Sign In to Follow Application
View All Documents & Correspondence

Expression Of The Cysteine Protease Legumain In Vascular And Inflammatory Diseases

Abstract: The present invention provides isolated and purified polynucleotides, polypeptides, and antibodies related to mammalian (e.g., mouse and human) legumain and the novel legumain splice variant, ZB-I. The invention further relates to the use of these isolated and purified polynucleotides, polypeptides, and antibodies, as well as other legumain and ZB-I agonists and antagonists, in modulating legumain and/or ZB-I activity, expression, and/or secretion in a cell or cell population, e.g., monocytes, macrophages, foam cells, vascular endothelial cells, kidney proximal tubule cells, arterial endothelial cells, sites of inflammatory cell invasion into a vessel intima, and neointimal lesional areas of an artery. The invention also provides legumain and ZB-I antagonists, e.g., antagonistic small molecules, antibodies and antibody fragments to legumain and ZB-I, legumain and ZB-I inhibitory polypeptides, and legumain and ZB-I inhibitory polynucleotides. The present invention is also directed to novel methods for diagnosing, prognosing, monitoring, treating, ameliorating and/or preventing vascular disorders / diseases and inflammatory disorders / diseases.

Get Free WhatsApp Updates!
Notices, Deadlines & Correspondence

Patent Information

Application #
Filing Date
29 October 2008
Publication Number
10/2009
Publication Type
INA
Invention Field
BIOTECHNOLOGY
Status
Email
Parent Application

Applicants

WYETH
FIVE GIRALDA FARMS, MADISON, NJ

Inventors

1. CLERIN, VALERIE
32 HARDY AVENUE, WATERTOWN, MA 02472
2. SHIH, HEATHER, H.
7 JOYCE TERRACE, ANDOVE, MA 01810
3. SHIELDS, KATHLEEN
157 SHAKER ROAD, HARVARD, MA 01451
4. FELDMAN, JEFFREY
1 OLD COLONY LANE, APT. 12, ARLINGTON, MA 02476
5. HERBERT, GUSTAVE, T.
75 WINDSOR STREET, APT. 2, ARLINGTON, MA 02474
6. PITTMAN, DEBRA, D.
20 NORTH SHORE ROAD, WINDHAM, NH 03087
7. DENG, NANHUA DAN
135 PLEASANT STREET, APT. 411 BROOKLINE, MA 02446

Specification

EXPRESSION OF THE CYSTEINE PROTEASE LEGUMAIN IN
VASCULAR AND INFLAMMATORY DISEASES
Related Applications
[0001] This application claims the benefit of priority from U.S. Provisional
Patent Application Nos. 60/808,381, filed May 25, 2006, and 60/837,604, filed
August 15, 2006, the contents of which are hereby incorporated by reference
herein in their entireties.
BACKGROUND OF THE INVENTION
Field of the Invention
[0002] This invention relates to legumain and the use of legumain in regulating
vascular disorders / diseases and inflammatory disorders / diseases. This
invention additionally relates to a novel splice variant of legumain, designated
ZB-1. The methods and pharmaceutical compositions disclosed herein are
useful to diagnose, prognose, monitor, treat, ameliorate and/or prevent vascular
disorders / diseases and inflammatory disorders / diseases.

Related Background Art
[0003] Cysteine proteases (CPs) are a related class of ubiquitous enzymes that
are classified in mammals as protein clans based on the structural organization
of the enzyme active site (Dickinson (2002) Crit. Rev. Oral Biol.
Med. 13:238-75). The mammalian CP clan includes, inter alia, the CA clan,
which is comprised of protease members having structural and evolutionary
commonality with papain, and the CD clan, which contains caspases and
legumain (id.). Legumain, also known as asparaginyl endopeptidase (AEP) or
osteoclast inhibitory peptide 2 (OIP-2) (Choi et al. (2001) J. Bone Miner. Res.
16(10):1804-11), is encoded by the PRSC1 gene (Tanaka et al. (1996)
Cytogenet. Cell Genet. 74:120-23), and is a relatively new member of the CD
clan, with strict specificity for hydrolysis of asparaginyl bonds at the PI site of
the substrate sequence (Chen et al. (1997) J. Biol. Chem. 272:8090-98).
Legumain belongs to the CI 3 family of cysteine proteases that include caspases
and separases (Ishii (1994) Methods Enzymol. 244:604-15). Legumain is a
unique lysosomal cysteine protease that does not share homology with the
papain family of lysosomal proteases to which the cathepsins belong. Under
physiological conditions, legumain is present in acidic endosome/lysosome
compartments and functions in intracellular protein degradation (Shirahama-
Noda et al. (2003) J. Biol. Chem. 278:33194-99). Legumain may play a role in
antigen presentation (Manoury et al. (1998) Nature 396:695-99), although
legumain-deficient mice do not exhibit defects in antigen presentation of the
invariant chain or maturation of class II MHC products (Maehr et al. (2005) J.
Immunol. 174:7066-74).
[0004] Legumain is a lysosomal endopeptidase that is highly conserved in
mammals, with mouse and human legumain displaying about 83% amino acid
identity (Chen et al. (1998) J. Biochem. 335:111-17), and human and pig
legumain displaying about 84% amino acid identity (Chen et al. (1997) supra).
[0005] Legumain protease expression and activity have been evaluated in scores
of various tissues (see, e.g., PCT Publication No. WO 05/075675), and found to
be detectable in many; high peptidase activity occurs in the kidney (Chen et al.

(1998) supra), particularly in kidney proximal tubule cells (Shirahama-Noda et
al. (2003) supra). Legumain is additionally expressed in monocytes, where it is
believed to play a role in antigen and/or cathepsin L processing (Wolk et al.
(2005) Genes Immun. 5:452-56; Maehr et al. (2005) supra; Watts (2005)
Immunol. Rev. 207:218-28; Alvarez-Fernandez et al. (1999) J. Biol. Chem.
274:19195-203). Interestingly, the expression of legumain is upregulated
during the differentiation of human blood monocytes into dendritic cells, as well
as during the activation of human blood macrophages by M-CSF (Li et al.
(2003) J. Biol. Chem. 278:38980-90; Hashimoto et al. (1999) Blood 94:837-44).
Legumain has also been reported to play a role in osteoclast formation and bone
resorption (Choi et al. (1999) J. Biol. Chem. 274:27747-53), endotoxin tolerance
(Wolk et al., supra), and epidermal cornification (Zeeuwen et al. (2004) Hum.
Mol. Genetics 13:1069-79). Several protein substrates have been identified for
legumain, including MMP2 (Chen et al. (2001) Biol. Chem. 382:777-83),
cathepsins H, B, and L (Shirahama-Noda et al. (2003) supra), and a-thymosin
(Sarandeses et al. (2003) J. Biol. Chem. 278:13286-93).
[0006] Legumain is expressed as a zymogen that is autoactivated by sequential
removal of C- and N-terminal propeptides (e.g., cleavage at the N-termimis
occurs at residue Asp25 or Asp21, while cleavage at the C-terminus occurs at
residue Asn323) at different pH thresholds, which is believed to be controlled by
endosomal acidification or progress through the endosome/lysosome system (Li
et al., supra; Kato et al. (2005) Nature Chem. Biol. 1:33-38; Chen et al. (2000)
Biochem. J. 352:327-34). The mature legumain protein is additionally
N-glycosylated, and displays protease activity that is largely dependent upon
low pH, i.e., less than about pH 6.0 (Chen et al. (1997) supra).
(0007] Legumain is inhibited by certain cystatins (e.g., ovocystatin and
cystatins C and M (see, e.g., PCT Publication No. WO 00/064945 and
Vigneswaran et al. (2006) Life Sciences 78:898-907)) and inhibitors of thiol-
dependent enzymes (e.g., iodoacetates, iodoacetamides, and maleimides), but is
unaffected by the papain inhibitors E64 (trans-epoxysuccinyl-L-leucylamido-
(4-guanidino)butane), leupeptin, and Z-Phe-Ala-CHN2 (id.; Rozman-Pungercar

et al. (2003) Cell Death Diff. 10:881-88; Vigneswaran et al., supra; Chen et al.
(1998) supra). Certain fluoro- and chloromethylketone peptide caspase
inhibitors (such as those disclosed in Rozman-Pungercar et al., supra), and anti-
legumain antibodies (Choi et al. (1999) supra) also inhibit legumain activity.
[0008] Various synthetic compounds have also been shown to inhibit legumain
protease activity, including aza-peptide Micheal acceptors/inhibitors (Niestroj et
al. (2002) Biol. Chem. 383:1205-14; Ekici et al. (2004) J. Med. Chem.
47:1889-92; Gotz (2004) "Design, Synthesis and Evaluation of Irreversible
Peptidyl Inhibitors for Clan CA and Clan CD Cysteine Proteases" Thesis
Dissertation, May 2004, Georgia Institute of Technology), aza-peptide epoxides
(Gotz, supra; Asgian et al. (2002) J. Med. Chem. 45:4958-60; James et al.
(2003) Biol. Chem. 384:1613-18; U.S. Patent No. 7,056,947), methylketones
(such as acyloxymethylketones, e.g., 2,6-dimethyl-benzoic acid
3-benzyloxycarbonylamino-4-carbamoyl-2-oxo-butyl ester [MV026630] as
disclosed in Loak et al. (2003) Biol. Chem. 384:1239-46, and
halomethylketones, e.g., those disclosed in Niestroj et al., supra), and other
synthetics (see, e.g., U.S. Patent No. 6,004,933; PCT Publication Nos.
WO 03/016335 and WO 99/048910; Yamane et al. (2002) Biochim. Biophys.
Acta 1596:108-20 (disclosing inhibition of legumain by
p-chloromercuribenzene-sulfonic acid, Hg2+, and Cu2+); and Li et al., supra
(disclosing the reversible AEP inhibitor Fmoc-AENK-amide)).
[0009] Atherosclerosis is a generalized and inflammatory vascular disease of
the arterial blood vessel, commonly referred to as "hardening" of the arteries,
which results from fat deposition inside the vessel wall. The initial step of
atherogenesis is the formation of fatty streaks, which are largely comprised of
foam cells, i.e., macrophage cells filled with massive amounts of phagocytosed
cholesterol (e.g., Greaves and Gordon (2005) J. Lipid Res. 46:11-20). It is
believed that these streaks are initiated by the adherence of monocytes to
activated endothelial cells in the arterial cell walls (id.). Adherent monocytes
then migrate from the vessel lumen into the subendothelial space of the vessel
intima (i.e., the neointima), in the process known as extravasation, where they

differentiate into macrophages that recognize and engulf low-density
lipoproteins (LDLs) via scavenger receptors such as CD36 and SR-A
(Wasserman and Shipley (2006) Mt. Sinai J. Med. 73:431-39; Lucas and
Greaves (2001) Expert Rev. Mol. Med. 5:1-18). Over time, smooth muscle cells
of the vessel media also begin to proliferate and migrate into the neointima
where they accumulate cholesterol, becoming smooth muscle-derived foam
cells (id.). Both smooth muscle-derived and macrophage-derived foam cells
eventually necrose, leaving a lipid-filled core that is enriched with matrix
molecules and cellular debris, and which is walled-offfrom the lumen of the
artery by a matrix cap secreted by the remaining smooth muscle cells (id.). The
resultant structure is an atherosclerotic lesion, which is covered by a fibrous
"atherosclerotic" or "atheromatous" plaque.
[0010] Because the inelastic atheromatous plaque thickens the vessel wall,
thereby decreasing the arterial lumenal diameter, the artery expands in size,
resulting in arterial aneurysms (Wasserman and Shipley, supra; Stary et al.
(1995) Circulation 92:1355-74). If the expansion is insufficient to expand the
lumen of the artery in relation to the thickening of the artery wall, stenosis
results {id.). Moreover, the thinner and weaker fibrous caps (i.e., "vulnerable"
or "unstable" caps) often rupture (Wasserman and Shipley, supra). During
plaque rupture, inflammatory cells localize to the shoulder region of the
vulnerable plaque (Lucas and Greaves, supra). In this area of the lesion, T
lymphocytes (CD4+) secrete IFNγ, an inflammatory cytokine mat impairs
vascular smooth muscle cell proliferation and collagen synthesis, which
weakens the atheromatous plaque (id.). In addition, activated macrophages
within the lesion produce matrix metalloproteinases (MMPs) that degrade
collagen {id.). These mechanisms highlight the role of inflammatory cells in the
denudation and rupture of the fibrous cap.
[0011] Plaque rupture may result in thrombosis due to platelet aggregation at
the rupture site, partial or complete occlusion of the blood vessel, and
progression of the atherosclerotic lesion due to incorporation of the thrombus
into the atherosclerotic plaque. Thrombus formation and accumulation in the

artery enhances the stenosis already induced by the presence of the
atheromatous plaque, resulting in obstruction of blood flow (i.e., ischemia or
stroke) to downstream tissues, such as heart or kidney (id.). Platelet-derived
growth factor (PDGF), insulin-like growth factor (IGF), transforming growth
factor (TGF) alpha and beta, macrophage colony stimulating factor (M-CSF),
thrombin, macrophage chemoattractant protein-1 (MCP-1), and angiotensin 11
are mitogens produced by activated platelets, macrophages, and activated
endothelial cells at sites of endothelial cell disruption that characterize early
atherogenesis, vascular inflammation, and atherothrombosis (id.).
[0012] Proteolysis is a pathological event involved in multiple aspects of
atherogenesis, including the infiltration of leukocytes into subendothelial space,
the migration of SMCs into the intima, the degradation of the extracellular
matrix and destabilization of the plaque, and neovascularization (Liu et al.
(2004) Arterioscler. Thromb. Vase. Biol. 24:1359-66). A number of proteases
have been implicated in the development of atherosclerosis. In addition to
metalloproteases (MMPs) and serine proteases, the lysosomal cysteine proteases
have recently been linked to atherogenesis. For example, deletion of cathepsin
S, K or L led to reduced atherosclerosis in LDLR-/- or ApoE-/- mice,
demonstrating a functional role for these cysteine proteases in atherogenesis
(Sukhova et al. (2003) J. Clin. Invest. 111(6):897-906; Lutgens et al. (2006)
Circulation 113(1):98-107; Kitamoto et al. (2007) Circulation
115(15):2065-75). Recently, the legumain gene was found to be differentially
expressed in stable and in unstable human atherosclerotic plaques
(Papaspyridonos et al. (2006) Arterioscler. Thromb. Vase. Biol. 26:1837-44.).
SUMMARY OF THE INVENTION
[0013] The present invention provides various methods and compositions
related to mammalian legumains, e.g., human, mouse, and pig legumain, and
mammalian legumain splice variants, particularly the novel splice variant ZB-1.
In the present study, the inventors document the gene and protein expression of
legumain in mouse models of atherosclerosis and further characterize legumain

expression in human atherosclerotic tissue. In addition, the inventors report that
macrophage-expressed legumain may contribute to atherogenesis via protease-
dependent as well as protease-independent mechanisms.
[0014] In at least one embodiment, the invention disclosed herein provides a
polynucleotide comprising the nucleic acid sequence set forth in SEQ ID
NO: 11. In another embodiment, the polynucleotide comprises a nucleic acid
sequence that hybridizes under high stringency conditions to the nucleic acid
sequence or the complement of the nucleic acid sequence set forth in SEQ ID
NO: 11. In another embodiment, the invention provides a polynucleotide
comprising a nucleic acid sequence that encodes an amino acid sequence
selected from the group consisting of the amino acid sequence set forth in SEQ
ID NO: 12, amino acids 21 to 323 of SEQ ID NO: 12, amino acids 25 to 323 of
SEQ ID NO: 12, and other active fragments of SEQ ID NO: 12. In another
embodiment, the polynucleotide comprises a nucleic acid sequence that
hybridizes under high stringency conditions to a nucleic acid sequence or a
complement of a nucleic acid sequence that encodes an amino acid sequence
selected from the group consisting of the amino acid sequence set forth in SEQ
ID NO: 12, amino acids 21 to 323 of SEQ ID NO: 12, amino acids 25 to 323 of
SEQ ID NO: 12, and other active fragments of SEQ ID NO: 12. In other
embodiments, a polynucleotide with a high sequence identity to one or more of
these sequences is provided.
[0015] In at least one embodiment, the invention disclosed herein provides a
polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 12,
amino acids 21 to 323 of SEQ ID NO: 12, or amino acids 25 to 323 of SEQ ID
NO: 12. In another embodiment, the invention provides a polypeptide encoded
by the nucleic acid sequence set forth in SEQ ID NO: 11. In another
embodiment, the invention provides a polypeptide encoded by a nucleic acid
sequence that hybridizes under high stringency conditions to the complement of
the nucleic acid sequence set forth in SEQ ID NO: 11. In other embodiments, a
polypeptide with a high sequence identity to one or more of these sequences is
provided.

[0016] In at least one embodiment, the invention disclosed herein provides an
antibody or antigen binding fragment thereof that specifically binds a
mammalian ZB-1 polypeptide or a fragment of a mammalian ZB-1 polypeptide.
In another embodiment, the mammalian ZB-1 polypeptide or the fragment of a
mammalian ZB-1 polypeptide is derived from a human. In another
embodiment, the human ZB-1 polypeptide comprises the amino acid sequence
set forth in SEQ ID NO:12 or an active fragment of the amino acid sequence-set
forth in SEQ ID NO: 12. In another embodiment, the antibody or antigen
binding fragment thereof is antagonistic or agonistic.
f0017] In at least one embodiment, the invention disclosed herein provides a
pharmaceutical composition comprising a therapeutically effective amount of
ZB-1 and a pharmaceutically acceptable carrier.
[0018] In at least one embodiment, the invention disclosed herein provides the
use of a legumain antagonist and/or a ZB-1 antagonist for the preparation of a
pharmaceutical composition for use in a method of treating, ameliorating, or
preventing a vascular disorder or an inflammatory disorder, wherein the
pharmaceutical composition comprises a therapeutically effective amount of the
legumain antagonist and/or the ZB-1 antagonist, and a pharmaceutically
acceptable carrier. In another embodiment, the disorder is an inflammatory
disorder. In another embodiment, the inflammatory disorder is selected from
the group consisting of arthritis, tuberculosis, multiple sclerosis, Crohn's
disease, or ulcerative colitis. In another embodiment, the disorder is a vascular
disorder. In another embodiment, the vascular disorder is selected from the
group consisting of atherosclerosis, congestive heart failure, myocardial
infarction, arrhythmia, atrial arrhythmia, ventricular arrhythmia, stenosis,
aneurysm, peripheral vascular disease, peripheral arterial disease, chronic
peripheral arterial occlusive disease, thrombosis, atherothrombosis, deep venous
thrombosis, acute arterial thrombosis, embolism, inflammatory vascular
disorders, Raynaud's phenomenon, vasculitis, arteritis, venous disorders,
hypertensive vascular disease, claudication, angina, stable angina, unstable
angina, stroke, peripheral artery occlusive disease, coronary artery disease,

acute coronary syndrome, metabolic syndrome, ischemia, reperfusion, chronic
kidney disease, end-stage renal disease, diabetic nephropathy, hyperlipidemia,
hypertension, and diabetes. In another embodiment, the legumain antagonist
and/or ZB-1 antagonist is selected from the group consisting of inhibitory
polynucleotides, inhibitory polypeptides, small molecules, antagonistic
antibodies and antigen binding fragments thereof. In another embodiment, the
inhibitory polynucleotide is selected from the group consisting of antisense
polynucleotides, siRNA molecules, ribozymes, and aptamers. In another
embodiment, the inhibitory polypeptide is selected from the group consisting of
cystatins or active fragments thereof, aza-peptide Micheal acceptors/inhibitors,
aza-peptide epoxides, fluoromethylketone peptide caspase inhibitors, and
chloromethylketone peptide caspase inhibitors. In another embodiment, the
small molecule is selected from the group consisting of methylketones,
iodoacetates, iodoacetamides, and maleimides.
[0019] In at least one embodiment, the invention disclosed herein provides a
method for treating, ameliorating, or preventing a vascular disorder or an
inflammatory disorder in a mammal comprising administering to the mammal a
therapeutically effective amount of a legumain antagonist and/or a ZB-1
antagonist. In another embodiment, the disorder is an inflammatory disorder.
In another embodiment, the inflammatory disorder is selected from the group
consisting of arthritis, tuberculosis, multiple sclerosis, Crohn's disease, or
ulcerative colitis. In another embodiment, the disorder is a vascular disorder. In
another embodiment, the vascular disorder is selected from the group consisting
of atherosclerosis, congestive heart failure, myocardial infarction, arrhythmia,
atrial arrhythmia, ventricular arrhythmia, stenosis, aneurysm, peripheral
vascular disease, peripheral arterial disease, chronic peripheral arterial occlusive
disease, thrombosis, atherothrombosis, deep venous thrombosis, acute arterial
thrombosis, embolism, inflammatory vascular disorders, Raynaud's
phenomenon, vasculitis, arteritis, venous disorders, hypertensive vascular
disease, atherothrombosis, claudication, angina, stable angina, unstable angina,
stroke, peripheral artery occlusive disease, coronary artery disease, acute

coronary syndrome, metabolic syndrome, ischemia, reperfusion, chronic kidney
disease, end-stage renal disease, diabetic nephropathy, hyperlipidemia,
hypertension, and diabetes. In another embodiment, the legumain antagonist
and/or ZB-1 antagonist is selected from the group consisting of inhibitory
polynucleotides, inhibitory polypeptides, small molecules, antagonistic
antibodies and antigen binding fragments thereof. In another embodiment, the
inhibitory polynucleotide is selected from the group consisting of antisense
polynucleotides, siRNA molecules, ribozymes, and aptamers. In another
embodiment, the inhibitory polypeptide is selected from the group consisting of
cystatins or active fragments thereof, aza-peptide Micheal acceptors/inhibitors,
aza-peptide epoxides, fluoromethylketone peptide caspase inhibitors, and
chloromethylketone peptide caspase inhibitors. In another embodiment, the
small molecule is selected from the group consisting of methylketones,
iodoaeetates, iodoacetamides, and maleimides.
[0020] In at least one embodiment, the invention disclosed herein provides a
method for treating, ameliorating, or preventing a vascular disorder or an
inflammatory disorder in a mammal comprising contacting a cell or cell
population of the mammal with a therapeutically effective amount of a legumain
antagonist and/or a ZB-1 antagonist. In another embodiment, the cell or cell
population comprises a macrophage, a monocyte, a vascular endothelial cell, a
foam cell, or a mixture of monocytes, macrophages, vascular endothelial cells
and/or foam cells. In another embodiment, the cell or cell population secretes
legumain and/or ZB-1. In another embodiment, the cell or cell population
comprises an arterial endothelial cell or a kidney proximal tubule cell. In
another embodiment, the cell or cell population is derived from a site of
inflammatory cell infiltration into the intima of an artery. In another
embodiment, the cell or cell population is derived from a neointimal lesional
area of an artery.
[0021] In at least one embodiment, the invention disclosed herein provides a
method for decreasing the level of legumain and/or ZB-1 activity, expression,
and/or secretion in a cell or cell population, comprising contacting the cell or

