Abstract: The present invention relates to lipase enzymes with enhanced activity titer by expressing a recombinant lipase gene at two different loci in a yeast host. The cultured lipase enzymes result in 2-4 fold expression of recombinant lipase activity per litre of culture media.
1. A lipase enzyme with enhanced enzymatic activity titre having recombinant lipase gene represented by SEQ ID No: 1, SEQ ID No: 2 and SEQ ID No: 3 and expressed at the dual locus of yeast host Pichia pastoris.
2. The lipase enzyme as claimed in Claim 1, wherein the recombinant lipase genes are expressed in locus site AOX1 and His4 in the Pichia pastoris genome.
3. The lipase enzyme as claimed in Claim 1, wherein the yeast host Pichia pastoris is selected from Pichia pastoris GS115 and Pichia pastoris X-33.
4. The lipase enzyme as claimed in Claim 1, wherein the expression vector is selected from a group comprising pPICZa, pGAPZaA, and pPIC9K.
5. The lipase enzyme as claimed in Claim 1, wherein the restriction enzymes include but is not limited to SacI and SalI.
6. The lipase enzyme as claimed in Claim 1, wherein the restriction sites are selected from AOX1- SacI Restriction site and His4- Sal I Restriction site.
7. A process of producing lipase enzyme with enhanced activity titer by expressing a recombinant lipase gene at two different loci of yeast host Pichia pastoris comprising; i. optimizing a lipase gene to generate a recombinant lipase gene for yeast expression; ii. inserting said recombinant lipase gene into an expression vector; iii. transforming yeast host Pichia pastoris with the recombinant lipase gene expression vector using a restriction enzyme in dual locus; and iv. culturing the transformed yeast in a fermentation media to express recombinant lipase, wherein the culturing results in the 2-4 fold higher expression of recombinant lipase activity per liter of culture media.
8. The process as claimed in Claim 7, wherein the lipase gene is selected from the group comprising lipase genes of Thermomyces lanuginosus, or Candida antarctica Lipase B (CALB) gene or co-expression of both the gene but not limited to wild type or mutant variants of the same.
9. The process as claimed in Claim 7, wherein recombinant lipase gene is represented by SEQ ID No: 1, SEQ ID No: 2 and SEQ ID No: 3.
10. The process as claimed in Claim 7, wherein the recombinant lipase genes are expressed in locus site AOX1 and His4 in the yeast host Pichia pastoris genome.
11. The process as claimed in Claim 7, wherein the recombinant lipase genes having SEQ ID No: 1-3 are used for preparing Construct 1-4.
12. The process as claimed in Claim 7, wherein the yeast host Pichia pastoris is selected from Pichia pastoris GS115 and Pichia pastoris X-33.
13. The process as claimed in Claim 8, wherein the expression vector is selected from a group comprising pPICZa, pGAPZaA, and pPIC9K.
14. The process as claimed in Claim 7, wherein the restriction enzymes include but is not limited to SacI and SalI.
15. The process as claimed in Claim 7, wherein the restriction sites are selected from AOX1- SacI Restriction site and His4- Sal I Restriction site.
16. The process as claimed in Claim 7, wherein the fermentation media optimized for said expression systems includes but is not limited to BSM media and FM-22 media.
17. The process as claimed in Claim 7, wherein the lipase enzymes are purified using filtration and centrifugation techniques.
18. The lipase enzyme, as claimed in Claim 1, for use in the synthesis of oleo intermediates and products from oil and fats hydrolysis, biodiesel, rubber, cosmetic intermediates, for hydrolysis, esterification, and transesterification reactions, and synthesis of fatty acid esters selected from Ricinoleic acid, Erucic acid, and Linolenic acid.
19. A composition comprising the lipase enzyme of claim 1 along with acceptable excipients.
20. A method of increasing the enzyme activity comprising using the lipase enzyme of any of the preceding claims.
DESC:FIELD OF INVENTION:
[0001] The present invention generally relates to a lipase enzyme developed by expressing recombinant lipase genes at two different loci in yeast host Pichia pastoris. More particularly, the present invention relates to a highly active lipase enzyme suitable for applications, including the synthesis of oleo intermediates, biodiesel, hydrolysis, esterification, and transesterification reactions.
BACKGROUND OF THE INVENTION:
[0002] Lipases (triglycerol ester hydrolases—EC 3.1.1.3) are enzymes that catalyze the degradation of fats and oils, releasing fatty acids, diacylglycerols, monoacylglycerols, and glycerol. They work very well in a variety of processes, including the esterification, transesterification, and interesterification of organic solvents. Lipase even plays a crucial role in lipid metabolism in mammalian, plant tissues, and even in microbes. Although pancreatic lipases are frequently the most researched, industrial researchers are increasingly concentrating on lipases of microbial origin since they enable large-scale synthesis.
[0003] Free enzymes, which are enzymes in their natural state, have been employed for centuries in the food business and more recently in the chemical and pharmaceutical sectors. These enzymes can now be produced in vast quantities and can alter their primary structures using modern genetic engineering techniques in order to change some of their Physico-chemical and biological properties. These enzymes can even be produced on a large scale and can customize for particular uses through DNA Manipulation.
