Referenee to Related AppTieaQions This application claiins priority to U.S. Provisional Application No. 61/934,377 of the same title filed January 3 1,20 14, the entirety of which is specificaIly incorporated by refirei~ce. Background 1. Field sf the Invention The present ir-nvention relates to the field of recoinbinant protein production in bacterial hosts. K particular, the present invention relates to a production process for obtaining high ievels sf solubie recombinant Cm29p7ro tein from E. dl. The i~~vei~taiolsno relates to purification and characterization methods for CRM19a7s well as uses ofthe cm19pTro duced by the method. 2. Description of the Background Diphtheria toxin (DT) is a proteinaceoeasexotoxin synthesized and secreted by pathogenic strains of Co~neb~srferi~md@k~k~?rihTihee.s e pathogenic strains contain a bacteriophage Iysogenthat carries the toxin gene. Diphtheria toxin is an ADP-ribosylating emyrne tl-nat is secreted as a pmeizyrne of 535 residues and processed by tq-psin-like proteases with release of two fragments (A ai-nd B). Fragment A uses NAD as a substrate, catalyzing the cleavage of the Ngiycosidic: bond between the nicotinamide ring and the N-ribose and mediating the covalent transfer of the ADP-ribose QADPRT activity) to the modified histidine 7'1 5 Qdiphtharnide) of the elongation factor EF-2. This post-translational diphthamids insdification inactivates BF-2, halting protein synthesis and resulting in cell death. The A fragment of DT (also named C dornail~) carries the catalytic active site and is the only fragment of the toxin required for the final step of intoxication. The W domain, carried on the B hginent, mediates binding to receptors on the host cell surface ai~dth e T domain, also carried on the B fiapermt, promotes the pH-dependent transfer of fragment A to the cytoplasm, An Arginine-dch disulfide-Pinked loop coimects fragment A to fiapent B (or domain C to domains TW). This inter-chain disulfide bond is the only covalent link between the two fragments after pmteslytic cleavage of the chain at position 186. The isolation of various non-toxic and partially toxic immunologically crossresecting forms sf diphtl~eriato xins (CPXs or cross reacting materials) resulted in discovery of C M I(U~ch~ida el al., Journal of Biological Chemistry 248, 3845-3850, 1933; see alsoGiannini et sl.WucPeic Acids Res, 1884 May 25;12(10):4063-9). Preferably, C M s can be of any size and composition that contain all or a portion of DT. @M1is9 aT la rgelyenzymaticafly iiiactive and noi~toxicf orm or" diphtheria toxin th&t contains sn siirgle amino acid substitutioii GEE. This mutatioi~c auses intrinsic flexibility of the active-site loop in fioi~ot f the NAD-binding site and reduces the ability of @RM19t7o biiid NAD and eliminates toxic properties of DT (MaTZto et al.,ProcNatlAcadScr USA i 0311 4)rS223- 342012) Like DT, CHllg7ha s ~~o disulfide bonds. One &sulfide joins Cys186 to Cys201, linking fragment A to fragment B. A second disulfide bridge joins Cys46i to Cys471 within fragmei~Bt . Both DT and CM197 have fragment A-associated nuclease activity (Bruce e'c al., Proc. Nati. Acad. Sci. USA 87,2995-8, 1990). Many antigens are poorly immunogenic, especialiy in infants, unless chemically linked to a protein q'konjugation"), thereby forming a eorqjrrgate or conjugate vaccine. The protein component of these conjugate vaccii~esi s also called the "'carrier protein". C w l g 7is ~01mrnon1y used as the carrier protein for protein-carbohydrate and l~apten-protein conjugates. As a carrier protein, has a number sf advantages over diptheria tswoid as well as other toxoid proteins, many of which have been documented (Sl~hefi"ledVaccine2, 8:4335,2010, Broker et al, Biologicais, 39:195 201 1). For example since Cm197 is genetically