DESC:FIELD OF INVENTION
The present invention relates to an engineered microorganism suitable for the production of bioalcohols. In particular, the invention relates to an Escherichia coli (E. coli) strain for the production of bioalcohols. The invention also provides a process for the production of bioalcohols from short chain fatty acids.
BACKGROUND OF INVENTION
Finding different means for production of biofuel molecules will help in gradual shift from usage of fossil fuels [1]. Ethanol so far has served the purpose of alternative fuel due to its easy and cost effective manufacturing process [2]. Butanol, however, is considered to be closer to the fossil fuel in terms of its energy density and hygroscopicity [3-5].
n-Butanol has traditionally been produced by Clostridium acetobutylicum through acetone, butanol and ethanol (ABE) fermentation [4]. C. acetobutylicum undergoes acidogenic phase, when it produces majorly acetic acid and butyric acid, followed by solventogenic phase, when it produces ABE mix [6]. There are several challenges to the ABE fermentation that prevented this technology from being commercially viable. Some of these challenges include high feedstock cost, low butanol titer, low butanol productivity and strain instability [4,7]. Therefore, engineering efforts have been made to construct non-native industry-friendly host to produce n-butanol. Here, butanol producing pathway from Clostridium sp. has been engineered in laboratory host for heterologous butanol production [8-11]. Further, enhancement in butanol yield was made by replacing the pathway intermediate enzyme from the non-Clostridium host [12].
Research recently has been focused on separating alcohol or hydrocarbon production into two distinct biological events - fatty acids production in the first biological event and conversion of the fatty acids into various biofuel molecules in the second biological event. E. coli and Clostridium species have been used as the common host to fulfill these two functions. Free fatty acid production in engineered E. coli has been reported up to 0.3-0.4 g/g glucose [13-15], while native Clostridium was shown to produce 0.45-0.54 g short chain fatty acid per gram of sugar [16,17]. Further, the long chain fatty acids were converted into alcohols and alka(e)nes by the engineered E. coli [18,19] and short chain fatty acids were converted into alcohols using Clostridium sp. [20-22]. While pathway for independent biological conversion of long chain fatty acids to alcohol or alkane is well characterized and has been successfully used in the heterologous system, the pathway responsible for conversion of short chain fatty acids of C3-C7 length into either alcohol or alkane has been poorly characterized and has not been used in the heterologous system for such purpose. Moreover, native Clostridium host used for converting butyric acid to butanol needs to be constantly activated and regenerated through heat-shock and re-inoculation [20], thereby demanding the development of more robust, industry friendly platform for this purpose.
Accordingly, there is a need to find out a solution for efficient production of bioalcohols from fatty acids, more particularly short chain fatty acids.
OBJECTS OF THE INVENTION
It is an object of the invention to provide an engineered microorganism that is suitable for the production of bioalcohols.
It is another object of the invention to provide an efficient method for the production of bioalcohols.
It is yet another object of the invention to provide a process for the production of bioalcohols in bioreactor.
SUMMARY OF THE INVENTION
The present invention provides an engineered microorganism suitable for the conversion of short chain fatty acids into bioalcohols. In one embodiment, the present invention provides an E. coli strain engineered with the genes from second microorganism. In another embodiment the second microorganism is Clostridium acetobutylicum having accession number ATCC824.
In another embodiment, the engineered E. coli strain SSY101 (hereafter referred as as ‘MG1655 pQE-adhE2/ptb/buk’) has Accession No. MTCC 5938 and is specific for the production of bioalcohols.
In another embodiment, the E. coli strain is engineered by transforming the available E. coli strains with genes responsible for bioalcohols production. In one particular embodiment, E. coli is engineered with genes specific for butanol production and are of C. acetobutylicum origin. In another particular, the genes transformed in E. coli strain are namely butyrate kinase (buk), phosphotransbutyrylase (ptb) and aldehyde/alcohol dehydrogenase (adhE2).
In another particular embodiment, the E. coli strain is transformed using a vector carrying an operon comprising three genes namely butyrate kinase (buk) having SEQ ID 1, phosphotransbutyrylase (ptb) having SEQ ID 2 and aldehyde/alcohol dehydrogenase having SEQ ID 3. In another embodiment, the vector is pQE30 plasmid vector. In another particular embodiment the vector has SEQ ID 4.
In still another embodiment, the vector comprises nucleotide sequences with adhE2 at a position between 151-2745, ptb between 2765 to 3671 and buk between 3699 to 4784 nucleotides, with reference to XhoI restriction site at position 1 of the vector.