[0004] At present, lipases account for about 5% of the world market for enzymes; however, there is a strong growth trend owing to their vast field of application. Because of their exceptional adaptability in terms of thermal stability, resistance to organic solvents, specificity, regioselectivity, and stereoselectivity, these enzymes are gaining a sizable share of the global market for industrial enzymes.
[0005] The primary biological role of lipases is the catalysis of triglyceride hydrolysis to create fatty acids and glycerol. Most lipases may, however, exercise their catalytic activity in alcoholysis and transesterification reactions when there is little water present in the media. These processes are of enormous interest to the petroleum industry because they can produce biolubricants and biodiesel.
[0006] Recombinant enzyme protein production by homologous expression with increasing copy number or stronger promoter to drive lipase gene may not meet the technical requirements for scale up for high protein production, fast growth, or optimal physiological conditions in bioreactor so the heterologous expression of lipase gene in the suitable microbial host is better option to exploit lipase diversity.
[0007] Technically heterologous expression systems comprise three steps: (i) cloning of the gene of interest in a vector having a selection marker, (ii) transformation of the host strain with the constructed plasmid, and (iii) expression of the gene of interest under the control of an inducible or constitutive promoter and a known terminator. The predominant hosts used for recombinant lipase production are Escherichia coli and Komagataella phaffi (previously known as Pichia pastoris) have enabled the transformation of desired lipase gene on an industrial scale for enzyme production although Aspergillus, Trichoderma, and Bacillus have been explored by many. Techniques, such as site-directed mutagenesis based on rational design, different mutants can be constructed showing improved thermal stability, tolerance against organic solvents, and optimized selectivity.
[0008] As a noticeable thermostable enzyme, the lipase from Thermomyces lanuginosus (TLL) (formerly called Humicola lanuginosa), and Candida antarctica lipase B as an industrial biocatalyst in both soluble and immobilized forms are being used in many different industrial areas including the modification of oils and fats, biodiesel production, organic chemistry, environmental applications, detergents, and the cosmetic industry to name a few. All of these practical applications require large quantities of enzymes.
[0009] US Patent Publication No: 20040101928 relates to isolated novel genes with high homology to the T. lanuginosus lipase gene and are thus well suited for use in gene shuffling. The invention further provides a method of generating genetic diversity into lipolytic enzymes by the family shuffling of two or more homologous genes which encode lipolytic enzymes.
[0010] US Patent No: 9394530 relates to a method for obtaining a lipase variant, comprising introducing into a parent lipase a substitution at one or more positions corresponding to positions T37, N39, or G91 of the mature polypeptide of SEQ ID NO: 2. The variant has lipase activity and in comparison with the parent lipase has improved performance in the presence of an organic catalyst.
[0011] US Patent No: 9163203 relates to a variant of a lipase enzyme having improved in-detergent stability and polynucleotides encoding the same. Lipolytic enzyme variants with improved in-detergent stability are obtained by substituting certain specified amino acid residues in a parent lipolytic enzyme.
[0012] US Patent No: 9909109 relates to a variant of a lipase enzyme, comprising a substitution at one or more positions corresponding to positions 86, 87, 90, and/or 92, especially substitutions to D, E, Q, N, or C, and specifically substitutions 186D, E, N, Q, E87C, 190D, E, Q, and N92D, E, Q of the mature polypeptide of SEQ ID NO: 2, wherein the variant has lipase activity.
[0013] US Patent No: 10669511 relates discloses a variant of a parent lipase, which variant comprises substitutions at the positions corresponding to E1C and N233C of the mature polypeptide of SEQ ID NO: 2, has lipase activity, and has at least 60% but less than 100% sequence identity to the mature polypeptide of SEQ ID NO: 2.
[0014] On analyzing the literature pertaining to lipase enzyme, there appears need in the art to provide a method of improving the enzymatic activity and enzymatic expression levels to multiple folds to obtain lipase products to cater to diverse industrial applications, thus replacing the existing conventional process with the green enzymatic process leading to the reduced carbon footprint.
OBJECT OF INVENTION:
[0015] Accordingly, the main objective of the present invention is to provide lipase enzymes with enhanced activity titers by expressing recombinant lipase genes at two different loci in a yeast host.
[0016] Another object of the present invention is to provide a lipase enzyme suitable for applications, including the synthesis of oleo intermediates, and biodiesel, for hydrolysis, esterification, and transesterification reactions.
SUMMARY OF THE INVENTION
[0017] Accordingly, the present invention discloses lipase enzymes with enhanced activity titer by expressing a recombinant lipase gene at two different loci in a yeast host.
[0018] Accordingly, the present invention provides a lipase enzyme with enhanced enzymatic activity titre having a recombinant lipase gene represented by SEQ ID No: 1, SEQ ID No: 2 and SEQ ID No: 3 and expressed at the dual locus of yeast host Pichia pastoris.
[0019] The said lipase enzyme of the present invention provides a 2-4 fold enzymatic activity titer compared to a single locus expression of the same enzyme.
[0020] Accordingly, the present invention provides a lipase enzyme produced by expressing a recombinant lipase gene sequence selected from Seq ID No: 1, 2, and 3 at the dual locus of yeast host Pichia pastoris to achieve a 2-4 fold enzymatic activity titer compared to a single locus expression of the same enzyme.
