Sign In to Follow Application
View All Documents & Correspondence

Diamine Producing Microorganism And Method For Producing Diamine Using Same

Abstract: The present invention relates to a microorganism for producing diamine, in which activity of a protein having an amino acid sequence of SEQ ID NO: 6 or an amino acid sequence having 42% or higher sequence homology with SEQ ID NO: 6 is introduced or enhanced, and a method of producing diamine using the same.

Get Free WhatsApp Updates!
Notices, Deadlines & Correspondence

Patent Information

Application #
Filing Date
21 November 2016
Publication Number
10/2017
Publication Type
INA
Invention Field
BIOTECHNOLOGY
Status
Email
Parent Application
Patent Number
Legal Status
Grant Date
2023-08-18
Renewal Date

Applicants

CJ CHEILJEDANG CORPORATION
330 Dongho ro Jung gu Seoul 100 400

Inventors

1. LEE Kyoung Min
716 10 20 Yangcheon ro 57 gil Gangseo gu Seoul 157 807
2. PARK Su Jin
506 10 20 Yangcheon ro 57 gil Gangseo gu Seoul 157 807
3. JUNG Hee Kyoung
49 Jeungga ro 10 gil Seodaemun gu Seoul 120 806
4. YANG Young Lyeol
1910 101 99 Seongsin ro Deogyang gu Goyang si Gyeonggi do 412 719
5. LI Hong Xian
B 608 34 Hwagok ro 66 gil Gangseo gu Seoul 157 840
6. UM Hye Won
122 101 36 Gwongwang ro 260beon gil Yeongtong gu Suwon si Gyeonggi do 443 710

Claims

1. A microorganism for producing diamine, wherein activity of a protein having an amino acid sequence of SEQ ID NO: 6 or an amino acid sequence having 42% or higher sequence homology with SEQ ID NO: 6 is introduced or enhanced.

2. The microorganism according to claim 1, wherein the amino acid sequence having 42% or higher sequence homology with SEQ ID NO: 6 is SEQ ID NO: 23 or SEQ ID NO: 26.

3. The microorganism according to claim 1, wherein diamine acetyltransferase activity is further weakened compared to the endogenous activity.

4. The microorganism according to claim 3, wherein the diamine acetyltransferase has an amino acid sequence selected from the group consisting of SEQ ID NOS: 12, 13, and 14.

5. The microorganism according to claim 1, wherein the diamine is putrescine or cadaverine.

6. The microorganism according to claim 1, wherein the microorganism is a microorganism belonging to genus Corynebacterium or genus Escherichia.

7. A method of producing diamine, comprising: WO 2015/163592 PCT/KR2015/003066 48 (i) culturing the microorganism of any one of claims 1 to 6 to obtain a cell culture; and (ii) recovering diamine from the cultured microorganism or the cell culture.