cell population with a legumain antagonist and/or a ZB-1 antagonist in an
amount sufficient to decrease the level of activity, expression, and/or secretion
of legumain and/or ZB-1 in the cell or cell population. In another embodiment,
the cell or cell population comprises a macrophage, a monocyte, a vascular
endothelial cell, a foam cell, or a mixture of monocytes, macrophages, vascular
endothelial cells and/or foam cells. In another embodiment, the cell or cell
population secretes legumain and/or ZB-1. In another embodiment, the cell or
cell population comprises an arterial endothelial cell or a kidney proximal
tubule cell. In another embodiment, the cell or cell population is derived from a
site of inflammatory cell infiltration into the intima of an artery. In another
embodiment, the cell or cell population is derived from a neointimal lesional
area of an artery.
[0022] In at least one embodiment, the invention disclosed herein provides a
method for decreasing the level of legumain and/or ZB-1 activity, expression,
and/or secretion in a mammal comprising administering to the mammal a
legumain antagonist and/or a ZB-1 antagonist in an amount sufficient to
decrease the level of activity, expression, and/or secretion of legumain and/or
ZB-1 in the mammal. In another embodiment, the legumain antagonist and/or
ZB-1 antagonist is selected from the group consisting of inhibitory
polynucleotides, inhibitory polypeptides, small molecules, antagonistic
antibodies and antigen binding fragments thereof. In another embodiment, the
inhibitory polynucleotide is selected from the group consisting of antisense
polynucleotides, siRNA molecules, ribozymes, and aptamers. In another
embodiment, the inhibitory polypeptide is selected from the group consisting of
cystatins or active fragments thereof, aza-peptide Micheal acceptors/inhibitors,
aza-peptide epoxides, fluoromethylketone peptide caspase inhibitors, and
chloromethylketone peptide caspase inhibitors. In another embodiment, the
small molecule is selected from the group consisting of methylketones,
iodoacetates, iodoacetamides, and maleimides.
[0023] In at least one embodiment, the invention disclosed herein provides a
method for monitoring the course of a treatment for a vascular disorder or

inflammatory disorder in a patient, comprising: measuring the level of activity,
expression and/or secretion of legumain and/or ZB-1 in a cell or cell population
from the patient; administering a legumain antagonist and/or a ZB-1 antagonist
to the patient; and measuring the level of activity, expression and/or secretion of
legumain and/or ZB-1 in a cell or cell population from the patient following
administration of the legumain antagonist and/or ZB-1 antagonist, wherein a
lower level of activity, expression and/or secretion of legumain and/or ZB-1 in
the cell or cell population from the patient following administration of the
legumain antagonist and/or ZB-1 antagonist, in comparison to the level of
activity, expression and/or secretion of legumain and/or ZB-1 in the cell or cell
population from the patient prior to administration of the legumain antagonist
and/or ZB-1 antagonist, provides a positive indication of the effect of the
treatment for the vascular disorder or inflammatory disorder in the patient.
[0024] In at least one embodiment, the invention disclosed herein provides a
method for monitoring a vascular disorder or inflammatory disorder in a patient,
comprising: measuring the level of activity, expression and/or secretion of
legumain and/or ZB-1 in a cell or cell population from the patient at a first time
point; and measuring the level of activity, expression and/or secretion of
legumain and/or ZB-1 in a cell or cell population from the patient at a second
time point, wherein a lower level of activity, expression and/or secretion of
legumain and/or ZB-1 in the cell or cell population from the patient at the
second time point, in comparison to the level of activity, expression and/or
secretion of legumain and/or ZB-1 in the cell or cell population from the patient
at the first time point, provides an indication that the vascular disorder or
inflammatory disorder has decreased in severity.
[0025] In at least one embodiment, the invention disclosed herein provides a
method for monitoring a vascular disorder or inflammatory disorder in a patient,
comprising: measuring the level of activity, expression and/or secretion of
legumain and/or ZB-1 in a cell or cell population from the patient; and
comparing the level of activity, expression and/or secretion of legumain and/or
ZB-1 in the cell or cell population from the patient to the level of activity,

expression and/or secretion of legumain and/or ZB-1 in a reference cell or cell
population, wherein a lower level of activity, expression and/or secretion of
legumain and/or ZB-1 in the cell or cell population from the patient, in
comparison to the level of activity, expression and/or secretion of legumain
and/or ZB-1 in the reference cell or cell population, provides an indication that
the vascular disorder or inflammatory disorder has decreased in severity.
[0026] In at least one embodiment, the invention disclosed herein provides a
method for prognosing a vascular disorder or inflammatory disorder in a patient,
comprising: measuring the level of activity, expression and/or secretion of
legumain and/or ZB-1 in a cell or cell population from the patient at a first time
point; and measuring the level of activity, expression and/or secretion of
legumain and/or ZB-1 in a cell or cell population from the patient at a second
time point, wherein a lower level of activity, expression and/or secretion of
legumain and/or ZB-1 in the cell or cell population from the patient at the
second time point, in comparison to the level of activity, expression and/or
secretion of legumain and/or ZB-1 in the cell or cell population from the patient
at the first time point, indicates a decreased likelihood that the patient either will
develop the vascular disorder or inflammatory disorder, or will develop a more
severe form of the vascular disorder or inflammatory disorder.
[0027] In at least one embodiment, the invention disclosed herein provides a
method for prognosing a vascular disorder or inflammatory disorder in a patient,
comprising: measuring the level of activity, expression and/or secretion of
legumain and/or ZB-1 in a cell or cell population from the patient; and
comparing the level of activity, expression and/or secretion of legumain and/or
ZB-1 in the cell or cell population to the level of activity, expression and/or
secretion of legumain and/or ZB-1 in a reference cell or cell population, wherein
a lower level or similar level of activity, expression and/or secretion of
legumain and/or ZB-1 in the cell or cell population from the patient, in
comparison to the level of activity, expression and/or secretion of legumain
and/or ZB-1 .in the reference cell or cell population, indicates a decreased
likelihood that the patient either will develop the vascular disorder or

inflammatory disorder, or will develop a more severe form of the vascular
disorder or inflammatory disorder.
[0028] In at least one embodiment, the invention disclosed herein provides a
method of screening for a compound capable of treating, ameliorating, or
preventing a vascular disorder or an inflammatory disorder comprising the steps
of: contacting a sample containing legumain and/or ZB-1 with a compound of
interest; and determining whether the level of activity, expression, and/or
secretion of legumain and/or ZB-1 in the contacted sample is decreased relative
to the level of activity, expression, and/or secretion of legumain and/or ZB-1 in
a sample not contacted with the compound, wherein a decrease in the level of
activity, expression, and/or secretion of legumain and/or ZB-1 in the contacted
sample identifies the compound as a compound that is capable of treating,
ameliorating, or preventing a vascular disorder or an inflammatory disorder.
[0029] In at least one embodiment, the invention disclosed herein provides a
method for treating, ameliorating, or preventing a vascular disorder or an
inflammatory disorder in a mammal comprising administering to the mammal a
therapeutically effective amount of a legumain agonist and/or a ZB-1 agonist.
In another embodiment, the invention provides the use of a legumain agonist
and/or a ZB-1 agonist for the preparation of a pharmaceutical composition for
use in a method of treating, ameliorating, or preventing a vascular disorder or an
inflammatory disorder, wherein the pharmaceutical composition comprises a
therapeutically effective amount of the legumain agonist and/or the ZB-1
agonist, and a pharmaceutically acceptable carrier.
[0030] In at least one embodiment, the invention disclosed herein provides a
method for inhibiting cell migration in a mammal comprising administering to
the mammal a legumain antagonist and/or a ZB-1 antagonist. In another
embodiment, the legumain antagonist and/or ZB-1 antagonist is selected from
the group consisting of inhibitory polynucleotides, inhibitory polypeptides,
small molecules, antagonistic antibodies and antigen binding fragments thereof.
In another embodiment, the inhibitory polynucleotide is selected from the group
consisting of antisense polynucleotides, siRNA molecules, ribozymes, and

aptamers. In another embodiment, the inhibitory polypeptide is selected from
the group consisting of cystatins or active fragments thereof, aza-peptide
Micheal acceptors/inhibitors, aza-peptide epoxides, fiuoromethylketone peptide
caspase inhibitors, and chloromethylketone peptide caspase inhibitors. In
another embodiment, the small molecule is selected from the group consisting
of methylketones, iodoacetates, iodoacetamides, and maleimides. In another
embodiment, the invention provides the use of a legumain antagonist and/or a
ZB-1 antagonist for the preparation of a pharmaceutical composition for use in a
method of inhibiting cell migration in a mammal, wherein the pharmaceutical
composition comprises a therapeutically effective amount of the legumain
antagonist and/or the ZB-1 antagonist, and a pharmaceutically acceptable
carrier.
[0031] In at least one embodiment, the invention disclosed herein provides a
method for promoting cell migration in a mammal comprising administering to
the mammal a legumain agonist and/or a ZB-1 agonist. In another embodiment,
the invention provides the use of a legumain agonist and/or a ZB-1 agonist for
the preparation of a pharmaceutical composition for use in a method of cell
migration in a mammal, wherein the pharmaceutical composition comprises a
therapeutically effective amount of the legumain agonist and/or the ZB-1
agonist, and a pharmaceutically acceptable carrier.
[0032] In at least one embodiment, the invention disclosed herein provides a
method of promoting wound healing in a mammal comprising administering to
the mammal a legumain agonist and/or a ZB-1 agonist. In another embodiment,
the invention provides the use of a legumain agonist and/or a ZB-1 agonist for
the preparation of a pharmaceutical composition for use in a method of
promoting wound healing in a mammal, wherein the pharmaceutical
composition comprises a therapeutically effective amount of the legumain
agonist and/or the ZB-1 agonist, and a pharmaceutically acceptable carrier.
[0033] In at least one embodiment, the invention disclosed herein provides a
method for inhibiting angiogenesis in a mammal comprising administering to
the mammal a legumain antagonist and/or a ZB-1 antagonist. In another

embodiment, the legumain antagonist and/or ZB-1 antagonist is selected from
the group consisting of inhibitory polynucleotides, inhibitory polypeptides,
small molecules, antagonistic antibodies and antigen binding fragments thereof.
In another embodiment, the inhibitory polynucleotide is selected from the group
consisting of antisense polynucleotides, siRNA molecules, ribozymes, and
aptamers. In another embodiment, the inhibitory polypeptide is selected from
the group consisting of cystatins or active fragments thereof, aza-peptide
Micheal acceptors/inhibitors, aza-peptide epoxides, fluoromethylketone peptide
caspase inhibitors, and chloromethylketone peptide caspase inhibitors. In
another embodiment, the small molecule is selected from the group consisting
of methylketones, iodoacetates, iodoacetamides, and maleimides. In another
embodiment, the invention provides the use of a legumain antagonist and/or a
ZB-1 antagonist for the preparation of a pharmaceutical composition for use in a
method of inhibiting angiogenesis in a mammal, wherein the pharmaceutical
composition comprises a therapeutically effective amount of the legumain
antagonist and/or the ZB-1 antagonist, and a pharmaceutically acceptable
carrier.
[0034] In at least one embodiment, the invention disclosed herein provides a
method for promoting angiogenesis in a mammal comprising administering to
the mammal a legumain agonist and/or a ZB-1 agonist. In another embodiment,
the invention provides the use of a legumain agonist and/or a ZB-1 agonist for
the preparation of a pharmaceutical composition for use in a method of
promoting angiogenesis in a mammal, wherein the pharmaceutical composition
comprises a therapeutically effective amount of the legumain agonist and/or the
ZB-1 agonist, and a pharmaceutically acceptable carrier.
[0035] In at least one embodiment, the invention disclosed herein provides a
method for inhibiting proliferation of endothelial cells in a mammal comprising
administering to the mammal a legumain antagonist and/or a ZB-1 antagonist.
In another embodiment, the legumain antagonist and/or ZB-1 antagonist is
selected from the group consisting of inhibitory polynucleotides, inhibitory
polypeptides, small molecules, antagonistic antibodies and antigen binding

fragments thereof. In another embodiment, the inhibitory polynucleotide is
selected from the group consisting of antisense polynucleotides, siRNA
molecules, ribozymes, and aptamers. In another embodiment, the inhibitory
polypeptide is selected from the group consisting of cystatins or active
fragments thereof, aza-peptide Micheal acceptors/inhibitors, aza-peptide
epoxides, fluoromethylketone peptide caspase inhibitors, and
chloromethylketone peptide caspase inhibitors. In another embodiment, the
small molecule is selected from the group consisting of methylketones,
iodoacetates, iodoacetamides, and maleimides. In another embodiment, the
invention provides the use of a legumain antagonist and/or a ZB-1 antagonist for
the preparation of a pharmaceutical composition for use in a method of
inhibiting proliferation of endothelial cells in a mammal, wherein the
pharmaceutical composition comprises a therapeutically effective amount of the
legumain antagonist and/or the ZB-1 antagonist, and a pharmaceutically
acceptable carrier.
[0036] In at least one embodiment, the invention disclosed herein provides a
method of promoting proliferation of endothelial cells in a mammal comprising
administering to the mammal a legumain agonist and/or a ZB-1 agonist. In
another embodiment, the invention provides the use of a legumain agonist
and/or a ZB-1 agonist for the preparation of a pharmaceutical composition for
use in a method of promoting proliferation of endothelial cells in a mammal,
wherein the pharmaceutical composition comprises a therapeutically effective
amount of the legumain agonist and/or the ZB-1 agonist, and a pharmaceutically
acceptable carrier.
[0037] In at least one embodiment, the invention disclosed herein provides a
method of inhibiting tumor metastasis, comprising contacting a cell or cell
population of the mammal with a legumain antagonist and/or ZB-1 antagonist.
In at least one other embodiment, the invention disclosed herein provides a
method of inhibiting tumor metastasis in a mammal comprising administering to
the mammal a legumain antagonist and/or ZB-1 antagonist. In another
embodiment, the legumain antagonist and/or ZB-1 antagonist is selected from

the group consisting of inhibitory polynucleotides, inhibitory polypeptides,
small molecules, antagonistic antibodies and antigen binding fragments thereof.
In another embodiment, the inhibitory polynucleotide is selected from the group
consisting of antisense polynucleotides, siRNA molecules, ribozymes, and
aptamers. In another embodiment, the inhibitory polypeptide is selected from
the group consisting of cystatins or active fragments thereof, aza-peptide
Micheal acceptors/inhibitors, aza-peptide epoxides, fluoromethylketone peptide
caspase inhibitors, and chloromethylketone peptide caspase inhibitors. In
another embodiment, the small molecule is selected from the group consisting
of methylketones, iodoacetates, iodoacetamides, and maleimides. In another
embodiment, the invention provides the use of a legumain antagonist and/or a
ZB-1 antagonist for the preparation of a pharmaceutical composition for use in a
method of inhibiting tumor metastasis in a mammal, wherein the pharmaceutical
composition comprises a therapeutically effective amount of the legumain
antagonist and/or the ZB-1 antagonist, and a pharmaceutically acceptable
carrier.
[0038] In at least one embodiment, the invention disclosed herein provides a
method of promoting transplant surgery recovery, comprising contacting a cell
or cell population of the mammal with a legumain agonist and/or a ZB-1
agonist. In another embodiment, the invention provides the use of a legumain
agonist and/or a ZB-1 agonist for the preparation of a pharmaceutical
composition for use in a method of promoting transplant surgery recovery in a
mammal, wherein the pharmaceutical composition comprises a therapeutically
effective amount of the legumain agonist and/or the ZB-1 agonist, and a
pharmaceutically acceptable carrier.
[0039] In at least one embodiment, the invention disclosed herein provides a
method for treating, ameliorating, or preventing a vascular disorder or an
inflammatory disorder in a mammal comprising administering to the mammal a
therapeutically effective amount of OIP-2. In another embodiment, the
invention provides the use of OIP-2 for the preparation of a pharmaceutical
composition for use in a method of treating, ameliorating, or preventing a

vascular disorder or an inflammatory disorder, wherein the pharmaceutical
composition comprises a therapeutically effective amount of OIP-2 and a
pharmaceutically acceptable carrier.
BRIEF DESCRIPTION OF THE DRAWINGS
[0040] FIG. 1 shows legumain mRNA expression (upper panel; Y-axis:
"Normalized Intensity (fold scale)") in human atherosclerotic arterial samples
with plaques (X-axis: "Athero Plaque") or plaque-free (X-axis: "Athero
Vessel") segments compared to healthy arterial samples (X-axis: "Normal").
Legumain (201212_at) expression is increased in atherosclerotic arterial
samples containing plaques relative to plaque-free segments or nondiseased
arterial samples; values are shown in the lower panel.
[0041] FIG. 2 shows legumain mRNA expression (Y-axis: "Frequency (ppm)")
in the aortic arch of ApoE-/- mice ("ApoE-/-") and C57BL/6 wild-type control
mice ("C57BL/6") at 5 to 55 weeks of age (X-axis: "Age (weeks)"). Legumain
gene expression increases with progression of disease.
[0042] FIG. 3 shows validation of legumain mRNA expression (Y-axis:
"Relative TAQMAN® Units (p-Actin Normalized)") profile in atherosclerosis
by Real-Time PCR (RT-PCR). mRNA was isolated from the aortic arch of
ApoE-/- mice ("ApoE-/-") and C57BL/6 wild-type control mice ("C57BL/6") at
40 weeks at 12 to 54 weeks of age (X-axis: Age (weeks)) and analyzed by RT-
PCR. The data demonstrate that legumain gene expression increases as
atherosclerosis progresses in mice.
[0043] FIG. 4 shows that legumain mRNA, protein, and activity are increased
in differentiated (macrophage) THP1 human monocytic leukemia cells.
(FIG. 4A) THP1 cells were differentiated in PMA (phorbol 12-myristate 13-
acetate)-containing media for 0, 1, 2, or 3 days (X-axis: "Days after
differentiation"). The mRNA levels (Y-axis: "Fold Change") were determined
by TAQMAN® (Applied Biosystems, Foster City, CA) quantitative-PCR.
(FIG. 4B) Mature legumain and actin (control) protein levels in undifferentiated
(left lane) or PMA-differentiated THP1 cells (right lane) were determined by

Western analysis using an anti-legumain polyclonal antibody and an anti-actin
polyclonal antibody, respectively. Molecular weight markers (in kDa) are
shown on the left side. (FIG. 4C) Using the same cell lysates as in FIG. 4B,
the protease activity of legumain (Y-axis: "Rate of Reaction") was determined
by measuring the hydrolysis of the legumain substrate peptide, Z-AAN-MCA
(Peptide Institute, Louisville, KY) (X-axis: undifferentiated THP1 monocytes,
"Non-dif;" differentiated THP1 macrophages, "Dif").
[0044] FIG. 5 shows that legumain protein levels and activity are increased in
M-CSF-activated primary human macrophages. Cell lysates were prepared
from primary human macrophages cultured in serum-free media (FIGs. 5A and
5B) or RPMI media supplemented with 0.25% FBS (FIG. 5C) with or without
M-CSF. (FIG. 5A): Detection of legumain protein ("Mature legumain" and
"Pro-legumain") in M-CSF-stimulated human macrophages by Western
analysis. Lane 1: unstimulated; Lane 2: M-CSF treated. "Actin": actin loading
control. (FIG. 5B): Detection of pro-legumain in conditioned media from
M-CSF stimulated human macrophages. Lane 1: unstimulated; Lane 2: M-CSF
treated. (FIG. 5C): Detection of legumain activity (Y-axis: "Rate of Reaction")
in M-CSF-stimulated human macrophages (X-axis: "M-CSF") or unstimulated
macrophages (X-axis: "un-treated") measured by the hydrolysis of
Z-AAN-MCA.
[0045] FIG. 6 shows dose-dependent migration of primary human monocytes
towards purified legumain in Boyden chambers, measured and quantified using
a luminescent cell viability assay (Y-axis: "Luminescence"). VEGF at lOng/mL
and 5% FBS were used as positive controls; statistical significance was
achieved at p<0.05 (ANOVA). An asterisk (*) denoted significance compared
to 0 ng/ml.
[0046] FIG. 7 shows detection of cell-surface legumain activity. 293 cells were
infected with adenovirus expressing mouse legumain. Cell-surface legumain
activity (Y-axis: "Rate of Reaction") was determined by incubating legumain-
expressing cells in a reaction buffer containing the legumain substrate peptide

Z-AAN-MCA (Peptide Institute) in the presence or absence of protease
inhibitors cystatin C or E64. Control: "No inhibitor."
[0047] FIG. 8 shows the effect of legumain on HEK293 cell migration in the in
vitro wound-healing assay. VEGF (10 ng/mL) and 5% FBS were used as
positive controls. The results reveal a significant increase in cell migration in
response .to stimulation with legumain at 10 ng/mL and 25 ng/mL relative to
control, denoted by an asterisk (*). Statistical significance is achieved at p<0.05
(ANOVA).
[0048] FIG. 9 shows the effect of legumain on human umbilical vein
endothelial cell (HUVEC) migration in the in vitro wound-healing assay.
VEGF (10 ng/mL) and 5% FBS were used as positive controls. The results
reveal a significant increase in cell migration in response to stimulation with
legumain at 25 ng/mL relative to control, denoted by an asterisk (*). Legumain
at 25 ng/mL promotes an increase in migration to the same extent as VEGF at
10 ng/mL. Statistical significance is achieved at p<0.05 (ANOVA)..
[0049] FIG. 10 shows the dose-dependent Matrigel invasion of HUVECs
exposed to purified legumain in modified Boyden chambers, measured and
quantified using a luminescent cell viability assay (Y-axis: "Luminescence").
VEGF at 10 ng/mL was used as a positive control. Legumain loaded in top and
bottom chambers at 25 ng/mL was used as a negative control. The results
reveal a significant increase in cell invasion in response to stimulation with
legumain at 25 ng/mL relative to control, denoted by an asterisk (*). Legumain
at 25 ng/mL promotes an increase in invasion to the same extent as VEGF at 10
ng/mL. Statistical significance is achieved at p<0.05 (ANOVA).
[0050] FIG. 11 shows the amino acid sequence of human ZB-1 (bottom
sequence (1 -377)) aligned with the human legumain sequence (top sequence
(1-434)). "Asp25 Cleavage": N-terminal propeptide cleavage site; "Asn323
Cleavage": C-terminal propeptide cleavage site.