[0021] In an embodiment of the present invention, the method of producing lipase in yeast host Pichia pastoris comprises the steps of optimizing a lipase gene to generate a recombinant lipase gene for yeast expression, inserting said recombinant lipase gene into an expression vector; transforming yeast with the recombinant lipase gene expression vector using a restriction enzyme in dual locus; and culturing the transformed yeast in a fermentation media to express recombinant lipase, wherein the culturing results in the
2-4 fold higher expression of recombinant lipase activity per liter of culture media.
[0022] In another embodiment of the present invention, the lipases genes are selected from lipase genes of Thermomyces lanuginosus, or Candida antarctica Lipase B (CALB) gene or co-expression of both the gene but not limited to wild type or mutant variants of the same.
[0023] In still another embodiment of the present invention, the Pichia pastoris host is selected from Pichia pastoris GS115 and Pichia pastoris X-33.
[0024] In yet another embodiment of the present invention, the vectors are selected from a group comprising pPICZa, pGAPZaA, and pPIC9K.
[0025] In still another embodiment of the present invention, the restriction enzyme used includes but is not limited to SacI and SalI.
[0026] In yet another embodiment of the present invention, the recombinant lipase genes are expressed in locus site AOX1 and His4 in the respective host genome.
[0027] In an embodiment of the present invention, the lipase enzymes are purified using filtration and centrifugation techniques to achieve desired purity and specific activity.
[0028] In an embodiment of the present invention, the lipase enzymes are suitable for applications, including the synthesis of oleo intermediates, and biodiesel, for hydrolysis, esterification, and transesterification reactions.
DESCRIPTION OF FIGURES:
Figure 1: Depicts Confirmation of gene by colony PCR
Figure 2: Depicts Single locus colony showing clearance on tributyrin agar
Figure 3 a and 3 b: Depicts Double locus colony showing clearance on tributyrin agar
Figure 4: Depicts activity profile of transformants with SEQ ID No: 1
Figure 5: Depicts activity profile of transformants with SEQ ID No: 2
Figure 6: Depicts activity profile of transformants with SEQ ID No: 3
SOURCE OF BIOLOGICAL ORGANISMS:-
[0029] The biological organisms including Pichia pastoris, Thermomyces lanuginosus, and Candida Antarctica are not of Indian Origin.
DETAILED DESCRIPTION OF THE INVENTION:
[0030] While the invention has been disclosed with reference to certain embodiments, it will be understood by those skilled in the art that various changes may be made and equivalents may be substituted without departing from the scope of the invention. In addition, many modifications may be made to adapt to a particular situation or material to the teachings of the invention without departing from its scope.
[0031] Throughout the specification and claims, the following terms take the meanings explicitly associated herein unless the context clearly dictates otherwise. The meaning of "a", "an", and "the" include plural references. The meaning of "in" includes "in" and "on." Referring to the drawings, like numbers indicate like parts throughout the views. Additionally, a reference to the singular includes a reference to the plural unless otherwise stated or inconsistent with the disclosure herein.
[0032] Accordingly, to accomplish the objectives of the present invention, the inventors propose lipase enzymes with enhanced activity titer by expressing a recombinant lipase gene at two different loci in a yeast host.
[0033] In an embodiment, the present invention provides a lipase enzyme with improved enzymatic activity titer having a recombinant lipase gene represented by SEQ ID No: 1, SEQ ID No: 2 and SEQ ID No: 3 and expressed at the dual locus of yeast host Pichia pastoris.
[0034] The said lipase enzyme of the present invention provides a 2-4 fold enzymatic activity titer compared to a single locus expression of the same enzyme.
[0035] In an embodiment of the present invention, the lipase enzyme is produced by expressing a recombinant lipase gene at the dual locus of yeast host Pichia pastoris to achieve a 2-4 fold enzymatic activity titre compared to a single locus expression of the same enzyme.
[0036] In another embodiment, the recombinant lipase genes are expressed in locus site AOX1 and His4 in the Pichia pastoris genome.
[0037] In yet another embodiment, the yeast host Pichia pastoris is selected from Pichia pastoris GS115 and Pichia pastoris X-33.
[0038] In a further embodiment, the expression vector is selected from a group comprising pPICZa, pGAPZaA, and pPIC9K.
[0039] In another embodiment, the restriction enzymes include but are not limited to SacI and SalI.
[0040] In yet another embodiment, the restriction sites are selected from AOX1- SacI Restriction site and His4- Sal I Restriction site.
[0041] In another embodiment of the present invention, the method of producing lipase in yeast host Pichia pastoris comprises the steps of optimizing a lipase gene to generate a recombinant lipase gene for yeast expression, inserting said recombinant lipase gene into an expression vector; transforming yeast with the recombinant lipase gene expression vector using a restriction enzyme in dual locus; and culturing the transformed yeast in a fermentation media to express recombinant lipase, wherein the culturing results in the 2-4 fold higher expression of recombinant lipase activity per liter of culture media.
[0042] In yet another embodiment of the present invention, the recombinant lipase genes are expressed in locus site AOX1 and His4 in the respective host genome.