detoxified: it retains a larger complement of lysines, which are used for conjugation but are blocked by chemical toxoiding. cMlg7ha s proven to be an effective carrier protein for S&eptococcus pneaemonia capsular polysaccharides, as evidenced by the success of PREWARTM (Pfizer), a vac~inec onsisting of up to 13 capsular polysaccharides chemically linked to ch&fi97T, here is also evidence J' suggesting that coinpared with tetanus toxoid, there is iess carrier-induced suppression of the iimmuile response, aspeciaiiy mihen there are many individual prsPysacchwides iinked to the same c&er protein. CW197 and native DT have a similar aafn'nnity for the diphtheria toxin receptor (DTR), which has om identical amino acid sequence to the HB-EGF precmssr pro-HB-EGF (Mihmura et al., J. Bisl, Chem. 2'72(43):27084-88, 1997). cwl97b inds to the so1ubPe form of Em-EGF, as well as to the meiabrme form pro-HE%-EGF, and inhibits HE%--EGFm itotic action by preventing its binding to EGF receptor. Thus @Mimsay7 al so have a future role in cancer therapy (Miyamoto et al., Anticancer Wes., Nov-Dec 27(6A):3713-21,2007). 6 = M l 9 7h as been produced in the original host Co~nebactmiuasab, ut yields are Pow, ty-pically . active sulfated resins, phosphate resins, or heparin or heparin-like resins. Preferably binding of @RM to resin is performed in a low salt buffer and eluted in higher salt buffer, yielding highly purified CRl~l~~~.Prefeb~in"di"inegd b uffers contain, for example, one or more chaotropic agents, NaCl, KCI, glycerol, isopropyl alcohol, ethan~ia, rginine, acetate, gpanidine, urea, ATP, one or more mono-, di-, tri-, and/or polyphosphates, sulfates or pyophosphates, ai~dco mbinations thered Preferred elution buffers contain, For example, higher concentration sf one or more c o ~ o n e n tosf the bh~dingb uffer, Other preferred purification methods include any one or combination of ananion emcliange chromatography, hydrophobic interactioim chromatography andor Cibacmn-Blue resin (CN P01265288A7 U,S.Pateirt No. $,383,7$3),Purification method of the invention produce recolabinsr~t C M protein (e.g., 6=m197) at high yields, 8s discussed herein, and with a purity level sf greater than 80%, preferably greater than 85%; preferably greater than 9094, preferably greater than 95%, preferably greater than 99%: and preferably with an eve11 greater purity, Another embodiment of the invention is directed to rnetl~odst o characterize recoinbinant DT and C M proteins (c.g., binding activity) and, in parti~rplar cm19T, which contain a receptor bindii~g domain (see SEQ ID NO 2). These methodscomprisc deteminatior~ of the binding activity ef proteins containing native or modified sequence of receptor binding domain of DT. Such modifieatiorqs preferably preserve the ability of Cl3.M to bind to HB-EGF (heparin binding epidermal go~'t11fa ctor). The method is applicable to both crude ar~dp urified CRAd197. Winding activity represents binding to the s~liibkf orm of diphtheria toxin receptor FIB-EGF (DTR).. These methods comprise, preferably, determining the binding @ M 1 9 7 to DTR and detection sf with rnolecuPes(e.g., antibodies, antibody fragmer~tts, antigens) specific 'rep the properly folded strictire, the complex, binding, and/or the binding sites, and preferably In an ELISA format. Assays to determine and quantitate bindii~ga llo~wforth e rapid deteminatioilthat CN'vl~gis~ correctly folded, as oi~iyp roperly folded CRM197bi nds to the receptor. Thus, the method mcmitors correct folding of i~ar~ufa~br@eRd Mr97m d related proteins during the development, production and purification process. In addition, this characterization rnethod can be used to identify and track @M protein after conjugation with another molecuIe such as in vaccine production. Using the detection