In yet another embodiment, the present invention provides a process for the production of bioalcohols. In particular embodiment, the invention provides a process for the production of bioalcohols from lower chain fatty acids. In another embodiment the chain length of fatty acids vary from C3-C7.
In another embodiment, the process comprises providing a culture of engineered E. coli, providing a solution comprising substrates for bioalcohols production; stirring the culture and said solution in anaerobic environment at a speed of 200-300 rpm for 48-240 hr. In one embodiment substrates are selected from sugars and fatty acids. In particular embodiment, the sugars are selected from glucose and glycerol. In another particular embodiment, fatty acids have carbon chain length between C3-C7 and are selected from propanoic acid, butyric acid, isobutyric acid, pentanoic acid, isopentanoic acid, hexanoic acid and heptanoic acid. In another embodiment, sugars and fatty acids are used in a ratio of 1.5:1 (mM/mM) or 1.57:1 (w/w).
In another embodiment, the initial cell density of the engineered E. coli culture is 1-10 at OD600.
In one particular embodiment, the concentration of butyric acid and glycerol used is 10-400 mM and 15-600 mM, respectively.
In another embodiment, the process is being carried out at a temperature suitable for the growth of culture. In particular embodiment, the process is carried out at 37oC. In another embodiment, the process is being carried out in a bioreactor. In another embodiment the solution comprising substrates for butanol production is fed in the bioreactor at a dilution rate of 0.2 h-1 so that the feeding rate of fatty acid and sugar is 15 mmol/L/h and 22.5 mmol/L/h, respectively.
In another embodiment, the anaerobic/inert environment of the bioreactor is maintained by purging argon in said bioreactor at a rate of 0.01 L/min.
In yet another embodiment, the process for production of bioalcohol is a continuous process.
In still another embodiment, the engineered E. coli strain converts lower chain fatty acids like propanoic acid to propanol; butyric acid to butanol; isobutyric acid to isobutanol; pentanoic acid to pentanol; isopentanoic acid to isopentanol; hexanoic acid to hexanol; and heptanoic acid to heptanol.
BRIEF DESCRIPTION OF DRAWINGS
The invention is explained by way of the following non-limiting drawings:
Figure 1 shows metabolic pathway of Clostridium acetobutylicum engineered in E. coli;
Figure 2 shows expression of clostridial pathway enzymes in E. coli for conversion of butyric acid to butanol. (A) The DH5a strain containing test and control plasmids were grown in LB medium in presence or absence of IPTG and analyzed for the expression of aldehyde/alcohol dehydrogenase (AdhE2) and butyrate kinase (Buk) containing 6-histidine tag on Western blot. Lane M – Molecular weight marker; lane 1 – pQE30 – IPTG; lane 2 - pQE30 + IPTG; lane 3 – pQE-adhE2/ptb/buk – IPTG; lane 4 – pQE-adhE2/ptb/buk + IPTG. (B) The grown cells in the LB medium were permeabilized with chloroform and analyzed for the activity of phosphotransbutyrylase (PTB), Buk and AdhE2. (C) Cells containing control and test plasmids were grown in LB medium containing 10 mM butyric acid and samples were withdrawn after 48 h and 120 h to test for butanol production;
Figure 3 depicts butyrate tolerance level of engineered E. coli. The MG1655 strain containing pQE-adhE2/ptb/buk plasmid was grown under anaerobic condition and resuspended in TB medium containing various concentration of butyric acid and 100 mM glycerol to achieve OD600 of either 1 (A) or 5 (B). The butanol production and cell density were monitored after 120 h of growth in the sealed bottle under anaerobic condition;
Figure 4 depicts substrate specificity and substrate ratio for butanol production. (A) Impact of electron donor on butanol yield. Engineered E. coli MG1655 pQE-adhE2/ptb/buk strain was grown under anaerobic condition and resuspended in Terrific Broth with 40 mM butyric acid and 40 mM of either glucose or glycerol as electron donor. Various substrates consumed and butanol produced were anlyzed through HPLC after 120 h of incubation. The butanol yield was calculated with resepect to (wrt) each carbon source. (B) Different ratios of glycerol and butyric acid were tested for production of butanol using cells at the OD600 of 1.0. (C) Different butyric acid concentrations were tested for production of butanol using cells at the OD600 of 10 by keeping the glycerol to butyric acid ratio fixed at 1.5:1;
Figure 5 shows substrate specificity of engineered cells towards various short chain fatty acids. Various short chain fatty acids were added in the growth medium (i.e. Terrific broth + 45 mM glycerol) of E. coli MG1655 carrying control or the test plasmid and their conversion to the corresponding alcohol were monitored through HPLC or GC;
Figure 6 depicts metabolism of glycerol and mixed acid fermentation of pathway. Genes involved in the pathway - ldhA – lactate dehydrogenase, pflB – pyruvate formate lyase, frdABCD – fumarate reductase, pta – ack – phosphotranacetylase and acetate kinase, adhe – alcohol dehydrogenase. Glycerol conversion to DHAP is catalyzed by the action of two glycerol dehydrogenases – glpD and glpABC.
Figure 7 depicts effect of strain type (A) and fadD gene deletion (B) on butyric acid uptake and butanol production. All strains were grown anaerobically in Terrific broth medium containing 45 mM glycerol and 30 mM butyric acid;
Figure 8 depicts production of butanol in the bioreactor in batch and continuous mode. (A) Fermentation profile and (B) enzyme kinetics of the E. coli MG1655 pQE-adhE2/ptb/buk strain in a bioreactor cultivated in the batch mode with an initial OD600 of 1.0. (C) Fermentation profile of the engineered strain with an initial OD600 of 10. (D) Butyric acid consumption and butanol production kinetics in the bioreactor operated under continuous mode with cell recycling using hollow fiber module. Vertical bar at 24 h indicates the position where fermentation was shifted from batch mode to continuous mode at the dilution rate of 0.2 h-1.
DETAILED DESCRIPTION OF THE INVENTION
Recent progress in the production of various biofuel precursors and molecules such as fatty acids, alcohols and alka(e)nes, is a significant step forward for replacing fossil fuels with renewable fuels. A two-step process, where fatty acids from sugars are produced in the first step and then converted to corresponding biofuel molecules in the second step, seems more viable and attractive at this stage.
The present invention provides an engineered microorganism for the production of bioalcohols. In particular the invention provides an Escherichia coli (E. coli) strain for the production of bioalcohols. The engineered E. coli is deposited in the depository at IMTECH, Chandigarh under the accession no MTCC 5938. In an embodiment, the engineered E. coli is prepared by transformation with foreign genes (genes from another microorganism) with the help of a vector pQE30. The genes being transformed encoding butyrate kinase (Buk) having SEQ ID 1, phosphotransbutyrylase (Ptb) having SEQ ID 2 and aldehyde/alcohol dehydrogenase (AdhE2) SEQ ID 3 are of Clostridium acetobutylicum origin.
