Abstract: A thermophilic microorganism lacks lactate dehydrogenase activity and preferably contains an active pyruvate formate lyase pathway. The thermophilic microorganism contains a gene encoding an NAD-linked formate dehydrogenase. The gene encoding an NAD-linked formate dehydrogenase is preferably a codon optimised version of the gene encoding a thermostable NAD-linked formate dehydrogenase. DNA constructs allow stable expression of the gene encoding an NAD-linked formate dehydrogenase in the thermophilic microorganism. The DNA constructs are based upon use of an insertion sequence to achieve stable expression or recombination to insert the gene encoding an NAD-linked formate dehydrogenase into the lactate dehydrogenase gene, thus achieving gene ...
This invention relates to fermentation procedures and microorganisms for use uherein and in particular to the enhancement of microbial ethanol production. More specifically, the invention relates to enhanced ethanol production by thermophilic bacteria, such as Bacilli from mixed sugars derived from the hydrolysis of biomass. -In particular, the invention envisages a novel pathway for ethanol production by cloning a gene which encodes an NAD-linked formate dehydrogenase enzyme into a microorganism that possesses a functional gene which encodes a pyruvate-formate lyase enzyme complex but lacks lactate dehydrogenase activity.
Background to "the invention -
Bioethanol is currently made from glucose, maltose or sucrose derived from cereal starch, sugar cane or sugar beet, which all have fooc value. Celluloses and hemicelluloses form a major part of agricultural by-producos and could, in principle, be a major source of low-cost, renewable bio-ethanol. However, it is difficult and expensive to derive fermentable sugars from cellulose. In contrast, hemicelluloses are almost as abundant as cellulose and are easy to hydrolyse, but yield a mixture of mainly pentose sugars that yeasts cannot ferment.
For this reason, Hartley (see International Publication Number WO 88/09379) proposed production of ethanol by mutants of a thermophilic Bacillus, which very rapidly ferments all of the sugars derived from biomass, at
temperatures up to 7 C ° C . High ethanol yield is achieved only by stressed and moribund cells, however.
Many micro-organisms contain a pyruvate-formate lyase (PFL) pathway that converts pyruvate into acetyl CoA and formate (Figure 1A). Heterolactate fermentative microorganisms are one such class. these microorganisms first convert input sugars to pyruvate (generally by the EMP pathway of glycolysis), which then car. take many routes to produce lactate, formate, acetate, ethanol and CO2, in various proportions, depending on the growth conditions.
In fully aerobic cells, the pyruvate is normally metabolised to H2O and CO2 via the pyruvate dehydrogenase (PDH) pathway, tri-carboxylic acid cycle and the Electron Transport Chain. However, in many of these organisms, particularly thermophilic Bacilli, sugar uptake and glycolysis appear to be unregulated and lactate is a dominant product at high sugar concentrations, even under aerobic conditions. This suggests that the PDH flux nas then become saturated, and that the excess pyruvate is diverted into an overflow lactate dehydrogenase pathway. This is not used for growth but produces heat which causes the ambient temperature to rise and kills mesophilic competitors, as can be seen when fresh grass is put on a compost heap.
If the 1dh gene (encoding lactate dehydrogenase) is inactivated, as described for example in WO 02/29030, lactate production stops and the excess pyruvate is diverted mainly into the growth-linked PFL pathway, (Figure 1A) . However, at very high sugar concentrations and/or at acid pH, the PFL pathway flux declines and the excess pyruvate
then overflows into an anaerobic PDF. pathway, which yields only ethanol and CO2 (Figure 1 B). Therefore the preferred conditions to obtain high ethanol yields are those that reduce flux through the PFL pathway and increase flux via the PDF pathway (Hartley, B.s. and Shama, G. Proc. Roy. Soc. Lond. 321, 555-566 {1987}). Unfortunately, under such conditions the cells experience metabolic stress, with reduced ATP production,, and a potential imbalance in NAD/NADH and CoA/acetyl CoA ratios (Figure 1C) .
Various fermentation protocols have been proposed to try to avoid or minimize this problem such as that of Hartley, B.S. as discussed above (see International Publication Number WG 88/09379).
There are two classes of formate dehydrogenase. One (encoded by the fdhF gene) converts formate into CO2 + H2 and is typical of enterobacteriae such as E. coli. The other
(encoded by the fdhl gene converts formate + NAD into CO2 + NADH2 and is present in many facultative anaerobes. Berrios-Rivera et al (Metabolic Engineering 4, 217-212
(2002) replaced the fdhF gene in E. coli with a yeast fdhl gene and found that the reduced anaerobic products such as ethanol, lactate and succinate increased relative to oxidised products such as acetate. Building on this observation, San, K-Y. Berrios-Rivers, S.J. and Bennett, G.N. (see International Publication Number WO 2003/040690 ) proposed the introduction of an NAD-linked formate dehydrogenase gene as a general method to increase reducing power in cells involved in a broad range of bio¬transformations. Subsequently San, K-Y. Bennett, G.N. and Sanchez, A. (US Patent Application US 2005/0042736 Al)
proposed a specific application of this concept for production of succinate . These studies were carried out in T. Coll, an example of a mesophiie where sugar uptake is regulated. The purpose of these experiments was to increase intracellular NADE levels so as to provide enhanced reducing power for various bio-transformations.
The yeast formate dehydrogenase recommended by Sen. et al (200/-) is inactive at 6D'C, which is the minimal growth temperature for the thermophilic bacteria potentially of use in bioethanol production. The most thermostable formate dehydrogenases so far described is the Pseudomonas sp. 101 enzyme (A. Rojkova, A. Galkin, 1. Kulakova, A. Serov, P. Savitsky, V. Fedorchuk, V. Tishkov FEBS Letters, Volume 445, Issue 1, Pages 183-288, 1999": .