method sf the inventiorn, properly folded and configured conjugated @RM protein can be monitored during the development of a vaccine fur the treatment andor prevention of diseases and disorders in patients. Another embodiment of the invention comprises methods for conjugating @W protein for vaccine pretdu~tion, such as, for example, by co~~jugatiorwr ith a polysaccharide. Also included are the ~csnjugatisn of proteins, peptides oligosascharides and haptens. Another embodiment sf the invention comprises a vaccine containing @RM protein of the invention. Another embodiment of the invention is directed to C M protein of the invention fi~sed genetically or chemically with another molecule, such as another protein or polysaecharida, Fusion is preferabJy by one or more covalent bonds between the molecules. The following examples illustrate cnnbodinne~~tssf the invention, but should not be viewed as limiting the scope of the invention. Examples Example I. CRM197 expressioa detected from expression vectors ssntaiaing "8 g9 9 sr 12 mpnclestides seqnenee between RBS and initial AT@ codoa. DNA encoded mature (JI'sP1/II97 -was cloned into expression vector in polycist~onilf: ormat resulting in the: PsIlowing sequence sf DNA regulatory and coding f'cagrncnts: tat promotel=. ribosome binding site-ATG eodon-T7 tqpribssolne: binding site-AT@ codon-CM coding seqaesce-stop codsn. Different E coli strains, including OFJGAMI 2, C41, were tested as expression strains Figure I). Example 2. @WlMn97e xpresses soiubie in Origami 2, R coli expression strain that aEIows formation of disnlfide bonds in the cytoplasm. CRM197 was etrpr-essed insoluble at 37°C. it%en expressioi~ temperature -was dropped below 37", solubiIity of the protein expressed in BNGAMirM 2 cells and SHUFFLEqM cells, bul not in fhe other tested E. coli strains, increases. is inostly sol~biew hen expressed in ORIGAMITM2 cells at 18°C. Example 3. Expression enhancer sequence (EES)i n cMlge7xp ression. The EES promotes &ms~riptioio?f CRM sequence iw a Cm-containing vector and results in polycisffonic mmA that trailslates into N-Qpr oteii~s;a short EES peptide and a @M peptide. The coding sequence of the native CRWI gene was analyzed for potential 3D structure formation and found to contain s number of potential hairpins, which could inhibit translation. A C Ms equel~cew as created that would potentially result in an mmA with no haiipii~ss tructures yet translate the same CKbl amino acid sequence. This gene sequence is referred to an optimized C M sequence and coinprises SEQ ID NO 8, The optimized CRM sequence expresses well in both E. coli (e.g., BE211 and in & coli engineered to contain an oxidized cytoplasm (e,g., Shuffle). @Wpe ptide trsei~slatedfr om polycistrsnic mWMA produces a full length protein and is believed to be more stable than the native @M coding sequence, Unlike the native CRM sequence, the optimized @M sequence expressed as fill-length and as a soluble protein in Shuffle cells, In addition, compared to native C M , higher expression of the optimized CFW sequence is observed with a lower cell density and with increased binding to chromatogaphy resin resulting in greater production levels of CPUM protein. Example: 4. Ammonium sulfate precipitation of CRlMIw from eePl Pysate. SWFFEETM cells expressing CMrs7 were opeir using mieroflnridizer and lM of sodium chloride was added to the cell lysate, To this was added enough ammonium sulfate to equal 1M follo~wedb y centrifugation for 38 minutes at 20,000~g , which removed mis-folded @ w 1 9 7a nd most of the bacterial proteins. Following clarification the ammonium sulfate concentration was further increased to 2.2M. The precipitate, which is mainly CPaIg7 was collected and resolubilized in a low c o n d ~ ~ t i ~bui tffye r. Example 