Clostridium acetobutylicum is known to have an efficient pathway for production of butyric acid in the acidogenic phase as well as conversion of butyric acid to butanol in the solventogenic phase [23]. The production of butyric acid from butyryl-CoA during acidogenic phase happens through a reversible pathway consisting of two enzymes, i.e., butyrate kinase (Buk) and phosphotransbutyrylase (Ptb) [24], while conversion of butyric acid to butyryl-CoA during solventogenic phase occurs through CoA transferase (CoAT) enzyme with concurrent conversion of acetoacetyl-CoA to acetoacetate [25]. Reversal of Buk-Ptb pathway for conversion of butyric acid to the intermediate butyryl-CoA is a more energy efficient process as compared to the equivalent ß-oxidation pathway in E. coli for exogenous fatty acid activation and their subsequent degradation, because clostridial pathway needs one ATP as against requirement of two ATP equivalence for E. coli acyl-CoA synthetase (FadD) based pathway [26]. Further, conversion of butyryl-CoA to butanol is more efficiently done by alcohol dehydrogenase from C. acetobutylicum as compared to the corresponding native enzyme of host E. coli due to its higher affinity towards the butyryl-CoA than the acetyl-CoA [9,27]. Therefore, three genes from Clostridium acetobutylicum, i.e., an operon containing phosphotransbutyrylase (ptb) and butyrate kinase (buk) genes and aldehyde-alcohol dehydrogenase (adhE2) gene (Figure 1), are cloned in a pQE30 vector and expressed in E. coli. The vector pQE30 carrying the operon has SEQ ID 4. The genes being cloned are obtained from GenBank and have the following GenBank Seq IDs:
• Butyrate kinase (buk): GenBank Seq ID 1119258;
• Phosphotransbutyrylase (ptb) :GenBank Seq ID 1119259; and
• Aldehyde/alcohol dehydrogenase (adhE2): GenBank Seq ID: 1116040)
The vector comprise nucleotide sequences with adhE2 at a position between 151-2745, ptb between 2765 to 3671 and buk between 3699 to 4784 nucleotides, with reference to XhoI restriction site at position 1.
In an embodiment, the heterologous expression of Clostridial genes is tested in the engineered E. coli by Western blotting and enzyme assay. Western blotting is performed to assess the expression of two enzymes, Buk (whose gene is placed at the 3’end of ptb-buk operon) and AdhE2, where 6-histidine tag is incorporated during cloning. Clear bands corresponding to the molecular weight of Buk (~39 kDa) and AdhE2 (~96 kDa) are observed on Western blot using antibody against 6-histidine tag (Figure 2A), indicating their efficient expression in E. coli [27,28]. The assay performed to assess enzyme activities of Ptb, Buk and AdhE2 showed 80 nmol/min/mg, 8 nmol/min/mg and 23 nmol/min/mg of activities, respectively (Figure 2B). These values are largely close to the earlier reported enzyme activities for Ptb, Buk and AdhE2 in E. coli though variation in activities is observed perhaps due to different cultivation condition, vector copy number and design of synthetic operon [29,30]. Significant enzyme expression and their activities are also observed in the uninduced cells, suggesting the leaking expression of these enzymes.
In another embodiment, the present invention provides a process for the production of bioalcohols. The short chain fatty acids are converted into corresponding alcohols by engineered E. coli strain using butyrate kinase (Buk), phosphotransbutyrylase (Ptb) and aldehyde/alcohol dehydrogenase (AdhE2). The chain length of fatty acids vary from C3-C7.
The process comprises providing a culture of engineered E. coli, providing a solution comprising substrates for bioalcohols production; stirring the culture and said solution in anaerobic environment at a speed of 200-300 rpm for 48-240 hr. The substrates are selected from sugars and fatty acids. The sugars are selected from glucose and glycerol. The fatty acids are selected from propanoic acid, butyric acid, isobutyric acid, pentanoic acid, isopentanoic acid, hexanoic acid and heptanoic acid, The sugars and fatty acids are used in a ratio of 1.5:1 [mM/mM] or 1.57:1 [w/w]. The process is carried out at a temperature suitable for the growth of culture. Generally the temperature maintained is 37oC.
In one particular embodiment, engineered E. coli produces butanol from butyric acid and glycerol. The concentration of butyric acid and glycerol used is 10-400 mM and 15-600 mM, respectively.
In another embodiment, the process is carried out in a bioreactor. The solution comprising substrates for bioalcohol production is fed in the bioreactor at a dilution rate of 0.2h-1 so that the feeding rate of fatty acid and sugar is 15 mmol/L/h and 22.5 mmol/L/h, respectively. The anaerobic/inert environment of the bioreactor is maintained by purging argon in said bioreactor at a rate of 0.01 L/min. The process is a continuous process. The engineered E. coli strain converts lower chain fatty acids like propanoic acid to propanol; butyric acid to butanol; isobutyric acid to isobutanol; pentanoic acid to pentanol; isopentanoic acid to isopentanol; hexanoic acid to hexanol; and heptanoic acid to heptanol.
In one particular embodiment, conversion of butyric acid to butanol by the engineered E. coli (pQE-adhE2/ptb/buk) strain is tested with relevant controls. Neither pQE30 nor pQE-ptb/buk bearing cells utilizes butyric acid to produce butanol, suggests that all the three clostridial enzymes are needed to convert butyric acid to butanol (Figure 2C). The E. coli (pQE-adhE2/ptb/buk) strain produced 1.7 mM butanol from 2.3 mM butyric acid after 120h of incubation under anaerobic condition. Interestingly, it is found that that butyrate concentration in the E. coli (pQE – ptb/buk) strain increases when grown for 48 and 120 hours, leading to negative values for butyric acid consumption in Figure 2C. This may be because both Ptb and Buk enzymes are reversible in nature and may be diverting some of the internal butyryl CoA pool of E. coli into butyrate.
In another embodiment, the tolerance level of butyric acid to the E. coli host strain is tested. It is found that butyric acid concentration beyond 100 mM is inhibitory to both cell growth and butanol production (Figure 3A). Four fold higher cell density at the time of induction and butyric acid addition does not improve the tolerance level beyond 100 mM (Figure 3B), though the conversion yield is found higher with butanol concentration reaching to 53 mM as against 33 mM for lower cell density. At every concentration of butyric acid tested, some residual butyric acid remains unutilized at the end of cultivation (Table 1).
Table 1. Substrate and product concentrations along with conversion yield of butanol with respect to butyrate for all figures
Figure No.
Strain
Glycerol consumed (mM)
Residual glycerol (mM)
Butyrate consumed (mM)
Residual butyrate (mM)
Butanol produced (mM)
Conversion Yield (mM butanol/mM butyrate consumed)