8. The method according to claim 7, wherein the diamine is putrescine or cadaverine.

Specification

The present disclosure relates to a microorganism for
producing diamine and a method of producing diamine using the
same.
Background Art
Biogenic amines (BAs) are nitrogenous compounds which are
mainly produced by decarboxylation of amino acids or by
amination and transamination of aldehydes and ketones. These
biogenic amines are low molecular weight compounds and
synthesized in the metabolism of microorganisms, plants and
animals, and thus biogenic amines are known as components
frequently found in these cells. In particular, biogenic
amines are polyamines such as spermidine, spermine, putrescine
or 1,4-butanediamine, and cadaverine.
In general, putrescine is an important raw material for
production of polyamine nylon-4,6 which is produced by
reacting putrescine with adipic acid. Putrescine is usually
produced by chemical synthesis involving conversion of
propylene to acrylonitrile and to succinonitrile.
As a production method of putrescine using a
microorganism, a method of producing putrescine at a high
WO 2015/163592 PCT/KR2015/003066
3
concentration by transformation of E. coli and Corynebacterium
has been reported (International Patent Publication No.
WO06/005603; International Patent Publication No. WO09/125924;
Qian ZD et al., Biotechnol. Bioeng. 104: 4, 651-662, 2009;
Schneider et al., Appl. Microbiol. Biotechnol. 88: 4, 859-868,
2010; Schneider et al., Appl. Microbiol. Biotechnol. 95, 169-
178., 2012). Furthermore, studies have been actively conducted
on putrescine transporters in E. coli, yeast, plant and animal
cells (K Igarashi, Plant Physiol. Biochem. 48: 506-512, 2010).
Meanwhile, cadaverine is a foul-smelling diamine compound
produced by protein hydrolysis during putrefaction of animal
tissues. Cadaverine has the chemical formula of NH2(CH2)5NH2,
which is similar to that of putrescine.
Cadaverine serves as a component of polymers such as
polyamide or polyurethane, chelating agents, or other
additives. In particular, polyamide having an annual global
market of 3.5 million tons is known to be prepared by
polycondensation of cadaverine or succinic acid, and thus
cadaverine has received much attention as an industrially
useful compound.
Cadaverine is a diamine found in a few microorganisms
(Tabor and Tabor, MicrobiolRev., 49:81-99, 1985). In the gram
negative bacterium E. coli, cadaverine is biosynthesized from
L-lysine by L-lysine decarboxylase. The level of cadaverine in
E. coli is regulated by biosynthesis, degradation, uptake and
WO 2015/163592 PCT/KR2015/003066
4
export of cadaverine (Soksawatmaekhin et al., MolMicrobiol.,
51:1401-1412, 2004).
Disclosure
Technical Problem
The present inventors have made intensive efforts to
investigate a protein having an ability to export diamine such
as putrescine or cadaverine so as to improve diamine
productivity in a microorganism having the diamine
productivity. As a result, they found that a Arcanobacterium
haemolyticum-derived protein or a protein having high amino
acid sequence homology therewith has a diamine export activity,
and this protein is introduced into a microorganism for
producing diamine to enhance its activity, resulting in a
remarkable increase in the ability to export diamine such as
putrescine and cadaverine, thereby completing the present
invention.
Technical Solution
An object of the present invention is to provide a
microorganism for producing diamine.
Another object of the present invention is to provide a
method of producing diamine, including the steps of (i)
culturing the microorganism for producing diamine to obtain a
cell culture; and (ii) recovering diamine from the cultured
microorganism or the cell culture.
WO 2015/163592 PCT/KR2015/003066
5
Best Mode
In an aspect to achieve the above objects, the present
invention provides a microorganism for producing diamine, in
which activity of a protein having an amino acid sequence of
SEQ ID NO: 6 or an amino acid sequence having 42% or higher
sequence homology with SEQ ID NO:6 is introduced or enhanced.
As used herein, the term “diamine” collectively refers to
a compound having two amine groups, and specific examples
thereof may include putrescine and cadaverine. Putrescine is
tetramethylenediamine which may be produced from ornithine as
a precursor. Cadaverine is called 1,5-pentanediamine or
pentamethylenediamine, which may be produced from lysine as a
precursor. Such diamines are industrially applicable compounds
that serve as valuable raw materials for synthesis of polymers
such as polyamine nylon, polyamide or polyurethane.
As used herein, the term “protein having an amino acid
sequence of SEQ ID NO: 6” is a protein found in
Arcanobacterium haemolyticum, and also called ARCH_0271. It
was investigated that this protein retains high homology with
a membrane protein of Corynebacterium, NCgl2522. In an
embodiment of the present invention, ARCH_0271 protein is
identified as a putative protein which is involved in diamine
export in a strain having diamine productivity, thereby
remarkably increasing diamine productivity.
WO 2015/163592 PCT/KR2015/003066
6
Here, ARCH_0271 protein having the amino acid sequence of
SEQ ID NO: 6 may be a protein that is encoded by a nucleotide
sequence of SEQ ID NO: 5 or SEQ ID NO: 7. In the
polynucleotide encoding the ARCH_0271 protein, however,
various modifications may be made in the coding region
provided that they do not change the amino acid sequence of
the polypeptide expressed from the coding region, due to codon
degeneracy or in consideration of the codons preferred by an
organism in which the protein is to be expressed. Thus, the
CE2495 protein may be encoded by various nucleotide sequences
as well as by the nucleotide sequence of SEQ ID NO: 5 or SEQ
ID NO: 7. Of them, the nucleotide sequence represented by SEQ
ID NO. 7 is a sequence prepared by optimizing the ARCH_0271
gene (SEQ ID NO. 5) for codon usage of Corynebacterium
glutamicum, but is not limited thereto.
Further, the ARCH_0271 protein of the present invention
may be any protein having the amino acid sequence of SEQ ID NO:
6, or having 40% or higher, preferably 60% or higher, more
preferably 80% or higher, much more preferably 90% or higher,
even much more preferably 95% or higher, and most preferably
99% or higher homology therewith, as long as the protein
exhibits a substantial diamine export activity. It is apparent
that an amino acid sequence having such homology, of which a
part is deleted, modified, substituted, or added, is also
within the scope of the present invention, as long as the
resulting amino acid sequence has a biological activity
WO 2015/163592 PCT/KR2015/003066
7
substantially equivalent or corresponding to the protein of
SEQ ID NO: 6.
As used herein, the term “protein having an amino acid
sequence having 42% or higher sequence homology with the amino
acid sequence of SEQ ID NO: 6” means any protein without
limitation, as long as the protein has an amino acid sequence
having 42% or higher sequence homology with the amino acid
sequence of SEQ ID NO: 6 and it also has substantially diamine
export activity. For example, the protein may be a protein
having an amino acid sequence of SEQ ID NO: 23 or SEQ ID NO:
26, but is not limited thereto.
For example, the protein having the amino acid sequence
of SEQ ID NO: 23 is a protein found in Alcaligenes faecalis
subsp. faecalis, and also called QWA_00075. It was
investigated that this protein retains 41% homology with a
membrane protein of Corynebacterium, NCgl2522 and 42% homology
with ARCH_0271 of Arcanobacterium haemolyticum. In an
embodiment of the present invention, it was investigated that
the QWA_00075 protein exhibits diamine export activity in a
strain having diamine productivity, thereby remarkably
increasing diamine productivity.
The QWA_00075 protein having the amino acid sequence of
SEQ ID NO: 23 may be a protein that is encoded by a nucleotide
sequence of SEQ ID NO: 22 or 24. In the polynucleotide
encoding this protein, however, various modifications may be
made in the coding region provided that they do not change the
WO 2015/163592 PCT/KR2015/003066
8
amino acid sequence of the polypeptide expressed from the
coding region, due to codon degeneracy or in consideration of
the codons preferred by an organism in which the protein is to
be expressed. Thus, this protein may be encoded by various
nucleotide sequences as well as by the nucleotide sequence of
SEQ ID NO: 22 or 24. Of them, the nucleotide sequence
represented by SEQ ID NO: 24 is a sequence prepared by
optimizing the QWA_00075 gene (SEQ ID NO: 22) for codon usage
of Corynebacterium glutamicum, but is not limited thereto.
Further, the protein having the amino acid sequence of
SEQ ID NO: 26 is a protein found in Stenotrophomonas
maltophilia, and also called SMD_2351. It was investigated
that this protein retains 52% homology with a membrane protein
of Corynebacterium, NCgl2522 and 47% homology with ARCH_0271
of Arcanobacterium haemolyticum. In an embodiment of the
present invention, it was investigated that the SMD_2351
protein exhibits diamine export activity in a strain having
diamine productivity, thereby remarkably increasing diamine
productivity.
The SMD_2351 protein having the amino acid sequence of
SEQ ID NO: 26 may be a protein that is encoded by a nucleotide
sequence of SEQ ID NO: 25 or 27. In the polynucleotide
encoding this protein, however, various modifications may be
made in the coding region provided that they do not change the
amino acid sequence of the polypeptide expressed from the
coding region, due to codon degeneracy or in consideration of
the codons preferred by an organism in which the protein is to
WO 2015/163592 PCT/KR2015/003066
9
be expressed. Thus, this protein may be encoded by various
nucleotide sequences as well as by the nucleotide sequence of
SEQ ID NO: 25 or 27. Of them, the nucleotide sequence
represented by SEQ ID NO: 27 is a sequence prepared by
optimizing the SMD_2351 gene (SEQ ID NO: 25) for codon usage
of Corynebacterium glutamicum, but is not limited thereto.
The term “homology”, as used herein with regard to a
sequence, refers to identity with a given amino acid sequence
or nucleotide sequence, and the homology may be expressed as a
percentage. In the present invention, a homology sequence
having identical or similar activity to the given amino acid
sequence or nucleotide sequence is expressed as “% homology”.
For example, homology may be identified using a standard
software program which calculates parameters of score,
identity and similarity, specifically BLAST 2.0, or by
comparing sequences in a Southern hybridization experiment
under stringent conditions as defined. Defining appropriate
hybridization conditions are within the skill of the art (e.g.,
see Sambrook et al., 1989, infra), and determined by a method
known to those skilled in the art.
As used herein, the term “microorganism for producing
diamine” refers to a microorganism prepared by providing
diamine productivity for a parent strain having no diamine
productivity or a microorganism having endogenous diamine
productivity. Specifically, the microorganism having diamine
productivity may be a microorganism having putrescine or
cadaverine productivity.
WO 2015/163592 PCT/KR2015/003066
10
The “microorganism having putrescine productivity” may be,
but is not limited to, a microorganism in which the activity
of acetylglutamate synthase that converts glutamate to Nacetylglutamate,
ornithine acetyltransferase (ArgJ) that
converts acetyl ornithine to ornithine, acetylglutamate kinase
(ArgB) that converts acetyl glutamate to N-acetylglutamyl
phosphate, acetyl-gamma-glutamyl-phosphate reductase (ArgC)
that converts acetyl glutamyl phosphate to N-acetyl glutamate
semialdehyde, or acetylornithine aminotransferase (ArgD) that
converts acetyl glutamate semialdehyde to N-acetylornithine is
enhanced compared to its endogenous activity, in order to
enhance the biosynthetic pathway from glutamate to ornithine,
and the productivity of ornithine which is used as a precursor
for putrescine biosynthesis is enhanced, but is not limited
thereto.
Further, the microorganism having putrescine productivity