DETAILED DESCRIPTION OF THE INVENTION
[00511 The findings disclosed herein identify legumain as a gene involved in
vascular disorders, e.g., cardiovascular disorders, such as atherosclerosis, and
inflammatory disorders, e.g., chronic inflammatory disorders, such as arthritis.
[0052] Additionally disclosed herein is a novel splice variant of legumain,
designated ZB-1, which lacks amino acids 341-397 of full-length human
legumain, and which, like legumain, is secreted upon overexpression in cell
culture. Thus, ZB-1 may also function in vascular and inflammatory disorders.
[00531 Disclosed herein are the findings that: (1) legumain mRNA and protein
expression increase dramatically during lesion formation in mouse models of
atherosclerosis; (2) legumain mRNA is increased in human atherosclerotic
samples compared to nondiseased tissues; (3) legumain protein is detected in the
foam cells of atherosclerotic plaques of ApoE-/- mice; (4) legumain is expressed
by arterial endothelial cells of aortic sinus in ApoE-/- mice; (5) legumain is
highly expressed in activated human macrophages and differentiated
macrophages, and is released into the culture media of activated human
macrophages; (6) legumain activity is markedly increased in cell culture during
macrophage differentiation and macrophage activation; (7) enzymatically active
legumain is detected on the cell surface of recombinant legumain-
overexpressing cells; (8) legumain is expressed in the kidney, e.g., in
endothelial cells of renal arteries, and in proximal tubule cells; (9) legumain is
expressed in coronary arteries of an atherosclerotic patient; (10) legumain
stimulation induces human monocyte migration; and (11)) legumain stimulation
induces endothelial cell migration and proliferation in wound-healing models of
HEK293 and HUVEC cultures, as well as endothelial cell invasion in HUVEC
culture. Taken together, these findings implicate a functional link between
legumain (and ZB-1) and vascular and/or inflammatory diseases, e.g., (i.e.,
including but not limited to) atherosclerosis.
[0054] Also disclosed herein is the finding that legumain expression is
increased in the collagen-induced arthritic (CIA) paw in a mouse model of
arthritis. As monocyte recruitment and macrophage differentiation, which occur

during e.g., atherogenesis (a form of vascular inflammation), are also typical.
features of diseases characterized by chronic inflammation (e.g., arthritis and
tuberculosis), these findings suggest that legumain and ZB-1 may have general
roles in inflammatory diseases.
[0055] In light of these findings, assaying and/or modulating the secretion,
expression, and/or activity of legumain and legumain variants, such as the novel
ZB-1, provide excellent tools for diagnosing, prognosing, monitoring, treating,
ameliorating and/or preventing vascular disorders and inflammatory disorders,
and disorders associated therewith.
[0056] As such, the present invention provides legumain and ZB-1 modulators
(e.g., legumain and ZB-1 antagonists, and legumain and ZB-1 agonists). Thus,
the present invention provides legumain and ZB-1 antagonists, e.g., mammalian
(e.g., mouse and human) legumain and ZB-1 inhibitory polynucleotides (i.e.,
polynucleotides that decrease legumain and/or ZB-1 levels, secretion from cells,
and/or activity, either directly or indirectly, e.g., antisense molecules, siRNA
molecules, aptamers); legumain and ZB-1 inhibitory polypeptides (i.e.,
polypeptides that decrease legumain and/or ZB-1 levels, secretion from cells,
and/or activity, either directly or indirectly, e.g., fragments of legumain or ZB-1,
such as fragments containing an aberrant protease enzymatic domain, and fusion
proteins thereof); antagonistic anti-legumain and ZB-1 antibodies or antibody
fragments (i.e., antibodies or antibody fragments (i.e., antigen-binding
fragments) mat decrease legumain and/or ZB-1 levels, secretion from cells,
and/or activity, either directly or indirectly, including, e.g., antagonistic
antibodies and antibody fragments that bind full-length legumain and/or ZB-1
and/or fragments of legumain and/or ZB-1); and antagonistic small molecules
(e.g., siRNA molecules, aptamers, and small organic molecules or compounds),
which may be used to suppress legumain and/or ZB-1 -mediated hydrolysis of
asparaginyl bonds, and consequently, which may be used in the diagnosis,
prognosis, monitoring and/or treatment of disorders related to increased
legumain and/or ZB-1 activity and/or disorders treatable by decreasing
legumain and/or ZB-1 activity or expression, i.e., legumain and/or ZB-1-

associated conditions or disorders. As used herein the term "antagonist" refers
to both direct antagonists (e.g., molecules that directly interact with legumain
and/or ZB-1 polypeptides or polynucleotides) and indirect antagonists (e.g.,
molecules that decrease the activity, secretion, and/or expression of ZB-1 and/or
legumain indirectly (e.g., RGD-containing peptides that block legumain
interaction with integrins)).
[0057] The present invention also provides legumain and ZB-1 agonists, e.g.,
mammalian (e.g., mouse and human) legumain and ZB-1 polynucleotides (i.e.,
polynucleotides that increase legumain and/or ZB-1 levels, secretion from cells,
and/or activity, either directly or indirectly, e.g., mRNAs, cDNAs); legumain
and ZB-1 polypeptides (i.e., polypeptides that increase legumain and/or ZB-1
levels, secretion from cells, and/or activity, either directly or indirectly, e.g.,
fragments of legumain or ZB-1, such as fragments containing the protease
enzymatic domain, and fusion proteins thereof); agonistic anti-legumain and
ZB-1 antibodies or antibody fragments (i.e., antibodies or antibody fragments
that increase legumain and/or ZB-1 levels, secretion from cells, and/or activity,
either directly or indirectly, including, e.g., agonistic antibodies and antibody
fragments that bind full-length legumain and/or ZB-1 and/or fragments of
legumain and/or ZB-1); and agonistic small molecules (e.g., small organic
molecules or compounds), which may be used to enhance legumain and/or
ZB-1-mediated hydrolysis of asparaginyl bonds, and consequently, which may
be used in the diagnosis, prognosis, monitoring and/or treatment of disorders
related to decreased legumain and/or ZB-1 activity and/or disorders treatable by
increasing legumain and/or ZB-1 activity or expression, e.g., disorders that are
treatable by or would benefit from increased cell (e.g., endothelial cell)
migration, e.g., wound healing (e.g., wounds surgically induced or occurring
accidentally or otherwise), or other conditions that are treatable by or would
benefit from such increased cell migration, e.g., recovery from transplant
surgery. As used herein the term "agonist" refers to both direct agonists (e.g.,
molecules that directly interact with legumain and/or ZB-1 polypeptides or
polynucleotides) and indirect agonists (e.g., molecules that increase the activity,

secretion, and/or expression of ZB-1 and/or legumain indirectly (e.g.,
transcriptional enhancers of legumain and/or ZB-1 expression)).
[0058] As legumain is a secreted protein that is believed to interact with matrix
molecules and/or cell surfaces, compounds that decrease the amount of
legumain and/or ZB-1 present extracellularly are useful to modulate legumain
and/or ZB-1 activity in a cell or population of cells that secrete legumain and/or
ZB-1, e.g., macrophages, foam cells, vascular and endothelial cells (e.g., arterial
endothelial cells), sites of inflammatory cell invasion into vessel walls (e.g., into
an arterial intima), neointimal lesional areas, kidney proximal tubule cells,
monocytes, etc.
[0059] Disorders related to increased legumain and/or ZB-1 activities are
described herein as "legumain- and/or ZB-1-associated conditions" or
"legumain- and/or ZB-1-associated disorders" or the like, and include, without
limitation, atherosclerosis (including, but not limited to, all stages of
atherogenesis and atherosclerosis, e.g., endothelial cell activation, formation of
fatty streaks, inflammatory cell invasion of vessel walls, endothelial cell
migration, formation of foam cells, plaque denudation, atheromatous plaque
formation, atheromatous plaque rupture, atherothrombosis, aneurysm, stenosis,
etc.), congestive heart failure, myocardial infarction, arrhythmias (e.g., atrial
and ventricular arrhythmias), stenosis, aneurysm, peripheral vascular disease,
chronic peripheral arterial occlusive disease (CPAOD), peripheral artery
occlusive disease (PAOD), thrombosis (including, e.g., acute arterial
thrombosis, atherothrombosis, and deep venous thrombosis), embolism,
inflammatory vascular disorders, Raynaud's phenomenon, vasculitis and/or
arteritis (including, e.g., Bechet's disease, Buerger's disease, central nervous
system vasculitis, Churg-Strauss syndrome cryoglobulinemia, giant cell arteritis,
Kawasaki disease, microscopic polyangitis, polyarteritis nodosa, polymyalgia
rheumatica, rheumatoid vasculitis, Takayasu's arteritis, and Wegener's
granulomatosis), venous disorders, hypertensive vascular disease, claudication,
anginas (e.g., stable angina, unstable angina), stroke, coronary artery disease
(CAD), peripheral arterial disease (PAD), acute coronary syndrome (ACS),

metabolic syndrome, ischemia, reperfusion, and exacerbation of various
diseases affected by the circulatory system (e.g., diabetic nephropathy, chronic
kidney disease, end-stage renal disease (ESRD), hyperlipidemia, hypertension,
and diabetes). Additional disorders amenable to diagnosis, prognosis,
monitoring, treatment, amelioration and/or prevention using the methods
disclosed herein include inflammatory disorders (e.g., chronic inflammatory
disorders, including but not limited to arthritis, tuberculosis, and multiple
sclerosis, as well as inflammatory bowel diseases, such as Crohn's disease and
ulcerative colitis).
[0060] The present invention further provides methods of screening for: (1)
legumain and/or ZB-1 antagonists, e.g., mouse and human legumain and/or
ZB-1 inhibitory polynucleotides (e.g., antisense, siRNA, aptamers); legumain
and/or ZB-1 inhibitory polypeptides (e.g., enzymatically inactive fragments of
legumain and/or ZB-1); antagonist anti-legumain and/or -ZB-1 antibodies and
antibody fragments (including antibodies and antibody fragments that bind
legumain and/or ZB-1 fragments); and antagonistic small molecules (e.g.,
siRNAs, aptamers, and small organic molecules or compounds); and (2)
compounds useful for treating, ameliorating, and/or preventing legumain- and/or
ZB-1-associated disorders, e.g., vascular disorders and/or inflammatory
disorders. Such screening methods may be undertaken by, e.g., measuring
changes in the level of expression of legumain and/or ZB-1 (e.g., levels of
legumain and/or ZB-1 mRNA, cDNA, protein and/or protein fragments), or by
measuring changes in the level of activity of legumain and/or ZB-1 (e.g.,
changes in levels of the hydrolysis of asparaginyl bonds on substrates), or by
measuring changes in the level of legumain and/or ZB-1 secretion (e.g., by
using immunohistochemistry or other well known techniques).
[0061] The terms "legumain" and "ZB-1" as used herein, where appropriate,
refer to mammalian legumain and ZB-1, e.g., primate (including human) and/or
rodent (including mouse) legumain and ZB-1, and includes both legumain and
ZB-1 polynucleotides and polypeptides.

[0062] Accordingly, the present application provides legumain and ZB-1-
related polynucleotides and polypeptides. The present invention also provides
antibodies and antibody fragments thereof, e.g., intact antibodies and antigen-
binding fragments thereof, that bind to legumain and/or ZB-1, e.g., mammalian
legumain and/or ZB-1, in particular, human, porcine and/or murine legumain
and/or ZB-1. In one embodiment, an anti-legumain or ZB-1 antibody inhibits or
antagonizes at least one legumain- and/or ZB-1-associated activity. For
example, an anti-legumain antibody may bind legumain and inhibit (e.g.,
decrease, limit, neutralize, block, interfere with, or otherwise reduce) the
interaction between legumain and a protein/peptide substrate. An anti-legumain
antibody may also bind legumain and/or ZB-1 and interfere with legumain
and/or ZB-1 enzymatic activity (e.g., protease activity, protein/peptide cleavage,
protein/peptide activation) by inducing, for example, a conformational change
in legumain or ZB-1 amino acid tertiary and/or secondary structure, or by
preventing the processing of legumain and/or ZB-1 into a mature peptide (e.g.,
by preventing N-terminal or C-terminal processing of the propeptide). Thus, the
antibodies of the invention may be used to detect, and optionally inhibit, a
legumain and/or ZB-1 activity (e.g., interaction of legumain and/or ZB-1 with a
protein/peptide substrate, or legumain and/or ZB-1 asparaginyl
peptidase/protease activity). Thus, the anti-legumain antibodies and anti-ZB-1
antibodies of the invention may be used to diagnose, prognose, monitor, treat,
ameliorate or prevent legumain and/or ZB-1-associated disorders, e.g., vascular
and inflammatory disorders, such as atherosclerosis and arthritis.
Legumain and ZB-1 Polynucleotides and Polypeptides
[0063] The present invention provides characterization of legumain and ZB-1,
e.g., expression profiles in the aorta, kidney, and atherosclerotic plaques,
subcellular localization, and enzymatic activity. As such, the present invention
relates to legumain and ZB-1 polynucleotides and polypeptides (e.g., full length
and fragments of legumain and ZB-1 polynucleotides and polypeptides) and
inhibitory legumain and ZB-1 polynucleotides and polypeptides (e.g., full length
and fragments of legumain and ZB-1 inhibitory polynucleotides and

polypeptides). Human legumain nucleic acid sequences, which correspond to
GenBank Accession Nos. NM_001008530 and NM_005606, are set forth in
SEQ ID NOs:l and 3. The corresponding human legumain amino acid
sequences are set forth in SEQ ID NOs:2 and 4, respectively. The mouse
legumain nucleic acid sequence, which corresponds to GenBank Accession No.
NM_011175, is set forth in SEQ ID NO:5. The corresponding mouse legumain
amino acid sequence is set forth in SEQ ID NO:6. A Pan troglodytes nucleic
acid sequence predicted to be a legumain, which corresponds to GenBank
Accession No. XM_510133, is set forth in SEQ ED NO:7. The corresponding
Pan troglodytes amino acid sequence is set forth in SEQ ID NO:8. A Macaca
mulatto nucleic acid sequence predicted to be a legumain, which corresponds to
GenBank Accession No. XM_001092047, is set forth in SEQ ID NO:9. The
corresponding Macaca amino acid sequence is set forth in SEQ ID NO: 10.
Additional legumain nucleotides and nucleotides predicted to be legumain
proteins include those from Bos taunts (GenBank Accession No. NM_174101),
Ovis aries (GenBank Accession No. DQ152974), Canis familiaris (GenBank
Accession Nos. XM_851487 and XM_537355), and Rattus norvegicus
(GenBank Accession No. NM_022226). "Legumain polypeptide" refers to
mammalian (e.g., human and mouse) legumain proteins (including, but not
limited to, allelic variants) and fragments thereof, such as the amino acid
sequences set forth in SEQ ID NOs:2,4, 6, 8 and 10. "Legumain
polynucleotide" refers to mammalian (e.g., human and mouse) legumain nucleic
acids (including, but not limited to, RNA and DNA, and allelic variants thereof)
and fragments thereof, such as the nucleic acid sequences set forth in SEQ ID
NOs:l, 3, 5, 7 and 9.
[0064] The inventors have also established that there exists high homology
between legumain and ZB-1, and that ZB-1, like legumain, is a secreted protein.
Thus, the present invention relates to ZB-1 polynucleotides and polypeptides
(e.g., full length and active fragments of ZB-1 polynucleotides and
polypeptides) and inhibitory ZB-1 polynucleotides and polypeptides (e.g., full
length and fragments of ZB-1 inhibitory polynucleotides and polypeptides).

The nucleotide sequence of a cDNA encoding this novel protein, designated
human ZB-1, is set forth in SEQ ID NO:l 1. Polynucleotides of the present
invention also include polynucleotides that hybridize under stringent conditions
to SEQ ID NO:l 1, or its complement, and/or encode polypeptides that retain
substantial biological activity of full-length human ZB-1. Polynucleotides of
the present invention also include continuous portions of the sequence set forth
in SEQ ID NO: 11 comprising at least 21 consecutive nucleotides.
[0065] The deduced amino acid sequence of human ZB-1 is set forth in SEQ ID
NO:l 2. Polypeptides of the present invention also include continuous portions
of the sequence set forth in SEQ ID NO:12 comprising at least seven
consecutive amino acids. A preferred polypeptide of the present invention
includes any continuous portion of the sequence set forth in SEQ ID NO: 12 that
retains substantial biological activity (i.e., an active fragment) of human ZB-1.
Polynucleotides of the present invention also include, in addition to those
polynucleotides of human origin described above, polynucleotides that encode
the amino acid sequence set forth in SEQ ID NO: 12 or a continuous portion
thereof, and that differ from the polynucleotides of human origin described
above due only to the well-known degeneracy of the genetic code.
[0066] "ZB-1 polypeptide" refers to mammalian (e.g., human and mouse) ZB-1
proteins (including allelic variants) and fragments thereof, such as the amino
acid sequence set forth in SEQ ID NO:12. "ZB-1 polynucleotide" refers to
mammalian (e.g., human and mouse) ZB-1 nucleic acids (including RNA and
DNA, and allelic variants thereof) and fragments thereof, such as the nucleic
acid sequence set forth in SEQ ID NO:l 1. "Active fragment" refers to a portion
of a legumain or ZB-1 polynucleotide or polypeptide that retains, to a
substantial degree, a biological activity of a legumain or ZB-1 polynucleotide or
polypeptide, e.g., asparaginyl protease/peptidase activity or encoding a
polypeptide/peptide that retains asparaginyl protease/peptidase activity. One of
ordinary skill in the art will know of several assays for evaluating the biological
activity of such fragments.

[0067] The isolated polynucleotides of or related to the present invention may
be used as hybridization probes and primers to identify and isolate nucleic acids
having sequences identical to or similar to those encoding the disclosed
polynucleotides. Hybridization methods for identifying and isolating nucleic
acids include polymerase chain reaction (PCR), Southern hybridization, in situ
hybridization and Northern hybridization, and are well known to those skilled in
the art.
[0068] Hybridization reactions may be performed under conditions of different
stringency. The stringency of a hybridization reaction includes the difficulty
with which any two nucleic acid molecules will hybridize to one, another.
Preferably, each hybridizing polynucleotide hybridizes to its corresponding
polynucleotide under reduced stringency conditions, more preferably stringent
conditions, and most preferably highly stringent conditions. Examples of
stringency conditions are shown in Table 1 below: highly stringent conditions
are those that are at least as stringent as, for example, conditions A-F; stringent
conditions are at least as stringent as, for example, conditions G-L; and reduced
stringency conditions are at least as stringent as, for example, conditions M-R.



[0069] The isolated polynucleotides of or related to the present invention may
be used as hybridization probes and primers to identify and isolate DNA having
sequences encoding allelic variants of the disclosed polynucleotides. Allelic
variants are naturally occurring alternative forms of the disclosed
polynucleotides that encode polypeptides that are identical to or have significant
similarity to the polypeptides encoded by the disclosed polynucleotides.
Preferably, allelic variants have at least 90% sequence identity (more preferably,

at least 95% identity; most preferably, at least 99% identity) with the disclosed
polynucleotides. Alternatively, significant similarity exists when the nucleic
acid segments will hybridize under selective hybridization conditions (e.g.,
highly stringent hybridization conditions) to the disclosed polynucleotides.
Such variants are encompassed within the scope of the present invention.
[0070] The isolated polynucleotides of or related to the present invention may
also be used as hybridization probes and primers to identify and isolate DNAs
having sequences encoding polypeptides homologous to the disclosed
polynucleotides. These homologs are polynucleotides and polypeptides isolated
from a different species than that of the disclosed polypeptides and
polynucleotides, or within the same species, but with significant sequence
similarity to the disclosed polynucleotides and polypeptides. Preferably,
polynucleotide homologs have a high sequence identity, e.g., at least 50%
sequence identity (more preferably, at least 75% identity, e.g., 80%, or 85%
identity; most preferably, at least 90% identity, e.g., 92%, 94%, 96%, 98%, or
99% identity) with the disclosed polynucleotides, whereas polypeptide
homologs have a high sequence identity, e.g., at least 30% sequence identity
(more preferably, at least 45% identity, e.g., 50%, or 55% identity; most
preferably, at least 60% identity, e.g., 65%, 70%, 75%, 80%, 85%, 90%, 95%,
or 99% identity) with the disclosed polypeptides. Preferably, homologs of the
disclosed polynucleotides and polypeptides are those isolated from mammalian
species. Such homologs are encompassed within the scope of the present
invention.
[0071] Calculations of "homology" or "sequence identity" between two
sequences may be performed by comparison methods well known in the art.
For example, regarding identity, the sequences are aligned for optimal
comparison purposes (e.g., gaps can be introduced in one or both of a first and a
second amino acid or nucleic acid sequence for optimal alignment, and
nonhomologous sequences can be disregarded for comparison purposes). In one
embodiment, the length of a reference sequence aligned for comparison
purposes is at least 30%, preferably at least 40%, more preferably at least 50%,

even more preferably at least 60%, and even more preferably at least 70%, 80%,
90%, 100% of the length of the reference sequence. The amino acid residues or
nucleotides at corresponding amino acid positions or nucleotide positions are
then compared. When a position in the first sequence is occupied by the same
amino acid residue or nucleotide as the corresponding position in the second
sequence, then the molecules are identical at that position. The percent identity
between the two sequences is a function of the number of identical positions
shared by the sequences, taking into account the number of gaps, and the length
of each gap, which need to be introduced for optimal alignment of the two
sequences.
[0072] The comparison of sequences and determination of percent sequence
identity between two sequences may be accomplished using a mathematical
algorithm. In one embodiment, the percent identity between two amino acid
sequences is determined using the Needleman and Wunsch ((1970) J. Mol. Biol.
48:444-53) algorithm, which has been incorporated into the GAP program in the
GCG software package (available at www.gcg.com), using either a Blossum 62
matrix or a PAM250 matrix, and a gap weight of 16, 14,12,10, 8, 6, or 4 and a
length weight of 1, 2, 3,4, 5, or 6. In another embodiment, the percent identity
between two nucleotide sequences is determined using the GAP program in the
GCG software package (available at www.gcg.com), using a NWSgapdna.CMP
matrix and a gap weight of 40, 50,60, 70, or 80 and a length weight of 1, 2, 3,4,
5, or 6. A preferred set of parameters (and the one that should be used if the
practitioner is uncertain about what parameters should be applied to determine
whether a molecule is within a sequence identity or homology limitation of the
invention) -is a Blossum 62 scoring matrix with a gap penalty of 12, a gap extend
penalty of 4, and a frameshift gap penalty of 5. The percent identity between
two amino acid or nucleotide sequences can also be determined using the
algorithm of Meyers and Miller ((1989) CABJOS 4:1-17), which has been
incorporated into the ALIGN program (version 2.0), using a PAM120 weight
residue table, a gap length penalty of 12 and a gap penalty of 4.