3A
MG1655 pQE adhE2/ptb/buk 11.2112 3.8742 6.176237 6.311072 5.823334 0.942861
25.2363 5.0217 14.05924 5.386077 13.99885 0.995705
39.699 4.3294 20.12462 8.314698 20.33218 1.010314
40.2962 7.6402 27.93928 21.64689 27.13738 0.971299
42.93372 76.6561 34.73171 73.33759 33.06318 0.951959
35.38403 79.24891 11.38805 128.4197 27.05825 2.376021
30.56038 75.35586 12.07007 189.0274 22.73239 1.883368
13.71199 69.42061 24.85079 396.3666 0.240285 0.009669

3B MG1655 pQE adhE2/ptb/buk 28.11465 9.471284 15.17163 14.70865 18.05532 1.190072
63.15549 13.19494 29.15922 16.50848 35.79966 1.227731
133.0163 0.708984 44.34805 19.40911 53.19907 1.199581
37.5012 179.9498 4.517272 114.3943 4.90004 1.084734
17.28655 410.4119 8.869817 226.7752 3.966098 0.447145

4B MG1655 pQE adhE2/ptb/buk 31.48825 16.00818 16.07573 17.21088 14.33952 0.891998
41.00051 12.28616 21.31372 9.114645 18.71696 0.878165
71.01815 2.061607 18.02301 34.51986 15.42202 0.855685

4C MG1655 pQE adhE2/ptb/buk 33.34181 13.97999 10.54548 20.0421 8.860052 0.840176
46.73242 2.810685 28.86429 4.2195 24.73113 0.856807
70.74759 24.81922 35.03602 15.43367 38.49941 1.098852
79.82374 38.69823 40.04159 22.23606 47.33496 1.182145
75.04482 91.97382 52.1932 39.63009 59.93658 1.14836
29.09376 158.0289 24.01114 83.36101 26.06718 1.085629