5. Paaifieatisn sf 67RM197 on a Heparin eslnmn. Ammonium sulfate prec'lpitated Cm197 was resohbilized i i ~2O mM Tris-h-Cl pH 8.8 to achieve conductivity 5 mmS/cm aird loaded on an CO~U~II~cIo ntaining Heparin Sephai-ose CL-4B resin (GE). The purification was pei-forimed under the foilswing condit2011s: flow rste was Srnilixin: wash buffer A: 20i~MT i%-EiC1 pH8. Eiutiom was done wih a buffer B 0-108% gradient, buffer B: buEer A + 1M NaCT in 28 CV, Eluted @ M l 9 7 WBS analyzed by SDS-PAGE in recluced and non-reduced conditions. The purity of eluted cm19wa7s greater than 95%. The protein reduced with DTT appears as a single pslypeptideconfimii?g that the intact fonn of CRA41~71es xpressed in E, eoll'. Example 6, Purification sf on Capto D~v~Pc'osl,u mn, SHUFFLE^ cells expressing CRMi97 were opened using a microfluidizer in IxPBS, pH7.4, 1% sodium pyrophosphate. The lysate was clarified using depth filtratic3n.Clarifieci Iysate was loaded on a column containing Q Sepharose XL (GE) ai~dfl ow through fraction was collected. To reduce volume and conductivity flow through fraction was subjected to tangential flow filtration rasing 1 OK. cassette (Sartorius). Capto Devirs resin was equilibrated with 2TmM sodium phosphate buffer, pH8.0. CRM197w as bound to the coPumn ~lnderth e foilowing conditions: conductivity was Pesa than 18inSlcm, in a binding buffer contairning a chaotropic agent (e.g., in this case urea), wash buffer was 25mM sodium phospl~atep, HS.0, Elution was done with NaGl. Eluted CEhPdf197 was analyzed by SDS-PAGE under reduced a1d non-reduced conditions, The purity of eluted @ W P P / f was greater than 95%" The protein, reduced with DTT, appears as a single polypeptide confirming that CMrs7 remains intact during purification process. Example 9. Binding assay for the CMP97~P Para~fe~ization, The recombinant soPuble diphtheria toxin receptor HB-EGF (DTR) (Sigma) was bound to the ELISA plate. BIocking solution of 5% dry non-fat milk was used to prevent high backgonnd. Recombinant CRh4197d iluted in PxPBS, pH7.4,0.1%T win 20 was incubated on the plate for I hour at 37°C. CltA41~7b ound to HB-EGF was detected by rabbit polyclonal anti- CMn97 antibody and goat anti-rabbit antibody conjugated to soybean peraxidasa (Fina BioSolutions; Rochille, MD). Denatured reeoixbinant @RM197d id not bind to the receptor, Example 8, CRM19p7r oduced inn ,E3:,colbib idds ts DTR similarly to GRIM from Cory~ehacaerZ~a~nmd Psendoms~;~as~ ELISA plates were coated with soluble HB-EGF (heparin-binding EGF-like growth factor) and blacked with 5% dry non-fat inilk. was bound to the receptor and detected with rabbit anti-@M19ap olycloiial antibody and goat anti-rabbit polyclonal conjugated with SBP. CMl9r expressed iiz E.coli showed the same affinity to HEg-EGF as C M produced in Cokyvaebacteriu~raa nd ~ s ~ u ~ Q ~ o M ~ . Example 9 CMlra is a carrier protein @RIMIg7w, as expressed and padfied according to the metl~odo f this inventicri~( Exaixpla 1) and chemically linked ( c ~ i i ~ g a ttdo )p neumococcal cspsale polysacchafides serotypes 14 and 6B usiing CDAP cheinis'try (Lees, A., Producing iimiinogei~ico astmcts using sol~ble carbohydrates activated via orgaaic cyanylating rezgents. See U.S. Patent Nos. 5,55 1,971; 5,693,326 and 5,849,301). The conjng8tes were pwified from ui~coajugatedp mtein iind polysaccl~axideB. ALB/c female mice were immunized subcutaneously with the conjugate accWd-dii?gt o the schedule in Table 1.Mice were immunized i i ~co mplete Freiind's adjuvaat and boosted twice in incomplete Freund's adjuvant and day 57 bleeds were taken. Sera was tested for reactivity by ELPSA on a Bra~ndtechImmlano~adpela te coated with 2 Table P pg/mT of Pn6B or Pni4(from ATCC) using gamma-specific detection. Resuits III Figure 2 show a strong reactivity with Pn4B. Mouse 5086 was used for hybridoma production and thee of the D57 bleed bleed Serotype 6B 14 resulting hybridomas were used to prepare highly specific mouse anti-6B monoclonal antibodies. +60% Complete Freund's Adjuvant; **6Q% Incomplete Freund's Adjuvant The results of the s e m titration against Pn14 coated plates are shown in Figure 3, Mouse I397 was subsequentiy use62 fisr Qe production of four highly specific mouse moi~oclrgnaal i~tibodies Primzq- in @FA* 20 ug 20 ug reactive with P14 po~ysaccharide.