)].pdf | 2021-06-29 |
| 23 | 201717046465-OTHERS [29-06-2021(online)].pdf | 2021-06-29 |
| 24 | 201717046465-PETITION UNDER RULE 137 [29-06-2021(online)]-1.pdf | 2021-06-29 |
| 24 | 201717046465-COMPLETE SPECIFICATION [29-06-2021(online)].pdf | 2021-06-29 |
| 25 | 201717046465-PETITION UNDER RULE 137 [29-06-2021(online)].pdf | 2021-06-29 |
| 25 | 201717046465-CLAIMS [29-06-2021(online)].pdf | 2021-06-29 |
| 26 | 201717046465-ABSTRACT [29-06-2021(online)].pdf | 2021-06-29 |
| 26 | 201717046465-FORM 3 [16-04-2021(online)].pdf | 2021-04-16 |
| 27 | 201717046465-FORM 3 [12-10-2021(online)].pdf | 2021-10-12 |
| 27 | 201717046465-FORM 4(ii) [30-03-2021(online)].pdf | 2021-03-30 |
| 28 | 201717046465-FER.pdf | 2021-10-18 |
| 28 | 201717046465-FORM 3 [03-12-2019(online)].pdf | 2019-12-03 |
| 29 | 201717046465-FORM 18 [15-06-2019(online)].pdf | 2019-06-15 |
| 29 | 201717046465-FORM 3 [05-04-2022(online)].pdf | 2022-04-05 |
| 30 | 201717046465-FORM 3 [03-10-2022(online)].pdf | 2022-10-03 |
| 30 | 201717046465-FORM 3 [29-01-2019(online)].pdf | 2019-01-29 |
| 31 | 201717046465-FORM 3 [18-06-2018(online)].pdf | 2018-06-18 |
| 31 | 201717046465-US(14)-HearingNotice-(HearingDate-02-08-2023).pdf | 2023-07-11 |
| 32 | 201717046465-Correspondence-060318.pdf | 2018-03-15 |
| 32 | 201717046465-REQUEST FOR ADJOURNMENT OF HEARING UNDER RULE 129A [29-07-2023(online)].pdf | 2023-07-29 |
| 33 | 201717046465-Power of Attorney-060318.pdf | 2018-03-15 |
| 33 | 201717046465-US(14)-ExtendedHearingNotice-(HearingDate-23-08-2023).pdf | 2023-07-31 |
| 34 | 201717046465-FORM-26 [01-03-2018(online)].pdf | 2018-03-01 |
| 34 | 201717046465-REQUEST FOR ADJOURNMENT OF HEARING UNDER RULE 129A [18-08-2023(online)].pdf | 2023-08-18 |
| 35 | 201717046465-US(14)-ExtendedHearingNotice-(HearingDate-14-09-2023).pdf | 2023-08-29 |
| 35 | abstract.jpg | 2018-01-17 |
| 36 | 201717046465-FORM-26 [12-09-2023(online)].pdf | 2023-09-12 |
| 36 | 201717046465-COMPLETE SPECIFICATION [23-12-2017(online)].pdf | 2017-12-23 |
| 37 | 201717046465-DECLARATION OF INVENTORSHIP (FORM 5) [23-12-2017(online)].pdf | 2017-12-23 |
| 37 | 201717046465-Correspondence to notify the Controller [12-09-2023(online)].pdf | 2023-09-12 |
| 38 | 201717046465-FORM 3 [14-09-2023(online)].pdf | 2023-09-14 |
| 38 | 201717046465-DRAWINGS [23-12-2017(online)].pdf | 2017-12-23 |
| 39 | 201717046465-Written submissions and relevant documents [27-09-2023(online)].pdf | 2023-09-27 |
| 39 | 201717046465-FORM 1 [23-12-2017(online)].pdf | 2017-12-23 |
| 40 | 201717046465-SEQUENCE LISTING [23-12-2017(online)].pdf | 2017-12-23 |
| 40 | 201717046465-Response to office action [08-12-2023(online)].pdf | 2023-12-08 |
| 41 | 201717046465-SEQUENCE LISTING(PDF) [23-12-2017(online)].pdf | 2017-12-23 |
| 41 | 201717046465-Response to office action [11-12-2023(online)].pdf | 2023-12-11 |
| 42 | 201717046465-PatentCertificate12-12-2023.pdf | 2023-12-12 |
| 42 | 201717046465-STATEMENT OF UNDERTAKING (FORM 3) [23-12-2017(online)].pdf | 2017-12-23 |
| 43 | 201717046465-IntimationOfGrant12-12-2023.pdf | 2023-12-12 |
| 43 | 201717046465-TRANSLATIOIN OF PRIOIRTY DOCUMENTS ETC. [23-12-2017(online)].pdf | 2017-12-23 |
| 1 | NeisseriagonorrhoeaeE_28-09-2020.pdf |