may be a microorganism which is modified to have activity of
ornithine carbamoyl transferase (ArgF) involved in synthesis
of arginine from ornithine, a protein (NCgl1221) involved in
glutamate export, and/or a protein (NCgl469) involved in
putrescine acetylation weaker than its endogenous activity,
and/or is modified to be introduced with activity of ornithine
decarboxylase (ODC).
Here, as non-limiting examples, the acetyl gamma glutamyl
phosphate reductase (ArgC) may have an amino acid sequence of
SEQ ID NO: 15, the acetylglutamate synthase or ornithine
WO 2015/163592 PCT/KR2015/003066
11
acetyltransferase (ArgJ) may have an amino acid sequence of
SEQ ID NO: 16, the acetyl glutamate kinase (ArgB) may have an
amino acid sequence of SEQ ID NO: 17, and the acetylornithine
aminotransferase (ArgD) may have an amino acid sequence of SEQ
ID NO: 18. However, the amino acid sequences of respective
enzyme proteins are not particularly limited thereto, and the
enzymes may be proteins having amino acid sequences having 80%
or higher, preferably 90% or higher, or more preferably 95% or
higher homology therewith, as long as they have activities of
the respective enzymes.
Further, as non-limiting examples, the ornithine
carbamoyl transferase (ArgF) may have an amino acid sequence
represented by SEQ ID NO: 19, the protein involved in
glutamate export may have an amino acid sequence represented
by SEQ ID NO: 20, and ornithine decarboxylase (ODC) may have
an amino acid sequence represented by SEQ ID NO: 21. However,
the amino acid sequences of respective enzyme proteins are not
particularly limited thereto, and the enzymes may include
amino acid sequences having 80% or higher, preferably 90% or
higher, more preferably 95% or higher, or particularly
preferably 97% or higher homology therewith, as long as they
have activities of the respective enzymes.
Meanwhile, the “microorganism having cadaverine
productivity” may be, but is not limited to, a microorganism
prepared by additionally introducing or enhancing activity of
lysine decarboxylase (LDC) in a microorganism having lysine
WO 2015/163592 PCT/KR2015/003066
12
productivity. For example, the microorganism may be one having
enhanced lysine productivity in order to increase cadaverine
production. A method of enhancing lysine productivity may be
performed by a known method which is predictable to those
skilled in the art.
The lysine decarboxylase is an enzyme catalyzing
conversion of lysine to cadaverine, and its activity is
introduced or enhanced, thereby effectively producing
cadaverine.
The lysine decarboxylase may have an amino acid sequence
of SEQ ID NO: 33, but is not particularly limited thereto. The
enzyme may have an amino acid sequence having 80% or higher,
preferably 90% or higher, or more preferably 95% or higher
homology therewith, as long as it has the above activity.
As used herein, the term “production” is a concept
including extracellular release of diamine, for example,
release of diamine into a culture medium, as well as
production of diamine within a microorganism.
Meanwhile, the term “introduction of protein activity”,
as used herein, means that a microorganism having no
endogenous protein is externally provided with an activity of
the protein, and for example, it may be performed by
introduction of a foreign gene. Further, the term “enhancement
of protein activity” means that active state of the protein
retained in or introduced into the microorganism is enhanced,
compared to its intrinsic active state.
WO 2015/163592 PCT/KR2015/003066
13
Non-limiting examples of the introduction or enhancement
of the protein activity may include improvement of the
activity of the protein itself present in a microorganism due
to mutation so as to achieve effects beyond the endogenous
functions, and/or improvement in endogenous gene activity of
the protein present in the microorganism, amplification of the
endogenous gene by internal or external factors, increase in
the gene copy number, increase in the activity by additional
introduction of a foreign gene or replacement or modification
of a promoter, but are not limited thereto.
The increase in the gene copy number may be, but is not
particularly limited to, performed by operably linking the
gene to a vector or by integrating it into the host cell
genome. Specifically, the copy number of the polynucleotide in
the host cell genome may be increased by introducing into the
host cell the vector which is operably linked to the
polynucleotide encoding the protein of the present invention
and replicates and functions independently of the host cell,
or by introducing into the host cell the vector which is
operably linked to the polynucleotide and is able to integrate
the polynucleotide into the host cell genome.
As used herein, “modification of the expression
regulatory sequence for increasing the polynucleotide
expression” may be, but is not particularly limited to, done
by inducing a modification on the expression regulatory
sequence through deletion, insertion, non-conservative or
conservative substitution of nucleotide sequence, or a
WO 2015/163592 PCT/KR2015/003066
14
combination thereof in order to further enhance the activity
of expression regulatory sequence, or by replacing the
expression regulatory sequence with a nucleotide sequence
having stronger activity. The expression regulatory sequence
includes, but is not particularly limited to, a promoter, an
operator sequence, a sequence coding for a ribosome-binding
site, and a sequence regulating the termination of
transcription and translation.
As used herein, the replacement or modification of a
promoter, although not particularly limited thereto, may be
performed by replacement or modification with a stronger
promoter than the original promoter. A strong heterologous
promoter instead of the original promoter may be linked
upstream of the polynucleotide expression unit, and examples
of the strong promoter may include a CJ7 promoter, a lysCP1
promoter, an EF-Tu promoter, a groEL promoter, an aceA or aceB
promoter, and specifically, a Corynebacterium-derived promoter,
lysCP1 promoter or CJ7 promoter is operably linked to the
polynucleotide encoding the enzyme so that its expression rate
may be increased. Here, the lysCP1 promoter is a promoter
improved through nucleotide sequence substitution of the
promoter region of the polynucleotide encoding aspartate
kinase and aspartate semialdehyde dehydrogenase (WO
2009/096689). Further, CJ7 promoter is a strong promoter
derived from Corynebacterium ammoniagenes (Korean Patent No.
0620092 and WO 2006/065095).
WO 2015/163592 PCT/KR2015/003066
15
Furthermore, modification of a polynucleotide sequence on
chromosome, although not particularly limited thereto, may be
performed by inducing a mutation on the expression regulatory
sequence through deletion, insertion, non-conservative or
conservative substitution of polynucleotide sequence, or a
combination thereof in order to further enhance the activity
of the polynucleotide sequence, or by replacing the sequence
with a polynucleotide sequence which is modified to have
stronger activity.
As used herein, the term “vector” refers to a DNA
construct including a nucleotide sequence encoding the desired
protein, which is operably linked to an appropriate expression
regulatory sequence to express the desired protein in a
suitable host cell. The regulatory sequence may include a
promoter that can initiate transcription, an optional operator
sequence for regulating the transcription, a sequence encoding
a suitable mRNA ribosome binding site, and a sequence
regulating the termination of transcription and translation.
After the vector is introduced into the suitable host cell, it
may replicate or function independently of the host genome,
and may be integrated into the genome itself.
The vector used in the present invention is not
particularly limited, as long as it is able to replicate in
the host cell, and any vector known in the art may be used.
Examples of conventional vectors may include a natural or
recombinant plasmid, cosmid, virus and bacteriophage. For
instance, pWE15, M13, λMBL3, λMBL4, λIXII, λASHII, λAPII, λt10,
WO 2015/163592 PCT/KR2015/003066
16
λt11, Charon4A, and Charon21A may be used as a phage vector or
cosmid vector. pBR type, pUC type, pBluescriptII type, pGEM
type, pTZ type, pCL type and pET type may be used as a plasmid
vector. A vector usable in the present invention is not
particularly limited, and any known expression vector may be
used. Preferably, pDZ, pACYC177, pACYC184, pCL, pECCG117,
pUC19, pBR322, pMW118, or pCC1BAC vector may be used.
Further, the polynucleotide encoding the desired
endogenous protein in the chromosome can be replaced by a
mutated polynucleotide using a vector for bacterial
chromosomal insertion. The insertion of the polynucleotide
into the chromosome may be performed by any method known in
the art, for example, homologous recombination. Since the
vector of the present invention may be inserted into the
chromosome by homologous recombination, it may further include
a selection marker to confirm chromosomal insertion. The
selection marker is to select cells that are transformed with
the vector, that is, to confirm insertion of the desired
polynucleotide, and the selection marker may include markers
providing selectable phenotypes, such as drug resistance,
auxotrophy, resistance to cytotoxic agents, or surface protein
expression. Only cells expressing the selection marker are
able to survive or to show different phenotypes under the
environment treated with the selective agent, and thus the
transformed cells may be selected.
WO 2015/163592 PCT/KR2015/003066
17
As used herein, the term “transformation” means the
introduction of a vector including a polynucleotide encoding a
target protein into a host cell in such a way that the protein
encoded by the polynucleotide is expressed in the host cell.
As long as the transformed polynucleotide can be expressed in
the host cell, it can be either integrated into and placed in
the chromosome of the host cell, or exist extrachromosomally.
Further, the polynucleotide includes DNA and RNA encoding the
target protein. The polynucleotide may be introduced in any
form, as long as it can be introduced into the host cell and
expressed therein. For example, the polynucleotide may be
introduced into the host cell in the form of an expression
cassette, which is a gene construct including all elements
required for its autonomous expression. Typically, the
expression cassette includes a promoter operably linked to the
polynucleotide, transcriptional termination signals, ribosome
binding sites, or translation termination signals. The
expression cassette may be in the form of a self-replicable
expression vector. Also, the polynucleotide as it is may be
introduced into the host cell and operably linked to sequences
required for expression in the host cell.
Further, as used herein, the term “operably linked” means
a functional linkage between a polynucleotide sequence
encoding the desired protein of the present invention and a
promoter sequence which initiates and mediates transcription
of the polynucleotide sequence.
WO 2015/163592 PCT/KR2015/003066
18
Further, the microorganism having diamine productivity
may be a microorganism, in which the diamine acetyltransferase
activity is weakened compared to the endogenous activity, in
order to increase diamine production.
As used herein, the term “diamine acetyltransferase” is
an enzyme catalyzing transfer of an acetyl group from acetyl-
CoA to diamine, and it may be exemplified by Corynebacterium
glutamicum NCgl1469 or E. coli SpeG, but its name may differ
depending on the species of a microorganism having diamine
productivity. NCgl1469 may have an amino acid sequence of SEQ
ID NO: 12 or 13, and SpeG may have an amino acid sequence of
SEQ ID NO: 14, but the sequence may differ depending on the
species of the microorganism. The protein may have an amino
acid sequence having 80% or higher, preferably 90% or higher,
or more preferably 95% or higher, or particularly preferably
97% or higher homology therewith, as long as it has the
diamine acetyltransferase activity.
Since the diamine acetyltransferase converts diamine to