Summary of the invention
The present invention attempts to solve the problems of producing high yields of ethanol from biomass. In particular, herein described for the first time is a novel metabolic pathway which allows thermophilic microorganisms, especially bacteria such as Bacillus to produce maximal ethanol yields,
The invention relies upon microorganisms which lack lactate dehydrogenase activity and thus require an alternative route for re-oxidation of excess NADH produced by glycolysis. This is provided by introduction into the microorganism of a gene encoding an NAD-linked formate dehydrogenase, such as an fdh1 gene. In thermophilic microroganisms, and in contrast to mesophiles such as E. coll, sugar uptake is unregulated and this leads to accumulation of NADH in the
presence of high levels of sugars. This eventually leads to a metabolic collapse and so-callec "redox death" as shown schematically in figure 1C. Incorporation ir;tc the microorganism of a gene encodinc an NAD-linked formate dehydrogenase helps to prevent cell death at high sugar concentrations by leading to a decrease in NADH levels and an increase in NAD levels. This is partly by restoring flux through the pyruvate dehydrogenase (PDH) pathway but most importantly, inclusion of a gene encoding an NAD-linked formate dehydrogenase creates a novel pyruvate formate lyase (PFL)-NAD-linked formate dehydrogenase (FDH) pathway for ethanol production. Figure ID shows the potential for this PFL-FDH pathway to restore redox balance by converting all of the pyruvate produced by rapid glycolysis in the presence of high sugar levels to ethanol and CO2, especially under neutral pH conditions. Importantly, the pathway operates under conditions that are optimal for cell growth, leading tc rapid ethanol production and high yield, since the PFL pathway is the major growth-linked anaerobic pathway in thermophilic microorganisms.
Accordingly, in a first aspect the invention provides a microorganism, in particular a thermophilic microorganism, lacking lactate dehydrogenase (ldh) activity, characterised in that the microorganism, preferably a thermophilic microorganism contains a gene encoding an NAD-linked formate dehydrogenase (fdh) .
In one embodiment, the microorganism lacks lactate dehydrogenase activity by virtue of an appropriate gene deletion or other mutation which removes lactate dehydrogenase activity. Thus, preferably the Idh gene is
deleted or otherwise rendered non-functional. Methods of gene knock-out and deletion are well known in the art and preferred examples are described in detail herein. Moreover, known strains of bacteria lacking lactate dehydrogenase activity (such as TN-T? deposited under accession number NCIME 41075 and TN-TK deposited under accession number NCIME 41115} may be suitable for use in tne present invention.
The microorganism of the invention typically contains an active pyruvate formate lyase pathway. In particular, the microorganism preferably comprises a gene encoding a pyruvate formate lyase such as the pf1 gene. The microorganisms of the invention typically also contain an active pyruvate dehydrogenase (PDH} pathway.
In a preferred embodiment, tne gene encoding an NAD-linked formate dehydrogenase is integrated into the genome of the thermophilic microorganism. However, it is also possible for stable expression to be achieved without integration for example by introduction of a suitable plasmid. . One preferred method of integration is by recombination. The gene encoding an NAD-linkec formate dehydrogenase may be operably linked to any suitaole regulatory element to direct expression of the NAD-linked formate dehydrogenase. By "operably linked" is meant a functional linkage exists between the regulatory element and the gene encoding an NAD linked formate dehydrogenase. For example, the gene encoding an NAD-linked formate dehydrogenase may be linked to a suitable promoter which may be a constitutive or inducible promoter for example. "Promoter" is defined herein to include a region of DNA which is involved in the binding of RNA polymerase to initiate transcription.
Typically the promoter is a prokaryotic promoter and thus includes the appropriate -10 and -35 sequences, the consensus sequences of which are well defined in the art. The gene may also be operably linked to other appropriate regulatory sequences such as terminators for example. "Terminator" is defined as a nucleotide sequence which causes RNA polymerase to terminate transcription. In one embodiment, the gene encoding an NAD-linked formate dehydrogenase is expressed from its own promoter. In an alternative embodiment, the gene encoding an NAD-linked formate dehydrogenase is expressed from a promoter of the thermophilic microorganism due to integration in an appropriate location in the genome). Constructions can also be envisaged where expression of the gene encoding an NAD-linked formate dehydrogenase is driven by a foreign promoter. This may be done to achieve maximal expression levels or inducible expression for example. As an example, phage promoters such as T7 may be utilised in conjunction with a suitable phage polymerase (which may be provided in a separate or the same DNA construct).
In a particularly preferred embodiment, the gene encoding an NAD-linked formate dehydrogenase is operably linked to the appropriate regulatory regions of a gene encoding a lactate dehydrogenase, in particular the upstream regulatory regions. The regulatory region preferably comprises the promoter of a gene encoding a lactate dehydrogenase. The promoter may be defined to include as a minimum functional unit the appropriate -10 and -35 sequences. Thus, according to one preferred embodiment of the invention the gene encoding an NAD-linked formate dehydrogenase is inserted into the lactate dehydrogenase gene of the thermophilic
microorganism, thus inactivating the lactate dehydrogenase activity of the thermophilic microorganism. This embodiment is particularly preferred since both modifications required to produce e thermophilic microorganism of the invention are produced in the same step. Suitable constructs for achieving this are described in detail herein.
