Abstract:
FIELD OF INVENTION:
The present invention relates to a method of enhancing the content of Xanthophylls, preferably of lutein and or Zeaxanthin, more preferably hydroxylated carotenoids in a plant, plant cell, callus, tissue, fruit, root or other part of a plant, and/or a method of increasing the foliage and or number of flowers in a plant, to a plant, plant cell, callus tissue, root or fruit produced by such method, and to a nucleic acid construct and the use of such nucleic acid construct.
BACKGROUND OF THE INVENTION:
Among modern diseases and ailments, both cancer and cardiovascular diseases rank close to the top and affect a significant proportion of the population. These diseases have been linked to factors such as reactive oxygen species, which cause damage to membranes, DNA and other cellular functions. Consequently anti-oxidants have become very popular dietary supplements among all age groups a number of products such as fresh fruits, juices, plant extracts and tablets are available and consumed on a daily basis towards the maintenance of health. This category of chemicals includes vitamins C and E, polyphenols, flavonols and carotenoids. As humans do not synthesize any of these, these are obtained from plant of microbial sources. One of the key groups involved in reactive oxygen quenching are poly-ols and poly-enes.
PRIOR ART:
Lutein and diet
Lutein is member of the carotenoid family, a family best known for one of its members, beta-carotene. They are natural fat-soluble yellowish pigments found in some plants, algae and photosynthetic bacteria. This serves as accessory light-gathering pigments and to protect these organisms against the toxic effects of ultra-violet radiation and oxygen. They also appear to protect humans against phototoxic damage. Lutein is found in the macula of the human retina, as well as the human crystalline lens. They are thought to play a role in protection against age-related macular degeneration (AMD) and age-related cataract formation. They may also be protective against some forms of cancer. These two carotenoids are sometimes referred to as macular yellow, retinal carotenoids or macular pigment.
Lutein also filters the high-energy, blue wavelengths of light from the visible-light spectrum by as much as 90%. Blue light, in both indoor lighting and sunlight, is believed to induce oxidative stress and possible free-radical damage in human organs exposed to light, such as the eyes and skin. Blue light is not the same as the commonly known ultraviolet A and ultraviolet B wavelengths of the invisible spectrum. Other studies suggest that a mixture of nutrients, including lutein, may provide supplemental antioxidant capacity to the skin, helping counteract free radical damage.
Research suggests a minimum of 6-10 mg per day of lutein from dark green leafy vegetables and other sources is necessary to realize lutein's health benefits. Lutein / zeaxanthin supplements are available in free (non-esterified) and esterified (with fatty acids) forms, and as single ingredient or combination products. The amount of zeaxanthin in these products is considerably lower than that of zeaxanthin. Products that deliver higher amounts of zeaxanthin are being developed. Dosage is variable, and optimal dosage for ophthalmological health is not known. Dietary intake of lutein of 6.9-11.7 milligrams daily has been associated with a decreased risk of age-related macular degeneration.
Green leafy vegetables are good dietary sources of lutein, but poor sources of zeaxanthin. Good dietary sources of zeaxanthin include yellow corn, orange pepper, orange juice, honeydew, mango and chicken egg yolk.
Food sources of lutein, include corn, egg yolks and green vegetables and fruits, such as broccoli, green beans, green peas, brussel sprouts, cabbage, kale, collard greens, spinach, lettuce, kiwi and honeydew. Lutein is also found in nettles, algae and the petals of many yellow flowers. In green vegetables, fruits and egg yolk, lutein and zeaxanthin exist in non-esterified forms. They also occur in plants in the form of mono-or-di esters of fatty acids. For example, lutein and zeaxanthin dipalmitates, dimyristates and monomyristates are found in the petals of the marigold flower (Tagetes erecta).
Lutein
Lutein and zeaxanthin belong to the xanthophyll class of carotenoids, also known as oxycarotenoids. The xanthophylls, which in addition to lutein and zeaxanthin include alpha-and beta-cryptoxanthin, contain hydroxyl groups. This makes them more polar than carotenoids, such as beta-carotene and lycopene, which do not contain oxygen. Although lutein and zeaxanthin have identical chemical formulas and are isomers, they are not stereoisomers, as is sometimes believed. They are both polyisoprenoids containing 40 carbon atoms and cyclic structures at each end of their conjugated chains. Also, they both occur naturally as all-trans (all-E) geometric isomers. The principal difference between them is in the location of a double bond in one of the end rings. This difference gives lutein three chiral centers rather than the two that are found in zeaxanthin.
Owing to its three chiral centers, there are 23 or 8 stereoisomers of lutein. The principal natural stereoisomer of lutein is (3R, 3'R, 6'R)-lutein. Lutein is also known as xanthophyll (also, the group name of the oxygen-containing carotenoids), vegetable lutein, vegetable luteol and beta, epsilon-carotene-3, 3'diol. The molecular formula of lutein is C40H56O2 and its molecular weight is 568.88 daltons. The chemical name of the principal natural stereoisomer of lutein is (3R, 3,R,6'R)-beta,epsilon-carotene-3,3'-diol.
Zeaxanthin has two chiral centers and therefore, 22 or 4 stereoisomeric forms. One chiral center is the number 3 atom in the left end ring, while the other chiral center is the number 3' carbon in the right end ring. One stereoisomer is (3R, 3'R)-zeaxanthin; another is (3S-3'S)-zeaxanthin. The third stereoisomer is (3R, 3'S)-zeaxanthin, and the fourth, (3S,3'R)-zeaxanthin. However, since zeaxanthin, in contrast to lutein, is a symmetric molecule, the (3R,3'S)-and (3S,3'R)-stereoisomers are identical. Therefore, zeaxanthin has only three stereoisomeric forms. The (3R,3'S)-or (3S,3'R)-stereoisomer is called meso-zeaxanthin.