acetyl-diamine (e.g., N-Ac-putrescine or N-Ac-cadaverine),
diamine productivity may be increased by weakening its
activity, compared to the endogenous activity.
As used herein, the term “endogenous activity” refers to
activity of the protein that the original microorganism
possesses in its native or undenatured state, and “modified to
have weakened activity, compared to the endogenous activity”
WO 2015/163592 PCT/KR2015/003066
19
means that activity of the protein is further weakened
compared to the activity of the corresponding protein that the
original microorganism possesses in the native or undenatured
state.
The weakening of the protein activity means that the
protein activity is reduced, compared to a non-modified strain,
or the activity is eliminated. It is possible to apply a
method well known in the art to the weakening of the protein
activity.
Examples of the method may include a method of replacing
the gene encoding the protein on the chromosome by a gene that
is mutated to reduce the enzyme activity or to eliminate the
protein activity, a method of introducing a mutation into the
expression regulatory sequence of the gene encoding the
protein on the chromosome, a method of replacing the
expression regulatory sequence of the gene encoding the
protein by a sequence having weaker activity, a method of
deleting a part or an entire of the gene encoding the protein
on the chromosome, a method of introducing antisense
oligonucleotide that complementarily binds to a transcript of
the gene on the chromosome to inhibit translation of mRNA to
the protein, a method of artificially adding a sequence
complementary to SD sequence at upstream of SD sequence of the
gene encoding the protein to form a secondary structure,
thereby preventing access of the ribosomal subunits, and a
reverse transcription engineering (RTE) method of adding a
WO 2015/163592 PCT/KR2015/003066
20
promoter for reverse transcription at 3’-terminus of open
reading frame (ORF) of the corresponding sequence, and
combinations thereof, but are not particularly limited thereto.
In detail, a partial or full deletion of the gene
encoding the protein may be done by introducing a vector for
chromosomal insertion into a microorganism, thereby
substituting the polynucleotide encoding an endogenous target
protein on chromosome with a polynucleotide having a partial
deletion or a marker gene. The “partial” may vary depending on
the type of polynucleotide, but specifically refers to 1 to
300, preferably 1 to 100, and more preferably 1 to 50
nucleotides.
Meanwhile, the microorganism of the present invention is
a microorganism having diamine productivity, and includes a
prokaryotic microorganism expressing the protein having the
amino acid sequence of SEQ ID NO: 6, and examples thereof may
include microorganisms belonging to Escherichia sp., Shigella
sp., Citrobacter sp., Salmonella sp., Enterobacter sp.,
Yersinia sp., Klebsiella sp., Erwinia sp., Corynebacterium sp.,
Brevibacterium sp., Lactobacillus sp., Selenomanas sp., Vibrio
sp., Pseudomonas sp., Streptomyces sp., Arcanobacterium sp.,
Alcaligenes sp. or the like, but are not limited thereto. The
microorganism of the present invention is specifically a
microorganism belonging to Corynebacterium sp. or Escherichia
sp., and more specifically, Corynebacterium glutamicum or
Escherichia coli, but is not limited thereto.
WO 2015/163592 PCT/KR2015/003066
21
A specific example may be a microorganism prepared by
deleting NCgl2522, which is a protein having putrescine export
activity, from a Corynebacterium glutamicum ATCC13032-based
putrescine-producing strain KCCM11240P (Korean Patent
Publication No. 2013-0082478) and then introducing ARCH_0271
into the transposon gene. Therefore, this microorganism
KCCM11240P ΔNCgl2522 Tn:P(cj7)-ARCH_0271 is designated as
CC01-0758, and deposited under the Budapest Treaty to the
Korean Culture Center of Microorganisms (KCCM) on November 15,
2013, with Accession No. KCCM11476P.
In another aspect, the present invention provides a
method of producing diamine, comprising: (i) culturing the
microorganism having putrescine diamine, in which activity of
the protein having the amino acid sequence of SEQ ID NO: 6 or
42% or higher sequence homology therewith is introduced or
enhanced, so as to obtain a cell culture; and (ii) recovering
diamine from the cultured microorganism or the cell culture.
The diamine, the protein having the amino acid sequence
of SEQ ID NO: 6 or the protein having the amino acid sequence
having 42% or higher sequence homology therewith, the
introduction of the protein activity, the enhancement of the
protein activity, the diamine, and the microorganism having
diamine productivity are the same as described above.
WO 2015/163592 PCT/KR2015/003066
22
In the method, the step of culturing the microorganism
may be, although not particularly limited to, preferably
performed by batch culture, continuous culture, and fed-batch
culture known in the art. In this regard, the culture
conditions are not particularly limited, but an optimal pH
(e.g., pH 5 to 9, preferably pH 6 to 8, and most preferably pH
6.8) may be maintained by using a basic chemical (e.g., sodium
hydroxide, potassium hydroxide or ammonia) or acidic chemical
(e.g., phosphoric acid or sulfuric acid). Also, an aerobic
condition may be maintained by adding oxygen or oxygencontaining
gas mixture to a cell culture. The culture
temperature may be maintained at 20 to 45°C, and preferably at
25 to 40°C, and the cultivation may be performed for about 10
to 160 hours.
Furthermore, a medium to be used for culture may include
sugar and carbohydrate (e.g., glucose, sucrose, lactose,
fructose, maltose, molasse, starch and cellulose), oil and fat
(e.g., soybean oil, sunflower seed oil, peanut oil and coconut
oil), fatty acid (e.g., palmitic acid, stearic acid and
linoleic acid), alcohol (e.g., glycerol and ethanol), and
organic acid (e.g., acetic acid) individually or in
combination as a carbon source; nitrogen-containing organic
compound (e.g., peptone, yeast extract, meat juice, malt
extract, corn solution, soybean meal powder and urea), or
inorganic compound (e.g., ammonium sulfate, ammonium chloride,
ammonium phosphate, ammonium carbonate, and ammonium nitrate)
individually or in combination as a nitrogen source; potassium
WO 2015/163592 PCT/KR2015/003066
23
dihydrogen phosphate, dipotassium phosphate, or sodiumcontaining
salt corresponding thereto individually or in
combination as a phosphorus source; other essential growthstimulating
substances including metal salts (e.g., magnesium
sulfate or iron sulfate), amino acids, and vitamins. In the
present invention, the medium may be used as a synonym for the
culture liquid.
As used herein, the term “cell culture” is a material
obtained by culturing a microorganism, and includes the medium,
the microorganism cultured, and substances released from the
microorganism cultured. For example, a nutrient supply source
required for cell culture, such as minerals, amino acids,
vitamins, nucleic acids and/or other components generally
contained in culture medium (or culture liquid) in addition to
the carbon source, and the nitrogen source may be included.
Further, a desired substance or an enzyme produced/secreted by
the cells may be included.
Since diamine produced by culture may be secreted into
the medium or remain in the cells, the cell culture may
include diamine that is produced by culturing the
microorganism.
The method of recovering putrescine produced in the
culturing step of the present invention may be carried out,
for example, using a suitable method known in the art
according to a culturing method, for example, batch culture,
WO 2015/163592 PCT/KR2015/003066
24
continuous culture, or fed-batch culture, thereby collecting
the desired amino acids from the culture liquid.
Advantageous Effects
In the present invention, it is demonstrated that
Arcanobacterium haemolyticum-derived ARCH_0271 protein is a
protein having diamine export activity, and putrescine export
activity can be enhanced by introducing this protein activity
into Corynebacterium sp. microorganism which has a putrescine
synthetic pathway, but low putrescine export activity. It is
also demonstrated that the production of putrescine and
cadaverine can be increased at the same time by introducing
this protein activity into E.coli which has synthetic pathways
of putrescine and cadaverine. Accordingly, diamine can be
effectively produced by applying Arcanobacterium haemolyticumderived
ARCH_0271 protein to a microorganism having diamine
productivity.
Mode for Invention
Hereinafter, the present invention will be described in
more detail with reference to Examples. However, these
Examples are for illustrative purposes only, and the invention
is not intended to be limited by these Examples.
Reference Example 1. Preparation of Corynebacterium sp.
microorganism having putrescine productivity
WO 2015/163592 PCT/KR2015/003066
25
It was confirmed that putrescine production was reduced
when NCgl2522, a permease belonging to major facilitator
superfamily (MFS), was deleted in a Corynebacterium glutamicum
ATCC13032-based putrescine-producing strain KCCM11240P (Korean
Patent Publication NO. 2013-0082478) and a Corynebacterium
glutamicum ATCC13869-based putrescine-producing strain DAB12-a
ΔNCgl1469 (argF deletion, NCgl1221 deletion, E. coli speC
introduction, arg operon promoter substitution, NCgl1469
deletion; designated as DAB12-b, Korean Patent Publication NO.
2013-0082478) as Corynebacterium sp. microorganisms having
putrescine productivity.
It was also confirmed that putrescine was produced in a
high yield in Corynebacterium glutamicum strains prepared by
additional introduction of NCgl2522 gene into the transposon
in KCCM11240P or DAB12-b, or by substitution of NCgl2522
promoter on the chromosome with cj7 promoter to enhance
NCgl2522 activity. Further, the intracellular amount of
putrescine was measured in the strain in which NCgl2522
expression was enhanced, and as a result, a smaller amount of
putrescine was observed, compared to that of a control group.
It is indicating that NCgl2522 has an ability to export
putrescine.
In detail, based on the nucleotide sequence of the gene
encoding NCgl2522 of Corynebacterium glutamicum ATCC13032, a
pair of primers of SEQ ID NOS: 1 and 2 for obtaining a
homologous recombination fragment of the N-terminal region of
WO 2015/163592 PCT/KR2015/003066
26
NCgl2522 and a pair of primers of SEQ ID NOS: 3 and 4 for
obtaining a homologous recombination fragment of the Cterminal
region of NCgl2522 were used as in the following
Table 1.
[Table 1]
Primer Sequence (5’->3’)
NCgl2522-del-F1_BamHI
(SEQ ID NO: 1)
CGGGATCCCACGCCTGTCTGGTCGC
NCgl2522-del-R1_SalI
(SEQ ID NO: 2)
ACGCGTCGACGGATCGTAACTGTAACGAATGG
NCgl2522-del-F2_SalI
(SEQ ID NO: 3)
ACGCGTCGACCGCGTGCATCTTTGGACAC
NCgl2522-del-R2_XbaI
(SEQ ID NO: 4)
CTAGTCTAGAGAGCTGCACCAGGTAGACG
PCR was performed using the genomic DNA of
Corynebacterium glutamicum ATCC13032 as a template and two
pairs of primers so as to amplify PCR fragments of the Nterminal
and C-terminal regions, respectively. These PCR
fragments were electrophoresed to obtain the desired fragments.
At this time, PCR reaction was carried out for 30 cycles of
denaturation for 30 seconds at 95°C, annealing for 30 seconds
at 55°C, and extension for 30 seconds at 72°C. The fragment of
the N-terminal region thus obtained was treated with
restriction enzymes, BamHI and SalI, and the fragment of the
C-terminal region thus obtained was treated with restriction
enzymes, SalI and XbaI. The fragments thus treated were cloned
into the pDZ vector treated with restriction enzymes, BamHI
and XbaI, so as to construct a plasmid pDZ-1’NCgl2522(K/O).
WO 2015/163592 PCT/KR2015/003066
27
The plasmid pDZ-1’NCgl2522(K/O) was introduced into
Corynebacterium glutamicum KCCM11240P by electroporation, so
as to obtain a transformant. Then, the transformant was plated
and cultured on BHIS plate (37 g/l of Braine heart infusion,
91 g/l of sorbitol, and 2% agar) containing kanamycin (25
μg/ml) and X-gal (5-bromo-4-chloro-3-indolin-D-galactoside)
for colony formation. From the colonies thus formed, bluecolored
colonies were selected as the strain introduced with
the plasmid pDZ-1’NCgl2522(K/O).