[0073] The isolated polynucleotides of or related to the present invention may
also be used as hybridization probes and primers to identify cells and tissues
that express the polypeptides of or related to the present invention and the
conditions under which they are expressed.
[0074] Additionally, the function of the polypeptides of or related to the present
invention may be directly examined by using the polynucleotides encoding the
polypeptides to alter (i.e., enhance, reduce, or modify) the expression of the
genes corresponding to the polynucleotides of or related to the present invention
in a cell or organism. These "corresponding genes" are the genomic DNA
sequences of or related to the present invention that are transcribed to produce
the mRNAs from which the polynucleotides of or related to the present
invention are derived.
[0075] Altered expression of the genes of or related to the present invention
may be achieved in a cell or organism through the use of various inhibitory
polynucleotides, such as antisense polynucleotides, siRNAs, and ribozymes that
bind and/or cleave the mRNA transcribed from the genes of or related to the
invention (see, e.g., Galderisi et al. (1999) J. Cell Physiol. 181:251-57; Sioud
(2001) Curr. Mol. Med. 1:575-88). Inhibitory polynucleotides to legumain
and/or ZB-1 may be useful asparaginyl peptidase antagonists and, as such, may
also be useful in treating, ameliorating and/or preventing legumain and/or ZB-1-
associated disorders, e.g., vascular and inflammatory disorders (e.g.,
atherosclerosis and arthritis). Inhibitory polynucleotides may also consist of
aptamers, i.e., polynucleotides that bind to and regulate protein activity, e.g., the
activity of human legumain and/or ZB-1. Aptamers are described throughout
the literature (see, e.g., Nimjee et al. (2005) Annu. Rev. Med. 56:555-83; Patel
(1997) Curr. Opin. Chem. Biol. 1:32-46; Pendergrast et al. (2005) J. Biomol
Tech. 16:224-34; Proske et al. (2005) Appl Microbiol. Biotechnol. 69:367-7'4;
Blank and Blind (2005) Curr. Opin. Chem. Biol. 9:336-42; Tombelli et al.
(2005) Biosens. Bioelectron. 20(12):2424-34; and Di Gusto et al. (2006)
Chembiochem. 7(3):535-44),

[0076] The antisense polynucleotides or ribozymes related to the invention may
be complementary to an entire coding strand of a gene of or related to the
invention, or to only a portion thereof. Alternatively, antisense polynucleotides
or ribozymes can be complementary to a noncoding region of the coding strand
of a gene of or related to the invention. The antisense polynucleotides or
ribozymes can be constructed using chemical synthesis and enzymatic ligation
reactions using procedures well known in the art. The nucleoside linkages of
chemically synthesized polynucleotides can be modified to enhance their ability
to resist nuclease-mediated degradation, as well as to increase their sequence
specificity. Such linkage modifications include, but are not limited to,
phosphorothioate, methylphosphonate, phosphoroamidate, boranophosphate,
morpholino, and peptide nucleic acid (PNA) linkages (Galderisi et al., supra;
Heasman (2002) Dev. Biol. 243:209-14; Micklefield (2001) Curr. Med. Chem.
8:1157-79). Alternatively, these molecules can be produced biologically using
an expression vector into which a polynucleotide of or related to the present
invention has been subcloned in an antisense (i.e., reverse) orientation.
[0077] The inhibitory polynucleotides of the present invention also include
triplex-forming oligonucleotides (TFOs) that bind in the major groove of duplex
DNA with high specificity and affinity (Knauert and Glazer (2001) Hum. Mol.
Genet. 10:2243-51). Expression of the genes of or related to the present
invention can be inhibited by targeting TFOs complementary to the regulatory
regions of the genes (i.e., the promoter and/or enhancer sequences) to form
triple helical structures that prevent transcription of the genes.
[0078] In one embodiment of the invention, the inhibitory polynucleotides of
the present invention are short interfering RNA (siRNA) molecules. These
siRNA molecules are short (preferably 19-25 nucleotides; most preferably 19 or
21 nucleotides), double-stranded RNA molecules that cause sequence-specific
degradation of target mRNA. This degradation is known as RNA interference
(RNAi) (e.g., Bass (2001) Nature 411:428-29). Originally identified in lower
organisms, RNAi has been effectively applied to mammalian cells and has
recently been shown to prevent fulminant hepatitis in mice treated with siRNA

molecules targeted to Fas mRNA (Song et al. (2003) Nature Med. 9:347-51). In
addition, intrathecally delivered siRNA has recently been reported to block pain
responses in two models (agonist-induced pain model and neuropathic pain
model) in the rat (Dom et al. (2004) Nucleic Acids Res. 32(5):e49).
[0079] The siRNA.molecules of the present invention may be generated by
annealing two complementary single-stranded RNA molecules together (one of
which matches a portion of the target mRNA) (Fire et al., U.S. Patent No.
6,506,559) or through the use of a single hairpin RNA molecule that folds back
on itself to produce the requisite double-stranded portion (Yu et al. (2002) Proc.
Natl. Acad. Sci. USA 99:6047-52). The siRNA molecules may be chemically
synthesized (Elbashir et al. (2001) Nature 411:494-98) or produced by in vitro
transcription using single-stranded DNA templates (Yu et al., supra).
Alternatively, the siRNA molecules can be produced biologically, either
transiently (Yu et al., supra; Sui et al. (2002) Proc. Natl. Acad. Sci. USA
99:5515-20) or stably (Paddison et al. (2002) Proc. Natl. Acad. Sci. USA
99:1443-48; Cullen (2006) Gene Therapy 13:503-08), using an expression
vector(s) containing the sense and antisense siRNA sequences. Recently,
reduction of levels of target mRNA in primary human cells, in an efficient and
sequence-specific manner, was demonstrated using adenoviral vectors that
express hairpin RNAs, which are further processed into siRNAs (Arts et al.
(2003) Genome Res. 13:2325-32).
[0080] The siRNA molecules targeted to the polynucleotides of or related to the
present invention can be designed based on criteria well known in the art (e.g.,
Elbashir et al. (2001) EMBOJ. 20:6877-88; Aronin (2006) Gene Therapy
13:509-16). For example, the target segment of the target mRNA preferably
should begin with AA (most preferred), TA, GA, or CA; the GC ratio of the
siRNA molecule preferably should be 45-55%; the siRNA molecule preferably
should not contain three of the same nucleotides in a row; the siRNA molecule
preferably should not contain seven mixed G/Cs in a row; and the target
segment preferably should be in the ORF region of the target mRNA and
preferably should be at least 75 bp after the initiation ATG and at least 75 bp

before the stop codon. Based on these criteria, or on other known criteria (e.g.,
Reynolds et al. (2004) Nature Biotechnol. 22:326-30), siRNA molecules related
to the present invention that target the mRNA polynucleotides of or related to
the present invention may be designed by one of skill in the art.
[0081] Altered expression of the genes of or related to the present invention in
an organism may also be achieved through the creation of nonhuman transgenic
animals into whose genomes polynucleotides of or related to the present
invention have been introduced. Such transgenic animals include animals that
have multiple copies of a gene (i.e., the transgene) of the present invention. A
tissue-specific regulatory sequence(s) may be operably linked to the transgene
to direct expression of a polypeptide of or related to the present invention to
particular cells or a particular developmental stage. Methods for generating
transgenic animals via embryo manipulation and microinjection, particularly
animals such as mice, have become conventional and are well known in the art
(e.g., Bockamp et al. (2002) Physiol. Genomics 11:115-32).
[0082] Altered expression of the genes of or related to the present invention in
an organism may also be achieved through the creation of animals whose
endogenous genes corresponding to the polynucleotides of or related to the
present invention have been disrupted through insertion of extraneous
polynucleotide sequences (i.e., a knockout animal). The coding region of the
endogenous gene may be disrupted, thereby generating a nonfunctional protein.
Alternatively, the upstream regulatory region of the endogenous gene may be
disrupted or replaced with different regulatory elements, resulting in the altered
expression of the still-functional protein. Methods for generating knockout
animals include homologous recombination and are well known in the art (e.g.,
Wolfer et al. (2002) Trends Neurosci. 25:336-40).
[0083] The isolated polynucleotides of or related to the present invention also
may be operably linked to an expression control sequence and/or ligated into an
expression vector for recombinant production of the polypeptides (including
active fragments and/or fusion polypeptides thereof) of or related to the present

invention. General methods of expressing recombinant proteins are well known
in the art.
[0084] An expression vector, as used herein, is intended to refer to a nucleic
acid molecule capable of transporting another nucleic acid to which it has been
linked. One type of vector is a plasmid, which refers to a circular double-
stranded DNA loop into which additional DNA segments may be ligated.
Another type of vector is a viral vector, wherein additional DNA segments may
be ligated into the viral genome. Certain vectors are capable of autonomous
replication in a host cell into which they are introduced (e.g., bacterial vectors
having a bacterial origin of replication and episomal mammalian vectors).
Other vectors (e.g., nonepisomal mammalian vectors) can be integrated into the
genome of a host cell upon introduction into the host cell, and thereby are
replicated along with the host genome. Moreover, certain vectors are capable of
directing the expression of genes to which they are operably linked. Such
vectors are referred to herein as recombinant expression vectors (or simply,
expression vectors). In general, expression vectors of utility in recombinant
DNA techniques are often in the form of plasmids. In the present specification,
plasmid and vector may be used interchangeably, as the plasmid is the most
commonly used form of vector. However, the invention is intended to include
other forms of expression vectors, such as viral vectors (e.g., replication-
defective retroviruses, adenoviruses and adeno-associated viruses) that serve
equivalent functions.
[0085] In one embodiment, the polynucleotides of or related to the present
invention are used to create recombinant legumain and/or ZB-1 antagonists. An
example of a legumain antagonist includes enzymatically inactive legumain
(polypeptide or polynucleotide) and enzymatically inactive fragments thereof.
An example of a ZB-1 antagonist includes enzymatically inactive ZB-1
(polypeptide or polynucleotide) and enzymatically inactive fragments thereof.
Enzymatically inactive legumain and/or ZB-1 include molecules that contain all
OT part of the N-terminal and/or C-terminal propeptides (e.g., the sequence
N-terminal to amino acid position 21 or 25 and/or the sequence C-terminal to

amino acid position 323). Such antagonists may be useful in regulating
asparaginyl protease activity, and consequently, in the treatment of
atherosclerosis or other vascular and inflammatory disorders in which it is
desirable to decrease asparaginyl bond hydrolysis. In another embodiment, the
polynucleotides of or related to the present invention are used to create other
legumain and ZB-1 antagonists, e.g., legumain and/or ZB-1 inhibitory
polynucleotides, legumain and/or ZB-1 inhibitory polypeptides (including
fragments and fusion proteins thereof), antagonistic anti-legumain antibodies
and fragment thereof, antagonistic anti-ZB-1 antibodies and fragments thereof,
and antagonistic small molecules.
[0086] Methods of creating fusion polypeptides, i.e., a first polypeptide moiety
linked with a second polypeptide moiety, are well known in the art. For
example, a legumain and/or ZB-1 polypeptide may be fused to a second
polypeptide moiety, e.g., an immunoglobulin or a fragment thereof (e.g., an Fc
fragment). In some embodiments, the first polypeptide moiety includes, e.g., a
full-length human legumain or ZB-1 polypeptide. Alternatively, the first
polypeptide may comprise less, man the full-length legumain or ZB-1
polypeptide (e.g., a substrate binding domain of legumain or ZB-1).
Additionally, soluble forms of legumain or ZB-1 may be fused through "linker"
sequences to the Fc portion of an immunoglobulin. Other fusions proteins, such
as those with glutathiones-transferase (GST), Lex-A, thioredoxin (TRX) or
maltose-binding protein (MBP),may also be used.
[0087] The second polypeptide moiety is preferably soluble. In some
embodiments, the second polypeptide moiety enhances the half-life, (e.g., the
serum half-life) of the linked polypeptide. In some embodiments, the second
polypeptide moiety includes a sequence that facilitates association of the fusion
polypeptide with a legumain or ZB-1 polypeptide. In one embodiment, the
second polypeptide includes at least a region of an immunoglobulin
polypeptide. Immunoglobulin fusion polypeptides are known in the art and are
described in, e.g., U.S. Patent Nos. 5,516,964; 5,225,538; 5,428,130; 5,514,582;
5,714,147; and 5,455,165, all of which are hereby incorporated by reference

herein in their entireties. The fusion proteins may additionally include a linker
sequence joining the first polypeptide moiety, e.g., human legumain or ZB-1,
including fragments thereof, to the second moiety. Use of such linker sequences
are well known in the art. For example, the fusion protein can include a peptide
linker, e.g., a peptide linker of about 2 to 20, more preferably less than 10,
amino acids in length. In one embodiment, the peptide linker may be 2 amino
acids in length. In other embodiments, a fusion protein of or related to the
invention includes more than two polypeptide moieties, e.g., a tripartite fusion
protein may comprise two legumain polypeptides (or fragments thereof), two
ZB-1 polypeptides (or fragments thereof), or a combination thereof linked by a
third polypeptide moiety that facilitates association of the two legumain
polypeptides (or fragments thereof), two ZB-1 polypeptides (or fragments
thereof), or a combination thereof.
[0088] In another embodiment, the recombinant protein includes a heterologous
signal sequence (i.e., a polypeptide sequence that is not present in a polypeptide
encoded by a legumain or ZB-1 polynucleotide) at its N-terminus. For example,
a signal sequence from another protein may be fused with a legumain or ZB-1
polypeptide, including fragments and/or fusion proteins thereof. In certain host
cells (e.g., mammalian host cells), expression and/or secretion of recombinant
proteins can be increased through use of a heterologous signal sequence. A
signal peptide that may be included in the fusion protein is the melittin signal
peptide with the sequence: MKFLVNVALVFMVVYISYIYA (SEQ ID NO: 13).
[0089] A fusion protein of the invention may be produced by standard
recombinant DNA techniques. For example, DNA fragments coding for the
different polypeptide sequences are ligated together in-frame in accordance with
conventional techniques by employing, e.g., blunt-ended or sticky-ended termini
for ligation, restriction enzyme digestion to provide for appropriate termini,
filling-in of cohesive ends as appropriate, alkaline phosphatase treatment to
avoid undesirable joining, and enzymatic ligation. In another embodiment, the
fusion gene can be synthesized by conventional techniques including automated
DNA synthesizers. Alternatively, PCR amplification of gene fragments may be

carried out using anchor primers that give rise to complementary overhangs
between two consecutive gene fragments that can subsequently be annealed and
reamplified to generate a chimeric gene sequence (see, for example, Current
Protocols in Molecular Biology, Ausubel et al. (eds.), John Wiley & Sons,
1992). Moreover, many expression vectors are commercially available that
encode a fusion moiety (e.g., an Fc region of an immunoglobulin heavy chain).
A legumain-encoding or a ZB-1-encoding nucleic acid may be cloned into such
an expression vector such that the fusion moiety is linked in-frame to the
immunoglobulin protein.
[0090] The recombinant expression vectors of the invention may carry
additional sequences, such as sequences that regulate replication of the vector in
host cells (e.g., origins of replication) and selectable marker genes. The
selectable marker gene facilitates selection of host cells into which the vector
has been introduced. For example, typically the selectable marker gene confers
resistance to drugs, such as G418, hygromycin or methotrexate, to a host cell
into which the vector has been introduced. Preferred selectable marker genes
include the dihydrofolate reductase (DHFR) gene (for use in dhfr" host cells
with methotrexate selection/amplification) and the neo gene (for G418
selection).
[0091] Suitable vectors can be chosen or constructed, containing appropriate
regulatory sequences, including promoter sequences, terminator sequences,
polyadenylation sequences, enhancer sequences, marker genes and other
sequences, e.g., sequences that regulate replication of the vector in the host cells
(e.g., origins of replication) as appropriate. Vectors may be plasmids or viral,
e.g., phage, or phagemid, as appropriate. For further details see, for example,
Molecular Cloning: a Laboratory Manual: 2nd ed., Sambrook et al., Cold Spring
Harbor Laboratory Press, 1989. Many known techniques and protocols for
manipulation of nucleic acids, for example, in preparation of nucleic acid
constructs, mutagenesis, sequencing, introduction of DNA into cells and gene
expression, and analysis of proteins, are described in detail in Current Protocols
in Molecular Biology, 2nd ed., Ausubel et al. (eds.) John Wiley & Sons, 1992.

[0092] A further aspect of the present invention provides a host cell comprising
a nucleic acid as disclosed herein. A still further aspect provides a method
comprising introducing such nucleic acid into a host cell. The introduction may
employ any available technique. For eukaryotic cells, suitable techniques may
include calcium phosphate transfection, DEAE-Dextran, electroporation,
liposome-mediated transfection, and transduction using retrovirus or other
viruses, e.g., vaccinia or, for insect cells, baculovirus. For bacterial cells,
suitable techniques may include calcium chloride transformation,
electroporation and transfection using bacteriophage. The introduction may be
followed by causing or allowing expression from the nucleic acid, e.g., by
culturing host cells under conditions for expression of the gene.
[0093] A number of cell lines may act as suitable host cells for recombinant
expression of the polypeptides of or related to the present invention.
Mammalian host cell lines include, for example, COS cells, CHO cells, 3T3-L1,
293 cells, A431 cells, 3T3 cells, CV-1 cells, HeLa cells, L cells, BHK21 cells,
HL-60 cells,.U937 cells, HaK cells, Jurkat cells, THP-1 cells as well as cell
strains derived from in vitro culture of primary tissue and primary explants.
[0094] Alternatively, it may be possible to recombinantly produce the
polypeptides of or related to the present invention in lower eukaryotes, such as
yeast, or in prokaryotes. Potentially suitable yeast strains include
Saccharomyces cerevisiae, Schizosaccharomyces pombe, Kluyveromyces
strains, and Candida strains. Potentially suitable bacterial strains include
Escherichia coli, Bacillus subtilis, and Salmonella typhimurium. If the
polypeptides of or related to the present invention are made in yeast or bacteria,
it may be necessary to modify them by, for example, phosphorylation or
glycosylation of appropriate sites, in order to obtain functionality. Such
covalent attachments may be accomplished using well-known chemical or
enzymatic methods.
[0095] Expression in bacteria may result in formation of inclusion bodies •
incorporating the recombinant protein. Thus, refolding of the recombinant
protein may be required in order to produce active or more active material.

Several methods for obtaining correctly folded heterologous proteins from
bacterial inclusion bodies are known in the art. These methods generally
involve solubilizing the protein from the inclusion bodies, then denaturing the
protein completely using a chaotropic agent. When cysteine residues are
present in the primary amino acid sequence of the protein, it is often necessary
to accomplish the refolding in an environment that allows correct formation of
disulfide bonds (a redox system). General methods of refolding are disclosed
in, e.g., Kohno (1990) Meth. Enzymol. 185:187-95. Other appropriate methods
are disclosed in, e.g., EP 0433225 and U.S. Patent No. 5,399,677.
[0096] The polypeptides of or related to the present invention may also be
recombinantly produced by operably linking the isolated polynucleotides of the
present invention to suitable control sequences in one or more insect expression
vectors, such as baculovirus vectors, and employing an insect cell expression
system. Materials and methods for baculovirus / Sf9 expression systems are
commercially available in kit form (e.g., BAC-TO-BAC® and MAXBAC® kits,
Invitrogen, Carlsbad, CA).
[0097] Following recombinant expression in the appropriate host, cells, the
recombinant polypeptides of the present invention may then be purified from
cell extracts using known purification processes, such as immunoprecipitation,
gel filtration and ion exchange chromatography. For example, membrane-
bound forms of a legumain and/or ZB-1 polypeptide may be purified by
preparing a total membrane fraction from the expressing cell and extracting the
membranes with a nonionic detergent such as Triton X-100. A polypeptide of
or related to the present invention may be concentrated using a commercially
available protein concentration filter, for example, an AMICON® or Millipore
PELLICON® ultrafiltration unit (Millipore, Billerica, MA). Following the
concentration step, the concentrate can be applied to a purification matrix such
as a gel filtration medium. Alternatively, an anion exchange resin can be
employed, for example, a matrix or substrate having pendant diethylaminoethyl
(DEAE) or polyetheyleneimine (PEI) groups. The matrices can be acrylamide,
agarose, dextran, cellulose or other types commonly employed in protein

purification. Alternatively, a cation exchange step can be employed. Suitable
cation exchangers include various insoluble matrices comprising sulfopropyl or
carboxymethyl groups. Sulfopropyl groups are preferred (e.g.,
S-SEPHAROSE® columns, Sigma-Aldrich, St. Louis, MO). The purification of
recombinant proteins from culture supernatant may also include one or more
column steps over such affinity resins as concanavalin A-agarose, heparin-
TOYOPEARL® (Toyo Soda Manufacturing Co., Ltd., Japan) or Cibacrom blue
3GA SEPHAROSE® (Tosoh Biosciences, San Francisco, CA); or by
hydrophobic interaction chromatography using such resins as phenyl ether,
butyl ether, or propyl ether; or by immunoaffinity chromatography. Finally, one
or more reverse-phase high performance liquid chromatography (RP-HPLC)
steps employing hydrophobic RP-HPLC media, e.g., silica gel having pendant
methyl or other aliphatic groups, can be employed to further purify the
recombinant protein. Affinity columns including antibodies (e.g., those
described using the methods herein) to the recombinant protein may also be
used in purification in accordance with known methods. Some or all of the
foregoing purification steps, in various combinations or with other known
methods, may also be employed to provide a substantially purified isolated
recombinant protein. Preferably, the isolated recombinant protein is purified so
that it is substantially free of other mammalian proteins. Additionally, these
purification processes may also be used to purify the polypeptides of the present
invention from other sources, including natural sources. For example,
polypeptides of or related to the invention, e.g., mouse and human Iegumain and
ZB-1 (e.g., full length or fragments of Iegumain or ZB-1, and fusions thereof),
which are expressed as a product of transgenic animals, e.g., as a component of
the milk of transgenic animals, e.g., transgenic cows, goats, pigs, or sheep, may
be purified as described above.
[0098] Alternatively, the polypeptides may also be recombinantly expressed in
a form that facilitates purification. For example, the polypeptides may be
expressed as fusions with proteins such as maltose-binding protein (MBP),
glutathione-5-transferase (GST), or thioredoxin (TRX). Kits for expression and