[0043] In still another embodiment of the present invention, the lipase gene is selected from lipase genes of Thermomyces lanuginosus, or Candida antarctica Lipase B (CALB) gene or co-expression of both the gene but not limited to wild type or mutant variants of the same.
[0044] In yet another embodiment of the present invention, the lipase genes are represented from Sequence ID No: 1-3.
[0045] In an embodiment of the present invention, SEQ ID No:1 is
gaggtctcccaggacttgttcaatcagttcaacttgtttgcccaatactccgcagccgca
tactgtggtaaaaataatagagcccctgctggtactcaaattacttgtactggtaacgct
tgtccagaagttgagaaggctgatgctactttcttgtactctttcgaagattctggtgtt
ggagatgttactggtttcttggctttggataacactaataagttgatcgttttgtctttc
agaggttccagatctatcgaaaactggatcggtaacttgaacttcgatttgaaggagatt
aatgatatttgttgtggttgtagaggtcatgatggtttcacttcttcttggagatctgtt
gctgatactttgagacaaaaagttgaagatgctgttagagagcatcctgattacagagtt
gtttttactggtcactctttgggtggtgctttggctactgttgctggtgctgatttgcgt
ggtaacggttacgatattgatgttttctcttatggtgctccaagagttggtaatagagct
tttgctgaatttttgactgttcaaactggtggtactttgtacagaatcactcatactaac
gatattgttcctagattgccacctagagaatttggttactctcactcttctccagagtat
tggattaagtctggtactttggttcctgttactagaaacgatattgttaagatcgagggt
atcgatgctactggtggtaacaatcaacctaacatcccatctatccctgctcatttgtgg
tattttggtttgattggaacttgcttg
[0046] In another embodiment of the present invention, SEQ ID No: 2 is
ggatccaccatgaggagctcccttgtgctgttctttgtctctgcgtggacggccttggcc
agtcctattcgtcgagaggtctcgcaggatctgtttaaccagttcaatctctttgcacag
tattctgcagccgcatactgcggaaaaaacaatgatgccccagctggtacaaacattacg
tgcacgggaaatgcctgccccgaggtagagaaggcggatgcaacgtttctctactcgttt
gaagactctggagtgggcgatgtcaccggcttccttgctctcgacaacacgaacaaattg
atcgtcctctctttccgtggctctcgttccatagagaactggatcgggaatcttaacttc
gacttgaaagaaataaatgacatttgctccggctgcaggggacatgacggcttcacttcg
tcctggaggtctgtagccgatacgttaaggcagaaggtggaggatgctgtgagggagcat
cccgactatcgcgtggtgtttaccggacatagcttgggtggtgcattggcaactgttgcc
ggagcagacctgcgtggaaatgggtatgatatcgacgtgttttcatatggcgccccccga
gtcggaaacagggcttttgcagaattcctgaccgtacagaccggcggaacactctaccgc
attacccacaccaatgatattgtccctagactcccgccgcgcgaattcggttacagccat
tctagcccagagtactggatcaaatctggaacccttgtccccgtcacccgaaacgatatc
gtgaagatagaaggcatcgatgccaccggcggcaataaccagcctaacattccggatatc
cctgcgcacctatggtacttcgggttaattgggacatgtctttagtggccggcgcggctg
ggtcgactctagcgagctcgagatctaga
[0047] In still another embodiment of the present invention, SEQ ID No: 3 is
atgaagctactctctctgaccggtgtggctggtgtgcttgcgacttgcgttgcagccact
cctttggtgaagcgtctaccttccggttcggaccctgccttttcgcagcccaagtcggtg
ctcgatgcgggtctgacctgccagggtgcttcgccatcctcggtctccaaacccatcctt
ctcgtccccggaaccggcaccacaggtccacagtcgttcgactcgaactggatccccctc
tcaacgcagttgggttacacaccctgctggatctcacccccgccgttcatgctcaacgac
acccaggtcaacacggagtacatggtcaacgccatcaccgcgctctacgctggttcgggc
aacaacaagcttcccgtgcttacctggtcccagggtggtctggttgcacagtggggtctg
accttcttccccagtatcaggtccaaggtcgatcgacttatggcctttgcgcccgactac
aagggcaccgtcctcgccggccctctcgatgcactcgcggttagtgcaccctccgtatgg
cagcaaaccaccggttcggcactcaccaccgcactccgaaacgcaggtggtctgacccag
atcgtgcccaccaccaacctctactcggcgaccgacgagatcgttcagcctcaggtgtcc
aactcgccactcgactcatcctacctcttcaacggaaagaacgtccaggcacaggccgtg
tgtgggccgctgttcgtcatcgaccatgcaggctcgctcacctcgcagttctcctacgtc
gtcggtcgatccgccctgcgctccaccacgggccaggctcgtagtgcagactatggcatt
acggactgcaaccctcttcccgccaatgatctgactcccgagcaaaaggtcgccgcggct
gcgctcctggcgccggcagctgcagccatcgtggcgggtccaaagcagaactgcgagccc
gacctcatgccctacgcccgcccctttgcagtaggcaaaaggacctgctccggcatcgtc
accccctga
[0048] In an embodiment of the present invention, the SEQ ID No: 1-3 is used for preparing Construct 1-4.