The selected strains were cultured with shaking in CM
medium (10 g/l of glucose, 10 g/l of polypeptone, 5 g/l of
yeast extract, 5 g/l of beef extract, 2.5 g/l of NaCl, and 2
g/l of urea, pH 6.8) at 30°C for 8 hours. Subsequently, each
cell culture was serially diluted from 10-4 to 10-10. Then, the
diluted samples were plated and cultured on an X-galcontaining
solid medium for colony formation. From the
colonies thus formed, the white colonies which appeared at
relatively low frequency were selected to finally obtain a
Corynebacterium glutamicum strain in which the gene encoding
NCgl2522 was deleted and putrescine productivity was weakened.
The Corynebacterium glutamicum strain in which putrescine
export activity was weakened was designated as KCCM11240P
△NCgl2522.
In the same manner, PCR was performed using the genomic
DNA of Corynebacterium glutamicum ATCC13869 as a template and
two pairs of primers given in Table 1 so as to construct a
WO 2015/163592 PCT/KR2015/003066
28
plasmid pDZ-2’NCgl2522(K/O) by the above described method. A
Corynebacterium glutamicum strain, in which the gene encoding
NCgl2522 of DAB12-b strain was deleted using the vector
according to the above described method to weaken putrescine
productivity, was constructed. This Corynebacterium glutamicum
strain having weakened putrescine export activity was
designated as DAB12-b ΔNCgl2522.
Example 1. Selection of Arcanobacterium haemolyticum
ARCH_0271
As confirmed in Reference Example 1, the NCgl2522
membrane protein was found to function to export putrescine.
Therefore, based on the amino acid sequence of NCgl2522, the
present inventors examine genes having homology therewith
other than genes of Corynebacterium sp. using BlastP program
of National Center for Biotechnology Information (NCBI,
www.ncbi.nlm.nih.gov), and as a result, they acquired a
nucleotide sequence (SEQ ID NO: 5) and an amino acid sequence
(SEQ ID NO: 6) of ARCH_0271 of Arcanobacterium haemolyticum
DSM 20595, which has 56% homology therewith. Among the
membrane proteins having a homology with the amino acid
sequence of NCgl2522, which are found in other species than
Corynebacterium sp., the amino acid sequence of ARCH_0271 is
phylogenetically closest to the amino acid sequence of
NCgl2522.
In the same manner, the nucleotide sequence (SEQ ID NO:
22) and amino acid sequence (SEQ ID NO: 23) of QWA_00075
derived from Alcaligenes faecalis subsp. faecalis NCIB 8687,
WO 2015/163592 PCT/KR2015/003066
29
which shows 41% homology with the amino acid sequence of
NCgl2522, and the nucleotide sequence (SEQ ID NO: 25) and
amino acid sequence (SEQ ID NO: 26) of SMD_2351 derived from
Stenotrophomonas maltophilia D457, which shows 52% homology
with the amino acid sequence of NCgl2522, were obtained. The
amino acid sequence of QWA_00075 and the amino acid sequence
of SMD_2351 show 42% and 47% homology with the amino acid
sequence of ARCH_0271, respectively, as shown in the following
Table 2.
[Table 2]
Comparison of amino acid sequence homology
ARCH_0271 QWA_00075 SMD_2351
NCgl2522 56% 41% 52%
ARCH_0271
42% 47%
Meanwhile, microorganisms having genes showing homology
with NCgl2522, and homology thereof are given in the following
Table 3.
[Table 3]
Species Homology
Acidovorax citrulli AAC00-1 47%
Actinomyces sp. oral taxon 181 53%
Actinomyces sp. ph3 54%
Actinomyces sp. S6-Spd3 53%
Actinosynnema mirum 53%
WO 2015/163592 PCT/KR2015/003066
30
Actinosynnema mirum DSM 43827 53%
Alcaligenes faecalis subsp. faecalis
NCIB 8687
41%
alpha proteobacterium LLX12A 52%
Arcanobacterium haemolyticum 56%
Arcanobacterium haemolyticum DSM 20595 56%
Arsenophonus nasoniae 44%
Brachybacterium paraconglomeratum 52%
Brachybacterium paraconglomeratum LC44 52%
Bradyrhizobium sp. BTAi1 43%
Citricoccus sp. CH26A 50%
Citrobacter freundii 4_7_47CFAA 53%
Dermabacter hominis 1368 50%
Dermabacter sp. HFH0086 51%
Dietzia sp. UCD-THP 52%
Enterobacteriaceae bacterium 9_2_54FAA 41%
Erwinia amylovora ATCC 49946 47%
Granulicoccus phenolivorans 55%
Hafnia alvei ATCC 51873 41%
Klebsiella pneumoniae 53%
Micrococcus luteus 52%
Micromonospora sp. ATCC 39149 53%
Mycobacterium chubuense 39%
Mycobacterium gilvum 38%
Mycobacterium neoaurum 39%
Mycobacterium rufum 39%
Nesterenkonia alba 48%
WO 2015/163592 PCT/KR2015/003066
31
Nesterenkonia sp. F 51%
Nocardia rhamnosiphila 40%
Nocardiopsis dassonvillei 58%
Nocardiopsis dassonvillei subsp.
dassonvillei DSM 43111
57%
Nocardiopsis kunsanensis 52%
Nocardiopsis sp. CNS639 57%
Nocardiopsis synnemataformans 57%
Ochrobactrum anthropi ATCC 49188 46%
Pectobacterium atrosepticum SCRI1043 46%
Providencia alcalifaciens DSM 30120 40%
Pseudomonas aeruginosa 53%
Pseudomonas aeruginosa C3719 46%
Pseudomonas geniculata 53%
Rahnella aquatilis HX2 40%
Rhodococcus 40%
Rhodococcus fascians 55%
Rhodococcus sp. AW25M09 42%
Rhodococcus sp. JVH1 40%
Rhodococcus triatomae 37%
Rhodococcus wratislaviensis NBRC 100605 40%
Salinispora 52%
Salinispora arenicola 52%
Salinispora pacifica 53%
Salinispora tropica CNB-440 51%
Sanguibacter keddieii DSM 10542 52%
Serratia marcescens 44%
WO 2015/163592 PCT/KR2015/003066
32
Sphingobium chinhatense 53%
Stenotrophomonas maltophilia 54%
Stenotrophomonas maltophilia D457 52%
Stenotrophomonas sp. RIT309 52%
Stenotrophomonas sp. SKA14 53%
Streptococcus anginosus 52%
Streptococcus anginosus CCUG 39159 51%
Streptomyces 52%
Streptomyces albidoflavus 54%
Streptomyces alboviridis 52%
Streptomyces albus 55%
Streptomyces albus J1074] 57%
Streptomyces atroolivaceus 53%
Streptomyces baarnensis 51%
Streptomyces californicus 52%
Streptomyces cyaneofuscatus 53%
Streptomyces floridae 52%
Streptomyces fulvissimus 51%
Streptomyces globisporus 52%
Streptomyces griseus 57%
Streptomyces mediolani 55%
Streptomyces sp. AA0539 48%
Streptomyces sp. CcalMP-8W 52%
Streptomyces sp. CNB091 55%
Streptomyces sp. NRRL B-1381 52%
Streptomyces sp. NRRL B-3253 57%
Streptomyces sp. NRRL F-2890 49%
WO 2015/163592 PCT/KR2015/003066
33
Streptomyces sp. NRRL F-5527 52%
Streptomyces sp. NRRL F-5702 52%
Streptomyces sp. NRRL S-623 52%
Streptomyces sp. PVA 94-07 57%
Streptomyces sp. S4 54%
Streptomyces sp. ScaeMP-e10 51%
Streptomyces sp. SM8 54%
Streptomyces sp. W007 54%
Streptomyces wadayamensis 54%
Tsukamurella paurometabola 38%
Turicella otitidis 56%
Turicella otitidis ATCC 51513 56%
Xenorhabdus nematophila ATCC 19061 42%
Yaniella halotolerans 61%
Yersinia enterocolitica 41%
Example 2. Fermentation of Putrescine by Introduction of
Protein having putrescine export activity into Putrescineproducing
strain derived from Corynebacterium sp.
<2-1> Introduction of ARCH_0271, QWA_00075, or SMD_2351
into transposon gene in chromosome of ATCC13032-based
putrescine-producing strain
In order to examine whether chromosomal insertion of
ARCH_0271, QWA_00075 or SMD_2351 gene affects putrescine
export in KCCM11240P ΔNCgl2522 having reduced putrescine
export activity which was prepared in Reference Example 1,
WO 2015/163592 PCT/KR2015/003066
34
ARCH_0271, QWA_00075, or SMD_2351 was introduced into a
transposon gene by the following method.
As a vector for transformation, which allows a gene
insertion into the chromosome using a transposon gene of
Corynebacterium sp. microorganism, pDZTn (WO 2009/125992) was
used, and cj7 (WO 2006/65095) was used as a promoter.
Based on the nucleotide sequence of Arcanobacterium
haemolyticum DSM 20595, ARCH_0271 gene was synthesized by
optimizing the nucleotide sequence (SEQ ID NO: 7) for codon
usage of Corynebacterium glutamicum. In the same manner,
QWA_00075 derived from Alcaligenes faecalis subsp. faecalis
NCIB 8687 and SMD_2351 derived from Stenotrophomonas
maltophilia D457 were also synthesized by optimizing the
nucleotide sequences (SEQ ID NO: 24, and SEQ ID NO: 27) for
codon usage of Corynebacterium glutamicum, respectively. The
genes synthesized were obtained as genes cloned into pGEM B1.
The plasmids thus obtained were designated as pGEM B1-
ARCH_0271, pGEM B1-QWA_00075, and pGEM B1-SMD_2351,
respectively.
A gene fragment of about 1.51 kb, 1.53 kb, or 1.53 kb was
amplified using pGEM B1-ARCH_0271, pGEM B1-QWA_00075, or pGEM
B1-SMD_2351 plasmid as a template and a pair of primers of SEQ
ID NOs. 10 and 11, SEQ ID NOs. 28 and 29, or SEQ ID NOs. 30
and 31 (See Table 4), respectively. At this time, PCR reaction
WO 2015/163592 PCT/KR2015/003066
35
was carried out for 30 cycles of denaturation for 30 seconds
at 95°C, annealing for 30 seconds at 55°C, and extension for 1
minute and 30 seconds at 72°C. Next, these PCR products were
electrophoresed on a 0.8% agarose gel to elute and purify each
band of the desired size.
Further, the cj7 promoter region was obtained by carrying
out PCR for 30 cycles of denaturation for 30 seconds at 95°C,
annealing for 30 seconds at 55°C, and extension for 30 seconds
at 72°C using p117-Pcj7-gfp as a template and a pair of
primers of SEQ ID NOs. 8 and 9 (See Table 4). A fragment of
the cj7 promoter gene was electrophoresed on a 0.8% agarose
gel to elute and purify a band of the desired size.
[Table 4]
Primer Sequence (5’->3’)
CJ7-F
(SEQ ID NO: 8)
TGTCGGGCCCACTAGT AGAAACATCCCAGCGCTACTAATA
CJ7-R
(SEQ ID NO: 9)
AGTGTTTCCTTTCGTTGGGTACG
ARCH_0271-F
(SEQ ID NO: 10)
CAACGAAAGGAAACACT ATGCCAGACGTGTCCTCC
ARCH_0271-R
(SEQ ID NO: 11)
GAATGAGTTCCTCGAG TTATTCGTGTGCATATGC
QWA_00075-F
(SEQ ID NO: 28)
CAACGAAAGGAAACACT ATGTTGCACTCCCCCACCC
QWA_00075-R
(SEQ ID NO: 29)
GAATGAGTTCCTCGAG TTAATCAGCATGGGAGCGGCC
SMD_2351-F
(SEQ ID NO: 30)
CAACGAAAGGAAACACT ATGCCAGCAGCGCATTCAAATAG
SMD_2351-R
(SEQ ID NO: 31)
GAATGAGTTCCTCGAG TTAGTGCTGAGTTGGATAGGCAG
pDZTn vector was digested with XhoI, and fusion cloning
of each PCR product obtained above was performed. In-Fusion◎HD
WO 2015/163592 PCT/KR2015/003066
36
Cloning Kit (Clontech) was used in the fusion cloning. The
resulting plasmids were designated as pDZTn-P(cj7)-ARCH_0271,
pDZTn-P(cj7)-QWA_00075, and pDZTn-P(cj7)-SMD_2351,
respectively.
Each of the three plasmids pDZTn-P(cj7)-ARCH_0271, pDZTn-
P(cj7)-QWA_00075, and pDZTn-P(cj7)-SMD_2351 was introduced
into Corynebacterium glutamicum KCCM11240P △NCgl2522 having
reduced putrescine export activity described in Reference
Example 1 by electroporation to obtain transformants. The
transformants were cultured with shaking in CM medium (10 g/l
of glucose, 10 g/l of polypeptone, 5 g/l of yeast extract, 5
g/l of beef extract, 2.5 g/l of NaCl, and 2 g/l of urea, pH
6.8) (30°C for 8 hours). Subsequently, each cell culture was
serially diluted from 10-4 to 10-10. Then, the diluted samples
were plated and cultured on an X-gal-containing solid medium
for colony formation.
From the colonies formed, the white colonies which
appeared at relatively low frequency were selected to finally
obtain strains in which the gene encoding ARCH_0271, QWA_00075
or SMD_2351 was introduced by secondary crossover. The strains
finally selected were subjected to PCR using a pair of primers
of SEQ ID NOs. 8 and 11, SEQ ID NOs. 8 and 29, or SEQ ID NOs.
8 and 31 to confirm introduction of the gene encoding
ARCH_0271, QWA_00075 or SMD_2351. These Corynebacterium
glutamicum mutant strain were designated as KCCM11240P
WO 2015/163592 PCT/KR2015/003066
37
△NCgl2522 Tn:P(cj7)-ARCH_0271, KCCM11240P △NCgl2522
Tn:P(cj7)-QWA_00075, and KCCM11240P △NCgl2522 Tn:P(cj7)-
SMD_2351, respectively.
<2-2> Introduction of ARCH_0271, QWA_00075, or SMD_2351
into transposon gene in chromosome of ATCC13869-based
putrescine-producing strain
In order to examine whether the chromosomal insertion of
ARCH_0271 gene affects putrescine export in DAB12-b ΔNCgl2522
having reduced putrescine export activity which was prepared
in Reference Example 1, pDZTn-P(cj7)-ARCH_0271, pDZTn-P(cj7)-
QWA_00075, or pDZTn-P(cj7)- SMD_2351 prepared above was
introduced into Corynebacterium glutamicum DAB12-b ΔNCgl2522
and strains are confirmed introduction of ARCH_0271, QWA_00075
or SMD_2351 into the transposon gene in the same manner as in
Example <2-1>.
Corynebacterium glutamicum mutant strains thus selected
were designated as DAB12-b ΔNCgl2522 Tn:P(cj7)-ARCH_0271,
DAB12-b ΔNCgl2522 Tn:P(cj7)- QWA_00075, and DAB12-b ΔNCgl2522
Tn:P(cj7)-SMD_2351, respectively.
<2-3> Evaluation of putrescine productivity of
Corynebacterium sp.-derived putrescine-producing strain
introduced with ARCH_0271, QWA_00075 or SMD_2351