purification of such fusion proteins are commercially available from New
England BioLabs (Beverly, MA), Pharmacia (Piscataway, NJ), and Tnvitrogen,
respectively. Recombinant proteins can also be tagged with a small epitope and
subsequently identified or purified using a specific antibody to the epitope. A
preferred epitope is the FLAG epitope, which is commercially available from
Eastman Kodak (New Haven, CT).
[0099] The polypeptides of or related to the present invention, including
legumain and/or ZB-1 antagonists, may also be produced by known
conventional chemical synthesis. Methods for chemically synthesizing such
polypeptides are well known to those skilled in the art. Such chemically
synthetic polypeptides may possess biological properties in common with the
natural, purified polypeptides, and thus may be employed as biologically active
or immunological substitutes for the natural polypeptides.
[0100] The polypeptides of or related to the present invention, including
legumain and/or ZB-1 antagonists, also encompass molecules that are
structurally different from the disclosed polypeptides (e.g., which have a
slightly altered sequence), but have substantially the same biochemical
properties as the disclosed polypeptides (e.g., are changed only in functionally
nonessential amino acid residues). Such molecules include naturally occurring
allelic variants and deliberately engineered variants containing alterations,
substitutions, replacements, insertions, or deletions. Techniques for such
alterations, substitutions, replacements, insertions, or deletions are well known
to those skilled in the art. In some embodiments, the polypeptide moiety is
provided as a variant polypeptide having mutations in the naturally occurring
sequence (wild type) that results in a sequence more resistant to proteolysis
(relative to the nonmutated sequence).
[0101] Some amino acid sequences of legumain and ZB-1 can be varied
without significantly modifying legumain or ZB-1 structure or function. To
retain a particular structure or function, it is possible to replace residues that
form legumain or ZB-1 protein tertiary structure, provided that the substituting
residue performs a similar function. In other instances, the type of residue may

be completely irrelevant if an alteration occurs in a noncritical area. Thus, the
invention further includes legumain or ZB-1 variants. Such variants include
deletions, insertions, inversions, repeats, and type substitutions (for example,
substituting one hydrophilic residue for another, but not a strongly hydrophilic
residue for a strongly hydrophobic residue). Small changes or "neutral" amino
acid substitutions will often have little impact on protein function (Taylor
(1986) J. Theor.Biol. 119:205-18). Conservative substitutions may include, but
are not limited to, replacements among the aliphatic amino acids, exchange of
acidic residues, substitution between amide residues, exchange of basic
residues, and replacements among the aromatic residues. Further guidance
concerning what amino acid change is likely to be phenotypically silent or noisy
can be found in Bowie et al. ((1990) Science 247:1306-10) and Zvelebil et al.
((1987) J. Mol. Biol 195:957-61). Thus, legumain and/or ZB-1 polynucleotides
and polypeptides may be naturally occurring or may be produced by altering
various residues without changing substrate specificity and enzymatic activity.
Alternatively, one of skill in the art would be able to produce legumain and/or
ZB-1 polynucleotides and polypeptides with altered substrate specificity and
enzymatic activity using the disclosed polynucleotide and polypeptide
sequences.
[0102] Mammalian legumain is highly conserved and contains the
pfam01650.12 "Peptidase_C13" conserved domain, which may be used as a
guide to design and construct recombinant legumain and ZB-1 polynucleotides
and polypeptides that display different substrate specificity, substrate affinity,
and enzymatic activity. For example, Chen et al. ((2000) supra) report that an
inactive legumain may be produced by mutating the active site cysteine, i.e.,
residue Cys(l 89). In addition, mammalian legumain undergoes both C- and N-
terminal processing of propeptides to induce activation (id.; Li et al., supra). It
has been shown that an inactive legumain may be produced by simply replacing
the C-terminal cleavage site, i.e., Asn(323), with various residues such as
aspartate, serine, alanine, or glutamate (Chen et al. (2000) supra). Additionally,
legumain activity may be reduced by mutating the N-terminal cleavage sites,

i.e., Asp(21) or Asp(25), e.g., via alanine replacement (Li et al., supra). Thus,
as used herein "legumain" and "ZB-1" additionally refer to these and other
derivative and variant polypeptide and polynucleotide sequences. Such
derivatives and variants are deemed to be within the scope and knowledge of
those skilled in the art.
[0103] Legumain and/or ZB-1 polypeptides, fragments and/or fusion
polypeptides thereof, recombinant and/or natural forms thereof, variant and/or
naturally occurring forms thereof, may be used to screen for agents (e.g., other
legumain and/or ZB-1 antagonists, e.g., anti-legumain antibodies) that are
capable of binding legumain and/or ZB-1 and/or regulating legumain and/or
ZB-1 activity, as described further herein. Binding assays utilizing a desired
bindingprotein, immobilized or not, are well known in the art and may be used
for this purpose with the polypeptides of or related to the present invention,
including the legumain and/or ZB-1 antagonists of the invention, e.g., legumain
polynucleotides and polypeptides. Purified cell-based or protein-based (cell-
free) screening assays may be used to identify such agents. For example,
legumain and/or ZB-1 polypeptides may be immobilized in purified form on a
carrier, and binding of potential substrates/ligands/antagonists to purified
legumain and/or ZB-1 may be measured.
Antibodies
[0104] In other embodiments, the invention provides legumain and/or ZB-1
antagonists as antibodies and antibody fragments thereof, i.e., intact antibodies
and antigen-binding fragments thereof, that specifically bind to legumain and/or
ZB-1 and/or fragments thereof, preferably mammalian (e.g.3 human or mouse)
legumain and/or ZB-1. In one embodiment, the antibodies are inhibitory
antibodies, i.e., they inhibit or reduce at least one legumain and/or ZB-1 activity
(e.g., hydrolysis of asparaginyl bonds) and may be useful in diagnosing,
prognosing, monitoring, treating, ameliorating and/or preventing legumain-
and/or ZB-1-associated disorders, e.g., vascular and/or inflammatory disorders.
Additionally, the invention provides anti-legumain antibodies and anti-ZB-1
antibodies that specifically bind to legumain and/or ZB-1 (respectively or

concurrently, as appropriate throughout), but do not inhibit legumain and/or
ZB-1 activity (i.e., detecting antibodies); such antibodies may be used to detect
the presence of, e.g., legumain or ZB-1 protein, e.g., as part of a kit for
diagnosing, prognosing, and/or monitoring legumain- and/or ZB-1 -associated
disorders, e.g., vascular and/or inflammatory disorders. In one embodiment, the
antibody is directed to legumain, preferably mammalian legumain, more
preferably human legumain. In another embodiment, the antibody is directed to
ZB-1, preferably mammalian ZB-1, more preferably human ZB-1. In another
embodiment, the antibody is a monoclonal or single specificity antibody. The
antibodies may also be human, humanized, chimeric, or in vitro-generated
antibodies against, e.g., human or mouse legumain and/or human or mouse
ZB-1.
[0105] One of skill in the art will recognize that, as used herein, the term
"antibody" refers to a protein comprising at least one, and preferably two, heavy
(H) chain variable regions (abbreviated herein as VH), and at least one and
preferably two light (L) chain variable regions (abbreviated herein as VL). The
antibody may further include a heavy and light chain constant region to thereby
form a heavy and light immunoglobulin chain, respectively. In one
embodiment, the antibody is a tetramer of two heavy immunoglobulin chains
and two light immunoglobulin chains, wherein the heavy and light
immunoglobulin chains are interconnected, e.g., by disulfide bonds.
[0106] The "antigen binding fragment," e.g., of an antibody (or simply
"antibody portion," or "fragment"), as used herein, refers to one or more
fragments, e.g., of a full-length antibody, that retain the ability to specifically
bind to an antigen. Examples of binding fragments encompassed within the
term "antigen binding fragment" of an antibody include, but are not limited to:
(i) an Fab fragment, a monovalent fragment consisting of the VL, VH, CL and
CHI domains; (ii) an F(ab')2 fragment, a bivalent fragment comprising two Fab
fragments linked by a disulfide bridge at the hinge region; (iii) an Fd fragment
consisting of the VH and CHI domains; (iv) an Fv fragment consisting of the
VL and VH domains of a single arm of an antibody; (v) a dAb fragment, which

consists of a VH domain; and (vi) an isolated complementarity determining
region (CDR). Furthermore, although the two domains of the Fv fragment, VL
and VH, are encoded by separate genes, they may be joined, using recombinant
methods, by a synthetic linker that enables their production as a single protein
chain in which the VL and VH regions pair to form monovalent molecules
(known as single chain Fv (scFv)). Such single chain antibodies are also
intended to be encompassed within the term "antigen binding fragment." These
antibody fragments, or antigen binding fragments, are obtained using
conventional techniques known to those skilled in the art, and the fragments are
screened for utility in the same manner as are intact antibodies.
[0107] In some embodiments, the invention provides single domain antibodies.
Single domain antibodies can include antibodies whose CDRs are part of a
single domain polypeptide. Examples include, but are not limited to, heavy
chain antibodies, antibodies naturally devoid of light chains, single domain
antibodies derived from conventional four-chain antibodies, engineered
antibodies and single domain scaffolds other than those derived from antibodies.
Single domain antibodies may be any of those known in the art, or any future
single domain antibodies. Single domain antibodies may be derived from any
species including, but not limited to, mouse, human, camel, llama, goat, rabbit,
bovine. According to one aspect of the invention, a single domain antibody as
used herein is a naturally occurring single domain antibody known as heavy
chain antibody devoid of light chains. Such single domain antibodies are
disclosed in, e.g., WO 94/04678. This variable domain derived from a heavy
chain antibody naturally devoid of light chain is known herein as a VHH or
nanobody, to distinguish it from the conventional VH of four-chain
immunoglobulins. Such a VHH molecule can be derived from antibodies raised
in Camelidae species, for example in camel, llama, dromedary, alpaca and
guanaco. Other species besides Camelidae may produce heavy chain antibodies
naturally devoid of light chain; such VHH molecules are within the scope of the
invention.

[0108] Antibody molecules to the polypeptides of or related to the present
invention, e.g., antibodies to legumain and/or ZB-1, may be produced by
methods well known to those skilled in the art. Legumain and/or ZB-1 proteins
of the invention may also be used to immunize animals to obtain polyclonal and
monoclonal antibodies that react with the legumain and/or ZB-1 protein and
which may inhibit the interaction of a substrate with legumain and/or ZB-1. A
full-length polypeptide of the present invention may be used as the immunogen,
or, alternatively, antigenic peptide fragments of the polypeptides may be used.
An antigenic peptide of a polypeptide of the present invention comprises at least
7 continuous amino acid residues and encompasses an epitope such that an
antibody raised against the peptide forms a specific immune complex with the
polypeptide. Preferably, the antigenic peptide comprises at least 10 amino acid
residues, more preferably at least 15 amino acid residues, even more preferably
at least 20 amino acid residues, and most preferably at least 30 amino acid
residues.
[0109] In a further improvement on the procedure for producing antibodies, a
method for identifying a clinically relevant epitope on an immunogen, and a
correlative method for selecting an antibody that binds immunospecifically to
the relevant epitope with high affinity, are disclosed in, e.g., U.S. Published
Patent Application No. 2002/0029391, which is hereby incorporated by
reference herein in its entirety. Exemplary epitopes generally useful for
targeting lipid asparaginyl peptidases and other cysteine peptidases are
discussed in Coleman and Lee (2004) supra.
[0110] Monoclonal antibodies may be generated by other methods known to
those skilled in the art of recombinant DN A technology. As an alternative to
preparing monoclonal antibody-secreting hybridomas, a monoclonal antibody to
a polypeptide of the present invention may be identified and isolated by
screening a recombinant combinatorial immunoglobulin library (e.g., an
antibody phage display library) with a polypeptide of or related to the present
invention (e.g., mouse and human legumain and/or ZB-1 and fragments thereof)
to thereby isolate immunoglobulin library members that bind to the polypeptides

of or related to the present invention. The "combinatorial antibody display"
method is well known and was developed to identify and isolate antibody
fragments having a particular antigen specificity, and can be utilized to produce
monoclonal antibodies.
[0111] Polyclonal sera and antibodies may be produced by immunizing a
suitable subject with a polypeptide of or related to the present invention. The
antibody titer in the immunized subject may be monitored over time, and the
antibody molecules directed against a polypeptide of the present invention may
be isolated from the subject or culture media and further purified by well-known
techniques.
[0112] Fragments of antibodies to the polypeptides of the present invention
may be produced by cleavage of the antibodies in accordance with methods well
known in the art. For example, immunologically active Fab and F(ab')2
fragments may be generated by treating the antibodies with an enzyme such as
pepsin.
[0113] Additionally, chimeric, humanized, and single-chain antibodies to the
polypeptides of the present invention, comprising both human and nonhuman
portions, may be produced using standard recombinant DNA techniques and/or
a recombinant combinatorial immunoglobulin library. For example, human
monoclonal antibodies (mAbs) directed against, e.g., human legumain and/or
ZB-1, may be generated using transgenic mice carrying the human
immunoglobulin genes rather than murine immunoglobulin genes.
[0114] Monoclonal, chimeric, human and humanized antibodies that have been
modified by, e.g., deleting, adding, or substituting other portions of the
antibody, e.g., the constant region, are also within the scope of the invention.
As nonlimiting examples, an antibody can be modified by deleting the constant
region, by replacing the constant region with another constant region, e.g., a
constant region meant to increase half-life, stability, or affinity of the antibody,
or a constant region from another species or antibody class, and by modifying
one or more amino acids in the constant region to alter, for example, the number

of glycosylation sites, effector cell function, Fc receptor (FcR)binding,
complement fixation, etc.
[0115] Antibodies with altered function, e.g., altered affinity for an effector
ligand, such as FcR on a cell, or the CI component of complement, can be
produced by replacing at least one amino acid residue in the constant portion of
the antibody with a different residue (see, e.g., EP 388,151, U.S. Patent Nos.
5,624,821 and 5,648,260, the contents of all of which are hereby incorporated
by reference herein in their entireties).
[0116] In addition to antibodies for use in the instant invention, other molecules
may also be employed to modulate the activity of legumain and/or ZB-1. Such
molecules include small modular immunopharmaceutical (SMIP™) drugs
(Trubion Pharmaceuticals, Seattle, WA). SMIPs are single-chain polypeptides
composed of a binding domain for a cognate structure such as an antigen, a
counter receptor or the like, a hinge-region polypeptide having either one or no
cysteine residues, and immunoglobulin CH2 and CH3 domains (see also
www.trubion.com). SMIPs and their uses and applications are disclosed in, e.g.,
U.S. Published Patent Appln. Nos. 2003/0118592, 2003/0133939,
2004/0058445, 2005/0136049, 2005/0175614, 2005/0180970, 2005/0186216,
2005/0202012, 2005/0202023,2005/0202028, 2005/0202534, and
2005/0238646, and related patent family members thereof, all of which are
hereby incorporated by reference herein in their entireties.
[0117] Anti-legumain antibodies and/or anti-ZB-1 antibodies of the invention
may be useful for isolating, purifying, and/or detecting legumain and/or ZB-1
polypeptides and legumain and/or ZB-1 polypeptide fragments (or fusions
thereof), in supernatant, in cellular lysate, on a cell surface, or within the
extracellular matrix. Antibodies disclosed in this invention also may be used
diagnostically to monitor, e.g., legumain and/or ZB-1 polypeptide levels, as part
of a clinical testing procedure, or clinically to target a therapeutic modulator to a
cell or tissue comprising the antigen of the antibody. For example, a
therapeutic, such as a small molecule or other therapeutic of the invention, may
be linked to an anti-legumain antibody and/or an anti-ZB-1 antibody in order to

target the therapeutic to the cell or tissue expressing legumain and/or ZB-1.
Antagonistic antibodies (including, but not limited to, monoclonal antibodies)
that bind to legumain and/or ZB-1 polypeptides may also be useful in the
treatment of a disease(s) related to legumain and/or ZB-1 activity, or legumain-
and/or ZB-1-associated conditions. Thus, the present invention further provides
compositions comprising an inhibitory (antagonist) antibody that specifically
binds to legumain and/or ZB-1 and which decreases, limits, blocks, or otherwise
reduces legumain and/or ZB-1 activity. Similarly, anti-legumain and/or anti-
ZB-1 antibodies may be useful in isolating, purifying, detecting, and/or
diagnostically monitoring legumain and/or ZB-1, and/or clinically targeting a
therapeutic modulator to a cell or tissue comprising legumain and/or ZB-1.
Screening Assays
[0118] The legumain and ZB-1 polynucleotides and polypeptides may be used
in screening assays to identify pharmacological agents or lead compounds for
agents that are capable of modulating the activity of legumain and/or ZB-1 in a
cell or organism, and are thereby potential regulators of vascular and
inflammatory disorders and disorders associated with, e.g., dysregulation of
asparaginyl peptidase activity. For example, samples containing legumain
and/or ZB-1 may be contacted with one of a plurality of test compounds (either
biological agents or small organic molecules), and the activity of legumain
and/or ZB-1 in each of the treated samples can be compared with the activity of
legumain and/or ZB-1 in untreated samples or in samples contacted with
different test compounds. Such comparisons will determine whether any of the
test compounds results in: (1) a substantially decreased level of expression
and/or activity (and/or secretion, if the sample consists of an intact cell(s)) of
legumain and/or ZB-1, thereby indicating an antagonist of legumain and/or
ZB-1; or (2) a substantially increased level of expression and/or activity (and/or
secretion, if the sample consists of an intact cell(s)) of legumain or ZB-1,
thereby indicating an agonist of legumain and/or ZB-1. In one embodiment, the
identification of test compounds capable of modulating legumain and/or ZB-1
activity is performed using high-throughput screening assays, such as

BIACORE® (Biacore International AB, Uppsala, Sweden), BRET
(bioluminescence resonance energy transfer), and FRET (fluorescence
resonance energy transfer) assays, as well as EL1SA and cell-based assays.
[0119] As legumain hydrolyzes asparaginyl bonds (and ZB-1 is predicted
similarly to hydrolyze such bonds), screens for antagonists of legumain and/or
ZB-1 activity may employ well-established methods for analyzing the activity
of a cysteine protease, or may follow the protocols described in the Examples.
Thus, one may contact a cell or sample containing legumain and/or ZB-1 with a
test compound, and determine if the test compound modulates legumain and/or
ZB-1 expression by, e.g., Western or Northern Analysis, PCR,
immunohistochemistry, in situ hybridization, differential display, etc.
Alternatively, one may contact a cell or sample containing legumain and/or
ZB-1 with a test compound and determine if the test compound modulates
legumain and/or ZB-1 activity (and/or secretion, if the sample consists of an
intact cell(s)). Legumain and/or ZB-1 activity may be measured by a variety of
methods, including those disclosed in Chen et al. ((2006) supra), Li et al.
(supra), and Kato et al. (supra). As shown in the examples, using, e.g., the
peptide substrate Z-AAN-MCA (Peptide Institute), one may determine whether
legumain or ZB-1 have increased or decreased protease activity in the presence
of a particular test compound. Various direct and indirect legumain regulators
are well known in the art, and may be used for comparative measurements (see,
e.g., Vigreswaran et al., supra and Yamane et al., supra). In addition, activity-
based probes for legumain are disclosed in Kato et al., supra.
Small Molecules
[0120] Decreasing legumain and/or ZB-1 activity, expression and/or secretion
in an organism (or subject) afflicted with (or at risk for) a disorder related to
enhanced legumain and/or ZB-1 expression and/or activity or a disorder related
to, e.g., increased asparaginyl protease activity, e.g., atherosclerosis, arthritis,
etc., or decreasing legumain and/or ZB-1 activity, expression, and/or secretion
in a cell involved in such disorders from such an organism, may also be
achieved through the use of small molecules (usually organic small molecules)

that antagonize, i.e., decrease or inhibit the activity of, legumain and/or ZB-1.
Novel antagonistic small molecules may be identified by the screening methods
described herein and may be used in the methods of the present invention
described herein. Additional small molecule regulators of legumain activity are
well known in the art and may be used for comparative measurements or in the
methods disclosed herein (see, e.g., Vigreswaran et al., supra; Niestro, et al.,
supra; and Gotz, supra).
[0121] The term small molecule refers to compounds that are not
macromolecules (see, e.g., Karp (2000) Bioinformatics Ontology 16:269-85;
Verkman (2004) AJP-Cell Physiol. 286:465-74). Thus, small molecules are
often considered those compounds that are, e.g., less than one thousand daltons
(e.g., Voet and Voet, Biochemistry, 2nd ed., ed. N. Rose, Wiley and Sons, New
York, 14 (1995)). For example, Davis et al. ((2005) Proc. Natl. Acad. Sci. USA
102:5981-86) use the phrase small molecule to indicate folates, methotrexate,
and neuropeptides, whereas Halpin and Harbury ((2004) PLos Biology 2:1022-
30) use the phrase to indicate small molecule gene products, e.g., DNAs, RNAs
and peptides. Examples of natural small molecules include, but are not limited
to, cholesterols, neurotransmitters, aptamers, and siRNAs (see, Dykxhoom et al.
(2006) Gene Therapy 13:541-52); synthesized small molecules include, but are
not limited to, various chemicals listed in numerous commercially available
small molecule databases, e.g., FCD (Fine Chemicals Database), SMID (Small
Molecule Interaction Database), ChEBI (Chemical Entities of Biological
Interest), and CSD (Cambridge Structural Database) (see, e.g., Alfarano et al.
(2005) Nuc. Acids Res. Database Issue 33:D416-24).
Methods for Diagnosing, Prognosing, and Monitoring the Progress of Disorders
and Conditions Related to Legumain and ZB-1 Activity
[0122] The present invention provides methods for diagnosing, prognosing, and
monitoring the progress of disorders and conditions related to legumain and/or
ZB-1 activity in a subject (e.g., conditions such as vascular and inflammatory
disorders, which directly or indirectly involve increases in the activity of
legumain and/or ZB-1) by detecting, e.g., an upregulation of legumain and/or