~nconjugatepdo lysac~harided oes not give a significant EElSA absorbance, Qthar embodiments and uses of the invention will be apparent to those skiljed in the ai-t ~ o o sItF A*" 10 ug day 28 5 ug day 21 from consideration of the specification and practice of the invention disclosed hereii~, All Boost IFA** 10 ~ idga y 48 5 ug day 48 references cited herein, including all publications, U.S, md foreign patents and patent applicatioi~s,a re specifically and entirely incorporated by reference. The tenn comprising, where ever used, is intended to include the terns coirsistilig and consisting essei~tiailyo f. Ful.ehemore, the terms comnpi-ising, including: containing and the like are not illtended to be limiting. It is intended that the specification and examples be considered exemplary only with the true scope and spirit of the invention indicated by the followiirg claims. Sequences SEQ ID NO P @ ~ I I S % GADDVVDSSK SFVMENFSSY HGTUGwDS TQKGIQIWKS CTQGNYDDDWIW? YSTDNMY DMGYSVEDm NPESGUGGV VKVTYPGLTK VLAEKVDNAE TIwTEL@LSL TEPLMEQVGT EEFIKRFG DG ASRV'hrE%LPF AEGSSS'JEYI rJMmQAKALS VEEEIF-FE TR GFXGQDAMtT YMAQACAGNR VlXRSVGSSLS ClNEDWrEJBrR. DKTKTKIESE KEHGPIKNi SESPNKTVSE EBXKQYLE EF HQTALEHPEL SEEKTVTGiN PVPAGANYM -WAVN-.M.A$VID SETADPITLEKT TMESILPGI GSVMGIADGA T I v QSMESSLW AQAIPLVGEL VDIGFMYNF VESIWLF QV V I l N S m A Y PGHKTQPFE HDGYAVSWNT WDSIWT GF QGESGHDIH TAENTPEPIA GVLLPTIPGK LDWKSKT HI SWGCMIDGDVTF CWKSIEVnrG NGWlX4NLH WA FHRSSSEKTM SNEISSDSIG VLGYQKTWDH TKBrMSUS LF FEIKS SEQ ID NO 2 Domain sf CRMP97 SPGHKTQPFL HDGYAVSWNT VEDSIIRT GF QGESGHDIKI TAENTPEPW GVLLPTIPGK EDW-RSRT EII S-V'NGRKIW CMDGDVTF CWKSPVYVG WGVHANLH VA FHFtSSSE=H SNEPS$DSIG VEGYQMTVDH TKWSmS LF FEIKS 8EQ ID NO 3 GATATAC spacer SEQ ID NO 4 GATATACCA spacer SEQ ID NO 5 GATATACCATAT spacer SEQ ID NO 6 XBBXBX putative heparin biirding site SEQ ID NO 9 GPA-IZR heparin binding site SEQ jD NO 8 Optimized @RM sequence SEQ ID NO 9 Not optimized C M sequence SEQ ID NO 18 srm 7 GAG@TCTA4GAA@C-AG14TATACATGGGTGCC3GATGACGTGGTTGACTCT SEQ D NO 12 cm 8 GAG@TCTMGUGGAGATd%TACAATGGGTGCCGATGACGTGGTTGACTCT SEQ ID NO 13 cria 9 GAGCTCT~G~G@-AGATATACA@ATG@GTGCCGATGA@GT@GTTGACTCT SEQ ID NO I5 SEQ ID NO17 We Claim 1. A method of producing all or a pofcisl~o f a @Mpro tein comprising: providing a recombinant cell that contains an expression vector that contains an irrdi~ciblep romoter finctionaiPy linked to a polycistronic genetic sequence wherein at least or~e ~istrone ncodes the C Mp rotein; inducing the expression vector to produce CI&PdI protein; and isolating the C M protein expressed. 2. The emethoci of ciaim 1, wherein the recombinant ceII has a reduced activity of one or inore disuifide reductase enzymes. 3. The method of claim 1, wherein each cistroncontains a ribosome binding site and an initiation codon. 4. The method sf claim 1, wherei1-i the polycistronic genetic sequence contains at least one spacer between one or more ribosome binding sites and one sr more initiation codons. 5. The method of claim 1, wherein the 47IgIB.T protein expressed by the cell is soluble. 4. The method of claim I, wherein the @RIM protein expressed is intracellular, periplasrnic or secreted. 