In order to confirm the effect of ARCH_0271 introduction
on putrescine productivity in the putrescine-producing strain,
putrescine productivities of the Corynebacterium glutamicum
WO 2015/163592 PCT/KR2015/003066
38
mutant strains prepared in Examples <2-1> and <2-2> were
compared.
In detail, 10 types of Corynebacterium glutamicum mutants
(KCCM11240P; KCCM11240P △NCgl2522; KCCM11240P △NCgl2522
Tn:P(cj7)-ARCH_0271; KCCM11240P △NCgl2522 Tn:P(cj7)-QWA_00075;
KCCM11240P △NCgl2522 Tn:P(cj7)-SMD_2351; DAB12-b; DAB12-b
△NCgl2522; DAB12-b △NCgl2522 Tn:P(cj7)-ARCH_0271; DAB12-b
ΔNCgl2522 Tn:P(cj7)- QWA_00075, and DAB12-b ΔNCgl2522
Tn:P(cj7)-SMD_2351) were plated on 1 mM arginine-containing CM
plate media (1% glucose, 1% polypeptone, 0.5% yeast extract,
0.5% beef extract, 0.25% NaCl, 0.2% urea, 100 μl of 50% NaOH,
and 2% agar, pH 6.8, based on 1 L), and cultured at 30°C for
24 hours, respectively. 1 platinum loop of each strain thus
cultured was inoculated in 25 ml of titer medium (8% Glucose,
0.25% soybean protein, 0.50% corn steep solids, 4% (NH4)2SO4,
0.1% KH2PO4, 0.05% MgSO4 ㆍ 7H2O, 0.15% urea, 100 μg of biotin, 3
mg of thiamine hydrochloride, 3 mg of calcium-pantothenic acid,
3 mg of nicotinamide, and 5% CaCO3, pH 7.0, based on 1 L), and
then cultured with shaking at 30°C and 200 rpm for 98 hours. 1
mM arginine was added to all media for culturing the strains.
The putrescine concentration in each cell culture was measured,
and the results are shown in the following Table 5.
[Table 5]
Strain
Putrescine
(g/L)
KCCM 11240P 12.4
KCCM 11240P △NCgl2522 1.9
WO 2015/163592 PCT/KR2015/003066
39
KCCM 11240P △NCgl2522 Tn:P(cj7)- ARCH_0271 17.7
KCCM 11240P ΔNCgl2522 Tn:P(cj7)- QWA_00075 4.1
KCCM 11240P ΔNCgl2522 Tn:P(cj7)- SMD_2351 3.5
DAB12-b 13.1
DAB12-b △NCgl2522 0.5
DAB12-b △NCgl2522 Tn:P(cj7)- ARCH_0271 17.5
DAB12-b ΔNCgl2522 Tn:P(cj7)- QWA_00075 5
DAB12-b ΔNCgl2522 Tn:P(cj7)- SMD_2351 4.1
As shown in Table 5, putrescine production was found to
be increased in both 2 types of the ARCH_0271-introduced
Corynebacterium glutamicum mutant strains. Further, putrescine
production was found to be increased in the QWA_00075 or
SMD_2351-introduced strain, compared to the parent strain,
KCCM 11240P △NCgl2522 or DAB12-b △NCgl2522. It is indicating
that QWA_00075 or SMD_2351 has putrescine export activity.
Example 3. Fermentation of cadaverine by ARCH_0271
introduction and lysine decarboxylase expression in
Corynebacterium sp.-derived lysine-producing strain
<3-1> Introduction of ARCH_0271 into transposon gene in
chromosome of L-lysine-producing Corynebacterium glutamicum
KCCM11016P
In order to confirm cadaverine export activity of
ARCH_0271 protein, ARCH_0271 gene was introduced into the
chromosome of a lysine-producing strain KCCM11016P (this
microorganism was deposited at the Korean Culture Center of
Microorganisms on December 18, 1995 with Accession No.
KFCC10881, and then deposited at the International Depository
WO 2015/163592 PCT/KR2015/003066
40
Authority under Budapest Treaty with Accession No. KCCM11016P,
Korean Patent No. 10-0159812). pDZTn-P(cj7)-ARCH_0271 prepared
above was introduced into Corynebacterium glutamicum
KCCM11016P and strain is confirmed introduction of ARCH_0271
into transposon in the same manner as in Example <2-1>.
A Corynebacterium glutamicum mutant strain thus selected
was designated as KCCM11016P Tn:P(cj7)-ARCH_0271.
<3-2> Introduction of E.coli–derived lysine decarboxylase
gene into L-lysine-producing strain introduced ARCH_0271
The L-lysine-producing strain introduced ARCH_0271,
KCCM11016P Tn:P(cj7)-ARCH_0271 which was prepared in Example
<3-1> was introduced with E.coli-derived lysine decarboxylase
gene in a plasmid form for cadaverine production. The
nucleotide sequence (SEQ ID NO: 32) and amino acid sequence
(SEQ ID NO: 33) of lysine decarboxylase ldcC from E. coli were
obtained from NCBI data base.
An ldcC gene fragment of about 2.1 kb was obtained by
carrying out PCR for 30 cycles of denaturation for 30 seconds
at 95°C, annealing for 30 seconds at 52°C, and extension for 2
minutes at 72°C using the chromosome of E.coli W3110 strain as
a template and a pair of primers of SEQ ID NOS: 36 and 37 (See
Table 6). This product was treated with HindIII and XbaI, and
then electrophoresed in a 0.8% agarose gel to elute and purify
a band of the desired size.
Further, the cj7 promoter region was obtained by carrying
out PCR for 30 cycles of denaturation for 30 seconds at 95°C,
WO 2015/163592 PCT/KR2015/003066
41
annealing for 30 seconds at 55°C, and extension for 30 seconds
at 72°C using p117-Pcj7-gfp as a template and a pair of
primers of SEQ ID NOs. 34 and 35 (See Table 6). A gene
fragment of the cj7 promoter gene was treated with KpnI and
HindII, and then electrophoresed on a 0.8% agarose gel to
elute and purify a band of the desired size.
[Table 6]
Primer for promoter cj7 gene
CJ7-F_KpnI
(SEQ ID NO: 34)
CGGGGTACC
AGAAACATCCCAGCGCTACTAATA
CJ7-R-HindIII
(SEQ ID NO: 35)
CCCAAGCTT
AGTGTTTCCTTTCGTTGGGTACG
Primer for E.coli ldcC gene
ldcC-F_HindIII
(SEQ ID NO: 36)
CCCAAGCTT
AAGCTT ATGAACATCATTGCCATTATGGG (52)
ldcC-R_XbaI
(SEQ ID NO: 37)
TGCTCTAGA
TTATCCCGCCATTTTTAGGACTC (53)
A gene fragment which was obtained by performing
electrophoresis of KpnI and XbaI-treated pECCG117
(Biotechnology letters vol 13, No. 10, p. 721-726 (1991))
vector in a 0.8% agarose gel and then eluting and purifying a
band of the desired size, the cj7 promoter gene fragment
treated with KpnI and HindIII, and the lysine decarboxylase
ldcC gene fragment treated with HindIII and XbaI were cloned
using T4 DNA ligase (NEB). The E.coli ldcC-encoding plasmid
WO 2015/163592 PCT/KR2015/003066
42
obtained by the above experiment was designated as pECCG117-
Pcj7-ldcC.
The prepared pECCG117-Pcj7-ldcC vector or pECCG117 vector
was introduced into KCCM11016P and KCCM11016P Tn:P(cj7)-
ARCH_0271 by electroporation, respectively. The transformants
were plated on BHIS plate containing 25 μg/ml kanamycin for
selection. The selected strains were designated as KCCM11016P
pECCG117, KCCM11016P pECCG117-Pcj7-ldcC, KCCM11016P Tn:P(cj7)-
ARCH_0271 pECCG117, and KCCM11016P Tn:P(cj7)-ARCH_0271
pECCG117-Pcj7-ldcC, respectively.
<3-3> Evaluation of cadaverine productivity of
Corynebacterium sp.-derived lysine-producing strain having
chromosomal insertion of ARCH_0271 and lysine decarboxylase
gene as plasmid
In order to examine whether introduction of ARCH_0271
into the cadaverine-producing strain affects cadaverine
production, cadaverine productivity was compared between
Corynebacterium glutamicum mutant strains prepared in Example
<3-2>.
In detail, 4 types of Corynebacterium glutamicum mutant
strains (KCCM11016P pECCG117; KCCM11016P pECCG117-Pcj7-ldcC;
KCCM11016P Tn:P(cj7)-ARCH_0271 pECCG117; and KCCM11016P
Tn:P(cj7)-ARCH_0271 pECCG117-Pcj7-ldcC) were cultured by the
following method, and cadaverine productivity was compared
therebetween.
WO 2015/163592 PCT/KR2015/003066
43
The respective mutant strains were plated on CM plate
media (1% glucose, 1% polypeptone, 0.5% yeast extract, 0.5%
beef extract, 0.25% NaCl, 0.2% urea, 100 μl of 50% NaOH, and 2%
agar, pH 6.8, based on 1 L), and cultured at 30°C for 24 hours.
Each of the strains cultured was inoculated to a 250 ml
corner-baffled flask containing 25 ml of seed medium (2%
glucose, 1% peptone, 0.5% yeast extract, 0.15% urea, 0.4%
KH2PO4, 0.8% K2HPO4, 0.05% MgSO4 7H2O, 100 μg of biotin, 1000 μg
of thiamine HCl, 2000 μg of calcium-pantothenic acid, and 2000
μg of nicotinamide, pH 7.0, based on 1 L), and cultured with
shaking at 30°C and 200 rpm for 20 hours.
Then, 1 ml of the seed culture was inoculated to a 250 ml
corner-baffled flask containing 24 ml of production medium (4%
Glucose, 2% (NH4)2SO4, 2.5% soybean protein, 5% corn steep
solids, 0.3% urea, 0.1% KH2PO4, 0.05% MgSO4 7H2O, 100 μg of
biotin, 1000 μg of thiamine hydrochloride, 2000 μg of calciumpantothenic
acid, 3000 μg of nicotinamide, 0.2 g of leucine,
0.1 g of threonine, 0.1 g of methionine, and 5% CaCO3, pH 7.0,
based on 1 L), and then cultured with shaking at 30°C and 200
rpm for 72 hours.
After culture, cadaverine productivities were measured by
HPLC. The concentrations of cadaverine in the cell culture of
each strain are given in the following Table 7.
[Table 7]
Strain Plasmid
Cadaverine
(g/L)
KCCM11016P
pECCG117 0
pECCG117-Pcj7-ldcC 2.3
WO 2015/163592 PCT/KR2015/003066
44
KCCM11016P
Tn:P(cj7)-ARCH_0271
pECCG117 0
pECCG117-Pcj7-ldcC 2.7
As shown in Table 7, cadaverine production was increased
in the ARCH_0271-introduced Corynebacterium glutamicum mutant
strains by more than 17%.
Example 4. Fermentation of Diamine by Introduction of
Protein having diamine export activity into E.coli
<4-1> Preparation of Strain by Introduction of ARCH_0271,
QWA_00075, or SMD_2351 into W3110
In order to examine whether expression of Arcanobacterium
haemolyticum DSM 20595-derived ARCH_0271, Alcaligenes
faecalis-derived QWA_00075, or Stenotrophomonas maltophiliaderived
SMD_2351 increases putrescine and cadaverine
productions in wild-type E. coli strain W3110 having
biosynthetic pathway of putrescine and cadaverine,
Corynebacterium and E. coli shuttle vector-based pDZTn-P(cj7)-
ARCH_0271, pDZTn-P(cj7)-QWA_00075, or pDZTn-P(cj7)-SMD_2351
was introduced into W3110, respectively.
A 2X TSS solution (Epicentre) was used for transformation
into E. coli, and the transformant was plated and cultured on
LB plate (10 g of Tryptone, 5 g of Yeast extract, 10 g of NaCl,
and 2% agar, based on 1 L) containing kanamycin (50 μg/ml) for
colony formation. The colonies thus formed were designated as
W3110 pDZTn-P(cj7)-ARCH_0271, W3110 pDZTn-P(cj7)- QWA_00075,
and W3110 pDZTn-P(cj7)- SMD_2351, respectively.
WO 2015/163592 PCT/KR2015/003066
45
<4-2> Comparison of diamine productivity of E.coli
introduced with ARCH_0271, QWA_00075, or SMD_2351
Putrescine and cadaverine productivities of the strains
obtained above were examined.
In detail, W3110 and W3110 pDZTn-P(cj7)-ARCH_0271, W3110
pDZTn-P(cj7)-QWA_00075, or W3110 pDZTn-P(cj7)-SMD_2351 were
cultured on LB solid media at 37°C for 24 hours.
Then, each of them was cultured in 25 ml of titration
medium (2 g of (NH4)2PO4, 6.75 g of KH2PO4, 0.85 g of citric
acid, 0.7 g of MgSO4 ㆍ 7H2O, 0.5% (v/v) trace element, 10 g of
glucose, 3 g of AMS, and 30 g of CaCO3, based on 1 L) at 37°C
for 24 hours. A trace metal solution contained 5 M HCl: 10 g
of FeSO4 ㆍ 7H2O, 2.25 g of ZnSO4 ㆍ 7H2O, 1 g of CuSO4 ㆍ 5H2O, 0.5
g of MnSO4ㆍ 5H2O, 0.23 g of Na2B4O7ㆍ 10H2O, 2 g of CaCl2ㆍ 2H2O,
and 0.1 g of (NH4)6Mo7O2ㆍ 4H2O per 1 liter.
The concentrations of putrescine and cadaverine produced
from each cell culture were measured, and the results are
given in the following Table 8.
[Table 8]
Parent
strain
Plasmid
Putrescine
(mg/L)
Cadaverine (mg/L)
W3110
(-) 13 5
pDZTn-P(cj7)-
ARCH_0271
51 23
pDZTn-P(cj7)-
QWA_00075
72 30
pDZTn-P(cj7)-
SMD_2351
37 15
WO 2015/163592 PCT/KR2015/003066
46
As shown in Table 8, compared to the parent strain W3110,
putrescine and cadaverine productions were remarkably
increased in W3110 pDZTn-P(cj7)-ARCH_0271, W3110 pDZTn-P(cj7)-
QWA_00075, or W3110 pDZTn-P(cj7)-SMD_2351 strain which was
introduced with ARCH_0271, QWA_00075 or SMD_2351, respectively.
That is, it was confirmed that the amount of diamine
produced in cell culture was remarkably increased by enhancing
activity of the ARCH_0271, QWA_00075 or SMD_2351 protein
having 56%, 41%, or 52% sequence homology with the amino acid
sequence of NCgl2522, suggesting that the ability to export
diamine such as putrescine and cadaverine can be improved by
enhancing activity of CE2495 or the protein having 42% or
higher sequence homology therewith.
As such, the present inventors demonstrated that
Corynebacterium glutamicum having enhanced ARCH_0271 activity
prepared by introducing ARCH_0271 into transposon of
Corynebacterium sp. microorganism KCCM11240P ΔNCgl2522 which
has a putrescine synthetic pathway, but a reduced putrescine
export activity has enhanced putrescine export activity,
thereby producing putrescine in a high yield.
Accordingly, this strain KCCM11240P ΔNCgl2522 Tn:P(cj7)-
ARCH_0271 was designated as CC01-0758, and deposited under the
Budapest Treaty to the Korean Culture Center of Microorganisms
(KCCM) on November 15, 2013, under Accession No. KCCM11476P.