The principal natural form of zeaxanthin is (3R,3'R)-zeaxanthin. (3R,3'R)-and meso-zeaxanthin are found in the macula of the retina, with much smaller amounts of the (3S,3'S)-stereoisomer. It is thought that weso-zeaxanthin in the macula is formed from (3R,3'R,6'R)-rutein. Zeaxanthin is also known as beta, beta-carotene-3,3'-diol, all-fnms-beta-carotene-3,3'-diol, (3R,3'R)-dihydroxy-beta-carotene (the principal natural stereoisomer), zeaxanthol and anchovyxanthin. Its molecular formula is C40H56O2 and its molecular weight is 568.88 daltons. Zeaxanthin is the principal pigment of yellow corn zea mays L, from which its name is derived. It is also produced by certain bacteria, such as Flavobacterium multivorum, which are yellow in color.
Lutein and health
Reactive oxygen species (ROS) are generated by a number of pathways whereby energy is transferred to ground state triplet oxygen making it highly reactive excited singlet oxygen. This species is capable of lipid, protein and DNA damage. ROS are thus associated with symptoms of aging, with cancer and cardiovascular diseases. By virtue of the abundance of unsaturations and the conjugation of these linkages, carotenoid molecules can quench the energy from the singlet oxygen. Concomitant with this step, the carotenoid molecule attains an excited state, which is subsequently dissipated as heat by interaction with the solvent milieu. After completing one quenching reaction, the carotenoid is regenerated for another reaction. Certain estimates reveal that carotenoids can quench around 1000 singlet oxygens before they break down (Krinsky, 1998).
ROS have been linked with a number of chronic diseases, due to the oxidative damage caused. In turn antioxidants have been associated with protecting lipids, membranes, low-density lipoproteins, proteins and DNA from damage. More specifically, lycopene has been demonstrated to prevent cancer and cardiovascular diseases. Several studies have found that lycopene, by binding to lipophylic moieties, protects such complexes from oxidative damage. Further it is proposed to prevent the carcinogen-induced phophorylation of p53 and Rb anti-oncogens, and stop cell division as the G0-G1 phase. It is also an inhibitor of HMG CoA reductase, the committed step in cholesterol biosynthesis. Additionally by binding to LDL and VLDL, it prevents the formation of cholesterol oxides and hence CVD.
Lutein and zeaxanthin, which are naturally present in the macula of the human retina, filter out potentially phototoxic blue light and near-ultraviolet radiation from the macula. The protective effect is due in part, to the reactive oxygen species quenching ability of these carotenoids. Further, lutein and zeaxanthin are more stable to decomposition by pro-oxidants than are other carotenoids such as beta-carotene and lycopene. Zeaxanthin is the predominant pigment in the fovea, the region at the center of the macula. The quantity of zeaxanthin gradually decreases and the quantity of lutein increases in the region surrounding the fovea, and lutein is the predominant pigment at the outermost periphery of the macula. Zeaxanthin, which is fully conjugated (lutein is not), may offer somewhat better protection than lutein against phototoxic damage caused by blue and near ultraviolet light radiation.
Lutein and Zeaxanthin, which are the only two carotenoids that have been identified in the human lens, may be protective against age-related increases in lens density and cataract formation. Again, the possible protection afforded by these carotenoids may be accounted for, in part, by their reactive oxygen species scavenging abilities.
Lutein and zeaxanthin exist in several forms. Nutritional supplement forms are comprised of these carotenoids either in their free (non-esterified) forms or in the form of fatty acid esters. Lutein and zeaxanthin exist in a matrix in foods. In the case of the chicken egg yolk, the matrix is comprised of lipids (cholesterol, phospholipid, triglycerides). The carotenoids are dispersed in the matrix along with fat-soluble nutrients, including vitamins A, D and E. In the case of plants, lutein and zeaxanthin are associated with chloroplasts or chromoplasts.
The efficiency of absorption of lutein and zeaxanthin is variable, but overall appears to be greater than that of beta-carotene. Esterified forms of these carotenoids may be more efficiently absorbed when administered with high-fat meals (about 36 grams), than with low-fat meals (about 3 grams). Lutein and zeaxanthin esters are hydrolyzed in the small intestine via esterases and lipases. Lutein and zeaxanthin that are derived from supplements or released from the matrices of foods, are either solubilized in the lipid core of micelles (formed from bile salts and dietary lipids) in the lumen of the small intestine, or form clathrate complexes with conjugated bile salts. Micelles and possibly clathrate complexes deliver lutein and zeaxanthin to the enterocytes.
Lutein and zeaxanthin are released from the enterocytes into the lymphatics in the form of chylomicrons. They are transported by the lymphatics to the general circulation via the thoracic duct. In the circulation, lipoprotein lipase hydrolyzes much of the triglycerides in the chylomicrons, resulting in the formation of chylomicron remnants. Chylomicron remnants retain apolipoproteins E and B48 on their surfaces and are mainly taken up by the hepatocytes and to a smaller degree by other tissues. Within hepatocytes, lutein and zeaxanthin are incorporated into lipoproteins. Lutein and zeaxanthin appear to be released into the blood mainly in the form of high-density lipoproteins (HDL) and, to a lesser extent, in the form of very-low density lipoprotein (VLDL). Lutein and zeaxanthin are transported in the plasma predominantly in the form of HDL.
Lutein and zeaxanthin are mainly accumulated in the macula of the retina, where they bind to the retinal protein tuberlin. Zeaxanthin is specifically concentrated in the macula, especially in the fovea. Lutein is distributed throughout the retina.
The form of lutein in the plasma is (3R,3'R,6'R)-lutein. Zeaxanthin found in plasma is predominantly (3R,3'R)-zeaxanthin. Lutein appears to undergo some metabolism in the retina to meso-zeaxanthin.