7 M15 pQE adhE2/ptb/buk 31.49903 15.87597 4.745248 27.09835 7.866684 1.657803
MG1655 pQE adhE2/ptb/buk 35.44251 8.580887 23.48449 6.247513 22.78401 0.970173
E. coli B pQE adhE2/ptb/buk 0 46.0135 4.967603 26.3028 0.845803 0.170264

8A MG1655 pQE adhE2/ptb/buk 57.1542 0 21.97818 19.37515 23.47850 1.068264

8C MG1655 pQE adhE2/ptb/buk 105.6912 52.97488 53.16143 31.25848 60.33334 1.134908

Butanol production from butyric acid needs one ATP and two NADH (Figure 1). Therefore an optimal electron donor that can satisfy both the requirements needs to be identified. In an embodiment, suitability of glucose and glycerol as energy and electron source for butanol production is tested. It is found that while butanol yield with respect to butyric acid is similar (>85% of theoretical maxima) for either of the substrate, butanol yield with respect to glycerol approximately gets doubled as compared to that of glucose (Figure 4A). Further butyric acid uptake and butanol production kinetics with respect to various ratios of glycerol and butyric acid are tested. Two ratios of glycerol and butyric acid, 1:1 and 1.5:1, are tested at three different concentrations (Figure 4B). Maximum butanol concentration is obtained when glycerol to butyric acid ratio is 45:30 (mM:mM).
Since glycerol to butyric acid ratio of 1.5:1 is found optimal for butanol production, the effect of increased biocatalyst on butanol production is tested when higher amount of substrates in the same ratio are used. The experiments are performed using biomass with optical density (OD) at 600 nm ranges from 1-10. With this cell density, first impact of growing cells under aerobic vs anaerobic condition is tested before re-suspending the culture at OD600 of 10 and shifting to anaerobic condition for conversion of butyric acid to butanol. Aerobic cultivation helps achieving the higher cell density faster and therefore saves significant time. However, the results indicate that butanol production is three fold lower when cells are grown under aerobic condition as compared to those grown under anaerobic condition (Figure 4C). Further, higher concentration of butyric acid is tested, ranging from 50 mM to 110 mM, in the culture media by growing cells under anaerobic condition. Maximum butanol concentration of ~60 mM is obtained when butyric acid concentration in the medium is 90 mM (Figure 4C).
In another embodiment, the invention provides characterization of C. acetobutylicum pathway for conversion of short chain fatty acids into corresponding alcohols. It is further shown that the yield of conversion is strain specific and internal E. coli enzymes do not play a significant role in this process.
In another embodiment, the ability of the engineered strain for conversion of other short chain fatty acids of chain length C2-C8 to their corresponding alcohols is tested. For the study acetic acid, propionic acid, butyric acid, isobutyric acid, pentanoic acid, isopentanoic acid, hexanoic acid, heptanoic acid and octanoic acid are considered. The engineered E. coli cells containing the clostridial pathway converts all the fatty acids, except octanoic acid, into their corresponding alcohols (Figure 5). The control E. coli cells with empty plasmid only convert only acetic acid and to a certain extent propionic acid into their corresponding alcohols. The yield of conversion by the engineered E. coli varied with chain length as C4>C3>C5>C6=C7>C8. The conversion yield is higher with the linear chain fatty acids as compared to the branched chain fatty acids (Figure 5, Table 2).
Table 2. Concentrations and yield for conversion of short chain fatty acids to alcohols.
Acid Glycerol consumed Residual Glycerol Fatty acid consumed Residual fatty acid Alcohol produced Conversion Yield
Acetic acid 35.50492 4.641139 22.3028 5.72957 19.72755 0.884532
Propanoic acid 37.26668 5.540624 17.939 11.0823 10.01702 0.558393
Butyric acid 40.23534 3.386311 14.29439 17.52984 16.30677 1.140781
Isobutyric acid 32.35561 7.467321 11.10831 17.89169 12.06054 1.085722
Pentanoic acid 29.48622286 18.2906 10.2301 17.7879 8.80245 0.860446
Isopentanoic acid 43.49190409 9.625686 3.462265 24.83174 4.524444 1.306787
Hexanoic acid 39.7321 5.2138 4.321 25.0202 2.91 0.673455
Heptanoic acid 40.2139 4.0297 5.0219 25.1911 3.853499 0.767339
Octanoic acid 37.0321 7.2104 0 29.384 0 NA

Three commonly used laboratory E. coli strains, i.e., E. coli M15, E. coli MG1655 and E. coli B, are tested for their ability to convert butyric acid into butanol when transformed with pQE-adhE2/ptb/buk plasmid. All three strains are grown under similar conditions and analyzed for butanol production. E. coli MG1655 is able to produce maximum amount of butanol (23 mM) as compared to E. coli M15 (7.8 mM) and E. coli B (0.84 mM) (Figure 7A), and therefore is selected for further studies. The results suggest that transport ability of different E. coli stains for butyric acid may vary significantly. This observation may also be applicable to other studies where E. coli is used to convert long chain fatty acids to either alcohol or alka(e)ne [18,19].
E. coli MG1655 strain transformed with butyric acid to butanol pathway produced three products besides butanol, i.e., succinic acid, acetic acid and ethanol, when glycerol and butyric acid is used as substrate. Among these, succinic acid and ethanol are sink for NADH since production of each of these molecules from glycolytic intermediates needs 2 molecules of NADH (Figure 6). Thus, these two molecules are the major competing products for butanol in terms of NADH requirement. The deletion mutants are tested for internal alcohol dehydrogenase (adhE) and fumarate reductase (frdA) in order to prevent formation of ethanol and succinate, respectively. However, these deletions did not affect butanol production (Table 3).
Table 3. Metabolite concentrations used for butanol production using different knockout strains:

Strain type Glycerol consumed (mM) Butyric acid consumed (mM) Butanol (mM) Succinic acid (mM) Acetic acid (mM) Ethanol (mM)
MG1655 (pQE-adhE2/ptb/buk) 38.1 24.2 23.7 11.8 31.3 1.5
?adhE (pQE-adhE2/ptb/buk) 88.4 25.9 2.6 8.5 18.0 2.6
?frdA (pQE-adhE2/ptb/buk) 31.3 18.3 16.6 2.9 33.6 7.2
Role of internal acyl-CoA synthase in the conversion of butyric acid to butanol
E. coli has an internal enzyme, acyl coenzyme A synthase, encoded by fadD gene that facilitates long chain fatty acids uptake and esterification into CoA thioesters prior to its degradation via ß-oxidation or incorporation into phospholipids. This enzyme converts free fatty acids into corresponding acyl-CoA with concomitant hydrolysis of ATP into AMP. The role of fadD in the uptake and conversion of butyric acid to butyryl-CoA is investigated. It is observed that when E. coli MG1655 is transformed with only alcohol dehydrogenase (AdhE2) from C. acetobutylicum, negligible amount of butyric acid is consumed and no butanol is detected in the medium (Figure 7B), suggesting no indigenous enzyme is helping in uptake of butyric acid and its assimilation into butyryl-CoA that can be further channeled through AdhE2 to butanol. Moreover, transformation with pQE-adhE2/ptb/buk plasmid carrying genes from C. acetobutylicum, into fadD deleted strain results in similar butyric acid uptake and butanol production as that of wild type strain, indicating that fadD had no role to play in converting butyric acid to butanol.
In another embodiment, the process for butanol production is validated at the bioreactor level under controlled environment for continuous production of butanol using the engineered E. coli cells. Butanol production is analyzed under controlled bioreactor environment, which is necessary to eventually develop a scalable process. Cells are grown under anaerobic condition in the flask, harvested and re-suspended in TB medium and grown further in a bioreactor in presence of butyric acid and glycerol. The cells produce 25 mM butanol from butyric acid at close to 100% conversion efficiency (Figure 8A). Enzyme kinetic studies during the cultivation indicates consistent production of the three heterologous enzymes in E. coli, i.e., Buk, Ptb and AdhE2 (Figure 8B). However, decline in Buk activity, which is the first enzyme in the butyric acid to butanol pathway, towards the end of cultivation explains decline in flux towards butanol production. Glycerol present in the medium is used by the cells as the source of electron and ATP, which is evident from the corresponding production of acetate (Figure 8A). To improve the titer and productivity of butanol, cultivation study is carried out in the bioreactor with the starting cell density of OD600~10. The butanol titer reaches to 60 mM within 24 h of fermentation (Figure 8B), as against 25 mM butanol in 100 h when low cell density is used (Figure 8A).
Further continuous production of butanol is tested by cell recycling through hollow-fiber cassette. The feed containing butyric acid and glycerol is given continuously at the rate of 15 mmol/L/h and 22.5 mmol/L/h, respectively, with the dilution rate of 0.2 h-1 after 24 h of fermentation with OD600 of 10. The butanol concentration is observed in the permeate intermittently until 240 h. An average butanol titer of 37 mM and productivity of 7.6 mmol/L/h is observed in the permeate during the continuous cultivation (Figure 8C). There is a corresponding consumption of butyric acid at the similar rate. Though the butanol production rate is considerably lower than what is expected at the commercial scale, further process development is likely to help in improving the production rate.
The engineered E. coli is able to convert butyric acid and other short chain fatty acids of chain length C3 to C7 into corresponding alcohols and the efficiency of conversion varies with different E. coli strain type. Glycerol is a better donor of ATP and electron as compared to glucose for converting butyric acid to butanol. The engineered E. coli is able to tolerate up to 100 mM butyric acid and produced butanol with the conversion rate close to 100% under anaerobic condition. Deletion of native genes, such as fumarate reductase (frdA) and alcohol dehydrogenase (adhE), responsible for side products succinate and ethanol, which act as electron sink and can compete with butyric acid uptake, does not improve the butanol production efficiency. Indigenous acyl-CoA synthase (fadD) is found to play no role in the conversion of butyric acid to butanol. Engineered E. coli is cultivated in a bioreactor under controlled condition where 60 mM butanol is produced within 24 of cultivation. A continuous bioreactor with the provision of cell recycling allows the continuous production of butanol at the average productivity of 7.6 mmol/L/h until 240 h.
E. coli engineered with the pathway from C. acetobutylicum efficiently converts butyric acid to butanol. Other short chain fatty acids with the chain length of C3 to C7 are also converted to the corresponding alcohols.
The preferred embodiments of the invention are hereinafter described by way of non-limiting examples and should not be construed to limit the scope of invention.

Example 1
Bacterial strains, plasmids and culture conditions
E. coli and C. acetobutylicum strains along with various primers and plasmids used in this study are listed in Table 4.
Table 4. Strains, plasmids and primers used in this study
Name Description Reference or Source
Strains

Clostridium acetobutylicum

ATCC #824
E. coli MG1655 F- LAM- rph-1 CGSC #6300
E. coli B F- CGSC #5713
E. coli DH5a F- F80lacZ?M15 ?(lacZYA-argF) U169 recA1 endA1 hsdR17 (rK–, mK+) phoA supE44 ?– thi-1 gyrA96 relA1 Invitrogen
E. coli M15 F- thi lac mtl, pREP4 plasmid Qiagen
E. coli BW25113 rrnB DElacZ4787 HsdR514 DE(araBAD)567 DE(rhaBAD)568 rph-1 CGSC #7636
E. coli BW25113 ?fadD BW25113, ?fadD :: FRT-kan-FRT CGSC #9503
E. coli ?adhE BW25113, ?adhe ::FRT-kan-FRT CGSC #9113
E. coli ?frdA BW25113, ?frdA :: FRT-kan-FRT CGSC #10964
Plasmids
pQE30 bla, cloning vector Qiagen
pQE-adhE2 pQE30 with adhe2 gene from C. acetobutylicum cloned between BamHI and SalI sites This study
pQE-ptb/buk pQE30 with ptb-buk operon from C. acetobutylicum cloned between SalI and PstI sites This study
pQE-adhE2/ptb/buk pQE-adhE2 with ptb-buk operon from C. acetobutylicum cloned between SalI and PstI sites SEQ ID 4
Primers
P1 ATCGGATCCATGAAAGTTACAAATCAAAAA SEQ ID 5
P2 ACTGGTCGACTTAGTGGTGGTGGTGGTGGTGAAATGATTTTATATAGATATC SEQ ID 6
P3 ACTGGTCGACGAAGGAGATATACCATGATTAAGAGTTTTAATGAAAT SEQ ID 7
P4 GTCTGCAGTTAGTGGTGGTGGTGGTGGTGTTTGTATTCCTTAGCTTTTTC SEQ ID 8