WE CLAIM:
1. A microorganism for producing diamine, wherein activity
of a protein having an amino acid sequence of SEQ ID NO: 6 or
an amino acid sequence having 42% or higher sequence homology
with SEQ ID NO: 6 is introduced or enhanced.
2. The microorganism according to claim 1, wherein the amino
acid sequence having 42% or higher sequence homology with SEQ
ID NO: 6 is SEQ ID NO: 23 or SEQ ID NO: 26.
3. The microorganism according to claim 1, wherein diamine
acetyltransferase activity is further weakened compared to the
endogenous activity.
4. The microorganism according to claim 3, wherein the
diamine acetyltransferase has an amino acid sequence selected
from the group consisting of SEQ ID NOS: 12, 13, and 14.
5. The microorganism according to claim 1, wherein the
diamine is putrescine or cadaverine.
6. The microorganism according to claim 1, wherein the
microorganism is a microorganism belonging to genus
Corynebacterium or genus Escherichia.
7. A method of producing diamine, comprising:
WO 2015/163592 PCT/KR2015/003066
48
(i) culturing the microorganism of any one of claims 1 to 6 to
obtain a cell culture; and
(ii) recovering diamine from the cultured microorganism or the
cell culture.
8. The method according to claim 7, wherein the diamine is
putrescine or cadaverine.