Possible biologic mechanisms of the protective role of lutein and zeaxanthin in the eye have been reviewed by Krinsky et al. and include their ability to: [a] filter harmful shortwave blue light, and [b] function as antioxidants. In liposomes, the blue light filtering efficacy of carotenoids has been ranked as lutein, zeaxanthin, carotene, Iycopene. The identification of oxidation products of lutein and zeaxanthin in human retina lens, and other ocular tissues lends support for an antioxidant role of xanthophylls in the human eye. Lutein and zeaxanthin have been identified in human rod outer segment membranes where the concentration of long-chain polyunsaturated fatty acids and susceptibility to oxidation is highest.
SUMMARY OF THE INVENTION:
The object of this invention is to provide means to enhance xanthophyll levels in plants and/or plant parts. A further object of the present invention is to provide a method for producing enhanced levels of xanthophylls, in particular lutein and or zeaxanthin, in plants and/or plant parts. Yet a further object of the present invention is to provide a plant or plant part having enhanced levels of xanthophylls, in particular lutein and zeaxanthin.
The objects of the present invention are solved by a method of enhancing the content of xanthophylls, preferably of lutein and or zeaxanthin, in a plant, plant cell, callus, tissue, fruit, root or other part of a plant, and/or increasing foliage size of the plant and or flower numbers, said method comprising:
Impairment of mitochondrial function, preferably impairment of mitochondrial complex I, II, III and /or IV, more preferably mitochondrial complex I in said plant, plant cell, callus, tissue, fruit, root or other part of a plant.
In one embodiment of the method according to the present invention, said impairment occurs using a modified protein component of mitochondrial complex I of said plant cell, preferably a protein component of mitochondrial complex I that is the translation product of an unedited coding sequence.
Preferably, said impairment occurs by transforming said plant cell with a nucleic acid construct, preferably a DNA-construct, or by transforming said plant cell with a nucleic acid construct via Agrobacterium species - mediated transformation, preferably Agrobacterium tumefaciens, or by viral transfection using a suitable plant virus such as Tobacco Mosaic Virus, or by protoplast transformation.
In one embodiment of the present invention, said nucleic acid construct, preferably said DNA-construct, or said Agrobacterium comprises, preferably in a binary vector, a nucleic acid encoding said modified protein component of said mitochondrial complex I.
In a preferred embodiment of the present invention, said modified protein component of mitochondrial complex I is a dysfunctional protein from another plant species than said plant cell or a dysfunctional protein of the same plant species as said plant cell.
In another embodiment of the method according to the present invention, said modified protein component of mitochondrial complex I is a dysfunctional protein selected from the group comprising NAD 1, 2, 3, 4, 4L, 5, 6, 7, 9, nuclear mitochondrial proteins 76 Kda, 55 Kda, 28.5 Kda, 22 Kda and Acyl carrier protein.
In one embodiment of the method according to the present invention, said nucleic acid construct, preferably said DNA-construct, or said Agrobacterium, preferably said Agrobacterium binary vector, additionally comprises a nucleic acid encoding a mitochondrial transit peptide, operably linked to said nucleic acid encoding said modified protein component of said mitochondrial complex I.
In a preferred embodiment of the invention, wherein said nucleic acid construct, preferably said DNA-construct, or said Agrobacterium, preferably said Agrobacterium binary vector, additionally comprises a promoter and a terminator, and said promoter and terminator are operably linked to said nucleic acid encoding said modified protein component of said mitochondrial complex I.
In one embodiment of the invention, wherein said nucleic acid construct, preferably said DNA-construct, or said Agrobacterium, preferably said Agrobacterium binary vector, comprises said promoter and said terminator, said nucleic acid encoding mitochondrial transit peptide and said nucleic acid encoding said modified protein component of said mitochondrial complex I, all as defined before, all of them being operably linked.
Preferably said impairment occurs by mutating said plant cell with respect to at least one of the components of said mitochondrial complex I in said plant cell.
In a preferred embodiment of the present invention, said mutating occurs by mutating said plant cell at random using a chemical and/or physical mutagenic agent being applied to at least one plant cell, preferably a plurality of plant cells of the same plant, said chemical mutagenic agent preferably being selected from the group comprising ethyl methane sulfonate and said physical mutagenic agent being selected from the group comprising fast neutron bombardment, X-ray, gamma ray and other mutagenic irradiation.
In one embodiment of the method according to the present invention, the method, after mutating, further comprises the additional step of screening for a modified protein component of mitochondrial complex I or other mitochondrial functions of said plant cell in said plant cell or plurality of plant cells.
In one embodiment of the method according to the present invention, said impairment occurs by applying a chemical inhibitor of mitochondrial function, preferably a chemical inhibitor of mitochondrial complex I of said plant cell, to said plant cell, plant, callus, tissue, a part of said plant, said plant in its entirety, fruit, root and / or other plant organ.
In a preferred embodiment of the present invention, said chemical inhibitor is selected from the group comprising rotenone, antimycin A, oxyfluorfen, violaxanthin, piericidin, piericidine A, pyrazoles, pyridaben, quinazolines, acetogenins, thiangazoles and fenaza.
In a preferred embodiment of the invention, said impairment is an inhibition of said of
mitochondrial complex I.
In one embodiment of the method according to the present invention, said method further comprises the step of raising said plant cell, plant part, tissue, seed or organ having undergone the method of any of the foregoing claims, to produce a plant callus, tissue, plant, root and/or fruit.
The objects of the present invention are solved by a plant cell, callus, tissue, plant, root or fruit produced by the method according to the present invention. Preferably the plant cell, callus, tissue, plant, root or fruit is/are derived from a plant origin selected from the group comprising solanaceous species, including tomato, pepper, capsicum, potato, petunia and or tobacco. Preferably, in the plant cell, callus, tissue, plant, root or fruit, the amount of Xanthophyll, preferably lutein and or Zeaxanthin is enhanced, in relation to a plant cell/callus/tissue/plant, root or fruit not having undergone the method according to the present invention.