[0049] In an embodiment of the present invention, the yeast Pichia pastoris host is selected from Pichia pastoris GS115 and Pichia pastoris X-33.
[0050] In another embodiment of the present invention, the expression vector is selected from a group comprising pPICZa, pGAPZaA, and pPIC9K.
[0051] In still another embodiment of the present invention, the restriction enzyme used includes but is not limited to SacI and SalI.
[0052] In another embodiment of the present invention, the restriction site for expressing recombinant lipase genes in Pichia pastoris are selected from AOX1- SacI Restriction site and His4- Sal I Restriction site.
[0053] In still another embodiment of the present invention, the fermentation media optimized for said expression systems includes but is not limited to BSM media and FM-22 media.
[0054] In another embodiment of the present invention, the lipase enzymes are purified using filtration and centrifugation techniques to achieve desired purity and specific activity.
[0055] In another embodiment of the present invention, the cultured lipase enzymes result in the 2-4 fold expression of recombinant lipase activity per litre of culture media compared to expressed enzyme from single locus.
[0056] In a preferred embodiment of the present invention, the cultured lipase enzymes result in the expression of above 900 U/ mg recombinant lipase activity per litre of culture media.
[0057] In another embodiment, the present invention provides a composition comprising the lipase enzyme along with acceptable excipients.
[0058] In another embodiment, the present invention provides a method of increasing the enzyme activity comprising using the lipase enzyme of the present invention.
[0059] In another embodiment of the present invention, the lipase enzymes are suitable for applications, including the synthesis of oleo intermediates, and biodiesel, for hydrolysis, esterification, and transesterification reactions.
[0060] In still another embodiment of the present invention, the lipase enzymes can be further used to synthesize products from oil and fats hydrolysis, fatty acid esters, biodiesel, rubber, and cosmetic intermediates.
[0061] In yet another embodiment of the present invention, the lipase enzymes can be further used in a range of fatty acid synthesis more specifically Ricinoleic acid, Erucic acid, and Linolenic acid.
EXAMPLES
[0062] The following examples, which include preferred embodiments, will serve to illustrate the practice of this invention, it being understood that the particulars shown are by way of example and for purpose of illustrative discussion of preferred embodiments of the invention.
[0063] Example 1: Preparation of Construct-1:
[0064] The plasmids pPICZa-SQ.ID-01 was linearized by SacI and transformed into Pichia pastoris by electroporation with a Gene Pulser apparatus (Biorad). According to the manufacturer’s protocol, the parameters were 2000 V, 200 O, and 25 µF, using a 0.2 cm cuvette (Biorad). Transformants were selected on YPD plates with Zeocin (300µg/mL concentration) after incubation for 2–3 days at 30°C, then further screened using YPD plates containing various concentrations of Zeocin (0.5–4.0 mg/mL) to get transformants with high copy number.
[0065] Example 2: Preparation of Construct-2:
[0066] The plasmids pGAPZaA- SQ.ID-01 was linearized by SacI and transformed into Pichia pastoris by electroporation with a Gene Pulser apparatus (Biorad). According to the manufacturer’s protocol, the parameters were 2000 V, 200 O, and 25 µF, using a 0.2 cm cuvette (Biorad). Transformants were selected on YPD plates with Zeocin (300µg/mL concentration) after incubation for 2–3 days at 30°C, then further screened using YPD plates containing various concentrations of Zeocin (0.5–4.0 mg/mL) to get transformants with high copy number.
[0067] Example 3: Preparation of Construct-3:
[0068] The plasmids pPIC9K-SQ.ID-01 was linearized by SalI and transformed into Transformant of construct-1 by electroporation with a Gene Pulser apparatus (Biorad). According to the manufacturer’s protocol, the parameters were 2000 V, 200 O, and 25 µF, using a 0.2 cm cuvette (Biorad). Transformants were selected on MD plates after incubation for 2–3 days at 30°C, then further screened using YPD plates containing various concentrations of Geneticin G418 (0.5–4.0 mg/mL). The next level of screening for the selection of transformants with both pPICZa-TLL-FBL and pPIC9K-TLL-FBL was done on YPD plates with both Zeocin & Geneticin (G418).
[0069] Example 4: Preparation of Construct-4:
[0070] The plasmids pPIC9K-SQ.ID-01 was linearized by SalI and transformed into Transformant of construct-2 by electroporation with a Gene Pulser apparatus (Biorad). According to the manufacturer’s protocol, the parameters were 2000 V, 200 O, and 25 µF, using a 0.2 cm cuvette (Biorad). His+ Transformants were selected on MD plates after incubation for 2–3 days at 30°C, then further screened using YPD plates containing various concentrations of Geneticin G418 (0.5–4.0 mg/mL). The next level of screening for the selection of transformants with both pGAPZa- TLL-FBL and pPIC9K-TLL-FBL was done on YPD plates with both Zeocin & Geneticin G418.
[0071] Example 5: Shake flask Screening:
[0072] Positive colonies from antibiotic-resistant plates were grown in YPD broth and Glycerol stock was prepared. Growth parameters for the shake flask study were 28°C and 150 rpm. Methanol induction was done at 25°C.