Documents

Application Documents

# Name Date
1 Sequence listing [21-11-2016(online)].txt 2016-11-21
2 Sequence listing [21-11-2016(online)].pdf 2016-11-21
3 Form 5 [21-11-2016(online)].pdf 2016-11-21
4 Form 3 [21-11-2016(online)].pdf 2016-11-21
5 Form 18 [21-11-2016(online)].pdf_63.pdf 2016-11-21
6 Form 18 [21-11-2016(online)].pdf 2016-11-21
7 Description(Complete) [21-11-2016(online)].pdf 2016-11-21
8 201617039687.pdf 2016-11-24
9 Other Patent Document [13-01-2017(online)].pdf_307.pdf 2017-01-13
10 Other Patent Document [13-01-2017(online)].pdf 2017-01-13
11 201617039687-Power of Attorney-170117.pdf 2017-01-19
12 201617039687-OTHERS-170117.pdf 2017-01-19
13 201617039687-Correspondence-170117.pdf 2017-01-19
14 Form 3 [01-04-2017(online)].pdf 2017-04-01
15 201617039687-certified copy of translation [22-05-2020(online)].pdf 2020-05-22
16 201617039687-certified copy of translation [22-05-2020(online)]-1.pdf 2020-05-22
17 201617039687-FORM 4(ii) [25-08-2020(online)].pdf 2020-08-25
18 201617039687-RELEVANT DOCUMENTS [24-11-2020(online)].pdf 2020-11-24
19 201617039687-PETITION UNDER RULE 137 [24-11-2020(online)].pdf 2020-11-24
20 201617039687-OTHERS [24-11-2020(online)].pdf 2020-11-24
21 201617039687-Information under section 8(2) [24-11-2020(online)].pdf 2020-11-24
22 201617039687-FORM 3 [24-11-2020(online)].pdf 2020-11-24
23 201617039687-FER_SER_REPLY [24-11-2020(online)].pdf 2020-11-24
24 201617039687-COMPLETE SPECIFICATION [24-11-2020(online)].pdf 2020-11-24
25 201617039687-CLAIMS [24-11-2020(online)].pdf 2020-11-24
26 201617039687-FER.pdf 2021-10-17
27 201617039687-US(14)-HearingNotice-(HearingDate-30-06-2023).pdf 2023-05-03
28 201617039687-Correspondence to notify the Controller [27-06-2023(online)].pdf 2023-06-27
29 201617039687-PETITION UNDER RULE 138 [10-07-2023(online)].pdf 2023-07-10
30 201617039687-Written submissions and relevant documents [05-08-2023(online)].pdf 2023-08-05
31 201617039687-Information under section 8(2) [05-08-2023(online)].pdf 2023-08-05
32 201617039687-FORM 3 [05-08-2023(online)].pdf 2023-08-05
33 201617039687-Annexure [05-08-2023(online)].pdf 2023-08-05
34 201617039687-PatentCertificate18-08-2023.pdf 2023-08-18
35 201617039687-IntimationOfGrant18-08-2023.pdf 2023-08-18

Search Strategy

1 Searchstrategy9687_24-02-2020.pdf

ERegister / Renewals

3rd: 06 Nov 2023

From 27/03/2017 - To 27/03/2018

4th: 06 Nov 2023

From 27/03/2018 - To 27/03/2019

5th: 06 Nov 2023

From 27/03/2019 - To 27/03/2020

6th: 06 Nov 2023

From 27/03/2020 - To 27/03/2021

7th: 06 Nov 2023

From 27/03/2021 - To 27/03/2022

8th: 06 Nov 2023

From 27/03/2022 - To 27/03/2023

9th: 06 Nov 2023

From 27/03/2023 - To 27/03/2024

10th: 29 Dec 2023

From 27/03/2024 - To 27/03/2025

11th: 12 Dec 2024

From 27/03/2025 - To 27/03/2026