OBJECTS OF THE INVENTION
The objects of the present invention are solved by a method of obtaining Xanthophylls, preferably lutein and or zeaxanthin, comprising the steps:
1. Producing a plant cell, callus, tissue, plant, root or fruit according to the present invention,
2. Purifying xanthophylls, preferably lutein and /or zeaxanthin, from said plant cell, callus, tissue, plant, root or fruit, preferably by solvent extraction and purification or by supercritical carbon dioxide extraction or any other method typically employed by someone skilled in the art.
3. The objects of the present invention are also solved by a nucleic acid construct comprising a nucleic acid sequence encoding a modified protein component of mitochondrial complex I.
4. Preferably, said modified protein component of mitochondrial complex I is selected from the group comprising NAD 1, 2, 3, 4, 4L, 5, 6, 7 and 9 or other proteinaceous component of said complex.
In one embodiment of the nucleic acid construct according to the present invention, said modified protein component of mitochondrial complex I is from a species selected from the group comprising tomato, potato, tobacco, rice, maize, petunia, Arabidopsis, and or Lotus, Medicago, wheat and/or Sorghum.
The objects of the present invention are solved by the use of a nucleic acid construct according to the present invention for enhancing the content of xanthophylls, preferably of lutein and or zeaxanthin, in a plant cell, plant, callus, tissue, fruit, root or other part of said plant and/or for increasing foliage and or flower numbers in a plant.
BRIEF DESCRIPTION OF THE DRAWINGS:
List of Figures
Figure 1: Plasmid pCAMBIA1390 construct used as a basic construct for transformation. The boxes named TP and nad9 indicate the coding regions of At-mRBP1a and Unedited nad9 inserted in multiple cloning site of the pCAMBIA1390 vector. The unedited nad9 gene is driven by Ubiquitin promoter (Ubi). The construct has hygromycin as plant selection marker under the control of CaMV35s promoter cloned in between XhoI site.
Figure 2: Plasmid pCAMBIA1390 construct used as a basic construct for transformation. The boxes named TP and nad9 indicate the At-mRBP1a and Unedited nad9 inserted in antisense orientation at the multiple cloning site of the pCAMBIA1390 vector. The unedited NAD9 gene is driven by Ubiqitin promoter (Ubi). The construct has hygromycin as plant selection marker under the control of CaMV35s promoter cloned in between Xhol site.
Figure 3a: PCR amplification of 1390pNGI1 To transgenic plants with various primer combinations. Note: All transgenic plants that showed clear amplification are positives.
Figure 3b: PCR amplification of 1390pNG23 T0 transgenic plants with various primer combinations. Note: All transgenic plants that showed clear amplification are positives
Figure 4a: RT-PCR analysis of transgenic plants having 1390pNGl 1 construct with TPM F and NAD9 R primers to confirm the transgene expression as well as the expression profile of different genes involved in the carotenoid biosynthesis pathway.
Figure 4b: RT-PCR analysis of transgenic plants having 1390pNG23 construct with TPM F and NAD9 R primers to confirm the transgene expression as well as the expression profile of different genes involved in the carotenoid biosynthesis pathway.
Figure 5a: Leutin content in the older leaves of 1390pNGll transgenic tobacco was estimated by HPLC analysis and is expressed as micrograms per 100 grams of leaves.
Figure 5b: Leutin content in the older leaves of 1390pNG23 transgenic tobacco was estimated by HPLC analysis and is expressed as micrograms per 100 grams of leaves.
DETAILED DESCRIPTION OF THE INVENTION:
Definition:
A "vector" is a polynucleic acid construct, generated recombinantly, artificially or chemically, comprising nucleic acid elements that may encode genes, proteins, promoters, terminators and transit peptides. These segments will be operably linked so as to enable the expression of the gene encoded or the complete execution of the process encoded. A nucleotide sequence is "operably linked" when adjacent segments of DNA sequence are linked in such a manner so as to enable a cellular/biological function as encoded by the gene sequence.
Xanthophylls are yellow pigments from the carotenoid group. Their molecular structure is based on carotenes, contrary to carotenes, hydroxyl groups substitute some hydrogen atoms and or some pairs of hydrogen atoms are substituted by oxygen atoms. They are found in leaves of most plants and are synthesized within the plastids
Impairment refers to the partial or complete loss of function of the organelle, functional complex, enzyme or other functional entity. A complete loss of function as used herein is also sometimes referred to as inhibition.
Mitochondrial complex Mitochondria complexes refer to the four electron transport chain complexes of mitochondria called I, II, III and IV respectively, where complex I is NADH- dehydrogenase, Complex II is succinate dehydrogenase, Complex III is cytochrome c reductase and complex IV is cytochrome c oxidase. These are multipolypeptide complexes involved in ATP production by oxidation of NADH+H4 and FADH2 to NAD+ and FAD respectively and water.
Mitochondrial complex I proteins This complexes comprises about 43 polypeptide chains including the mitochondrial encoded nad1, nad2, nad3, nad4, nad4Lm, nad5, nadp, nad7, nad9 and the nuclear encoded 76 Kda, 55 Kda, 28.5 Kda, 22 Kda and Acyl carrier protein.
"Modified protein component" refers to a protein component that differs from the native functional protein in its amino acid sequence, structure or function and may be non-functional. It is to be noted that in plant mitochondria, the amino acid sequence of the native (functional) protein differs from the hypothetical translation production of the native gene sequence that encodes the protein due to one or more post-translational RNA editing events.