ZB-1 activity, expression, and/or secretion, including, but not limited to, the use
of such methods in human subjects. These methods may be performed by
utilizing prepackaged diagnostic kits comprising.at least one of the group
comprising a legumain and/or a ZB-1 polynucleotide or fragments thereof, a
legumain and/or a ZB-1 polypeptide or fragments thereof (including fusion
proteins thereof), antibodies or antibody fragments to a legumain and/or a ZB-1
polypeptide, or small molecule modulators of legumain and/or a ZB-1 activity,
expression, and/or secretion, as described herein, which may be conveniently
used, for example, in a clinical setting. A skilled artisan will recognize that
other indirect methods may be used to confirm, e.g., the upregulation of, e.g.,
human legumain and/or ZB-1, including, but not limited to, measuring changes
in the mass or dimensions of an atherosclerotic plaque.
[0123] "Diagnostic" or "diagnosing" means identifying the presence or absence
of a pathologic condition. Diagnostic methods include detecting a test amount
of: 1) the level of expression of legumain and/or ZB-1; 2) the level of activity of
legumain and/or ZB-1; and/or 3) the level of secretion of legumain and/or ZB-1,
by determining a test amount of the level of expression of legumain and/or ZB-1
(e.g., the level of mRNA, cDNA, and/or polypeptide, including fragments
thereof), level of activity of legumain and/or the ZB-1 (e.g., the level of
asparaginyl protease/peptidase activity), and/or the level of secretion of
legumain and/or ZB-1 (e.g., the level of legumain and/or ZB-1 found
extracellularly) in a biological sample from a subject (human or nonhuman
mammal), and comparing the test level/activity/secretion of legumain and/or
ZB-1 with a normal level/activity/secretion of legumain and/or ZB-1 or range
thereof (e.g., a reference amount, such as an amount or range from an
individuals) known not to suffer from disorders related to legumain and/or
ZB-1 activity, etc.). Although a particular diagnostic method may not provide a
definitive diagnosis of disorders related to legumain and/or ZB-1 activity, etc. it
suffices if the method provides a positive indication that aids in diagnosis.
[0124] The present invention also provides methods for prognosing such
disorders by detecting changes in legumain and/or ZB-1 expression, secretion,

and/or activity. "Prognostic" or "prognosing" means predicting the probable
development and/or severity of a pathologic condition. Prognostic methods
include determining the test amount of: 1) the level of expression of a legumain
and/or ZB-1 gene product; 2) the level of activity of legumain and/or ZB-1;
and/or 3) the level of secretion of legumain and/or ZB-1 in a biological sample
from a subject, and comparing the test level/activity/secretion of legumain
and/or ZB-1 to a prognostic level/activity/secretion of legumain and/or ZB-1 or
range thereof (e.g., an amount or range from individuals with varying severities
of disorders related to legumain and/or ZB-1 activity, etc. and/or disorders
associated with asparaginyl peptidase/protease dysregulation). In one
embodiment, the prognostic level/activity/secretion of legumain and/or ZB-1 or
range thereof may be a measurement from an individual at an earlier time point
than the test level/activity/secretion of legumain and/or ZB-1. Various amounts
of legumain and/or ZB-1 activity, secretion and/or expression in a test sample
are consistent with certain prognoses for disorders related to legumain and/or
ZB-1 activity and/or disorders associated with asparaginyl peptidase/protease
dysregulation. The detection of an amount of legumain and/or ZB-1 activity,
secretion and/or expression at a particular prognostic level provides a prognosis
for the subject.
[0125] The present invention also provides methods for monitoring the
progress or course of disorders, or the progress or course of treatment of
disorders, related to legumain and/or ZB-1 activity (and/or disorders associated
with asparaginyl peptidase/protease dysregulation, e.g., vascular disorders and
inflammatory disorders) by detecting, e.g., the upregulation or downregulation
of legumain and/or ZB-1 activity, secretion and/or expression. Monitoring
methods include determining a test amount of: 1) the level of a gene product of
legumain and/or ZB-1; 2) the level of activity of legumain and/or ZB-1; and/or
3) the level of secretion of legumain and/or ZB-1 in biological samples taken
from a subject at a first and second time, and comparing the amounts. A change
in the amount of legumain and/or ZB-1 activity, secretion, and/or expression
between the first and second times indicates a change in the course of the

legumain and/or ZB-1 -related conditions or disorders. Such monitoring assays
are also useful for evaluating the efficacy of a particular therapeutic intervention
in patients being treated for legumain and/or ZB-1 -associated conditions,
and/or conditions resulting in asparaginyl peptidase/protease dysregulation.
[0126] Increased legumain and/or ZB-1 activity, secretion, and/or expression in
the methods outlined above may be detected in a variety of biological samples,
including bodily fluids (e.g., whole blood, plasma, and urine), cells (e.g., whole
cells, cell fractions, and cell extracts), and other tissues. Biological samples also
include sections of tissue, such as biopsies and frozen sections taken for
histological purposes. Preferred biological samples include artery, kidney,
blood vessels, endothelial cells, monocytes, and macrophages. It will be
appreciated that analysis of a biological sample need not necessarily require
removal of cells or tissue from the subject. For example, appropriately labeled
agents that bind legumain and/or ZB-1 gene products (e.g., antibodies, nucleic
acids) can be administered to a subject and visualized (when bound to the
target) using standard imaging technology (e.g., CAT, NMR (MRJ), and PET).
[0127] In the diagnostic and prognostic assays of the present invention, the
level of legumain and/or ZB-1 activity, secretion, and/or expression is detected
and quantified to yield a test amount. The test amount is then compared with a
normal amount or range. Particular methods of detection and quantitation of the
level of legumain and ZB-1 activity, secretion, and/or expression are described
below.
[0128] Normal amounts or baseline levels of legumain or ZB-1 activity,
secretion (i.e., location of gene products, e.g., secreted or extracellular versus
intracellular), and/or expression may be determined for any particular sample
type and population. Generally, baseline (normal) levels or the baseline locale
of legumain and/or ZB-1 protein or mRNA are determined by measuring
respective amounts or locale of legumain and/or ZB-1 protein or mRNA in a
biological sample from normal (i.e., healthy) subjects. Alternatively, normal
values of legumain and/or ZB-1 gene products or locale may be determined by
measuring the level or locale in healthy cells or tissues taken from the same

subject from which the diseased (or possibly diseased) test cells or tissues were
taken. The amount of legumain and/or ZB-1 gene products (either the normal
amount or the test amount) or the locale of such gene products (i.e., extracellular
or intracellular) may be determined or expressed on a per cell, per total protein,
or per volume basis. To establish a standard/control cell level or locale of
legumain or ZB-1 in a sample, one can measure the level or locale of a
constitutively expressed gene product or other gene product expressed at a
known level or locale in cells of the type from which the biological sample was
derived.
[0129] It will be appreciated that the assay methods of the present invention do
not necessarily require measurement of absolute values of legumain and/or
ZB-1 activity, secretion, and/or expression because relative values are sufficient
for many applications of these methods. It will also be appreciated that in
addition to the quantity or abundance of legumain and/or ZB-1 gene products,
variant or abnormal legumain and/or ZB-1 gene products (e.g., mutated
transcripts, truncated polypeptides) or their expression patterns may be
identified by comparison to normal gene products and expression patterns.
[0130] Whether the expression or location of a particular gene product in two
samples is significantly similar or significantly different, e.g., significantly
above or significantly below a given level, depends on the gene itself and, inter
alia, its variability in expression or localization between different individuals or
different samples. It is within the skill of those in the art to determine whether
expression levels or localization are significantly similar or different. Factors
such as genetic variation, e.g., in legumain and/or ZB-1 expression levels or
localization, between individuals, species, organs, tissues, or cells may be taken
into consideration (if necessary) when determining whether the level of
expression, activity, and/or secretion, e.g., of human legumain and/or ZB-1,
between two samples is significantly similar or significantly different, e.g.,
significantly above or below a given level. As a result of the natural
heterogeneity in gene expression between individuals, species, organs, tissues,
or cells, phrases such as "significantly similar," ''significantly greater,"

"significantly lower," "significantly above" and the like cannot be defined as a
precise percentage or value, but rather can be ascertained by one skilled in the
art upon practicing the invention.
[0131] The diagnostic, prognostic, and monitoring assays of the present
invention involve, e.g., detecting and quantifying, legumain and/or ZB-1 gene
products in biological samples. Legumain and ZB-1 gene products include, but
are not limited to, mRNAs and polypeptides; both can be measured using
methods well known to those skilled in the art. For example, mRNA can be
directly detected and quantified using hybridization-based assays, such as
Northern hybridization, in situ hybridization, dot and slot blots, and
oligonucleotide arrays. Hybridization-based assays refer to assays in which a
probe nucleic acid is hybridized to a target nucleic acid. In some formats, the
target, the probe, or both target and probe are immobilized. The immobilized
nucleic acid may be DNA, RNA, or another oligonucleotide or polynucleotide,
and may comprise naturally or nonnaturally occurring nucleotides, nucleotide
analogs, or backbones. Methods of selecting nucleic acid probe sequences for
use in the present invention are based on the nucleic acid sequences of legumain
and ZB-1, and the methods are well known in the art.
[0132] Alternatively, mRNA can be amplified before detection and
quantitation. Such amplification-based assays are well known in the art and
include polymerase chain reaction (PCR), reverse-transcription-PCR (RT-PCR),
quantitative or real time PCR (Q-PCR), PCR-enzyme-linked immunosorbent
assay (PCR-ELIS A), and ligase chain reaction (LCR). Primers and probes for
producing and detecting amplified legumain and/or ZB-1 gene products (e.g.,
mRNA or cDNA) may be readily designed and produced without undue
experimentation by those of skill in the art based on the nucleic acid sequences
of legumain and ZB-1 provided herein and known in the art. As a nonlimiting
example, amplified legumain or ZB-1 gene products may be directly analyzed,
for example, by gel electrophoresis; by hybridization to a probe nucleic acid; by
sequencing; by,detection of a fluorescent, phosphorescent, or radioactive signal;
or by any of a variety of well-known methods. In addition, methods are known

to those of skill in the art for increasing the signal produced by amplification of
target nucleic acid sequences. One of skill in the art will recognize that
whichever amplification method is used, a variety of quantitative methods
known in the art (e.g., quantitative PCR) may be used if quantitation of gene
products is desired.
[0133] Legumain and/or ZB-1 polypeptides (or fragments thereof) may be
detected using various well-known immunological assays employing the anti-
legumain antibodies and anti-ZB-1 antibodies that may be generated as
described herein. Anti-legumain antibodies have also been described in the
literature (Choi et al. (1999) supra). Immunological assays refer to assays that
utilize an antibody (e.g., polyclonal, monoclonal, chimeric, humanized, scFv,
and/or fragments thereof) that specifically binds to, e.g., a human legumain or
ZB-1 polypeptide (or a fragment thereof). Such well-known immunological
assays suitable for the practice of the present invention include ELISA,
radioimmunoassay (RIA), immunoprecipitation, immunofluorescence,
fluorescence-activated cell sorting (FACS), and Western blotting. A legumain
and/or ZB-1 polypeptide may also be detected using a labeled substrate for the
protease, e.g., Z-AAN-MCA as shown in the examples, or the activity-based
probes disclosed in Kato et al., supra. One of skill in the art will understand
that the aforementioned methods may be applied to disorders and conditions
related to legumain and/or ZB-1 activity, e.g., vascular and inflammatory
disorders.
Uses of Molecules Related to Legumain and ZB-1 Activity in Therapy
[0134] The inventors have demonstrated the following: (1) legumain is highly
expressed in human atherosclerotic samples relative to healthy arterial samples;
(2) legumain expression in the aortic sinus and aortic arch of ApoE KO mice
increases during atherosclerotic disease progression; (3) legumain is strongly
positive in atherosclerotic lesions of the aortic arch and aortic sinus of ApoE-/-
mice; (4) legumain expression in atherosclerotic lesions of the aortic sinus of
ApoE-/- mice occurs in areas of inflammatory cell infiltration; (5) legumain
expression in the coronary arteries of ApoE-/- mice increases in atherosclerotic

plaques; (6) legumain expression is found within neointimal lesional areas of
the carotid arteries in an ApoE-/- mouse model of accelerated atherosclerosis;
(7) legumain is expressed in arterial endothelial cells of aortic sinus of ApoE-/-
mice; (8) legumain is expressed in the kidney, e.g., in endothelial cells of renal
arteries, and in proximal tubule cells; (9) legumain protein levels, mRNA levels,
and activity is increased in differentiated THP-1 macrophages and M-CSF
activated primary human macrophages; (10) legumain is found in the
conditioned media of M-CSF-activated primary human macrophages; (11)
legumain protein is present on the cell surface upon recombinant overexpression
in CHO or HEK293 cells, and cell-surface legumain expressed by HEK293 cells
is enzymatically active; (12) legumain is expressed in coronary arteries of an
atherosclerotic patient; (13) legumain stimulation induces human monocyte-
migration; (14) legumain stimulation induces endothelial cell migration and
proliferation in wound-healing models of HEK293 and HUVEC cultures, as
well as endothelial cell invasion in HUVEC culture; (15) legumain expression is
increased in the diseased paw of the collagen-induced arthritis (CIA) mouse
model of arthritis; and (16) anovel splice variant of legumain, ZB-1, is secreted
into the culture medium of recombinant ZB-1-overexpressing HEK293 cells.
[0135] The above results indicate that the disclosed methods for using
molecules related to legumain and/or ZB-1 activity, e.g., antagonists of
legumain and/or ZB-1, may be employed to treat legumain- and/or ZB-1-
associated conditions and disorders, e.g., vascular and inflammatory disorders,
such as atherosclerosis and arthritis. These methods will be particularly useful
for treating such disorders in humans.
[0136] The legumain- and ZB-1-related molecules disclosed herein, including
modulators of mouse and/or human legumain and/or ZB-1 polynucleotide
and/or polypeptide activity, expression, and/or secretion, which may be
identified using the methods described herein, may be used in vitro, ex vivo, or
incorporated into pharmaceutical compositions and administered to individuals
(e.g., human subjects) in vivo to treat, ameliorate, or prevent disorders related to
legumain and/or ZB-1 activity and disorders related to asparaginyl

peptidase/protease activity (e.g., vascular disorders and inflammatory
disorders), by administration of a leguxnain and/or a ZB-1 antagonist(s) (e.g.,
legumain inhibitory polynucleotides (i.e., polynucleotides that decrease
legumain levels, activity, and/or secretion either directly or indirectly), such as
antisense molecules, siRNA molecules, and aptamers; legumain inhibitory
polypeptides (i.e., polypeptides that decrease legumain and/or ZB-1 levels,
activity, and/or secretion either directly or indirectly, e.g., fragments of
legumain, such as fragments containing an inactive enzymatic domain, and
fusion proteins thereof); antagonist anti-legumain and/or anti-ZB-1 antibodies or
antibody fragments (i.e., antibodies or antibody fragments that decrease
legumain and/or ZB-1 activity, expression, and/or secretion either directly or
indirectly, including antibodies and antibody fragments that bind legumain
and/or ZB-I fragments); and antagonistic small molecules (e.g., siRNAs,
aptamers, and small organic molecules or compounds)). Several
pharmacogenomic approaches to consider in determining whether to administer
a legumain and/or ZB-1 antagonist(s) are well known to one of skill in the art
and include genome-wide association, candidate gene approach, and gene
expression profiling. A pharmaceutical composition of the invention is
formulated to be compatible with its intended route of administration (e.g., oral
compositions generally include an inert diluent or an edible carrier). Other
nonlimiting examples of routes of administration include parenteral (e.g.,
intravenous), intradermal, subcutaneous, oral.(e.g., inhalation), transdermal
(topical), transmucosal, and rectal administration. The pharmaceutical
compositions compatible with each intended route are well known in the art.
[0137] A legumain and/or ZB-1 antagonist(s) may be used as a pharmaceutical
composition when combined with a pharmaceutically acceptable carrier. Such a
composition may contain, in addition to a legumain and/or a ZB-1 antagonist(s)
(e.g., a human legumain antagonist), carriers, various diluents, fillers, salts,
buffers, stabilizers, solubilizers, and other materials well known in the art. The
term "pharmaceutically acceptable" means a nontoxic material that does not
interfere with the effectiveness of the biological activity of the active

ingredient(s). The characteristics of the carrier will depend on the route of
administration.
[0138] The pharmaceutical composition of the invention may be in the form of
a liposome in which a legumain and/or a ZB-1 antagonist(s) is combined, in
addition to other pharmaceutically acceptable carriers, with amphipathic agents
such as lipids that exist in aggregated form as micelles, insoluble monolayers,
liquid crystals, or lamellar layers in aqueous solution. Suitable lipids for
liposomal formulation include, without limitation, monoglycerides,
diglycerides, sulfatides, lysolecithin, phospholipids, saponin, bile acids, etc.
[0139] As used herein, the term "therapeutically effective amount" means the
total amount of each active component of the pharmaceutical composition or
method that is sufficient to show a meaningful patient benefit, e.g., amelioration
of symptoms of, healing of, or increase in rate of healing of such conditions.
When applied to an individual active ingredient, administered alone, the term
refers to that ingredient alone. When applied to a combination, the term refers
to combined amounts of the active ingredients that result in the therapeutic
effect, whether administered in combination, serially or simultaneously.
[0140] In practicing the methods of treatment or use of the present invention, a
therapeutically effective amount of a legumain and/or ZB-1 antagonist(s) is
administered to a subject, e.g., a mammal (e.g., a human). A legumain and/or
ZB-1 antagonist(s) may be administered in accordance with the method of the
invention either alone or in combination with other therapies, such as, e.g., in
combination with additional therapies for arthritis or atherosclerosis. When
coadministered with one or more agents, a legumain and/or a ZB-1 antagonist(s)
may be administered either simultaneously with the second agent, or
sequentially. If administered sequentially, the attending physician will decide
on the appropriate sequence of administering the legumain and/or ZB-1
antagonist(s) in combination with other agents.
[0141] When a therapeutically effective amount of a legumain and/or ZB-1
antagonist(s) is administered orally, the binding agent will be in the form of a
tablet, capsule, powder, solution or elixir. When administered in tablet form,

the pharmaceutical composition of the invention may additionally contain a
solid carrier such as a gelatin or an adjuvant. The tablet, capsule, and/or powder
contain from about 5 to 95% binding agent, and preferably from about 25 to
90% binding agent. When administered in liquid form, a liquid carrier such as
water, petroleum, oils of animal or plant origin such as peanut oil (exercising
caution in relation to peanut allergies), mineral oil, soybean oil, or sesame oil, or
synthetic oils may be added. The liquid form of the pharmaceutical
composition may further contain physiological saline solution, dextrose or other
saccharide solution, or glycols such as ethylene glycol, propylene glycol, or
polyethylene glycol. When administered in liquid form, the pharmaceutical
composition contains from about 0.5 to 90% by weight of the binding agent, and
preferably from about 1 to 50% by weight of the binding agent.
[0142] When a therapeutically effective amount of a legumain and/or a ZB-1
antagonist(s) is administered by intravenous, cutaneous or subcutaneous
injection, the legumain and/or ZB-1 antagonist(s) will be in the form of a
pyrogen-free, parenterally acceptable aqueous solution. The preparation of such
parenterally acceptable protein solutions, having due regard for pH, isotonicity,
stability, and the like, is within the skill of those in the art. A preferred
pharmaceutical composition for intravenous, cutaneous, or subcutaneous
injection should contain, in addition to the legumain and/or ZB-1 antagonists),
an isotonic vehicle such as sodium chloride injection, Ringer's injection,
dextrose injection, dextrose and sodium chloride injection, lactated Ringer's
injection, or other vehicle as known in the art. The pharmaceutical composition
of the present invention may also contain stabilizers, preservatives, buffers,
antioxidants, or other additive known to those of skill in the art.
[0143] The amount of a legumain and/or a ZB-1 antagonist(s) in the
pharmaceutical composition of the present invention will depend upon the
nature and severity of the condition being treated, and on the nature of prior
treatments that the patient has undergone. Ultimately, the attending physician
will decide the amount of legumain and/or ZB-1 antagonist(s) with which to
treat each individual patient. Initially, the attending physician will administer

low doses of legumain and/or ZB-1 antagonist(s) and observe the patient's
response. Larger doses of legumain and/or ZB-1 antagonist(s) may be
administered until the optimal therapeutic effect is obtained for the patient, and
at that point the dosage is not generally increased further. It is contemplated
that the various pharmaceutical compositions used to practice the method of the
present invention should contain about 0.1 ug to about 100 mg of legumain
and/or ZB-1 antagonist(s), e.g., human legumain polypeptides (including fusion
proteins thereof), per kg body weight.
[0144] The duration of intravenous (i.v.) therapy using a pharmaceutical
composition of the present invention will vary, depending on the severity of the
disease being treated and the condition and potential idiosyncratic response(s) of
each individual patient. It is contemplated that the duration of each application
of the legumain and/or ZB-1 antagonist(s) may be within the range of, e.g., 1 -
12, 6-18, or 12-24 hrs of continuous or intermittent i.v. administration. Also
contemplated is subcutaneous (s.c.) therapy using a pharmaceutical composition
of the present invention. These therapies can be administered daily, weekly, or,
more preferably, biweekly, or monthly. It is also contemplated that where the
legumain and/or ZB-1 antagonist(s) is a small molecule (e.g., for oral delivery),
the therapies may be administered daily, twice a day, three times a day, etc.
Ultimately the attending physician will decide on the appropriate duration of i.v.
or s.c. therapy, or therapy with a small molecule, and the timing of
administration of the therapy, using the pharmaceutical composition of the
present invention.
[0145] The polynucleotides and proteins of the present invention are expected
to exhibit one or more of the uses or biological activities identified herein
(including those associated with assays cited herein). Uses or activities
described for proteins of the present invention may be provided by
administration or use of such proteins or by administration or use of
polynucleotides encoding such proteins (such as, for example, in gene therapies
or vectors suitable for introduction of DNA).