Ethanol production by thermophilic bacteria is advantageous since it can be carried out at high temperatures . Whilst thermophilic microorganisms nave lower ethanol tolerance than yeasts, ethanol may be continuously and conveniently removed from the high temperature fermentation by membrane and/or mild vacuum evaporation. In optimal anaerobic growth conditions, Bacillus strain LLD-R grows very rapidly at 7 0°C almost exclusively by the PFl-pathway (Hartley and Shama, 1982) . It can be envisaged that growth by the novel PF1-FDH pathway would be equally vigorous, but the maximum growth temperature would be limited by the thermostability of the NAD-linked formate dehydrogenase introduced into the thermophilic microorganism. Accordingly, in one preferred embodiment, the thermophilic microorganism of the invention incorporates a gene encoding a thermostable NAD-linked formate dehydrogenase and/or a gene whose nucleotide sequence has been codon optimised to facilitate expression by a thermophilic microorganism. Production of such a thermostable NAD-linked formate dehydrogenase is described in detail herein. In a specific embodiment, the gene encoding an NAD-linked formate dehydrogenase comprises, consists essentially of or consists of the nucleotide sequence set forth as SED ID NO: i. In a further embodiment, the thermophilic microorganism of the invention incorporates a codon optimised for expression in Bacillus,
ene encoding a thermostable NAD-linked formate dehydrogenase comprising, consisting essentially of or consisting of the nucleotiae sequence set forth as SEQ ID NO: 2 . This sequence includes, in addition to the basic thermostable NAD-linked dehydrogenase sequence, promoter and terminator regions and also Xbal sites to facilitate cloninc of the gene into a suitable DNA construct.
In a still further embodiment the gene encoding an NAD-linked formate dehydrogenase is the fdhl gene . The fdh1 gene may be derived from any suitable source and is preferably codon optimised for expression in the relevant thermophilic microorganism.
The thermophilic microorganism of the invention may be produced by transformation with any of the DNA constructs of the invention as described in further detail herein. Accordingly, the discussion provided there applies mutatis mutandis to this embodiment of the invention.
The thermophilic microorganism of the invention may be any suitable microorganism for production of ethanol from biomass. Preferably, the thermophilic microorganism is a heterolactate fermentative microorganism. More preferably the thermophilic microorganism is a thermophilic bacterium and is more preferably of the genus Bacillus and even more preferably Bacillus stearothermophilus. In one embodiment, the thermophilic microorganism of the invention is derived from the known strain LLD-R or LLD-15 (of Bacillus stearothermophllus) . In a further embodiment, the thermophilic microorganism is Geobacillus thermoglucosidasius.
The fermentation processes facilitated by the present invention preferably utilise a synthetic NAD-iinked formate dehydrogenase, designed to express a thermostable amino acid sequence due to use of the codon preferences of the appropriate thermophilic microorganism such as Bacillus strain LLD-R. The synthetic gene preferably contains engineered restriction sites to assist insertion into the lactate dehydrogenase gene. Thereby deletion of the LDK pathway and creation of the PFL-FDH pathway are achieved in a single operation. Accordingly, in a second aspect, the invention provides a thermostable NAD-iinked formate dehydrogenase. Preferably, the thermostable NAD-iinked formate dehydrogenase remains functional at or above a temperature of 60 "C. Preferably, the thermostable enzyme is encoded by a nucleotide sequence which has been codon optimised for expression in a thermophilic microorganism. The formate dehydrogenase may comprise, consist essentially of or consist of the amino acid sequence set forth as SEQ ID NO: 3 in one embodiment.
A specific thermostable NAD-iinked formate dehydrogenase has been designed based upon the amine acid sequence of the Pseudomonas sp 101 formate dehydrogenase (SEQ ID NO:3) and through use of optimised codons for Geobacillus zhermoglucosidasius as discussed in more detail in the detailed description below. The skilled person will appreciate that derivatives of this basic sequence will retain functionality. For example, conservative and semi-conservative substitutions may result in thermostable NAD-iinked formate dehydrogenases and these derivatives are intended to fall within the scope of the invention provided
they retain effective catalytic activity and thermostability such that they are useful in ethanel production using thermophilic microorganisms. Similarly, minor deletions and/or additions of amino acids may produce derivatives retaining appropriate functionality.
In a third aspect, the invention relates to a synthetic gene encoding a thermostable NAD-linked formate dehydrogenase. Preferably the gene comprises, consists essentially of or consists of the nucleotide sequence set forth as SEQ ID NO:1. This sequence represents a novel fdh gene sequence in which the codons are optimised for production of a thermostable NAD-iinked formate dehydrogenase. In a more specific embodiment, the gene encoding a thermostable NAD-iinked formate dehydrogenase comprises, consists essentially' of or consists of the nucleotide sequence set forth as SEQ ID NO:2. This sequence incorporates the coding region for tne thermostable NAD-iinked formate dehydrogenase together with a suitable Bacillus promoter and rho-mdependent terminator. The sequence also incorporates suitable restriction sites to assist in cloning, in particular Xbal sites. The skilled person will readily appreciate that minor modifications to the nucleotide sequence may be made without altering the functionality or thermostability of the resultant enzyme, for example through replacing optimized codons with other codons which are preferred in the translation systems of tne appropriate thermophilic microorganism.
The invention also relates to a DNA construct containing a gene encoding an NAD-iinked formate dehydrogenase, in particular a thermostable NAD-iinked formate dehydrogenase,
wherein the gene is flanked by restriction sires to facilitate cloning of the gene into a suitable DNA construct, such as an expression vector or plasmid.
In a related aspect, the invention also provides a DNA construct comprising a regulatory sequence operably linked to a gene encoding a thermostable NAD-linked formate dehydrogenase. This DNA construct thus facilitates transformation of thermophilic microorganisms, in particular those lacking lactate dehydrogenase activity, in order to produce thermophilic microorganisms capable of efficient fermentation giving maximal ethanol yields. As aforementioned, the term "operabiy linked" as used herein refers to a functional linkage between the regulatory sequence and the gene encoding the NAD-linked formate dehydrogenase, such that the regulatory sequence is able to influence gene expression. For example, a preferred regulatory sequence is a promoter. As aforementioned, the gene encoding an NAD-linked formate dehydrogenase preferably comprises, consists essentially of or consists of the nucleotide sequence set forth as 3EQ ID NO:1 . A. preferred regulatory sequence is a promoter, although the DNA construct may additionally incorporate suitable terminator sequences. In one specific embodiment, the promoter comprises the nucleotide sequence set forth as SEQ ID NO: 4. Other promoters, as discussec above, may be utilised for high levels and/or inducible expression.