"Unedited" refers to a gene sequence identical to the gene sequence present naturally in the mitochondrial genome. It is often different from the mRNA product that encodes the native (functional) protein due to post-transcriptional RNA editing whereby certain C ribonucleotides are modified to U ribonucleotides and rarely certain U ribonucleotides to C ribonucleotides. For example the "translation product of an unedited coding sequence" is a protein that would be expected to be produced if no editing events at a post- transcriptional level occurred.
Dysfunctional: partially or completely non-functional
Transit peptide refers to an N-terminal presequence, which directs mitochondria-bound proteins encoded by the nucleus to the mitochondrion. The transit peptide is required for the transport of such proteins across the relevant membranes from their site of synthesis in the cytoplasm. Inhibitors of mitochondria include but are not limited to Rotenone, Antimycin A, Cyanide, malonate (succinate dehydrogenase inhibitor), 2,4-Dinitrophenol (DNP), Carbonyl cyanide p- [trifluoromethoxy]-phenyl-hydrazone (FCCP), Oligomycin, oxyfluorfen, violaxanthin, piereicidin A, pyrazoles, pyridaben, quinazolines, acetogenins, thiangazoles, fenaza, thenoxyltrifluoroacetone, carfboxin, oxycarboxin, fenfuran, DDT, chlorproham, propanil, dinoseb, ioxynil, cyclodiene, paraquat, dinoseb, diafenthiuron, methomyl, Bongkrekic acid and hydramethylrion.
For example, said objective may be achieved by assembling a polynucleotide construct encoding a maize ubiquitin promoter, an Arabidopsis At-mRBP1a mitochondrial targeting transit peptide, an unedited nad9 gene from rice mitochondria peptide and a Nopaline synthase (NOS) terminator. This assembly may be carried out so as to render the construct transcriptionally and translationally competent in plants, and additionally allow the protein product to be translocated to the mitochondrion. A plant cell/plant/plant part transformed by such or similar construct can be observed to show high levels of xanthophylls, most notably lutein and/or zeaxanthin. This invention thus relates to a method of developing high xanthophylls plants, plant cell, tissues or plant parts (comprising leaves, stems, roots, fruits and flowers). This invention also relates to a method of developing plants with enhanced levels of lutein or zeaxanthin.
EXAMPLE 1
Isolation of targeting sequence, NAD9 gene and construction of vectors for plant
Transformation
Rice mitochondria (Approximately 75 ug) was resuspended in resuspension buffer and lysed with 1A volumes of lysis buffer. After gentle mixing by inversion, phenol was added, followed by chloroform. Phenol chloroform extraction was carried out 3 times followed by chloroform extraction. DNA was precipitated from the aqueous phase with 2.5 volumes of ethanol and 1/10 volumes of 3 M sodium acetate, by centrifugation at 13, 000 rpm for 20 minutes after a 30 minute incubation at -20 °C. The DNA pellet was washed with 70 % ethanol, dried and dissolved in water.
The mitochondrial targeting sequence (At-mRBP1a) (SEQ. ID. 7) was cloned by polymerase chain reaction (PCR) from Arabidopsis ihaliana cDNA, using the following set of primers:
Forward Primer: 5' AAGAGCTCCCATGGTCTTCTGTAACAAACTCG 3*
Reverse Primer: 5' AATCTAGACTTGGTAGACATCAACCGG 3'
The forward and the reverse primers have the Sad site and the Xba1 site incorporated within them respectively and this facilitated the cloning of the PCR product into pB(SK-) and the resulting vector was named pNG1.
Unedited NAD9 is obtained by PCR from rice mitochondrial DNA (SEQ. ID, 8). The following primer combination was used for the amplification:
Forward primer: 5' AATCTAGAATGGATAACCAATCCATTTTCCAA 3'
Reverse primer: 5' AAGGATCCGGGATTATCCGTCGCTACG 3'
The forward primer has the Xba I site and the reverse primer has the BamHI site with which the unedited NAD9 gene was cloned adjacent to the mitochondrial targeting sequence and the vector was named as pNG3.
pNGII: The unedited nad9 gene was excised out of pNG3 with Sad and BamHI and was ligated with the ubiquitin promoter upstream and the Nos terminator downstream. The resulting construct was called pNG1 1.
Plasmid constructs: The recombinant plasmids used for transformation are in figure 1 and 2 and the details are as follows:
Detailed cloning strategy of the constructs
Plasmid 1390pNGU:
Method of Construction: Un-edited NAD9 gene isolated from rice was excised from pNG11 (pBSK(SK-) vector and inserted into 1390pCAMBIA (Figure 1). pi 390 + Ubi was digested with Hind III and Bam HI. Biolistic pNG11 clone was digested serially with Hind III followed by Bam HI and cloned in pi 390 digested with Hind III and Bam HI. The transformants were screened using CvMv and NOS primers and positive colonies picked up. The transformants were sequenced with CvMv as well as NOS primers to confirm the plasmids.
Plasmid 1390pNG23:
Method of Construction: Un-edited NAD9 gene isolated from rice was excised from pNG23 (pBSK(SK-) vector and inserted into 1390pCAMBIA (Figure 2). pl390 + Ubi was digested with Hind III and Bam HI. Biolistic pNG23 clone was digested serially with Hind III followed by Bam HI and cloned in pl390 digested with Hind III and Bam HI. The transformants were screened using CvMv and NOS primers and positive colonies picked up. The transformants were sequenced with CvMv as well as NOS primers to confirm the plasmids.
EXAMPLE 2
Generation of plants with altered NAD9 gene expression - Development of transgenic
plants: Plant material: Nicotiana tabaccum was used for transformation to present a proof of concept.
Detailed steps in Agrobacterium mediated transformation of tobacco
A. Sterilization of seeds and generation of explants:
The seeds were washed twice with double distilled autoclaved water. The seeds were rinsed in 70% Ethanol for 30 seconds. The seeds were then be immersed in a 70% solution of commercial bleach for 30 minutes, in a shaker. They were then washed until all the traces of bleach are removed. The seeds were dried on autoclaved tissue papers. The seeds were then placed on XAMS media for germination. The germinated seedling were maintained in-vitro indefinitely by sub culturing every month on to a fresh media.