Uses of Legumain and/or ZB-1 Antagonists
[0146] In one aspect, the invention features a method of regulating asparaginyl
peptidase/protease activity in a cell or sample of interest (e.g., a monocyte, a
foam cell, a macrophage, a kidney proximal tubule cell, a site of inflammatory
cell invasion into a vessel, an atherosclerotic plaque intima, a kidney, or an
artery). One such method comprises contacting a cell or population of cells
with a legumain and/or a ZB-1 antagonist(s) (e.g., a human legumain and/or
ZB-1 inhibitory polynucleotide or polypeptide (e.g., siRNA, aptamers,
antisense, or antagonistic legumain and/or ZB-1 soluble proteins, including
fusion proteins); or anti-legumain or -ZB-1 antibodies (i.e., antagonistic
antibodies)) in an amount sufficient to modulate the level of asparaginyl
peptidase/protease activity in the cell or sample of interest. In another
embodiment of the invention, a legumain and/or ZB-1 antagonists) is used,
such that the level of secretion or expression of legumain and/or ZB-1 is
decreased in the cell or sample of interest. Modulation of asparaginyl
peptidase/protease activity, expression and/or secretion is expected to be
beneficial for individuals suffering from legumain-associated conditions, ZB-1-
associated conditions, and/or conditions accompanied by asparaginyl
peptidase/protease dysregulation, e.g., vascular and inflammatory disorders,
such as atherosclerosis and arthritis.
[0147] Thus, antagonists of legumain and/or ZB-1 are believed to be useful to
treat subjects afflicted with a condition such as atherosclerosis (including, but
not limited to, all stages of atherogenesis and atherosclerosis, e.g., endothelial
cell activation, formation of fatty streaks, inflammatory cell invasion of vessel
walls, endothelial cell migration, formation of foam cells, plaque denudation,
atheromatous plaque formation, atheromatous plaque rupture, atherothrombosis,
aneurysm, stenosis, etc.), congestive heart failure, myocardial infarction, atrial
and ventricular arrhythmias, stenosis, aneurysm, peripheral vascular disease,
chronic peripheral arterial occlusive disease (CPAOD), peripheral artery
occlusive disease (PAOD), thrombosis (including, e.g., acute arterial
thrombosis, atherothrombosis, and deep venous thrombosis), embolism,

inflammatory vascular disorders, Raynaud's phenomenon, vasculitis and/or
arteritis (including, e.g., Bechet's disease, Buerger's disease, central nervous
system vasculitis, Churg-Strauss syndrome cryoglobulinemia, giant cell arteritis,
Kawasaki disease, microscopic polyangitis, polyarteritis nodosa, polymyalgia
rheumatica, rheumatoid vasculitis, Takayasu's arteritis, and Wegener's
granulomatosis), venous disorders, hypertensive vascular disease, claudication,
stable angina, unstable angina, stroke, coronary artery disease (CAD), acute
coronary syndrome (ACS), metabolic syndrome, ischemia, reperfusion, and
exacerbation of various diseases affected by the circulatory system (e.g., chronic
kidney disease, end-stage renal disease (ESRD), hyperlipidemia, hypertension,
and diabetes). Additional disorders amenable to diagnosis, prognosis,
monitoring, treatment, amelioration and/or prevention using the methods
disclosed herein include inflammatory disorders (e.g., chronic inflammatory
disorders, such as arthritis and tuberculosis).
[0148] The methods of the present invention are based, at least in part, on the
finding that legumain expression is increased in atherosclerotic samples from
the aortic arch, aortic sinus, carotid arteries foam cells, and sites of
inflammatory cell infiltration into vessels, that legumain levels and activity are
increased in activated macrophages, and that ZB-1 is a splice variant of
legumain, which is secreted from ZB-1-overexpressing cells. Accordingly,
legumain and/or ZB-1 antagonists, i.e., molecules that inhibit legumain and/or
ZB-1 activity, expression and/or secretion (e.g., antagonist anti-legumain
antibodies), may be used to decrease the asparaginyl peptidase/protease activity
associated with vascular and inflammatory disorders, e.g., for treating,
ameliorating, or preventing disorders such as atherosclerosis and arthritis.
[0149] By using a legumain and/or ZB-1 antagonist(s), it is possible to
modulate asparaginyl protease/peptidase in a number of ways. For example,
decreasing activity, expression and/or secretion may be undertaken by inhibiting
or blocking an established legumain and/or ZB-1-associated condition or
disorder, or may involve preventing the induction of a legumain and/or ZB-1 -
associated conditions or disorders.

[0150] Pharmaceutical compositions of the invention containing a legumain
and/or ZB-1 antagonist(s) may also contain additional therapeutic agents for
treatment of the particular targeted disorder. For example, a pharmaceutical
composition for treatment of atherosclerosis may also include anti-hypertensive
agents, cholesterol-reducing drugs, statins, and/or inflammatory cytokine
mediators, such as HUMIRA® or ENBREL®. The pharmaceutical composition
may contain thrombolytic or antithrombotic factors such as plasminogen
activator and Factor VI11. The pharmaceutical composition may further contain
additional anti-infiammatory agents. Such additional factors and/or agents may
be included in the pharmaceutical composition to produce a synergistic effect
with legumain and/or ZB-1 antagonist(s), or to minimize side effects caused by
the legumain and/or ZB-1 antagonists).
[0151] In one embodiment, a legumain and/or ZB-1 antagonists), including
pharmaceutical compositions thereof, is administered in combination therapy,
i.e., combined with other agents, e.g., therapeutic agents, that are useful for
treating pathological conditions or disorders, such as disorders of the
cardiovascular system. The term "in combination" in this context means that
the agents are given substantially contemporaneously, either simultaneously or
sequentially. If given sequentially, at the onset of administration of the second
compound, the first of the two compounds is preferably still detectable at
effective-concentrations at the site of treatment.
[0152] Preferred therapeutic agents used in combination with a legumain and/or
ZB-1 antagonist(s) are those agents that modulate different aspects of vascular
and inflammatory disorders, e.g., agents that interfere with the activity of
proinflammatory cytokines.
[0153] Thus, agents useful in combination with a legumain and/or an ZB-1
antagonist(s) include, without limitation, agents that stimulate cholesterol efflux
from cholesterol containing cells, e.g., macrophages and foam cells, such as
modulators of PPARs (i.e., PPARa, PPARp, and PPARγ), modulators of LXR
(Liver X Receptor, e.g., oxysterols), and modulators of ABC (ATP-binding
cassette transporters, e.g., ABCA, ABCG, and ABC8). Such agents include

thiazolidinediones (e.g., glitazones, such as rosiglitazone and troglitazone), fatty
acids (including polyunsaturated fatty acids), fibrates (e.g., fenofibrate,
gemfibrozil, clofibrate, Wy-14,643), GW1516, GW764, GW7845, GW0742,
GW7647, eicosapentaenoic acid, xanthohumols, roselipins, prenylflavonoids,
polyacetylenes, tanshinones and derivatives thereof (see, e.g., Coleman and Lee
(2004) Prog. Lipid Res. 43:134-76; Chen and Farse (2005) Atheroscler.
Thromb. Vase. Biol. 25:482-86; Rustan et al. (1988)7. Lipid Res. 29:1417-26;
Tabata et al. (1997) Phytochemistry 46:683-87; Tomoda (1999) J. Antibiotics
52:689-94; Chung et al. (2004) Planta Med. 70:258-60; Lee et al. (2004) Planta
Med. 70:197-200; Ko et al. (2002) Arch. Pharm. Res. 25:446-48; Li et al. (2004)
J. Clin. Invest. 1564-76; Castrillo and Tontonz (2004) J. Clin. Invest. 114:1538-
40; Marx et al. (2004) Circ. Res. 94:1168-78; Chawla et al. (2001) Mol. Cell.
7:161-71; Lie et al. (2000) J. Clin. Invest. 106:523-31; Collins et al. (2001)
Artheroscler. Thromb. Vase. Biol. 21:365-71; Lee et al. (2003) Science 302:453-
57; Duez et al. (2002)7. Biol. Chem. 277:48051-57; Rubins et al. (1999)//.
Eng. J. Med. 341:410-18; Oliver et al. (2001) Proc. Natl. Acad. Sci. USA
98:5306-11; Chinetti et al. (2001) Nat. Med. 7:53-58; Ricotte et al. (1998)
Nature 391:79-82; Joseph et al. (2002) Proc. Natl. Acad. Sci. USA 99:7604-09;
Tangirala et al. (2002) Proc. Natl. Acad. Sci. USA 99:11896-901;
Venkateswaran et al. (2000) J. Biol. Chem. 275:14700-07; and Wang et al.
(2004) Proc. Natl. Acad. Sci. USA 101:9774-79).
[0154] Additionally, combination therapy with legumain and/or ZB-1
antagonist(s) may utilize statins (e.g., mevastatin, lovastatin, simvastatin,
pravastatin, fluvastatin, atorvastatin, cerivastatin and rosuvastatin), cystatins
(e.g., ovocystatin, cystatin C, and cystatin M), and/or agents that augment statin
activity and/or bioavailability, such as inhibitors of cytochromes P 450 (CYP
450), CYP 3A4, and CYP 2C8/9 (e.g., macrolide antibiotics, azoles, protease
inhibitors, verapamil, diltiazem, amiodarone, warfarin, grapefruit juice,
gemfibrozil, phenytoin, losartan, diclofenac, ibuprofen, and dolbutamide), and
inhibitors of the hepatic statin transporter, OATP-C (e.g., cyclosporine A and
gemfibrozil) {see Rutishauser (2006) Swiss Med. Wkly. 136:41-49). Additional

agents useful in combination with legumain and/or ZB-1 antagonist(s) include
agents that reduce hyperglycemia (e.g., repaglinide, see, Schmoelzer and
Wascher (2006) Cardiovasc. Diabetol. 5:9); antagonists of leukotrienes (e.g.,
antagonists of proteins involved in leukotriene biosynthesis, such as 5-
lipoxyegenase (5-LO), 5-LO-activating protein (FLAP), and leukotriene
hydrolases (e.g., LTA4 hydrolase)); agents that lower cholesterol, LDL, and
triglyceride levels (e.g., fibrinates, HMG-CoA reductase inhibitors, nicotinic
acid derivatives); anti-hypertensive agents; anti-platelet agents; anti-coagulants;
inhibitors of cholesterol acyltransferase enzymes (see, Krause et al. (1995)
Inflammation Mediators and Pathways, pp. 173-98 CRC Press, Boca Raton,
FL); agents for the treatment of diabetes (e.g., insulin; insulin sensitizers such as
metformin; Glp-1 mimetics, such as exenatide (BYETTA®); insulin
secretagogues, such as sulfonylureas (e.g., tolazamide, glyburide and others)
and metiglinides (e.g., nateglinide (STARLIX®)); modulators of sterol
regulatory element-binding protein (SREBP), such as atorvastatin and
simvastatin (e.g., L1P1TOR® and CADUET®); modulators of farnesoid X
receptor (FXR) (e.g., bile acids); and other modulators of tissue lipid and
cholesterol levels.
[0155] Another aspect of the present invention accordingly relates to kits for
carrying out the administration of a legumain and/or ZB-1 antagonist(s) with
other therapeutic compounds. In one embodiment, the kit comprises one or
more legumain and/or ZB-1 antagonists formulated with one or more binding
agents in a pharmaceutical carrier, and at least one other agent, e.g., another
therapeutic agent, formulated as appropriate, in one or more separate
pharmaceutical preparations.
Involvement of Legumain in Vascular and Inflammatory Disorders
[0156] The present invention provides methods of treating, ameliorating, or
preventing vascular disorders, e.g., atherosclerosis, comprising contacting a cell
or cell population with a modulator of the lysosomal cysteine protease legumain
and/or ZB-1, and/or comprising administering such a modulator to a subject.
Lysosomal cysteine protease-mediated proteolysis is associated with multiple

pathological aspects of atherogenesis. The inventors have shown that the
cysteine protease legumain is highly expressed in the atherosclerotic plaques in
ApoE-/- mice, as well as in lesions formed in ligated mouse carotid arteries. In
the atherosclerosis-prone ApoE-/- mice, progressive increases in legumain
expression in lesioned areas correlated with disease advancement. Legumain
protein was not observed in normal vascular tissues, and was first detected in
the developing lesion in 2-month old ApoE-/- mice. Prominent legumain
expression was found in the advanced atherosclerotic lesions in 6-month and 1-
year old ApoE-/- mice. Consistent with the results from ApoE-/- mice, data
mining using the GENELOGIC® database revealed a 2.4-fold increase in
legumain mRNA expression in human atherosclerotic plaques (FIG. 1)
compared with either asymptomatic blood vessels from the same patient, or
blood vessels from asymptomatic patients. Thus, the pattern of legumain
expression suggested its involvement in vascular inflammatory disorders, e.g.,
atherosclerosis.
[0157] Also disclosed herein is the finding that macrophages are the major cell
type expressing disease-associated legumain in atherosclerotic plaques.
Macrophages are a rich source of extracellular lysosomal proteases with
implications in extracellular matrix remodeling and plaque destabilization.
Reddy et al. have shown that monocyte-derived macrophages secrete active
cathepsin S and L into the extracellular milieu that can participate in vascular
remodeling (Reddy et al. (1995) Proc. Natl. Acad. Sci. U.S.A. 92:3849-53).
Others have confirmed that cathepsins S and L can functionally promote
atherosclerosis (Liu et al. (2006) Atherosclerosis 184:302-11; Sukhova et al.,
supra). Disclosed herein are the findings that differentiated macrophages
express high levels of legumain and are capable of secreting legumain into the
extracellular space. Although the secreted legumain was found as the pro-form,
it may become active in trie extracellular acidic microenvironment where it
activates other macrophage-derived lysosomal proteases, including cathepsins
B, L, and S (e.g., Reddy et al., supra). Alternatively, legumain may be activated
in intracellular compartments and then become associated with the cell surface.

Indeed, disclosed herein is the finding that 293 cells overexpressing legumain
exhibited cell-surface legumain activity (e.g., FIG. 7; see also Liu et al. (2003)
Cancer Res. 63:2957-64). This activity may result from active legumain in
endosomes / lysosomes being presented on the cell surface as a result of
endosomal / lysosomal membranes fusing with the plasma membrane (Andrews
(2000) Trends Cell Biol. 10:316-21). The cell-membrane association may be
mediated by legumain binding to integrins via the RGD sequence in the mature
legumain enzyme.
[0158] Endogenous cell-surface legumain activity can be difficult to detect, and
may only be present in the lesion microenvironment. For example, tumor cell
surface-associated legumain has only been found in the tumor
microenvironment, but not on tumor cells in culture (Liu et al., supra; Wu et al.
(2006) Cancer Res. 66:970-80). Furthermore, legumain was detected on the
surface of tumor-associated macrophages, but not on circulating monocytes (Wu
et al., supra).
[0159] A proposed role for other extracellular lysosomal cysteine proteases in
atherosclerosis is extracellular matrix (ECM) degradation and tissue
remodeling. Cathepsins L and S possess collagenolytic and elastolytic activities
that are directly involved in ECM degradation (Liu et al. (2006) supra; Reddy et
al., supra). In addition, several cathepsins, including cathepsins B and L, may
process caspases and induce apoptosis, leading to atherosclerotic lesion
evolution (Guicciardi et al. (2000) J. Clin. Invest. 106:1127-37; Ishisaka et al.
(1999) Cell Struct. Funct. 24:465-70; Vancompernolle et al. (1998) FEBS Lett.
438:150-58). ECM components and caspases are not currently known to be
legumain substrates. However, legumain may indirectly contribute to ECM
degradation by processing and activating other collagenolytic / elastolytic
enzymes, such as MMP-2 and cathepsins B, H, and L. The presence of
legumain at atherosclerotic plaques together with its proteolytic function
suggest that modulators of legumain expression and activity are useful in
methods of treating, preventing, or ameliorating atherosclerosis.

[0160] Macrophages are postulated to damage host tissues in chronic
inflammatory disease states by causing degradation of the surrounding tissue
(Reddy et al., supra). The results provided herein indicate that legumain is
expressed in the arthritic paw of the mouse CIA model. As rheumatoid arthritis
is a chronic inflammatory disease, the discovery that legumain is expressed in
arthritic joints in the CIA model suggests a role for legumain-mediated joint
degradation, possibly via macrophage activity. In addition, it is important to
note that several vascular disorders are also inflammatory disorders, i.e., the
inflammation of, e.g., the intima of the vessel is at least in part responsible for
the damage to the vasculature. Thus, modulators of legumain can be used in
methods of treating, preventing, or ameliorating inflammatory disorders, e.g.,
rheumatoid arthritis.
[0161] Cell migration is a major feature of inflammatory diseases, including
but not limited to vascular inflammatory disorders, e.g., atherosclerosis. For
instance, migration of monocytes into the arterial wall is an early event of the
atherosclerotic process leading to the formation of foam cells and ultimately to
the development of advanced atherosclerotic lesions. As disclosed herein,
legumain can induce migration of monocytes in nanomolar concentrations, and
the chemoattractant activity of legumain can be as potent as VEGF. This
suggests legumain possesses chemoattractant properties.
[0162] Monocyte invasion of the endothelial cell layer is thought to occur by
the process known as extravasation (e.g., leukocyte extravasation), in which
monocytes first adhere to the endothelial cell layer of the blood vessel, and then
squeeze between endothelial cells towards the basement membrane and the
vessel neointima (Janeway et al. (1999) Immunobiology, 4th Edition; p. 607,
Elsevier Science Ltd./Garland Publishing). Because the present invention
discloses that legumain induces monocyte recruitment to sites of atherosclerotic
lesions, antagonists of legumain and/or ZB-1 will be useful in preventing both
monocyte recruitment and monocyte extravasation. Monocytes that have
successfully extravasated into the neointima usually differentiate into

macrophages; thus, legumain and/or ZB-1 antagonists will also prevent
monocyte differentiation at the sites of atherosclerotic plaques.
[0163] Furthermore, these same data suggest that legumain and/or ZB-1
agonists and antagonists will be useful in promoting and inhibiting, respectively,
other forms of extravasation, e.g., cancer metastasis (see further below), other
forms of leukocyte extravasation, etc. One of ordinary skill in the art will know
of several established assays for evaluating the biological effects of, e.g.,
legumain agonists or antagonists on cellular processes / activities such as cell
migration, extravasation, etc., in addition to such related assays presented in the
Examples (below).
[0164] The chemoattractant function of legumain appears to be independent
from its protease activity because both the purified form of legumain and heat-
denatured form retain the chemoattractant function (data not shown), which
suggests that a linear peptide sequence mediates the chemotactic function of
legumain. Interestingly, a protease-independent biological activity has been
described for legumain. The inactive pro form of legumain contains a 17-kDa
C-terminal peptide, OIP-2 (osteoclast inhibitory peptide 2) that is cleaved
during autocatalytic activation of legumain. Legumain / OIP-2 has been shown
to inhibit the differentiation of monocytes into osteoclasts, as well as inhibit
bone resorption (Choi et al. (2001) supra; Choi et al. (1999) supra). Thus,
legumain receptor may be present on the surface of monocytes, and the C-
terminal peptide of legumain may be sufficient to mediate chemoattraction. As
such, legumain may exhibit dual functions in atherogenesis, e.g., as a protease
and as a chemoattractant. Legumain protease function may lead to extracellular
matrix degradation, whereas the chemoattractant function may contribute to
monocyte recruitment into atherosclerotic lesions as well as macrophage
retention in the plaque. Because of the dual function of legumain, antagonists
of legumain will inhibit both proteolytic and chemotactic functions of legumain,
and thus will be useful in the methods of treatment of, e.g., atherosclerosis. In
addition, OIP-2 and related agonists and/or antagonists may be useful in

treating, ameliorating, or preventing various vascular disorders or inflammatory
disorders in, e.g., a mammal.
[0165] In addition, the invention teaches that legumain is expressed by
endothelial cells of ApoE-/- mice, and this result is consistent with detection of
legumain in the surface of tumor vascular endothelial cells (Wu et al., supra).
As disclosed herein, endothelial cells, e.g., HEK293 cells and HUVECs, have
increased migratory properties in response to legumain. This result, combined
with the detection of a high concentration of inflammatory cells expressing
legumain in regions of plaque neovascularization in human coronary arteries,
suggests a role of legumain in angiogenesis. Intra-plaque angiogenesis is
believed to be a critical pathological feature of atherosclerosis, enhancing
plaque growth and vulnerability (Moulton et al (2003) Proc. Natl. Acad. Sci.
100:4736-41; Moulton et al. (1999) Circulation 99:1726-32). Legumain
secreted by macrophages may contribute to neovessel formation by promoting
endothelial cell migration, invasion and proliferation; therefore modulators of
legumain may be useful in the methods of treating, ameliorating, or preventing
angiogenesis, e.g., angiogenesis associated with atherosclerosis and tumor
growth, as well as methods of inhibiting or promoting proliferation of
endothelial cells (e.g., promoting proliferation, and angiogenesis, in '
revascularization of tissue).
[0166] Interestingly, legumain was recently found to be present and active in
the microenvironment of tumor cells, in association with the extracellular matrix
and cell surface. It has been suggested that extracellular legumain activity may
functionally contribute to the metastatic behavior of tumor cells. Indeed,
researchers have shown that legumain is found in membrane-associated vesicles
at the invadopodia of tumor cells, as well as on the surface of tumor cells where
it colocalizes with integrins (Liu et al. (2005) Cancer Res. 63:2957-64; Wu et al.
(2006) Cancer Res. 66:970-80). Legumain has also been reported to play a role
in tumor pathology (Murthy et al. (2005) Clin. Cancer Res. 11:2293-99). As
disclosed herein, legumain plays a key role in angiogenesis, by promoting
endothelial cell migration. Thus, legumain activity will be important in

promoting angiogenesis related to metastatic cancers; and antagonists of
legumain and/or ZB-1 may be useful in the methods of treating, ameliorating,
and preventing tumor metastasis.
[0167] Conversely, agonists of legumain and/or ZB-1 may be useful in methods
of treating, ameliorating, or preventing conditions requiring increased vessel
formation. For example, agonists of legumain may be used in methods of
promoting, e.g., revascularization, wound healing, transplant surgery recovery,
etc.
[0168] In summary, the data provided herein establishes a novel link between
the lysosomal protease legumain and vascular and inflammatory disorders.
These results also show that monocytes / macrophages are a major source of
atherosclerosis-associated legumain, and that cell surface / extracellular
legumain may functionally contribute to disease formation, e.g., through
stimulation of cell migration.
[0169] The entire contents of all publications, patents, patent applications, and
other references cited throughout this application are hereby incorporated by
reference herein in their entireties.
EXAMPLES
[0170] The following Examples provide illustrative embodiments of the
invention and do not in any way limit the invention. One of ordinary skill in the
art will recognize that numerous other embodiments are encompassed within the
scope of the invention.
[0171] The Examples do not include detailed descriptions of conventional
methods, such as methods employed in the construction of vectors, the insertion
of genes encoding polypeptides into such vectors and plasmids, the introduction
of such vectors and plasmids into host cells, and the expression of polypeptides
from such vectors and plasmids in host cells. Such methods are well known to
those of ordinary skill in the art.