7. The method of claim I, wherein the recombinant cell is propagated at a temperature from about P 5°C to about 32°C. 8. The method sf claim I, wherein the @RM protein is isolated from the cell by chromatography, 9. The method of claim 8, wherein the chromatography comprises a dextral sulfate resin, a gel resin, an active sulfated resin? a phosphate resin, a heparin resin or a heparin-like resin. 18. CF4.M protein isolated by the method of claim 8, I 1. A method of producing all or a portion sf a @RM protein comprising: providing a recombinant cell that contains an expression ve~tor, wherein the recombinant cell has been modified to shifi the redox status of the cytoplasm to a more oxidative state as compared to an unmodified recoinbinar~t cell and the expression vector contains an il~duciblep romoter fmctionally linked to a @RIM coding sequence, a spacer sequence between a ribosor-rre binding site and a start codon such asan initiation codon, an expression enhancer region upstream of the CRP1/I coding sequence; inducing the expression vector to produce CRM protein; ai~d isolating the CKM proteiii expressed. 12. The method sf ciaim 11, wherein the recombinantceli is an E. ceoli cell or a derivative or strain of E. codz. 13. The method of claim 11, evherein the recombinant ceii modifica'rio~c~o mprises a reduced activity of one or more disulfide reductase enzymes. 4 . The method of ciaiin 13, wherein the one or more disuifide reductase enzymes comprises one or more of ail ruxidoreductase, a dihyQ-sfdate reductase, a thioredoxin reductase, a protein reductase or a glutathione reductase. 15. The method of claim I1 , wherein reduced activity sf the one or more disrmlfide reductase enzymes shifts the redox state of the cytoplasm of the recombinant celi to air oxidative state as coinpared with a non-recoinbinant cell. 16. The method of claim i I, wherein the @M coding sequence encodes one or more C M epitopes? Cl3.M peptide sequences: C M domains, or combinations thereof. 17. The metl~odo f claim P I, wherein the @Mco ding sequence encodes CRh419'~. 18. The method of claim P I, wherein the spacer comprises more or less than 9 nuclestides. 19. The method of claiin P 8, wherein the spacer comprises between 5 aiid 20 nncleotides. 20. The method of claim 11, wherein the expression enhancer coinprises a ribosoi-me binding site upstream sf the C M coding sequence and an ATG codon, 2 1. The method of claim P I, wherein the C M protein expressed by the eeil is soluble. 22, The method of claim I 1, wherein the C W protein expressed is intraceilular, periplasmic or secreted. 23. The method of claim 1 1, wherein the recombinant cell is propagated at a temperature from about P 5 O C to about 32'@. 24. The method of claim 11, wherein the @M protein is isolated from the cell by chomatogaphy. 25. The method sf claim 24, wherein the chromatography colnprises a dextran sulfate resin, a gel resin, an active sulfated resin, a phosphate resin, a heparin resin or a heparin-like resin. 26. CPM protein isslated by the method of elaim 24. 23. The method of claim 1 1? fiirther a;omprisfng conjugating the isolated C M protein. 28. The method of claim 27, wherein the conjugated @RM protein is a vaccine. 29. A CRM protein vaccine produced by the method of claim 28. 30. A me'chod of producing ail or a portion sf a C M prsteiir corxpi-ising; prouridii~g a recombinant iell that contains an expression vector, wherein the expression vector coi~tainsa promoter fui~ctionallyl ir~kedto a C Mc odii~gs equence; expressing @M protein from tlre CRNI coding sequence; afid isolating Zhe @&Xi protein expressed. 3 1. The inethod of claii-n 30, wherein the recombinant cell is a prokaryotf~ or a euka~yotic ceIP. 32. The method of claim 3 1, wherein the prokrrq-oti~ce ll is an E. coEi cell or a derivative or strain of E. coli. 33. The method of claim 30, wherein the promoter is constitutive or inducible. 