In a further aspect of the invention there is provided a DNA construct comprising a gene encoding an NAD-linked formate dehydrogenase and an insertion sequence, wherein the insertion sequence facilitates integration of the gene
encoding an NAD-linked formate dehydrogenase into the genome of a thermophilic microorganism transformed with the DNA construct. By "insertion seciuence" is meant a transposabie DNA element which is capable of integration into the genome of the appropriate thermophilic microorganism. Insertion sequences may also be referred to as insertion sequence elements (IE) and may be naturally occurring. In one specific embodiment of the invention, the insertion sequence is derived from Bacillus szearoznarmophilus strain LLD-R or LLD-15.
In a more specific embodiment, the insertion sequence comprises, consists essentially of or consists of the nucleotide sequence set forth as SEQ ID NO:5 (Figure 3) . The preferred insertion sequence may be generated by amplification using primers comprising, consisting essentially of or consisting of the nucleotide sequence set forth as SEQ ID NO: 6 and 7 . In this case, genomic DNA from, the known Bacillus stearoZhermophilus strain LLD-15 may be used as the template. One particularly preferred DNA construct is plasmid pUE-ISF1 (as described in the experimental section below and in figure 5).
In a still further aspect, the invention relates to a DNA construct comprising a (fdh) gene encoding an NAD-linked formate dehydrogenase operaoly linked to appropriate regulatory regions of a gene encoding a lactate dehydrogenase, in particular the upstream regulatory-regions. The regulatory regions preferably comprise the promoter of a gene encoding a lactate dehydrogenase (Idh). The promoter may be defined to include as a minimum functional unit the appropriate -10 and -35 sequences to
allow effective RNA polymerase binding. The lactate dehydrogenase gene promoter is suitable for driving high levels of expression in thermophilic microorganisms such as Bacilli and also may advantageously be used as part of the cloning strategy to achieve both deletion of lactate dehydrogenase activity and introduction of NAD-linked formate dehydrogenase activity in the same step. The DNA construct may thus also be defined as comprising a gene encoding an NAD-iinked fcrmate dehydrogenase operably linked to a nucleic acid molecule which comprises the promoter of a gene encoding a lactate dehydrogenase (1dh).
The DNA construct preferably also contains part of the coding sequence of the host lactate dehydrogenase gene downstream of the gene encoding an NAD-linked formate dehydrogenase. This facilitates gene integration in a microorganism transformed with the DNA construct. By "at least part" is meant a portion of one gene of sufficient length to allow gene integration into the genome of a microorganism containing the lactate dehydrogenase gene by recombination (preferably by double cross-over). The part of the coding sequence preferably incorporates the end of the lactate dehydrogenase gene. In one embodiment, at least 100, 200, 300, 400, 500, 600, 700 or 750 nucleotides of the lactate dehydrogenase gene are incorporated downstream of the gene encoding an NAD-iinked formate dehydrogenase. Thus, in one embodiment of the invention, the DNA construct comprises a gene encoding an NAD-iinked formate dehydrogenase wherein the gene encoding an NAD-iinked formate dehydrogenase is flanked by nucleotide sequence from a gene encoding a lactate dehydrogenase (derived from the thermophilic microorganism of interest). The flanking
sequences are of sufficient length to allow integration of the gene encoding an NAD-linked formate dehydrogenase into the host gene encoding a lactate dehydrogenase to thereby introduce NAD-linked formate dehydrogenase activity and knock out lactate dehydrogenase activity in a single cloning step. Preferably, the gene encoding an NAD-linked formate dehydrogenase is flanked upstream by at least the promoter region of the gene encoding a lactate dehydrogenase, so that following integration by recombination tne gene encoding an NAD-linked formate dehydrogenase is operably linked tc the promoter. In a particularly preferred embodiment, the downstream portion of the lactate dehydrogenase gene is one obtainable by amplification of the 1dh gene using primers comprising, consisting essentially of or consisting of the nucleotide sequence set forth as SEQ ID NO: 8 and 9, using the strain LLD-R as template. Tne upstream flanking region, which preferably incorporates the Idh promoter, preferably comprises at least 100, 200, 300, 400, 500, 600, 700 or 750 nucleotides of the appropriate 1dh upstream regions to maximise efficiency of integration by recombination with the host genome. This upstream region may be dependent upon the sequence context of the 1dh gene in the specific thermophilic microorganism of interest, as would be readily determined by a skilled person. Thus, the skilled person with knowledge of the 1dh gene sequence would readily determine appropriate flanking regions to allow integration by recombination. For example, published genomic sequences may be studied, sequencing reactions carried out or flanking regions amplified by PCR using primers derived from the Idh gene sequence. Thus the fdh. gene becomes interposed between two nucleotide sequences derived from the 1dh gene such that
t:he fdh gene replaces, in frame, at least part of the idh gene.
The DNA construct thus generally comprises a gene integration cassette in which the gene of interest (gene encoding an NAD-linked formate dehydrogenase) is inserted within the coding sequence (DRF) of a gene to be knocked out during integration (lactate dehydrogenase gene in this instance). Upon integration through recombination, expression of the gene of interest is in effect under the control of the knocked out gene. Such a construct may be of general applicability in the circumstance where one gene needs to be knocked out in favour of expression of a heterologous gene. In one preferred embodiment, the gene encoding an NAD-linked formate dehydrogenase encodes a thermostable NAD-linked formate dehydrogenase. The discussion of the thermostable NAD-linked formate dehydrogenases provided herein thus applies mutatis mutandis to this aspect of the invention. In particular, in one embodiment, the gene encoding a thermostable NAD-linked formate dehydrogenase comprises, consists essentially of or consists of the nucleotide sequence set forth as SEG ID N0:1 or 2 . A particularly preferred DNA construct is plasmid pUCK-LFl (as described in the experimental section below and in figure 8) .