[0073] Shake flask LG – YPD 50 mL inoculated with glycerol stock of the transformants. Further 250mL BMGY media was inoculated with 5 mL inoculum from YPD-LG after an OD (600nm) of 20-30 is achieved in BMGY. Under sterile conditions, cells were pelleted and resuspended in 100 mL BMMY media to achieve an OD (600nm) of 55-75. Methanol induction did from a range of 0.5-3%.
[0074] Result: The resultant enzyme obtained on shake flask of 1litre and pilot scale of 75 litre with enhanced titre ranging from 2-4 fold increase in activity titre compared to enzyme obtained from single locus expression.
[0075] Example 6: Lipase activity assay:
[0076] Lipase activity was determined using the Hydrolysis of Tributyrin at 40°C using Potentiometric Titrator by 0.1 NaOH solutions.10% V/V of Glycerol tribytyrate (Tributyrin) in 0.1 M Sodium phosphate buffer pH 7.5, at 40°C was hydrolysed by lipase to form butyric acid which was titrated against 0.1 M Sodium hydroxide. Lipase activity is defined as: One TBU enzyme unit corresponds to amount of enzyme catalyzing the formation of 1 µmole of butyric acid at 40 °C, pH 7.5 at 10% (v/v) Tributyrin concentration per minute per mL enzyme in the milieu of 100 mM Sodium phosphate Buffer.
[0077] Result: The volumetric quantity of purified enzyme is 2-4 times compared to single locus.
[0078] The Constructs comprising SEQ ID No: 2 and SEQ ID No: 3 were prepared by the process as disclosed in the Examples 1 to 6 given above.
[0079] Example 7: Lipase Gene expression:
[0080] Lipase Gene expression was checked using Colony PCR. Selected colony from antibiotic resistant plate was suspended in to the 20 µl of Colony PCR Lysis Buffer (Tris-EDTA buffer with 0.1% Triton-X100) and boiled for 20 minute in a water bath followed by centrifugation at 13000 rpm for 10 minutes. 0.5 µl of the supernatant was used as a template DNA for the PCR. Positive and negative controls were also performed in every colony PCR set.
[0081] Intensity of DNA band on 0.8% agarose gel was preliminary selection for the high copy number transformants. Secondary line of selection was on Tributyrin agar plate. 1% Glycerol tributyrate was added to the Tributyrin agar base (Make: Himedia) and autoclaved.
[0082] Tributyrin agar plates were prepared and used for patching the selected colonies. The plates were incubated in inverted position at 28°C for 18-24 Hrs. On inverted lid 150-200 µl methanol was added and exposed the grown colony to induce enzyme production. After 24 hours of further incubation, zones of clearance could be seen. Bigger the zone of clearance was directly proportional to the high enzyme titre.
[0083] Result: The results of Colony PCR are depicted in Figure 1. Single locus colony showing clearance on tributyrin agar are depicted in Figure 2. Double locus colony showing clearance on tributyrin agar are depicted in Figure 3a and 3b. .
[0084] Example 8 : Activity profile of transformants:
[0085] Results: The activity profiles of transformants having SEQ ID No. 1, 2 and 3 are depicted in Figures 4, 5 and 6 respectively.
SEQUENCE LISTING
1 Sequence Listing Information
1-1 File Name ENHANCED EXPRESSION OF LIPASES USING DUAL LOCUS STRATEGY IN PICHIA PASTORIS.xml
1-2 DTD Version V1_3
1-3 Software Name WIPO Sequence
1-4 Software Version 2.3.0
1-5 Production Date 2023-09-22
1-6 Original free text language code
1-7 Non English free text language code
2 General
Information
2-1 Current application: IP Office IN
2-2 Current application: Application number 202221056928
2-3 Current application: Filing date 2022-10-04
Current application: 000101
2-4 Applicant file reference Fermenta Biotech 001
Earliest priority application: IP
2-5 Office IN
Earliest priority application:
2-6 Application number 202221056928
Earliest priority application:
2-7 Filing date 2022-10-04
2-
8en Applicant name Fermenta Biotech
2-8 Applicant name: Name Latin
2-9 Inventor name
2-9 Inventor name: Name Latin
2-
10en Invention title ENHANCED EXPRESSION OF LIPASES USING DUAL LOCUS STRATEGY IN PICHIA PASTORIS
2-11 Sequence Total Quantity 3
3-1 Sequences
3-1-
1 Sequence Number [ID] 1
3-1-