B. Transformation of tobacco leaf explant: The positive colony was inoculated in to LB broth with 50mg/L Kan and l0mg/L of Rifamicin as vector backbone consisted of Kan and Rif resistance gene, which also functions as double selection at one shot. The inoculated broth was incubated at 28°C for overnight. The overnight grown colony was inoculated into 50mL LB broth with 50mg/L Kan and l0mg/L of Rifamicin and incubated at 28°C for 3-4 hours and the OD checked at 600nm. The OD should be between 0.6-1. Once the broth reached required OD the broth was centrifuged at 5000rpm for 5min. The supernatant was discarded and the cell pellet dissolved in MS liquid medium. The tobacco leaf was cut in to small square pieces which served as explants with out taking midrib and care was taken to injure leaf at all four sides and with out injuring much at the center part of the inoculants. Placed this leaf samples in M.S Plain media for two days in BOD. After two days of inoculation these leaf samples were infected with transformed Agrobacterium cells, which are now in MS liquid (Agro-MS broth). Placed the leaf explants in this Agro-MS broth for 30min and place them on co-cultivation media, which consist of M.S +1mg/L BAP+0.2mg/L NAA +250mg/L Cefotaxime for two days. After co-cultivation the explants were kept in first selection medium which consist of M.S +1mg/L BAP+0.2mg/L NAA + 40mg Hyg +250mg/L Cefotaxime for 15 days and as the callus started protruding these explants were again sub cultured on to first selection media for allowing the callus to mature enough. Once the callus was found to be matured these calli were inoculated on to second selection medium which consist of M.S +lmg/L BAP+0.2mg/L NAA + 50mg Hyg+250mg/L Cefotaxime. As the concentration of Hygromycin is increased the escapes from first selection get suppressed and only the transformed callus starts surviving on this media. This was subcultured on second selection, which was done once in ten days. DNA was extracted at this stage from callus and PCR was done using gene specific primers, this is done to conform our transformation is working or not). By this time the plantlets start protruding from the callus. The plantlets from second selection were taken and placed on to rooting media, which consisted of 1/2M.S+0.2IBA. Here the plantlets start protruding roots for 12-15 days. Once the mature roots are formed the plants were transformed on to rooting media along with 20mg/L of Hygromycin, as escapes can be identified at this stage also. Plants from this stage were subjected to acclimatization where the caps of bottles are kept open for two days so that plants get adjusted to its growth room environment. Removing plants from agar medium and placing it in V* MS liquid medium for two days followed this. These plants are further transformed on to vermiculate and watered every day for one week. Depending upon the condition of the plants suitable plants were transferred to green house.
Detailed steps involved in molecular analysis of the resulting transgenic plants to confirm the presence of the gene:
DNA extraction and PCR analysis:
Total DNA was isolated from 100mg of leaf tissue essentially as per Qiagen DNAeasy mini kit nethod. 50ng of DNA was amplified in a final volume of 30 µl by using 1 unit of Taq I polymerase (Bangalore genei), 0.7mM dNTPs and 5 pmoles of each amplification primer.
The oligonucleotide primers (Table 1) used for PCR confirmation of various transgenic events are as follows:
a. 1390pNGll: UBIEF2-NosMR, TPMF- NosMR, UBIEF2-Nad9R, TPMF-Nad9R
b. 1390pNG23: CsVMVMF- NosMR, CsVMVMF- NAD9R, TPMF -NosMR, Nad9F-NosMR and TPMF-NAD9R.
Table 1: List of gene specific primers used for PCR and RT-PCR for confirmation of transgenic plants of 1390pNGll and 1390pNG23.
PCR confirmation of 1390pNGll plants: The chimeric gene was analyzed by polymerase chain reaction (PCR) amplification. Different primer pairs mentioned in Table 1 and PCR conditions as mentioned in Table 2 were used. The use of these primers excludes the amplification of the endogenous NAD9 gene. Figure 3a shows the result obtained from transgenic plants containing Target peptide and Unedited NAD9 in sense orientation under the control of ubiquitin promoter.
PCR confirmation of 1390pNG23 plants: The chimeric gene was analyzed by polymerase chain reaction (PCR) amplification. Different primer pairs mention in Table 1 and PCR conditions as mentioned in Table 2 were used. The use of these primers excludes the amplification of the endogenous NAD9 gene. Figure 3b shows the result obtained from transgenic plants containing Target peptide and Unedited NAD9 in antisense orientation under the control of ubiquitin promoter.
Table 2: PCR conditions for different combination of primers used for confirming the 1390pNGl 1 and 1390pNG23 transgenic tobacco plants
EXAMPLE 3
Evidence of expression of transgene in the generated transgenic plants and altered
expression of other genes involved in the carotenoid biosynthesis pathway
Detailed steps involved in confirmation of expression of transgene:
RNA extraction: The total RNA was extracted from leaves of To transgenic and control tobacco plants using the Trizol method and later analyzed on the RNA gel for its quality. The extraction was carried out as follows:
100mg of leaf tissue was taken in prechilled mortar and ground in liquid nitrogen to fine powder. The powder was transferred to a prechilled eppendorf tube using a chilled spatula. 1ml of Trizol solution was added to the homogenized sample. Mixed well and incubated at room temperature (RT) for 5min. 200ul of chloroform was added to it and shook vigorously for 15 seconds. Incubated it at room temperature for 5 mins. The samples were centrifuged at 13000 rpm for 15min at 4°C. The upper aqueous phase was collected in a fresh tube. (~ 60% i.e 600 ml). 500 ml of cold Isopropanol was added to the upper phase collected and incubated at RT for 10min. Centrifuged the sample at 13000 rpm for 15min at 4°C. The supernatant was decanted and the pellet washed with 500 ml of 70°/j> alcohol (DEPC H20) and centrifuged at 10000 rpm for 5 minutes at 4°C. Decanted the supernatant and dried the pellet for 15 min at RT. The pellet was dissolved in 20 ml of DEPC treated H20 in a heating water bath or dry bath set at 55° C. 2 ml of the sample is loaded on the gel for checking quality and quantity. Stored the samples at -80° C till further use.
cDNA synthesis: 5 mg of total RNA extracted as mentioned above was used for cDNA synthesis. The synthesis of c-DNA is carried out as follows.
a) The components were added in the given order below.