E. coli strains were grown at 37 ?C in Luria–Bertani (LB) medium or Terrific Broth (TB) medium along with 100 µg/ml ampicillin, 30 µg/ml kanamycin and 0.1 mM IPTG as per requirement. All deletion mutant E. coli strains used in this study were procured from CGSC (Coli Genetic Stock Centre, Yale University, USA). E. coli strains DH5a and M15 were obtained from Invitrogen and Qiagen, respectively. C. acetobutylicum ATCC 824 was procured form American Type Culture Collection (ATCC), USA. C. acetobutylicum was grown in Reinforced Clostridial Medium (RCM, Himedia Laboratories) in an anaerobic chamber maintained at 37 °C. E. coli DH5a strain was used for making all the plasmid constructs and pQE30 (Qiagen) was used as expression vector for all the genes. Recombinant DNA techniques were done as per standard procedures [31]. Restriction enzymes and T4 DNA ligase were procured from New England Biolabs (NEB). Plasmid isolation was performed using the kit from Himedia and DNA purification was done using the Sure-Extract PCR Cleanup and Gel Extraction Kit from Genetix. Oligonucleotides to be used as primers were custom synthesized from Sigma-Aldrich. PCR amplification was done using Phusion High Fidelity DNA Polymerase (Finnzymes) and Taq Polymerase from Bangalore Genei. All chemicals used in this study were procured from Sigma–Aldrich.
Transformed E. coli strains were streaked on LB agar plates containing 100 µg/ml ampicillin and/or 30 µg/ml kanamycin and grown overnight at 37 °C. Isolated colonies were used to prepare primary inoculum by inoculating in 5 ml LB medium containing antibiotics and growing overnight aerobically. The overnight culture was used to prepare secondary inoculum by inoculating in 20 ml TB medium containing 50 mM glucose or glycerol and incubating overnight at 37 °C under anaerobic conditions. The grown secondary inoculum was harvested, resuspended in 20 ml of TB medium to achieve an OD600 of 1.0 and transferred in a 100 ml rubber stoppered anaerobic bottle purged with argon gas. The TB medium also contained butyric acid and 0.1 mM IPTG in addition to the appropriate carbon source. The bottle was purged with argon and the culture was grown at 37°C in an orbital shaker. Samples were withdrawn from the bottles at appropriate time points for cell density and metabolite analysis.
The strains were also grown under controlled conditions in a bioreactor. A primary culture was prepared by inoculating an isolated colony in LB and growing the cells overnight at 37 °C. The grown culture was used to inoculate 350 ml TB medium in 1 L conical flask containing either glucose or glycerol and incubated for 24 hours in an anaerobic chamber maintained at 37 °C. An appropriate volume of this culture was harvested and inoculated in the bioreactor vessel (Multi-vessel BioStat Q Plus fermentor, Sartorius) containing 350 ml of TB medium along with glycerol and butyric acid so as to achieve an initial OD600 of 1 or 10. IPTG was not added in the bioreactor as it was shown at the small scale that addition of IPTG had no impact on conversion of butyric acid into butanol (data not shown), perhaps due to sufficient basal level expression of the pathway enzymes. The bioreactor was maintained at 37 °C with a stirrer speed of 300 rpm, pH of 7 and purging of highly pure grade argon at a rate of 0.01 L/min to maintain the anaerobic environment.
Continuous production of butanol was achieved by cell recycling using a Hollow Fiber Cartridge (surface area 420 cm2, 500,000 NMWC) from GE Healthcare. The cultivation was carried out in a bioreactor with 350 ml working volume under the operating mentioned above with an initial cell density at OD600 of 10. Solution containing 50 mM butyric acid, 75 mM glycerol, 72 mM K2HPO4 and 17 mM KH2PO4 were added to the fermentor vessel through the peristaltic pump at the dilution rate of 0.2 h-1 to achieve feeding of 15 mmol/L/h of butyric acid and 22.5 mmol/L/h of glycerol. Medium along with cells was pumped through the hollow fiber cassette. The cells were recycled back to the bioreactor while permeate from hollow fiber cassette containing butanol was recovered and used for analysis of butanol formation.
EXAMPLE 2
Cloning of C. acetobutylicum genes in E. coli
Total genomic DNA was isolated from C. acetobutylicum ATCC 824 as per standard procedure [31]. The adhE2 gene of C. acetobutylicum was PCR amplified using P1 and P2 primers, digested with BamHI and SalI restriction enzymes and ligated to the corresponding restriction sites of pQE30 plasmid to obtain pQE-adhE2. The P2 primer also contained codons for 6-histidine tag to monitor the expression at the protein level. The ptb – buk operon of C. acetobutylicum ATCC 824 encoding phosphotransbutyrylase and butyric acid kinase genes was amplified from the genomic DNA using the P3 and P4 primers. The PCR product was digested with SalI and PstI restriction enzymes and ligated to the corresponding restriction sites of pQE30 plasmid to obtain pQE-ptb/buk. P3 primer contained ribosomal biding site for translation initiation and P4 primer contained codons for 6-histidine tag to monitor the expression of operon at the protein level. The adhE2 gene was further cloned at the BamHI and SalI restriction sites of pQE-ptb/buk plasmid to obtain the final construct pQE-adhE2/ptb/buk.
The expression of the cloned genes was confirmed by SDS – PAGE and Western Blotting. Briefly, the cultures were induced and the crude cell lysates obtained were separated on a 12% polyacrylamide gel. The proteins were transferred to a nitrocellulose membrane (0.2 um, BioTraceNT, Pall Corporation), probed with anti – penta-his antibody (H1029, Sigma) followed by HRP-conjugated anti-mouse IgG antibody (A4416, Sigma). Color development of the blot was performed using DAB (diaminobenzidine) and hydrogen peroxide.
EXAMPLE 3
Analytical Methods
For extracellular metabolite analysis, cells were centrifuged at 13000 rpm for 10 min and the supernatant was filtered through 0.22 ?m membrane. The extracellular metabolites were analyzed on a 1260 Infinity Series HPLC system (Agilent) equipped with an Aminex HPX-87H anion exchange column (Bio-Rad). Filtered and degassed 4 mM H2SO4 was used as the mobile phase at a flow rate 0.3 ml/min. The column was maintained at a temperature of 40 °C in a thermostat chamber. Butanol was analyzed on a 7890A gas chromatography system (Agilent) with a flame ionization detector equipped with a 7694E headspace analyzer using a HP-5 column (30m length, 0.32 mm id, 0.25 um film thickness). The oven program was set as follows (40 °C for 4 minutes, 80 °C for 4 minutes at 10 °C/min, 120 °C for 2 min at 20 °C/min, 200 °C for 2 min at 20 °C/min). The inlet and detector were maintained at 150 °C and 280 °C, respectively. Metabolite concentrations were calculated from the area of the curve obtained for 1 g/L of the standards (Absolute Standards). All results were presented as average and standard deviation of the data from two independent experiments.
EXAMPLE 4
Enzyme Assays
Phosphotransbutyrylase (Ptb) activity was measured by estimating the liberation of coenzyme A on the addition of butyryl CoA to the reaction mixture. The free coenzyme A formed was then allowed to form a coloured complex with 5,5' – dithio-(2-nitrobenzoic acid) (DTNB) which could then be estimated by measuring the absorbance at 412 nm [32]. The reaction mixture contained 100 mM potassium phosphate buffer (pH 7.4), 0.02 mM butyryl CoA, 0.08 mM DTNB and crude cell extract. The extinction coefficient of the DTNB – CoA – SH complex was taken as 13.6 mM-1cm-1. Aldehyde/alcohol dehydrogenase (AdhE2) activity was measured in the reverse direction by estimating the amount of free NADH liberated during the reaction [33]. Briefly the reaction mixture contained 19 mM sodium pyrophosphate buffer (pH 8.8), 2.37% v/v ethanol or butanol, 5mM ß – NAD and crude cell extract in a total volume of 2 ml. The absorbance at 340 nm was monitored to estimate the amount of free NADH produced. The extinction coefficient of NADH at 340 nm was taken as 6.22 mM-1cm-1. The activity of butyrate kinase (Buk) was estimated by monitoring the formation of the coloured ferric hydroxamate complex with butyryl phosphate in the presence of excess of hydroxylamine [34]. The reaction mixture contained 770 mM potassium butyrate (pH 7.5), 48mM Tris – Cl, 10 mM MgSO4, 700 mM KOH, 10 mM ATP and crude cell extract. The reaction was initiated by the addition of ATP and the mixture was incubated at 37 ?C for 5 minutes. 1 ml of 10% trichloroacetic acid was used to stop the reaction and the end product was estimated by the addition of 4ml of FeCl3 (1.25% in 1N HCl). The extinction coefficient of the hydroxamate complex at 540 nm was taken as 0.691 mM-1cm-1. The enzyme units were represented as nmol/min/mg.
This invention has been completed with the aid of Bioenergy grant from DEPARTMENT OF BIOTECHNOLOGY, Ministry Of Science and Technology, Government of India.