2 Molecule Type DNA
3-1-
3 Length 807
3-1- Features source 1..807
4-1 Location/Qualifiers mol_type= other DNA
organism= synthetic construct
NonEnglishQualifier Value
gaggtctccc aggacttgtt caatcagttc aacttgtttg cccaatactc cgcagccgca 60
tactgtggta aaaataatag agcccctgct ggtactcaaa ttacttgtac tggtaacgct 120
tgtccagaag ttgagaaggc tgatgctact ttcttgtact ctttcgaaga ttctggtgtt 180
ggagatgtta ctggtttctt ggctttggat aacactaata agttgatcgt tttgtctttc 240
agaggttcca gatctatcga aaactggatc ggtaacttga acttcgattt gaaggagatt 300
aatgatattt gttgtggttg tagaggtcat gatggtttca cttcttcttg gagatctgtt 360
3-1-
5 Residues gctgatactt tgagacaaaa agttgaagat
gtttttactg gtcactcttt gggtggtgct gctgttagag
ttggctactg agcatcctga
ttgctggtgc ttacagagtt
tgatttgcgt 420
480
ggtaacggtt acgatattga tgttttctct tatggtgctc caagagttgg taatagagct 540
tttgctgaat ttttgactgt tcaaactggt ggtactttgt acagaatcac tcatactaac 600
gatattgttc ctagattgcc acctagagaa tttggttact ctcactcttc tccagagtat 660
tggattaagt ctggtacttt ggttcctgtt actagaaacg atattgttaa gatcgagggt 720
atcgatgcta ctggtggtaa caatcaacct aacatcccat ctatccctgc tcatttgtgg 780
tattttggtt tgattggaac ttgcttg 807
3-2 Sequences
3-2-
1 Sequence Number [ID] 2
3-2-
2 Molecule Type DNA
3-2-
3 Length 929
3-2-
4-1 Features Location/Qualifiers source 1..929
mol_type= genomic DNA
organism= Thermomyces lanuginosus
NonEnglishQualifier
Value
ggatccacca tgaggagctc ccttgtgctg ttctttgtct ctgcgtggac ggccttggcc 60
agtcctattc gtcgagaggt ctcgcaggat ctgtttaacc agttcaatct ctttgcacag 120
tattctgcag ccgcatactg cggaaaaaac aatgatgccc cagctggtac aaacattacg 180
tgcacgggaa atgcctgccc cgaggtagag aaggcggatg caacgtttct ctactcgttt 240
gaagactctg gagtgggcga tgtcaccggc ttccttgctc tcgacaacac gaacaaattg 300
atcgtcctct ctttccgtgg ctctcgttcc atagagaact ggatcgggaa tcttaacttc 360
gacttgaaag aaataaatga catttgctcc ggctgcaggg gacatgacgg cttcacttcg 420
3-2-
5 Residues tcctggaggt ctgtagccga tacgttaagg
cccgactatc gcgtggtgtt taccggacat cagaaggtgg
agcttgggtg aggatgctgt
gtgcattggc gagggagcat
aactgttgcc 480
540
ggagcagacc tgcgtggaaa tgggtatgat atcgacgtgt tttcatatgg cgccccccga 600
gtcggaaaca gggcttttgc agaattcctg accgtacaga ccggcggaac actctaccgc 660
attacccaca ccaatgatat tgtccctaga ctcccgccgc gcgaattcgg ttacagccat 720
tctagcccag agtactggat caaatctgga acccttgtcc ccgtcacccg aaacgatatc 780
gtgaagatag aaggcatcga tgccaccggc ggcaataacc agcctaacat tccggatatc 840
cctgcgcacc tatggtactt cgggttaatt gggacatgtc tttagtggcc ggcgcggctg 900
ggtcgactct agcgagctcg agatctaga 929
3-3 Sequences
3-3-
1 Sequence Number [ID] 3
3-3-
2 Molecule Type DNA
3-3-
3 Length 1029
3-3-
4-1 Features Location/Qualifiers source 1..1029 mol_type= genomic DNA
organism= Candida antarctica
NonEnglishQualifier
Value
3-3- Residues atgaagctac tctctctgac cggtgtggct ggtgtgcttg cgacttgcgt tgcagccact 60
5 cctttggtga agcgtctacc ttccggttcg gaccctgcct tttcgcagcc caagtcggtg 120
ctcgatgcgg gtctgacctg ccagggtgct tcgccatcct cggtctccaa acccatcctt 180
ctcgtccccg gaaccggcac cacaggtcca cagtcgttcg actcgaactg gatccccctc 240
tcaacgcagt tgggttacac accctgctgg atctcacccc cgccgttcat gctcaacgac 300
acccaggtca acacggagta catggtcaac gccatcaccg cgctctacgc tggttcgggc 360
aacaacaagc ttcccgtgct tacctggtcc cagggtggtc tggttgcaca gtggggtctg 420
accttcttcc ccagtatcag gtccaaggtc gatcgactta tggcctttgc gcccgactac 480
aagggcaccg tcctcgccgg ccctctcgat gcactcgcgg ttagtgcacc ctccgtatgg 540
cagcaaacca ccggttcggc actcaccacc gcactccgaa acgcaggtgg tctgacccag 600
atcgtgccca ccaccaacct ctactcggcg accgacgaga tcgttcagcc tcaggtgtcc 660
aactcgccac tcgactcatc ctacctcttc aacggaaaga acgtccaggc acaggccgtg 720
tgtgggccgc tgttcgtcat cgaccatgca ggctcgctca cctcgcagtt ctcctacgtc 780
gtcggtcgat ccgccctgcg ctccaccacg ggccaggctc gtagtgcaga ctatggcatt 840
acggactgca accctcttcc cgccaatgat ctgactcccg agcaaaaggt cgccgcggct 900
gcgctcctgg cgccggcagc tgcagccatc gtggcgggtc caaagcagaa ctgcgagccc 960
gacctcatgc
accccctga cctacgcccg cccctttgca gtaggcaaaa ggacctgctc cggcatcgtc 1020
1029
,CLAIMS:
1. A lipase enzyme with enhanced enzymatic activity titre having recombinant lipase gene represented by SEQ ID No: 1, SEQ ID No: 2 and SEQ ID No: 3 and expressed at the dual locus of yeast host Pichia pastoris.