For all DNA. constructs cf the invention a preferred form is an expression vector. Thus, the DNA constructs allow reliable expression of the gene encoding a thermostable NAD-linked formate dehydrogenase in s microorganism transformed with the construct. In a particularly preferred embodiment, the DNA construct is a plasmid. Preferably, the DNA,
construct can only replicant in the host thermophilic microorganism through recombination with the genome of the host thermophilic microorganism.
The DNA constructs of the invention also preferably incorporate a suitable reporter gene as an indicator of successful transformation. In one embodiment, the reporter gene is an antibiotic resistance gene, such as a kanamycin or ampicillin resistance gene. Other reporters, such as green fluorescent protein (GFP) and beta-galactosidase (lacZ) may be utilised as appropriate. The DNR constructs may incorporate multiple reporter genes, as appropriate. Loss of reporter function is, in subsequent generations, indicative of integration of the gene encoding a thermostable NAD-linked formate dehydrogenase, together with appropriate flanking regions.
In a still further aspect, tne invention relates to a microorganism comprising a DNA. construct of the invention. Preferred recipient microorganisms are heteroloactate fermentative microorganism. In particular, the invention preferably relates to thermophilic bacteria, such as those of the genus Bacillus and especially Bacillus
stearothermophilus. The bacterium may be derived from strain LLD-R or LLD-15 for example. In a further embodiment, the thermophilic microorganism, is Geobacillus thermoglucosldasius .
In a yet further aspect, the invention relates to the use of s microorganism of the invention or a thermophilic microorganism of the invention in fermentation, and in particular for the production of ethanol.
Similarly, the invention re_ates to a fermentation process for the production of ethanol comprising supplying a thermophilic microorganism of the invention or a microorganism of the invention with sugars. Microorganisms constructed according to the present invention are particularly suitable for high ethanol yield and volumetric productivity under optimal growth conditions. Accordingly, any microorganism of the invention may be used in any fermenter configuration, such as batch, fed-batch or continuous fermentation processes. In one preferred embodiment, the fermentation process is a fed-batch process.
One of the principal benefits of using microorganisms such as thermophilic bacteria to produce bioethanol is that, unlike yeasts, they are capable of fermenting a wide range of sugars derived from agricultural waste products such as hemicelluloses . Accordingly, in one embodiment the sugars used in the fermentation processes of the invention are derived from biomass. In a further embodiment, fermentation is of mixed sugars. In a specific embodiment, the mixed sugars include pentose sugars, preferably a majority of pentose sugars.
In a further embodiment, tne fermentation process is
maintained in redox balance. This is particularly critical with thermophiles since, unlike mesophiles, sugar uptake appears to be unregulated in these microorganisms. Preferably, this is achieved through use of feedback sensors.
Whilst thermophilic bacteria have low tolerance to ethanol, this can conveniently be overcome in the fermentation processes of the invention by regular or continuous removal of ethanol. This ensures that the ethanol concentration in the fermentation is kept below tne ethanol tolerance of the thermophilic microorganism or microorganism of the invention. Ethanol may be continuously and conveniently removed from the high temperature fermentation by evaporation or distillation,, such as membrane and/or mild vacuum evaporation for example.
Tne invention will now be described with reference to the following non-limiting description and figures.
Brief description of the figures
Figure 1 shows the effect of various conditions on metabolic
pathways in a thermophilic microorganism in which the
lactate dehydrogenase pathway has been inactivated. The
shade and thickness of the arrows indicate the relative
dominance of the respective metabolio pathways.
A. Metabolic pathways active at neutral pH and in the
presence of low sugars. Here the pyruvate formate lyase
pathway dominates.
E. Metabolic pathways active at low pK and in the presence
of low sugars. Here an anaerobic pyruvate dehydrogenase
pathway dominates.
C. Metabolic pathways active at low pH and in the presence
of high sugars. Here the cells experience metabolic stress
and fall out of redox balance leading to so called "redox
death".
D. Metabolic pathways active in thermophilic
microorganisms of the present invention, at neutral pH and
in the presence of high sugars. Here, tne novel PFL-FDK pathway is dominant and ethanel and CO2 are the only anaerobic products.
Figure 2 sets forth the nucleotide sequence of the synthetic fdh gene produced by codon optimisation to maximise thermostability. The DNA sequence of the fdh open reading frame is flanked by promoter and terminator (italics) regions. -35 and -10 boxes of the promoter are underlined. To clone the construct in a suitable vector, Xbal sites were introduced on both sides of the sequence.
Figure 3 shows the nucleotide sequence of the Insertion Sequence (IS) of B. stearozhermophilus Strain LLD-15. The 9 bp inverted repeat ends are shown in bold font.
Figure 4 is a schematic representation of the pCR-Blunt derivative piasmid pCR-Fl. The piasmid includes a codon optimised fdhl gene under the control of the 1dh promoter, cloned into pCR-Blunt at tne unique Xbal site.
Figure 5 is a schematic representation of the pUBllO derivative plasmid pUB-ISF1. The plasmid includes a codon optimised fdhl gene under tne control of the 1dh promoter, derived from the pCR-Fl plasmid and also an insertion sequence (IS) derived from the Known Bacillus strain LLD-15 .
Figure 6 is a schematic representation of the pUC18 derivative piasmid called pUCK. Tne piasmid includes a kanamycin resistance gene cloned from piasmid pUBllO into the unique Zral restriction sitein pUClB.
Figure 7 is a schematic representation of the pUCK derivative pUCK-LC. Tne plasmid carries an 1dh gene with a deletion of 363 bp in rhe middle of the ORF.
Figure 8 is a schematic representation of the pUCK derivative pUCK-ldhB. The plasmid contains 7 50 bp of the Idh gene, including the downstream region of the gene.