Total RNA : 4ul
Oligo dT's : 0.5ul
0.1% DEPC water : 6.5ul
Total : 11ul
b) Heated the contents at 75° C for 5 minutes in a PCR machine and snap chilled in ice for 5 minutes.
c) Meanwhile prepared the next mixture by adding the following components in another tube.
5x reaction buffer : 4ul
dNTP's(l0mM) : 2ul
RNase inhibitor (20 U/ml) : 0.5ml
0.1 %DEPC/nuclease free water : 2mL
d) Added this 8.5ul mixture to the snap chilled PCR tube and mix gently, by tapping.
e) The PCR tube was placed at 37°C for 5 minutes in a PCR machine.
f) 0.5 µl of the M-MuLv Reverse transcriptase enzyme was added to the tube and continued the program set in the PCR machine. 25° C - 10 min; 3 7° C - 60 min; 70° C - 10 min.
RT-PCR analysis of T0 1390pNGll transgenic plants: The chimeric gene was analyzed by reverse transcriptase polymerase chain reaction (PCR) amplification. For confirmation of expression of gene of interest, cDNA synthesized was amplified using target peptide forward and NAD9 reverse primers. In addition the differential transcript analysis for enzymes involved in the carotenoid metabolic pathway was done using the primers mentioned in Table 4 and Table 5 indicates the PCR conditions used to amplify cDNA with gene specific primers and metabolic pathway primers. Figure 4a shows amplification of cDNA with primers of different genes in carotenoid biosynthesis pathway along with the results obtained from transgenic plants expressing target peptide and NAD9.
The differential expression of different genes in the carotenoid synthesis pathway in the To plants were analyzed by generating a scoring for the RT-PCR results obtained. Here the expression levels of each gene is compared with that of the control plants by assigning a higher value than the control in case of enhancement in expression rates, and a negative value is assigned in case of reduction in the expression levels. Over expression of beta Lycopene cyclase, beta-carotene hydroxylase and zeaxanthin epoxidase was observed in transgenic plants as compared to untransformed wild type plants indicating an accumulation of Zeaxanthin in transgenic plants.
Table 4: List of gene specific primers used for RT-PCR for expression profiling of different genes involved in carotenoid biosynthesis of transgenic plants
RT-PCR analysis of T0 1390pNG23 transgenic plants: For confirmation of expression of gene of interest, cDNA synthesized was amplified using target peptide forward and NAD9 reverse primers as mentioned in Table 1. In addition the differential transcript analysis for enzymes involved in the carotenoid metabolic pathway was done using the primers mentioned in Table 4 and Table 5 indicates the PCR conditions used to amplify cDNA with gene specific primers and metabolic pathway primers. Figure 4b shows amplification of cDNA with primers of different genes in carotenoid biosynthesis pathway along with the results obtained from transgenic plants expressing target peptide and NAD9.
The differential expression of different genes in the carotenoid synthesis pathway in the T0 plants were analyzed by generating a scoring for the RT-PCR results obtained. Here the expression levels of each gene is compared with that of the control plants by assigning a higher value than the control in case of enhancement in expression rates, and a negative value is assigned in case of reduction in the expression levels. Over expression of beta Lycopene cyclase, beta-carotene hydroxylase and zeaxanthin epoxidase was observed in transgenic plants as compared to untransformed wild type plants indicating an accumulation of Zeaxanthin in transgenic plants.
Table 5: RT-PCR conditions for NAD9 gene specific and tubulin primers used for analyzing the expression of the transgene and other genes involved in the carotenoid biosynthesis pathway in 1390pNGl lT0and 1390pNG23T0 transgenic plants
EXAMPLE 4
Evidence that the Introduced NAD9 gene increases the lutein content in plants Detailed steps involved in biochemical analysis of transgenic plants: Tobacco leaves from transgenic plants and controls were collected and analyzed for the average lutein accumulation in the leaves at different stages (green -4th leaf from bottom, yelIow-2nd leaf from bottom and cured yellow leaf -2nd leaf from bottom, dried for 3 days in dark at 70°C) by extraction of lutein using organic solvents.
The extraction of lutein was carried out as follows.
Lutein extraction: 0.5 g of leaf sample was weighed. Weighed sample was ground in pestle and mortar with nitrogen. Ground sample was then extracted with 2ml of Acetone for three times and collected in 10 ml. Centrifuge tubes and centrifuged for 5 minutes at 7500 rpm. Supernatant was pipetted out to 5ml test tube and the contents were dried in root evaporator. Dried sample was re-dissolved in Hexane. 100 ul of the sample was then further diluted and passed through micron filter and analyzed in HPLC.
The Lutein samples extracted from different stages of leaves in the TO transgenic tobacco plants were subjected to HPLC analysis to determine the average content of lutein accumulated in the leaves.