References
1. Bhattarai K, Stalick WM, McKay S, Geme G, Bhattarai N: Biofuel: an alternative to fossil fuel for alleviating world energy and economic crises. J Environ Sci Health A Tox Hazard Subst Environ Eng 2011, 46:1424-1442.
2. Mussatto SI, Dragone G, Guimarães PM, Silva JP, Carneiro LM, Roberto IC, Vicente A, Domingues L, Teixeira JA: Technological trends, global market, and challenges of bio-ethanol production. Biotechnol Adv 2010, 28:817-830.
3. Jin C, Yao M, Liu H, Leed CF, Ji J: Progress in the production and application of n-butanol as a biofuel. Renew Sustain Energy Rev 2011, 15: 4080–4106.
4. Green EM: Fermentative production of butanol--the industrial perspective. Curr Opin Biotechnol 2011, 22:337-343.
5. Dürre P: Biobutanol: an attractive biofuel. Biotechnol J 2007, 2:1525-1534.
6. Gheshlaghi R, Scharer JM, Moo-Young M, Chou CP: Metabolic pathways of clostridia for producing butanol. Biotechnol Adv 2009, 27:764-781.
7. Zheng YN, Li LZ, Xian M, Ma YJ, Yang JM, Xu X, He DZ: Problems with the microbial production of butanol. J Ind Microbiol Biotechnol 2009, 36:1127-1138.
8. Atsumi S, Cann AF, Connor MR, Shen CR, Smith KM, Brynildsen MP, Chou KJ, Hanai T, Liao JC: Metabolic engineering of Escherichia coli for 1-butanol production. Metab Eng 2008, 10:305-311.
9. Inui M, Suda M, Kimura S, Yasuda K, Suzuki H, Toda H, Yamamoto S, Okino S, Suzuki N, Yukawa H: Expression of Clostridium acetobutylicum butanol synthetic genes in Escherichia coli. Appl Microbiol Biotechnol 2008, 77:1305-1316.
10. Chen SK, Chin WC, Tsuge K, Huang CC, Li SY: Fermentation approach for enhancing 1-butanol production using engineered butanologenic Escherichia coli. Bioresour Technol 2013. doi:pii: S0960-8524(13)00138-7.
11. Steen EJ, Chan R, Prasad N, Myers S, Petzold CJ, Redding A, Ouellet M, Keasling JD: Metabolic engineering of Saccharomyces cerevisiae for the production of n-butanol. Microb Cell Fact 2008, 7:36.
12. Shen CR, Lan EI, Dekishima Y, Baez A, Cho KM, Liao JC: Driving forces enable high-titer anaerobic 1-butanol synthesis in Escherichia coli. Appl Environ Microbiol 2011, 77:2905-2915.
13. Lennen RM, Pfleger BF: Engineering Escherichia coli to synthesize free fatty acids. Trends Biotechnol 2012, 30:659-667.
14. Steen EJ, Kang Y, Bokinsky G, Hu Z, Schirmer A, McClure A, Del Cardayre SB, Keasling JD: Microbial production of fatty-acid-derived fuels and chemicals from plant biomass. Nature 2010, 463:559-562.
15. Zhang F, Ouellet M, Batth TS, Adams PD, Petzold CJ, Mukhopadhyay A, Keasling JD: Enhancing fatty acid production by the expression of the regulatory transcription factor FadR. Metab Eng 2012, 14:653-660.
16. Zhang C, Yang H, Yang F, Ma Y: Current progress on butyric acid production by fermentation. Curr Microbiol 2009, 59:656-663.
17. Wei D, Liu X, Yang ST: Butyric acid production from sugarcane bagasse hydrolysate by Clostridium tyrobutyricum immobilized in a fibrous-bed bioreactor. Bioresour Technol 2013, 129:553-560.
18. Howard TP, Middelhaufe S, Moore K, Edner C, Kolak DM, Taylor GN, Parker DA, Lee R, Smirnoff N, Aves SJ, Love J: Synthesis of customized petroleum-replica fuel molecules by targeted modification of free fatty acid pools in Escherichia coli. Proc Natl Acad Sci USA 2013, 110:7636-7641.
19. Akhtar MK, Turner NJ, Jones PR: Carboxylic acid reductase is a versatile enzyme for the conversion of fatty acids into fuels and chemical commodities. Proc Natl Acad Sci USA 2013, 110:87-92.
20. Richter H, Qureshi N, Heger S, Dien B, Cotta MA, Angenent LT: Prolonged conversion of n-butyrate to n-butanol with Clostridium saccharoperbutylacetonicum in a two-stage continuous culture with in-situ product removal. Biotechnol Bioeng 2012, 109:913-921.
21. Baba S, Tashiro Y, Shinto H, Sonomoto K: Development of high-speed and highly efficient butanol production systems from butyric acid with high density of living cells of Clostridium saccharoperbutylacetonicum. J Biotechnol 2012, 157:605-612.
22. Tashiro Y, Shinto H, Hayashi M, Baba S, Kobayashi G, Sonomoto K: Novel high-efficient butanol production from butyrate by non-growing Clostridium saccharoperbutylacetonicum N1-4 (ATCC 13564) with methyl viologen. J Biosci Bioeng 2007, 104:238-240.
23. Jurgens G, Survase S, Berezina O, Sklavounos E, Linnekoski J, Kurkijärvi A, Väkevä M, van Heiningen A, Granström T: Butanol production from lignocellulosics. Biotechnol Lett 2012, 34:1415-1434.
24. Cary JW, Petersen DJ, Papoutsakis ET, Bennett GN: Cloning and expression of Clostridium acetobutylicum phosphotransbutyrylase and butyrate kinase genes in Escherichia coli. J Bacteriol 1988, 170:4613-4618.
25. Clark SW, Bennett GN, Rudolph FB: Isolation and Characterization of Mutants of Clostridium acetobutylicum ATCC 824 Deficient in Acetoacetyl-Coenzyme A:Acetate/Butyrate:Coenzyme A-Transferase (EC 2.8.3.9) and in Other Solvent Pathway Enzymes. Appl Environ Microbiol 1989, 55:970-976.
26. Black PN, DiRusso CC, Metzger AK, Heimert TL: Cloning, sequencing, and expression of the fadD gene of Escherichia coli encoding acyl coenzyme A synthetase. J Biol Chem 1992, 267:25513-25520.
27. Fontaine L, Meynial – Salles I, Girbai L, Yang X, Croux C, Soucaille P. Molecular characterization and transcriptional analysis of adhE2, the gene encoding the NADH – dependent aldehyde/alcohol dehydrogenase responsible for butanol production in alcohologenic cultures of Clostridium acetobutylicum ATCC 824. J Bacteriol 2002, 184:821 – 830.
28. Hartmanis MG. Butyrate kinase from Clostridium acetobutylicum. J Biol Chem 1987, 262:617 – 621.
29. Cary JW, Petersen DJ, Papoutsakis ET, Bennett GN: Cloning and expression of Clostridium acetobutylicum phosphotransbutyrylase and butyrate kinase genes in Escherichia coli. J Bacteriol 1988, 170:4613-4618.
30. Berezina OV, Zakharova NV, Brandt A, Yarotsky SV, Schwarz WH, Zverlov VV: Reconstructing the clostridial n-butanol metabolic pathway in Lactobacillus brevis. Appl Microbiol Biotechnol 2010, 87:635-646.
31. Sambrook J, Fritsch EF, Maniatis T: Molecular Cloning, A Laboratory Manual. Second edition. Cold Spring Harbour, NY: Cold Spring Harbor Laboratory Press; 1989.
32. Andersch W, Bahl H, Gottschalk G: Level of enzymes involved in acetate, butyrate, acetone and butanol formation by Clostridium acetobutylicum. Eur J Appl Microbiol Biotechnol 1983, 18:327-333.
33. Kagi J, Vallee B: The role of zinc in alcohol dehydrogenase: The effect of metal binding agents on the structure of the yeast alcohol dehydrogenase molecule. J Biol Chem 1960, 235:3188–3192.
34. Rose IA: Acetate kinase of bacteria (acetokinase). Methods Enzymol 1955, 1:591–593.
,CLAIMS:We Claim:
1. An engineered E. coli comprising butyrate kinase (buk), phosphotransbutyrylase (ptb) and aldehyde/alcohol dehydrogenase (adhE2) genes from second microorganism.
2. The engineered E. coli as claimed in claim 1 wherein the second microorganism is Clostridium acetobutylicum ATCC824.
3. The engineered E. coli as claimed in claim 1 wherein the butyrate kinase (buk) gene has Seq ID 1 , phosphotransbutyrylase (ptb) has Seq ID 2 and aldehyde/alcohol dehydrogenase (adhE2) has Seq ID 3.
4. The engineered E. coli as claimed in claims 1-3, wherein said strain produces bioalcohols from lower chain fatty acids.
5. The engineered E. coli as claimed in claim 4, wherein the fatty acids have chain length between C3-C7.
6. The engineered E. coli as claimed in claim 1 having Accession No. MTCC 5938.
7. A vector comprising an operon consisting of butyrate kinase (buk), phosphotransbutyrylase (ptb) and aldehyde/alcohol dehydrogenase (adhE2) genes.
8. The vector as claimed in claim 7, wherein the vector is a plasmid vector pQE30 and has Seq ID 4.
9. A process for the production of bioalcohols, said process comprises:
a) providing a culture of engineered E. coli;
b) providing a solution comprising substrates for bioalcohols production;
c) stirring the culture and said solution in anaerobic environment at a speed of 200-300 rpm for 48h to 240h; and
d) obtaining bioalcohols from fatty acids.
10. The process as claimed in claim 9, wherein culture is provided having cell density of 1-10 at OD600.
11. The process as claimed in claim 9, wherein the substrates are selected from sugars and fatty acids.
12. The process as claimed in claim 11, wherein the sugars are selected from glucose and glycerol.
13. The process as claimed in claim 11, wherein the chain length of fatty acids varies between C3-C7 and said fatty acids are selected from propanoic acid, butyric acid, isobutyric acid, pentanoic acid, isopentanoic acid, hexanoic acid and heptanoic acid,
14. The process as claimed in claim 9, wherein in step b, the solution comprises sugars and fatty acids in a ratio of 1.57:1 [w/w].
15. The process as claimed in claim 9, wherein in step b said solution is provided at a dilution rate of 0.2 h-1 so that the feeding rate of fatty acids and sugar is 15 mmol/L/h and 22.5 mmol/L/h, respectively.
16. The process as claimed in claim 9, wherein the process is carried out at a temperature of 37 oC.
17. The process as claimed in claim 9, wherein the process is carried out in an inert environment.
18. The process as claimed in claim 17, wherein said inert environment is created by using argon at a rate of 0.01 L/min.
19. The process as claimed in claims 9, wherein said process is carried out in a bioreactor.
20. The process as claimed in claims 9-19, wherein the process is a continuous process.
21. The process as claimed in claims 9-20, wherein the engineered E. coli strain converts lower chain fatty acids like propanoic acid to propanol; butyric acid to butanol; isobutyric acid to isobutanol; pentanoic acid to pentanol; isopentanoic acid to isopentanol; hexanoic acid to hexanol; and heptanoic acid to heptanol.

Dated this 5th day of September 2014.
(H. SUBRAMANIAM)
of SUBRAMANIAM & ASSOCIATES
Attorneys for the applicants