Figure 9 is a schematic representation of the pUCK-LF1 plasmid. This plasmid is a pUCK derivative incorporating a gene integrating cassette containing the fdh gene under the control of the idh promoter.
Description of the Invenrion
Materials
Media and buffers
LB medium: Tryptone 10 g; Yeast Extract 5 g; NaCl 10 g;
deionised water to 1 L
Adjusted pH to 7 and autoclavec tc sterilize
For plate medium 20 g/1 agar was added to the medium before
autoclaving, cooled to 550C and poured into sterile Petri
dishes (approx. 2 0 ml/plate,. .
For LB-amp plates filter-sterilised ampicillin solution was
added to final concentration of 50 µg /ml before pouring the
Petri plates.
SOC Medium: Tryptone 2.0 g; Yeast Extract 0.5 g; NaCl
0.05 g; MgCl2.6H2O 0.204 g;
MgSO4.7H2O 0.247 g; Glucose 0.36 g; deionised H2O to 100 ml.
Dissolved, adjusted the pH to 7.C and filter sterilised.
TGP Medium: Tryptone 17 g; Soya peptone 3 g.; K2HPO4 2.5 g;
NaCl 5 g; Na pyruvate 4 g; glycerol 4 mi; deionised water
to 1 L. Adjusted pH to 7 and autoclavec to sterilize.
For plate medium, 20 g/1 agar was added in the medium
before autoclaving, cooled to 550C and poured into sterile
Petri dishes (approx. 2 5 mi /plate; .
For TGP-kan plates, filter-sterilised kanamycin solution to
final concentration of 10 µg /ml was added before pouring
the Petri plates.
TH buffer: Trehalose 272 mM; HEPES (pH 7.5 with KOH) 8 mM;
double distilled H2O to 1 L
Microbial strains
E. coii DH5-alpha-Chemically competent cells were purchased
from Invitrogen (Cat. 18265-017) .
Bacillus subtilis subsp. Subtilis-German culture collection,
DSMZ (DSM No. 10)
Bacillus stearothermophilus. strain LLD-R - Deposited as
NCIMB 12 4 02
Bacillus stearothermophilus. strain LLD-15 - Deposited as
NCIMB 12428
Plasmids
Plasmid pCR-Blunt and pCR-TOPO2 were obtained from
Invitrogen
Plasmid pUB110 - Bacillus subtilis BD170 strain harbouring
this plasmid was obtained from the German culture
collection, DSMZ (DSM No. 4524;.
Plasmid pUC18 was obtained from Sigma-A1drich.
Example 1. Construction of a synthetic formate dehydrogenase gene (Fig. 2 )
An amino acid sequence (NCBI Protein Database Accession No P33I60 - SEQ ID NO:3) of Pseudomonas sp 101 formate dehydrogenases was back translated, into DNA sequence with optimised codons for Geobaclllus zhermoglucosidasius. A promoter and a rho-inaependent terminator region from a Bacillus strain were added, upstream and downstream of the translated sequence respectively (Figure 2) . The novel sequence showed less than 4 0% similarity with known fdh gene sequences (37% identity with known fdhl gene) . Xbal sites were designed into both sides of the construct to facilitate its cloning into suitable vectors.
The desired sequence was synthesized using the method of Gac et al (see Xinxtn Gao, Peggy Yo, Andrew Keith, Timothy J. Ragan and Thomas K. Harris (2003): . Nucleic Acids Research, 31 (22), e143) and cloned into pCR-Blunt at its unique Xbal position. The resulting vector pCR-Fl (Figure 4) was introduced into E. coll DH5 alpha: cells and the positive clones were confirmed by PCR and restriction analysis .
Two alternative strategies are available to insert and express this synthetic fdh gene _n tne genome of target Bacilli as shown in the following examples.
Example 2. Insertion of the fdh gene into multiple (IS) sites
This strategy applies to strains such as Bacillus stearothermophilus strain 1LD-R that contain an Insertion Sequence (IS) that frequently recombines at multiple insertion sites. A vector carrying the fdh gene and this IS sequence is expected to integrate stably at one or more of such locations
Construction of piasmid pUB-ISF1 (Figure 5)
Firstly, the known Insertion Sequence of strain LLD-R (SEQ ID NO: 5 and Figure 3) is PCR amplified using a forward primer (AGTACTGAAATCCGGATTTGATGGCG - SEQ ID NO:6 ) and a reverse primer (AGTACTGCTAAATTTCCAAGTAGC - SEQ ID NO:7 ) with B, stearothermophilus strain LLD-15 as the template. Seal restriction sites are introduced in the both ends of the sequence. The PCR product is first cloned in piasmid pCR-T0P02.1 and the resulting piasmid pCR-IS is then introduced into E.coli DH5 alpha cells and used to isolate the IS region by Seal restriction digestion. The isolated
IS is then cloned in pUB110 at its unique Seal site and the resulting plasmid pUB-IE is introduced into Bacillus subtills.
Then a 1.5 icb fragment containing the Idh promoter and the fdh gene .are digested from the pCR-Fl plasmid using Xba1 restriction enzyme, and cloned in plasmid pUB-IS that was already linearised with the same enzyme. The resulting plasmid pUB-ISFl (Figure 5: is then introduced into B. subtills and positive clones are selected on TGP-kan plates and confirmed by PCR and restriction analysis .
Integration of the fdh gene into strain LLD-R
Plasmid pUE-ISFl is then methylated in vitro with HaeIII
methylase enzyme and then Bacillus siearothermophilus strain
LLD-R or its 1dh-deleted strains (see Example 3) cells are
transformed with the methylated pUE-ISFl plasmid. Positive
clones are selected after 48 E hours on TGP-Kan plates at
50°C, and analysed by PCR amplification of the fdh gene.