HPLC Condition: Mobile phase: Methanol: Dichloromethane: Acetonitrile, 20:20:60; Sample diluents: Mobil phase; Mode: Isocratic single pump; Column: C18 symmetry (4.6 X 250mm) 5μ particle size; Detector: Photo Diode Array, Wave length: 450 nm; Flow rate: 1ml/min isocratic pump; Injection volume: 20 ml; Run time: 25 minutes
Leutin content in the leaves:
Among the 1390pNG11 transgenic tobacco lines analyzed for leutin content, the leutin content from the older leaves of 1390pNGll-AlP2, C1P2, C2Pland D1P1 was more than the leutin content in the wild type plants (untransformed) (Figure 5a).
Among the 1390pNG23 tobacco line analyzed for leutin content, the leutin content from the older leaves of pNG23- A1P2, B1P1, C1P2 was significantly higher than that of the wild type plant, while D1P1 also showed a slight increase in the leutin content than the wild type (Figure 5b).
The greater effect of increment in leutin content was visible in the plants with antisense gene, we were able to show an increase in the carotenoid content more specifically of leutin using this technology. The observed increase in leutin content can be attributed to the disruption of the mitochondrial complex due to the unedited NAD9 gene or the NAD9 gene in the antisense orientation. Additionally NAD9 gene in the antisense orientation disrupts the functioning of the NAD9 gene as well as interferes with the proper functioning of other NAD genes leading to their silencing. The silencing of other NAD genes could be due to the certain level of homology between them. Nevertheless the increment in leutin content was achieved in either case of the NAD9 gene in sense or antisense orientation.
We Claim
1. A method of enhancing the carotenoids and other isoprenoids, preferably of xanthophyll, in a plant, plant cell, callus, tissue, fruit or other part and/or increasing the height in a plant, comprising: Impairment of mitochondrial function, preferably impairment of mitochondrial complex I, II, III and /or IV, more preferably mitochondrial complex I in said plant cell.
2. The method according to claim 1, wherein said impairment occurs using a modified protein component of mitochondrial complex I of said plant cell, preferably the protein component of mitochondrial complex I that is the translation product of an unedited coding sequence.
3. The method according to claims 1 - 2, wherein said impairment occurs by transforming said plant cell with a nucleic acid construct, preferably a DNA-construct, or by transforming said plant cell with a nucleic acid construct via Agrobacterium species-mediated transformation, preferably Agrobacterium tumefaciens, or by viral transfection using a suitable plant virus such as Tobacco Mosaic Virus or by protoplast transformation.
4. The method according to any of claims 2-3, wherein said nucleic acid construct, preferably said DNA-construct, or said Agrobacterium comprises a nucleic acid encoding said modified protein component of said mitochondrial complex 1 and the said modified protein component of mitochondrial complex I is a dysfunctional protein from another species than said plant cell or a dysfunctional protein of the same species as said plant cell.
5. The method according to claim 4, wherein said modified protein component of mitochondrial complex I is a dysfunctional protein selected from the group comprising NAD 1, 2, 3, 4, 4L, 5, 6, 7, 9, nuclear mitochondrial proteins 16 kDa, 55 kDa, 28.5 kDa, 22 kDa and Acyl carrier protein.
6. The method according to claim 5, wherein said nucleic acid encoding modified protein component is selected from the group comprising SEQ ID NO: 1, 2, 3,8,9,10 & the aminoacid sequence is selected from the group comprising SEQ ID NO: 4,5,6.
7. The method according to claims 2-6, wherein said nucleic acid construct, preferably said DNA-construct, or said Agrobacterium binary vector additionally comprises a nucleic acid sequence, a nucleotide sequence encoding for a mitochondrial transit peptide, promoter and a terminator, and said promoter, and terminator are operably linked to said nucleic acid encoding said modified protein component of said mitochondrial complex I.
8. The method according to claims 1 - 2, wherein said impairment occurs by mutating said plant cell with respect to at least one of the components of said mitochondrial complex I in said plant cell.
9. The method according to any of claims 1 - 2, wherein said impairment occurs by applying a chemical inhibitor of mitochondrial function or specifically mitochondrial complex I of said plant cell to said plant cell, part, intact entire plant, fruit and / or other plant organ.
10. The method according to claims 1-9 wherein the said nucleic acid construct is used for enhancing the content of carotenoids in a plant cell and/or increasing the height in a plant; wherein the amount of carotenoid, is enhanced to >10mg, preferably >15 mg, even more preferably >18 mg and most preferably >20 mg/l00g fresh weight of plant cells, callus tissue, plant or fruit.
| # | Name | Date |
|---|---|---|
| 1 | 249-che-2008 correspodence other 29-01-2009.pdf | 2009-01-29 |
| 2 | 249-che-2008 correspodence other 26-03-2009.pdf | 2009-03-26 |
| 3 | 249-CHE-2008 CORRESPONDENCE OTHERS 19-08-2009.pdf | 2009-08-19 |
| 4 | 249-CHE-2008 SEQUENCE LISTING 19-08-2009.pdf | 2009-08-19 |
| 5 | 249-che-2008 form-5 19-08-2009.pdf | 2009-08-19 |
| 6 | 249-che-2008 form-2 19-08-2009.pdf | 2009-08-19 |
| 7 | 249-che-2008 form-1 19-08-2009.pdf | 2009-08-19 |
| 8 | 249-che-2008 drawings 19-08-2009.pdf | 2009-08-19 |
| 9 | 249-che-2008 description (complete) 19-08-2009.pdf | 2009-08-19 |
| 10 | 249-CHE-2008 CLAIMS 19-08-2009.pdf | 2009-08-19 |
| 11 | 249-che-2008 abstract 19-08-2009.pdf | 2009-08-19 |
| 12 | 249-che-2008-form 5.pdf | 2011-09-02 |
| 13 | 249-che-2008-form 3.pdf | 2011-09-02 |
| 14 | 249-che-2008-form 1.pdf | 2011-09-02 |
| 15 | 249-che-2008-description(provisional).pdf | 2011-09-02 |
| 16 | 249-che-2008-correspondnece-others.pdf | 2011-09-02 |