2. The lipase enzyme as claimed in Claim 1, wherein the recombinant lipase genes are expressed in locus site AOX1 and His4 in the Pichia pastoris genome.
3. The lipase enzyme as claimed in Claim 1, wherein the yeast host Pichia pastoris is selected from Pichia pastoris GS115 and Pichia pastoris X-33.
4. The lipase enzyme as claimed in Claim 1, wherein the expression vector is selected from a group comprising pPICZa, pGAPZaA, and pPIC9K.
5. The lipase enzyme as claimed in Claim 1, wherein the restriction enzymes include but is not limited to SacI and SalI.
6. The lipase enzyme as claimed in Claim 1, wherein the restriction sites are selected from AOX1- SacI Restriction site and His4- Sal I Restriction site.
7. A process of producing lipase enzyme with enhanced activity titer by expressing a recombinant lipase gene at two different loci of yeast host Pichia pastoris comprising;
i. optimizing a lipase gene to generate a recombinant lipase gene for yeast expression;
ii. inserting said recombinant lipase gene into an expression vector;
iii. transforming yeast host Pichia pastoris with the recombinant lipase gene expression vector using a restriction enzyme in dual locus; and
iv. culturing the transformed yeast in a fermentation media to express recombinant lipase,
wherein the culturing results in the 2-4 fold higher expression of recombinant lipase activity per liter of culture media.
8. The process as claimed in Claim 7, wherein the lipase gene is selected from the group comprising lipase genes of Thermomyces lanuginosus, or Candida antarctica Lipase B (CALB) gene or co-expression of both the gene but not limited to wild type or mutant variants of the same.
9. The process as claimed in Claim 7, wherein recombinant lipase gene is represented by SEQ ID No: 1, SEQ ID No: 2 and SEQ ID No: 3.
10. The process as claimed in Claim 7, wherein the recombinant lipase genes are expressed in locus site AOX1 and His4 in the yeast host Pichia pastoris genome.
11. The process as claimed in Claim 7, wherein the recombinant lipase genes having SEQ ID No: 1-3 are used for preparing Construct 1-4.
12. The process as claimed in Claim 7, wherein the yeast host Pichia pastoris is selected from Pichia pastoris GS115 and Pichia pastoris X-33.
13. The process as claimed in Claim 8, wherein the expression vector is selected from a group comprising pPICZa, pGAPZaA, and pPIC9K.
14. The process as claimed in Claim 7, wherein the restriction enzymes include but is not limited to SacI and SalI.
15. The process as claimed in Claim 7, wherein the restriction sites are selected from AOX1- SacI Restriction site and His4- Sal I Restriction site.
16. The process as claimed in Claim 7, wherein the fermentation media optimized for said expression systems includes but is not limited to BSM media and FM-22 media.
17. The process as claimed in Claim 7, wherein the lipase enzymes are purified using filtration and centrifugation techniques.
18. The lipase enzyme, as claimed in Claim 1, for use in the synthesis of oleo intermediates and products from oil and fats hydrolysis, biodiesel, rubber, cosmetic intermediates, for hydrolysis, esterification, and transesterification reactions, and synthesis of fatty acid esters selected from Ricinoleic acid, Erucic acid, and Linolenic acid.
19. A composition comprising the lipase enzyme of claim 1 along with acceptable excipients.
20. A method of increasing the enzyme activity comprising using the lipase enzyme of any of the preceding claims.
| # | Name | Date |
|---|---|---|
| 1 | 202221056928-STATEMENT OF UNDERTAKING (FORM 3) [04-10-2022(online)].pdf | 2022-10-04 |
| 3 | 202221056928-Sequence Listing in PDF [04-10-2022(online)].pdf | 2022-10-04 |
| 4 | 202221056928-PROVISIONAL SPECIFICATION [04-10-2022(online)].pdf | 2022-10-04 |
| 5 | 202221056928-FORM 1 [04-10-2022(online)].pdf | 2022-10-04 |
| 6 | 202221056928-Proof of Right [09-11-2022(online)].pdf | 2022-11-09 |
| 8 | 202221056928-Sequence Listing in txt [30-09-2023(online)].txt | 2023-09-30 |
| 9 | 202221056928-Sequence Listing in PDF [30-09-2023(online)].pdf | 2023-09-30 |
| 10 | 202221056928-ENDORSEMENT BY INVENTORS [30-09-2023(online)].pdf | 2023-09-30 |
| 11 | 202221056928-DRAWING [30-09-2023(online)].pdf | 2023-09-30 |
| 12 | 202221056928-COMPLETE SPECIFICATION [30-09-2023(online)].pdf | 2023-09-30 |
| 13 | 202221056928-FORM-26 [19-02-2024(online)].pdf | 2024-02-19 |
| 14 | 202221056928-FORM 18 [05-12-2024(online)].pdf | 2024-12-05 |