The fdh gene is then integrated in the chromosome by growing a transformed clone in TGP-Kan medium at 60-650C for a few generations and selecting or. TGP-Kan plates. The positive clones are analysed for presence of the fdh gene and then screened for ethanol production ano C5 (pentose) and C6 (hexose) sugar utilisation m shake flasks and in fermenters.
Example 3 . Construction of 1dh-deleted strains .
The first step is to clone a Bacillus kanomycin resistance
marker (kan) and a cassette carrying the Idh gene of B.
stearozhermophilus strain LLD-R into plasmid pUC18, which can replicate only in grarr. negative microorganisms .
Construction of a Bacillus cloning vector. Plasmid pUCK (Figure 6) .
A kanamycin resistance gene (kan) was cloned in plasmid pUC18 at its unique Zra1 site which is outside of any coding region and of the reporter gene (lacZ) in the plasmid. To clone the kan gene, a 1.13 kb fragment containing the Kanamycin resistance gene was PCR amplified with the primers:
kan-BsZ-F (ACACAGACGTCGGCGATTTGATTCATAC - SEQ ID NO: 10) and Kan-BsZ-R (CGCCATGACGTCCATGATAATTACTAATACTAGG - SEQ ID NO:11)
using plasmid pUB110 as template. The Zral sites were introduced at both ends of the Kan gene through the primers. The PGR product was then digested with Zral restriction endonuclease enzyme and ligated with previously Zra1-digested and dephosphorylated plasmid pUCIS , The resulting plasmid pDCK (Figure 6) was then introduced into E. coli DH5 alpha ceils. Positive clones were selected on LB-amp plates and confirmed by PCR and restriction analysis.
Construction of plasmid pUCK-LC (Pig.7) which carries a deleted 1dh gene
A 1.36 kb Idh cassette was designed to contain the whole idh gene of strain LLD-P. from which 363 bp of its ORF was deleted plus its flanks. The cassette was constructed by PCR amplification of the upper and lower regions of the 1dh gene using strain LLD-R as template. These regions were then Iigated and cloned in plasmid pUCK. BglII sites were
introduced into the inner primers. The upper region was PCR amplified using the following primers:
LC-U-F1 (AGGGCAATCTGAAAGGAAGGGAAAATTCC - SEQ ID NO: 12} and LC-UB-R1 TGCACAGATCTCCACCAAATCGGCGTC - SEQ ID NO: 13).
The lower region was PCR amplified using the following primers:
LODB-F1 (TTGAGCAGATCTTGATGCAAAACGATAAC - SEQ ID NO: 14) anc LC-D-R1 (TAAAGCCGATGAGCAGCAGTTGAAG - SEQ ID NO:15).
The PCR products were digested with Bg1II restriction
endonuclease enzyme and ligated using T4 DNA ligase enzyme.
Using the ligate as template, the 1dh-cassette was then PCR
amplified using as primers:
LC-UX-F2 (ATATTATCTAGACATTACGGAAATGATAATGGC - SEQ ID NO:16;
and
LC-DX-R2 (TCACAATCTAGACAATCGGCCATAAAC - SEQ ID NO:17).
Xbal sites were introduceo at the both ends of the cassette via the primers. The PCR product was then digested with Xbal enzyme and cloned into piasmid pUCK pre-digested with the same enzyme and dephosphorylated. The resulting piasmid pUCK-LC was then introduced into E. coli DH5 alpha. The positive clones were selected on LB-amp plates and confirmed by PCR and restriction analysis.
Construction of Idh deleted strains
Piasmid pUCK-LC is methylated in vitro with HaeIII methylase
enzyme and wild type thermophile cells (e.g. strain LLD-R)
are transformed into the methylated piasmid by
electroporation (1000 V, 2CI ohms, 25 micro-Faraday, and 5
milli-seconds). Positive clones are selected on TGP-Kan
plates at 650C and confirmed as single cross-over events by PGP. amplification of the kan gene.
To achieve gene deletion by double cross-over, the positive clones are grown in TGP medium for a few generations (about 5 sub-cultures) and clones which can grow on TGP plates but not on TGP-kan plates are selected. The positive clones are then confirmed as ldh gene deletions and for the absence of the kanamycin gene by PCP. analysis . The clones are then characterised for ethanoi production and C5 and C6 sugar utilisation in shake flasks and in fermenters.
Example 4. Simultaneous insertion of the fdh gene and deletion of the ldh gene.
This alternative strategy is broadly applicable to a wide class of heterolactate fermentative microorganisms as well as thermophilic Bacilli, though the latter will be used as illustration.
Construction of plasmid pUCK-LF {Fig.9)
A gene integrating cassette containing the fdh gene plus the whole ldh gene and about 300 bp of upstream and downstream flanking regions is cloned into plasmid pUCK. In this construct, the first 450 bp of the ldh open reading frame are replaced with the fdh gene in such a way that the gene expression becomes under control of the ldh gene promoter.
To achieve this a DNA fragment of about 7 50 bp containing the downstream region of the ldh gene is PCR amplified using; LDHB-X-Fl (GAACGATTCTAGATACAGCAAGATTCCGC - SEQ ID NO:8) and
LDHE-E-R1 (GTTTGCGAATTCATAGACGGACGCAG - SEQ ID NO:9) as primers and Bacillus stearothermophllus sprain LLD-R as template. Xbal and EcoR1 sites are thus introduced in the ends pf the PCR fragment. The PGR fragment is then digested and directionally cloned in plasmid pUCK between the Xbal and EcoRl sites. The resulting plasmid, pUCK-ldhB (Figure 8} is introduced into E. coli DE5 alpha and positive clones are selected on LB-amp plates and confirmed by PCR and restriction
Then, a 1.5 kb fragment containing the Idh promoter and the fdh gene are digested out from the pCR-Fl plasmid using Xbal restriction enzyme and cloned into plasmid pUCK-ldhE (Figure 8) which was already linearised with the same enzyme. The resulting plasmid pUCK-LFl (Figure 9; is introduced into E.celi DH5 alpha cells and clones are selected on LB-Amp plates. Positive clones and the correct orientation of the construct are confirmed by PGP. and restriction analysis.