34. The method of claim 30, wherein the @M coding sequence encodes one or more CRM epitopes, C M peptide sequences, @M domains, or combinations thereof. 35. The method of claim 30, wherein the @M coding sequence encodes CRM197. 34. The method sf claim 30, wherein the recor~binant cell has been modified to shift the redax stah9 of the c;gicopIasm to a more oxidative state as compared to an unmodified recombinant cell. 3'7. The method of claim 36, wherein the modifid recombinant cell has reduced activity of one or more disulfide reductase enzymes. 38. The method of claim 37> wherein the one or more disulfide reductase enzymes comprises one or more of an oxidoredu~tase, a dihydmfolate reductase, a thioredoxin, a thioredoxh reductase, a protein reductase or a glutathione reder~tsnse. 39. The method of claim 38, wherein the expressioii vector contains st spacer sequence between a ribosome binding site and an initiation codon, 40. The method of claim 39, wherein the spacer comprises more or less than 9 nuclestides, 4 The inelPlod of claim 39, wherein the spacer comprises bemeen 5 and 20 nracleotides. 42. The method of chiin 30, wherein the expression vector contains an expression enhancer. 43. The method of claim 303 wherein the expression enhancer coinprises a ribosome binding site upstreain of the C M coding sequence and an initiation codon. 44. The method of chiin 38, wherein isolating comprises: loading the G M protein oilto a chromatography column containing a resin with a ioading buffer; washing .the resin with one or inore washing buffers; eluting C W protein from the resin with an elution buffer. 45. The method of claii~4 4, wherein the loading buffer and the washing buffer may be the saine. 44. The method of claim 44, wherein the loadii~gb uffer tiid the one or more washing buffers aw low conductivity buffers that have a conductivity of about 20 rnS/crn or less. 47. The method of claim 44, wherein the elution buffer is a high conductivity buffer with a conductivity of about 2 0 raS/cm or more. 48, The method of claim 44, wherein the resin is selected from fhe: group consisting of a dextran sulfate resin, a gel resin, an active sulfated resin, a phosphate resin, a heparin resin or a heparin-like resin. 49, A method sf characterizing folding sf diphtheria tsxir~o r. @RIMp rotein comprising: contacting diphtheria toxin or C M protein to EB-EGF; determining the amount of birrding of diphtheria toxin or C M protein to FIB-EGF; and determining the folding of diphtheria toxin or @M protein by the amount sf binding determined, wherein binding iildicates correct folding, 58. The method of claim 49, wherein the diphtheria toxin or @lW contains a receptor binding domain, 5 P , The method of characterizing folding of @IM protein according to claim 49, \wherein the @M protein colnprises @RM197. 52. The method of elaim 49, wherein at least one of the diphtheria toxin or CRM protein and the ]HE%-EGF is bound to a solid support. 53, The method of ciairn 49, wherein the amount of binding of diphtheria towin or. @M protein to HB-EGF is determined by an EEISA, 54. The method of claim 49, wherein C M protein that binds to HB-EGF is soPwabPe in PBS and conceirtrated to 5 inghi or greater in a buffer of about pH 7.5. 55. Am expression vector comprises a promoter aid two or more cistronseaeh encoding a proteii~w, herein at least one cistron encodes CRM protein ai~dea ch cistron has a ribosome binding site and an initiation codon, 56. The expression vector of claim 55, hTth~r comprising a spacer between the ribosome binding site and the initiation codon, 57. The expression vector of claim 56, wherein the spacer comprises from 5 to 20 i~uclestides. 58. The expression vector of claim 56, whereii~th e spacer does not comprise9 nucleotides.