Construction of strains that make ethanol by the novel PFL-FDH pathway.
Plasmid pUCK-LFl is methylated in vitro with HaeIII methylase enzyme, and target wild type ceils (e.g. strain LLD-R cells) are transformed with the methylated plasmid and selected on TGP-Kan plates at 600C. The positive clones represent single cross-over events and are analysed by PCR amplification of the fdh gene.
To achieve double cross-over gene integration', clones that grow on TGP plates but not on TGP-Kan plates are selected. The positive clones are then confirmed for the presence of the fdh gene and absence of the kanamycin gene. Finally the
clones are screened for ethanol production and C5 and C6 sugar utilisation in shake flasks and in fermenters.
All references are incorporated herein in rheir entirety.
We claim
1. A thermophilic microorganism lacking lactate
dehydrogenase activity.: characterised in that the
thermophilic microorganism contains a gene encoding an NAD-
linked formate dehydrogenase.
2. The thermophilic microorganism of claim 1 which has
pyruvate formate lyaseactivity.
3. The thermophilic microorganism of claim 1 or 2 wherein
the gene encoding an NAD-linked formate dehydrogenase is
integrated into the .genome of the thermophilic microorganism.
4. The thermophilic microorganism of any one of claims 1 to 3 wherein the gene encoding an NAD-linked formate
dehydrogenase is expressed from its own promoter or from a promoter of the thermophilic microorcranism.
a
5 . The thermophilic microorganism of any one of claims 1
to A wherein the gene encoding an NAD-linked formate
dehydrogenase is inserted into the lactate dehydrogenase
gene of the thermophilic microorganism, thus inactivating
the lactate dehydrogenase activity of the thermophilic
microorganism.
6. The thermophilic microorganism of any preceding claim
wherein the gene encodiing an NAD-linked formate
dehydrogenase comprises the nucleotide sequence set forth as
SEQ ID NO: 1 or 2
7. The thermophilic microorganism of any preceding claim
whxch has been transformed with a DNA construct comprising a
gene encoding an NAD-linked formate dehydrogenase operably
linked to an upstream region of a gene encoding a lactate dehydroqenase wherein the unstream reqion includes the
promoter and further comprising at least part of the lactate
dehydroaenase gene downstream of the gene encoding an NAD-
linked formate dehydrogenase such that the gene encoding an
NAD-linked formate dehydrogenase is interposed between a
sufficient portion of the lactate dehydrogenase gene on
either side to facilitate integration of the gene encoding
an NAD-linked formate dehydrogenase by recombination with a
lactate dehydrogenase gene in the genome of the thermophilic
microorganism. 8 . The thermophilic microorganism of any preceding claim
which is a thermophilic bacterium of the genus Bacillus.
9. A gene encoding af thermostable NAD-linked formate
dehydrogenase comprising the nucleotide sequence set forth
as SEQ ID NO:1:
10.. A DNA construct domprising a regulatory sequence operably linked to a gene encoding a thermostable NAD-linkedi folrmate dehydrogenase comprising the nucleotide sequence set-forth as SEQ ID NO:1.
111. A DNA construct comprising a gene encoding an NAD-linked formate dehydrogenase, optionally a thermostable NAD-linked formate dehydrogenase, and an insertion sequence, wherein the insertion sequence facilitates integration of the gene encoding.an NAD-linked formate dehydroqenase into
the. genome 0f a thermophllic microoraanism transformed with the DNA construct.
12. A DNA construct comprisino a aene encodino an NAD-
linked formate dehydrogenase, optionally a thermostable -NAD--
linled formate dehydrogenase, operably linked to an upstream
region of a gene encoding a lactate dehydrogenase, wherein
the upstream region includes the promoter " ■ J
13. A microorganism comprising the DNA construct as defined
in any one of claims 10to12.
14. Use of a thermophilic microorganism as claimed in any one of claims 1 to 8 or a microorganism as claimed in claim 13 for the production of ethanol .
15. A fermentation process for production of ethanol
comprising supplying a thermophilic microorganism as claimed in 'any one of claims 1 1to 8 or a microorganism as claimed in
claim 13 with sugars.
| # | Name | Date |
|---|---|---|
| 1 | 8368-DELNP-2008-Correspondence Others-(03-10-2008).pdf | 2008-10-03 |
| 2 | 8368-DELNP-2008-Form-18-(16-12-2009).pdf | 2009-12-16 |
| 3 | 8368-DELNP-2008-Correspondence-Others-(16-12-2009).pdf | 2009-12-16 |
| 4 | abstract.jpg | 2011-08-20 |
| 5 | 8368-delnp-2008-pct-306.pdf | 2011-08-20 |
| 6 | 8368-delnp-2008-pct-210.pdf | 2011-08-20 |
| 7 | 8368-delnp-2008-form-5.pdf | 2011-08-20 |
| 8 | 8368-delnp-2008-form-3.pdf | 2011-08-20 |
| 9 | 8368-delnp-2008-form-2.pdf | 2011-08-20 |
| 10 | 8368-delnp-2008-form-13.pdf | 2011-08-20 |
| 11 | 8368-delnp-2008-form-1.pdf | 2011-08-20 |
| 12 | 8368-delnp-2008-drawings.pdf | 2011-08-20 |
| 13 | 8368-delnp-2008-description (complete).pdf | 2011-08-20 |
| 14 | 8368-delnp-2008-correspondence-others.pdf | 2011-08-20 |
| 15 | 8368-delnp-2008-claims.pdf | 2011-08-20 |
| 16 | 8368-delnp-2008-abstract.pdf | 2011-08-20 |
| 17 | 8368-DELNP-2008_EXAMREPORT.pdf | 2016-06-30 |