Example 1: Legumain is Highly Expressed in Human Atherosclerotic Samples
and During Atherosclerosis Disease Progression in ApoE-/- Mice
[0172] To determine whether cysteine proteases might be involved in
atherosclerotic lesions, the expression pattern of legumain was analyzed in
human atherosclerotic arterial samples.
Example 1.1: Expression Profiling of Legumain in Human Atherosclerosis
[0173] Expression data of human atherosclerotic plaques and human plaque-
free arterial samples was downloaded from the GENELOGIC™ database. The
data were generated from hybridization of RNA to the AFFYMETRIX® (Santa
Clara, CA) Hg_133A GENECHIP™ oligonucleotide microarrays. Data
analysis was performed using GENESPRING™. The normalized data were
filtered for gene transcripts that had either increased or decreased levels of
expression relative to the average of the controls. Gene transcripts with
increased levels of expression had to have a call of "Present," a frequency >5,
and a change in expression of at least 2-fold in at least 70% of the samples.
Decreasing gene transcripts had to have a call of "Present," a frequency >5, and
a change in expression of at least 2-fold in at least 70% of the samples. The
statistical analyses were performed using GENESPRING™ v6.1.
Example 1.2: Results
[0174] Legumain expression was increased in human atherosclerotic arterial
samples containing plaques relative to plaque-free segments or nondiseased
arterial samples (FIG. 1).
Example 2: Legumain is Highly Expressed in Atherosclerotic Lesions of the
Aortic Arch, Coronary Arteries, and the Aortic Sinus in ApoE-/- Mice
[0175] Gene expression associated with disease progress in atherosclerosis-
prone Apolipoprotein E-deficient (ApoE-/-) mice was determined by microarray
analysis. The ApoE-/- mice develop severe hypercholesterolemia that induces
the formation of atherosclerotic lesions at specific locations in the vasculature,
including the aortic sinus, the aortic arch and the proximal portion of the
coronary arteries (Nakashima et al. (1994) Arterioschler. Thromb. 14:133-40;
Reddick et al. (1994) Arterioscler. Thromb. 14:141-47).

Example 2.1: Animals and Tissue Preparation
[0176] All animal studies were approved by the Institutional Animal Care and
Use Committee. Male ApoE KO (ApoE-/-) and C57BL/6 mice from Taconic
Farms (Germantovin, NY) were maintained on a normal chow diet and
euthanized at selected time points. All mice were sacrificed by inhalation of
100% CO2 and perfused with saline solution injected through the left ventricle.
Heart and aortic arch were further perfused with RNALATER® (Amnion Inc.,
Austin, TX) collected and frozen in preparation for gene expression studies. For
histological studies, perfusion with saline through the left ventricle was
followed by perfusion with 4% paraformaldehyde. Heart, aortic arch, and
kidneys (see below) were stored overnight in 4% paraformaldehyde, switched to
70% ethanol, dehydrated and embedded in paraffin blocks in preparation for in
situ hybridization or immunohistochemistry. Paraffin embedded heart samples
were sectioned as previously described in order to collect tissue sections located
within the aortic sinus (Paigen et al. (1987) Atherosclerosis 68:231-40).
Example 2.2: Affymetrix Hybridization and Analysis
Example 2.2.1: RNA Analysis
[0177] Total RNA was isolated and purified from pooled aortic arches (n=3-5)
collected at selected time points in ApoE KO (ApoE-/-) and C57BL/6 mice.
Total RNA was isolated using RNAEASY™ minikit sample lysis buffer (RLT),
and RNA was purified according to the manufacturer's recommendations
(Qiagen, Valencia, CA). For each sample, total RNA was quantitated from a
measure of UV absorption at 260 nm, and an aliquot was analyzed with an
Agilent® 2100 BIOANALYZER™ (Agilent Technologies, Palo Alto, CA) to
determine RNA integrity.
Example 2.2.2: Preparation of Hybridization Solutions for Oligonucleotide
Array Analysis
[0178] Double-stranded cDNA was prepared from 3-5 ug of total RNA using
the SUPERSCRIPT™ Choice kit (Invitrogen, Carlsbad, CA) and 33 pmol of
oligo-dT primer containing a T7 RNA polymerase promoter (Proligo, LLC,
Boulder, CO). First strand cDNA synthesis was initiated with the addition of

the following kit components: first strand buffer at 1 X, DTT at 10 mM, dNTPs
at 500 mM, SUPERSCRIPT™ RTII at 400 U, and RNAse inhibitor at 40 U.
The reaction proceeded at 47°C for 1 hour. Second strand synthesis proceeded
with the addition of the following kit components: second strand buffer at IX,
additional dNTPs at 200 mM, E. coli DNA polymerase I at 40 U, E. coli
RnaseH at 2 U, E. coli DNA ligase at 10 U. The reaction proceeded at 15.8°C
for 2 hr. T4 DNA polymerase (New England Biolabs, Beverly, MA), at a final
concentration of 6 U (2 μl of 3000 U per ml stock), was added for the last five
minutes of the second strand reaction. Double stranded cDNA was purified
using the GENECHIP® Sample Cleanup Module as described by the
manufacturer (Affymetrix, Santa Clara, CA). Purified cDNA (10 μl) was
transcribed with the Bioarray High Yield RNA TRANSCRIPT LABELING
KIT (T7) ™, following the manufacturer's protocol (Enzo, Farmingdale, NY).
Biotin-labeled, antisense cRNA was purified using the GENECHIP® Sample
Cleanup Module as described by the manufacturer (Affymetrix, Santa Clara,
CA). The cRNA yield was determined from a measure of UV absorption at 260
nm.
Example 2.2.3: Oligonucleotide Microarray Hybridization Procedures
[0179] Fragmented cRNA (15 μg) was prepared as previously described (Byrne
et al. (2000) Preparation of mRNA for expression monitoring, In: Ausubel et al.
(eds.). Current Protocols in Molecular Biology, John Wiley and Sons, Inc.,
New York) and used to create an oligonucleotide microarray hybridization
solution as suggested by the manufacturer (Affymetrix, Santa Clara, CA).
Hybridization solutions contained a mix of eleven prokaryotic RNAs (Hill et al.,
supra), each at a different known concentration, which were used to create an
internal standard curve for each microarray and interpolated to determine the
frequencies of detected genes. The hybridization solution was heated for 1 -2
min at 95°C and microcentrifuged at maximum speed for 2 minutes to pellet
insoluble debris. Labeled cRNA solutions were hybridized to AFFYMETRIX®
(Santa Clara, CA) Mouse Genome 430 2.0 GENECHIP™ oligonucleotide
microarrays. Following hybridization, cRNA solutions were recovered and

microarrays were washed and prepared for scanning according to Affymetrix
protocols. Raw fluorescence data were collected and reduced with the use of
the GENECHIP™ MAS 5.0 software application (Affymetrix, Santa Clara,
CA). Frequency was determined using a bacterial RNA standard curve (Hill et
al. (2001) Genome Biol. 2(12):research0055.1-0055.13).
Example 2.2.4: Analysis of Expression Profiling Data
[0180] Data were reduced by filtering for gene transcripts that had either
increased or decreased levels of expression relative to the average of the
controls. Gene transcripts with increased levels of expression had to have a call
of "Present," a frequency >5, and a change in expression of at least 2-fold in at
least 70% of the samples. Decreasing gene transcripts had to have a call of
"Present" and a frequency >5 in at least 70% of the controls, and a change in
expression of at least 2-fold in at least 70% of the samples. The statistical
analyses were analyzed by GENESPRING™ v6.1 (Agilent Technologies, Palo
Alto, CA) using a Welch ANOVA and several multiple testing corrections
(Benjamini and Hochberg False Discovery Rate and Bonferroni Multiple
Testing Correction - Family-wise error rate (FWER) p<0.05). The legumain
qualifier was chosen for additional analysis.
Example 2.3: TAQMAN® Real-time Quantitative PCR
[0181] RNA was isolated and purified from mouse tissues (or THP-1 cells; see
below) using RNEASY® kit (Qiagen, Valencia, CA) according to the
manufacturer's instructions. Using an ABI PRISM® 7000 Sequence Detection
System (PE Applied Biosystems, Foster City, CA), legumain mRNA levels
were measured by TAQMAN® real-time quantitative PCR as previously
described (Lake et al. (2005) J. Lipid Res. 46:2477-87) with Assay-on-Demand
TAQMAN® reagents (PE Applied Biosystems, Foster City, CA or Eurogentec,
San Diego, CA). The following primers were used:
CCAGGAGGCTGTAACCCACTT (forward primer; SEQ ID NO: 14) and
GCAAGGCATGCTCGTACGT (reverse primer; SEQ ID NO:l 5). Data were
analyzed according to the manufacturer's instructions.

Example 2.4: In situ Hybridization
[0182] Murine legumain sense and antisense riboprobes were produced by
generating two independent PCR products with T7 RNA polymerase binding
sites at either the 5' end of the PCR product for sense riboprobe or the 3' end of
the PCR product for antisense riboprobe. Digoxigenin-labeled probes were
prepared as described by the manufacturer using DIG RNA labeling mix and T7
RNA polymerase (Roche Diagnostics, Mannheim, Germany). Primer and probe
sequences are described in Table 2 (below).
[0183] Sections of paraffin-embedded tissue were deparaffinized with xylene (2
changes, 3 minutes each) and rehydrated in water. After a rinse in RNase-free
water and phosphate buffered saline (PBS), permeabilization was performed by
incubation with 0.2% Triton-X 100/PBS for 15 minutes. After 2 washes with
PBS, each at 3 minutes, the sections were ready for proteinase K (PK) (Sigma,
St. Louis, MO) treatment. Sections were immersed in 0.1M Tris and 50 mM
EDTA (Sigma) (pH 8.0) prewarmed at 37 °C containing 5 mg/ml PK for 15
minutes. PK activities were stopped by 0.1 M glycine/PBS for 5 minutes
followed by a post-fixation with 4% paraformaldehyde for 3 minutes and a PBS
rinse. To prevent nonspecific electrostatic binding of the probe, sections were
immersed in 0.25% acetic anhydride and 0.1 M triethanolamine solution (pH
8.0) for 10 minutes, followed by 15 seconds in 20% acetic acid at 4 °C. After 3
changes in PBS, 5 minutes each, sections were dehydrated through 70%, 90%
and 100% ethanol, each at 3 minutes. The sections were completely air dried
before 40 ml of prehybridization buffer was applied, covered with Parafilm and
incubated at 52°C for 30 minutes to reduce nonspecific binding. Parafilm was
removed and 40 ml of hybridization buffer containing 5 ng/ml of digoxigenin-
labeled probe was applied to each section, recovered with Parafilm and
incubated overnight at 52°C in a humid chamber.
[0184] The Parafilm was carefully removed and the sections were placed in a
GENOMX™ i6000 (Biogenex, San Ramon, CA) automatic staining system.
Sections were washed in 2 X saline sodium citrate (SSC)/0.1% lauryl sulphate
(SDS) (both Sigma) at room temperature, 4 changes, at 5 min each. To ensure

only specific hybridization signal remains, sections were washed in a high
stringency solution containing 0.1x SSC/0.1% SDS at 52°C, 2 changes, 5
minutes each. To reduce endogenous peroxidase staining, the sections were
incubated in 3% H2O2 for 15 minutes followed by 3 washes in buffer. The
labeled probe was detected with anti-digoxigenin antibody conjugated to
horseradish peroxidase complex (Roche, Nutley, NJ) diluted 1:500 in 2%
normal sheep serum/0.1% Triton X-100 for 1 hours. The biotinylated complex
was amplified using a Tyramide Amplification System (TSA™) (Biogenex, San
Ramon, CA). Sections were incubated with TSA for 5 minutes, followed by 5
washes in buffer. The TSA complex was then amplified further by incubation
with horseradish peroxidase for 15 minutes, followed by 5 washes in buffer.
The amplified product was developed with 3,3'-diaminobenzidine (Vector
Laboratory, Burlingame, CA) for 10 minutes, washed in water, stained briefly
with Mayers' hematoxylin (Sigma), dehydrated through graded alcohol into
xylene, and mounted in a DPX mountant before microscopic examination.


Example 2.5: Immunohistochemistry and Histology
[0185] Four μm thick sections of paraffin-embedded tissue were deparaffinized
and rehydrated. Masson's trichrome staining was performed according to the
manufacturer's instructions (American MasterTech Scientific, Lodi, CA). For
immunohistochemistry, tissue sections were subjected to heat-mediated antigen
retrieval treatment (Target Retrieval Solution, DAKO, Carpinteria, CA;
DECLOAKING CHAMBER™, Biocare Medical, Concord, CA) according to
the manufacturer's instructions, followed by blocking of nonspecific
background staining (Serum-Free Protein Block, DAKO, Carpinteria, CA).

Immunofluorescent detection of legumain was achieved using a sheep anti-
mouse Iegumain primary antibody (R&D Systems, Minneapolis, MN) and a
donkey anti-sheep Alexa594 secondary antibody or a donkey anti-sheep
AIexa488 secondary antibody (Molecular Probes, Eugene, OR). Chromogenic
detection of legumain was performed using a sheep anti-mouse legumain
primary antibody (R&D Systems, Minneapolis, MN) and a rabbit anti-sheep
IgG conjugated, to alkaline phosphatase secondary antibody. Detection of the
signal was obtained using 5-bromo-4-chloro-3-indolyl phosphate/nitroblue
tetrazolium substrate (BCIP/NBT, Vector Laboratories, Burlingame, CA) with
added levamisole solution (Vector Laboratories) and nuclear Fast Red
counterstaining. Immunodetection of CD68 was obtained using a rat anti-
mouse CD68 primary antibody (Serotec, Raleigh, NC) and a rabbit anti-rat
Alexa488 secondary antibody (Molecular Probes, Eugene, OR). For double
immunofiuorescent staining of CD68 and legumain, a cocktail of CD68 and
legumain primary antibodies was used before appropriate secondary antibodies
were applied as described above.
[0186] Immunodetection of P-selectin was obtained using a goat anti-mouse P-
selectin primary antibody conjugated to biotin (R&D Systems, Minneapolis,
MN) that was applied to tissue sections in which endogenous biotin and avidin
had been blocked using a commercial kit (#X0590, DAKO, Carpinteria, CA).
The immunofiuorescent signal was then detected using streptavidin conjugated
to Alexafluor488 (S32354, Molecular Probes, Eugene, OR) in slides that were
mounted in VECTASHIELD® Hardset Mounting Medium with DAPI (Vector
Laboratories, Burlingame, CA). For double immunofiuorescent staining of P-
selectin and legumain, a cocktail of the P-selectin primary antibody described
above and a rat anti-mouse legumain (R&D Systems, Cat# MAB2058, Clone
301417, Minneapolis, MN) primary antibody was used. Detection of P-selectin
was obtained as described herein and the secondary antibody used to detect
legumain in that case was a rabbit anti-rat antibody conjugated to
Alexafluor594.

Example 2.6: Results
[0187] Legumain mRNA was identified as one of the genes upregulated in the
aortic arch of ApoE-/- mice beginning at 25 weeks of age (statistical
significance is denoted by asterisks), but was expressed at a low level that
remained unchanged over time in the C57BL/6 (wild type (WT)) control
animals (FIG. 2). TAQMAN® real-time PCR analysis confirmed the increase
in legumain mRNA in adult ApoE-/- mice (at 40 and 54 weeks) compared to
either 12-week old ApoE-/- mice or control 40-week old C57BL/6 (WT) control
mice (FIG. 3). In situ hybridization detected legumain mRNA expressed in 55-
week old ApoE-/- aortic arch, but not in a 45-week old C57BL/6 control section
or sections stained with control probes (data not shown).
[0188] Immunohistochemical staining demonstrated that legumain protein was
expressed in lesions at the aortic sinus in ApoE-/- mice (data not shown). In the
aortic sinus, legumain expression was first detectable in 2-month old ApoE-/-
mice (data not shown). Increased expression was detected in older mice in the
developing atherosclerotic plaques. In 1 -year old ApoE-/- mice, legumain was
found within the atherosclerotic lesions in the areas of infiltrated inflammatory
cells (data not shown). Legumain was not detected in the aortic sinus of adult
C57BL/6 control mice (data not shown).
Example 3: Legumain is Expressed in the ApoE-/- Mouse Model of Accelerated
Atherosclerosis
[0189] To determine whether legumain expression was limited to
atherosclerotic lesions developing spontaneously in ApoE-/- mice, the
expression pattern of legumain was analyzed in a model of accelerated
atherosclerosis following vascular injury.
Example 3.1: Preparation of a Mouse Model of Accelerated Atherosclerosis
[0190] A subset of animals underwent left carotid artery ligation as previously
described (A. Kumar and V. Lindner (1997) Arterioscler. Thromb. Vase. Biol.
17:2238-44). Briefly, 8-10 week old ApoE KO mice were anesthetized with a
solution of ketamine (100 mg/kg body wt) and xylazine (20 mg/kg) injected
intraperitoneally. The left common carotid artery was exposed through a small

midline incision in the neck. The artery was completely ligated just proximal to
the carotid bifurcation to disrupt blood flow. The animals were allowed to
recover for 4 weeks. At the end of the recovery period, animals were
euthanized, perfused with saline and 4% paraformaldehyde as described herein
and 5 mm-long segments of the left and right carotid arteries were collected to
be embedded in paraffin blocks for analysis by immunohistochemistry.
Example 3.2: Results
[0191] Immunohistochemical staining demonstrated that legumain expression
was detected in the neointimal lesions in the injured carotid arteries at four
weeks after ligation (data not shown). Control staining using normal IgG.did
not detect any signals (data not shown). Staining of uninjured carotid artery
with anti-legumain antibody did not reveal any signals (data not shown).
Example 4: Legumain is Expressed in Foam Cells of Atherosclerotic Lesions
[0192] To identify the type of cell associated with legumain in atherosclerotic
lesions, cells were immunostained for both legumain and the macrophage
marker CD68.
Example 4.1: Immunostaining of Atherosclerotic Lesions for Legumain and
Macrophage Markers
[0193] Immunodetection of CD68 was obtained using a rat anti-mouse CD68
primary antibody (Serotec, Raleigh, NC) and a rabbit anti-rat Alexa488
secondary antibody (Molecular Probes, Eugene, OR). For double
immunofluorescent staining, a cocktail of CD68 and legumain primary
antibodies was used before appropriate secondary antibodies were applied as
described above. Chromogenic detection of legumain was performed as
described herein..
Example 4.2: Results
[0194] Chromogenic and immunofiuorescent staining revealed that legumain
protein localized to atherosclerotic plaques within the coronary arteries (data not
shown). Moreover, legumain colocalized with the macrophage marker CD68 in
lesions developing at the aortic sinus, indicating that the major cell types

expressing legumain in atherosclerotic plaques were macrophages and foam
cells (data not shown).
Example 5: Legumain is Expressed by Arterial Endothelial Cells of Aortic
Sinus
[0195] To determine whether legumain is expressed by arterial endothelial
cells, cells were immunostained for both legumain and the endothelial marker,
P-selectin.
Example 5.1: Immunostaining of Atherosclerotic Lesions for Legumain and
Endothelial Cell Markers
[0196] Immunodetection of P-selectin was performed using a goat anti-mouse
P-selectin primary antibody conjugated to biotin (R&D Systems), followed by
streptavidin conjugated to AIexafluor488 (Molecular Probes, Eugene, OR). For
double immunofluorescent staining, a cocktail of legumain and P-selectin
primary antibodies was used before the secondary antibody and streptavidin
were applied.
Example 5.2: Results
[0197] Immunofluorescent staining revealed that legumain was expressed by
arterial endothelial cells of the aortic sinus of ApoE-/- mice aged 2 months to 1
year, including endothelial cells overlaying early inflammatory lesions (data not
shown).
Example 6: Legumain is Expressed within Kidney Proximal Tubule Cells and
Endothelial Cells of the Renal Arteries of ApoE-/- Mice
[0198] Due to the involvement of vascular dysfunction and inflammatory
processes in renal pathologies, the expression of legumain and was measured in
kidneys of ApoE KO and C57BL/6 mice.
Example 6.1: Materials
[0199] Kidneys from male ApoE KO and C57BL/6 mice were harvested,
prepared, and subjected to immunohistochemistry as described above in order to-
assess the expression of legumain in kidneys and renal arteries. P-selectin was
used as a marker for endothelial cells.

Example 6.2: Results
[0200] Immunodetection of legumain protein in kidneys isolated from ApoE
KO (ApoE-/-) mice revealed that legumain was predominantly expressed in
kidney proximal tubule cells (data not shown). Double immunostaining for
legumain and p-selectin in C57BL/6 mice revealed that the two proteins
colocalize and that legumain is consistently expressed by endothelial cells in
mouse renal arteries (data not shown).
Example 7: Expression of Legumain in Human Atherosclerotic Lesions
[0201] To determine whether legumain was also expressed in human
atherosclerotic lesions, human coronary artery sections were immunostained for
legumain expression.
Example 7.1: Human Coronary Artery Immunostaining
[0202] Human coronary arteries from a 57 year old female with advanced
atherosclerotic plaques were stained for legumain using a goat anti-human
legumain primary antibody (R&D Systems) and a biotinylated rabbit anti-goat
IgG secondary antibody.
Example 7.2: Results
[0203] Immunohistochemistry experiments indicated that legumain protein was
not expressed in normal human coronary arteries. In contrast, legumain protein
was mainly expressed by inflammatory cells in advanced coronary
atherosclerotic plaques, in regions of foam cell overlaying fibrotic and calcified
portions of the plaques, as well as in sites of neovascularization (data not
shown).
Example 8: Legumain Expression and Activity Increases in Differentiated THP1
Monocytes and Activated Primary Human Macrophages
[0204] The expression of legumain and the enzymatic activity of legumain
were measured in differentiated THP-1 macrophages and CSF-stimulated
human macrophages.
Example 8.1: Cell Culture
[0205] Human monocytic THP-1 cells were obtained from ATCC and
maintained in RPMI1640 medium (ATCC) containing 10% fetal bovine serum

and β-mercaptoethanol. THP-1 monocytes were differentiated into
macrophages over three days in the growth medium containing 100 μg/ml
phorbol 12-myristate 13-acetate (PMA) (Sigma).
Example 8.2: Human Primary Cell Culture Conditions
[0206] Human monocytes were isolated from the buffy coat byproduct of a
volunteer blood donor using Rosettesep Human Monocyte Enrichment cocktail
(StemCell Technologies, Vancouver, BC) following the manufacturer's
protocol. Monocyte purity was determined to be 88% by Celldyne clinical cell
counter (Abbott, Alameda, CA). Monocytes were suspended to 2 x 106 cells/ml
in RPMI supplemented with penicillin, streptomycin, L-glutamine, 2.5 mM
Hepes (Sigma), and 10% heat-inactivated fetal bovine serum (Hyclone, Logan,
UT) and further enriched by a 2 hour adherence to plastic in 10 cm tissue
culture dishes (Falcon, BD Biosciences, Rockville, MD) at 37°C.
[0207] Adherent cells were washed vigorously and cultured for 72 hours in
RPMI containing 0.25% FBS in the presence or absence of 20 ng/ml
recombinant human macrophage colony stimulating factor (M-CSF) (R&D
Systems, Minneapolis, MN). Supernatant was harvested, clarified by
centrifugation, and stored at -80°C. Cells were scraped into 0.5 ml modified
RIPA (50 mM Tris, 150 mM NaCl, 1 mM EDTA, 1% NP40, 0.25%
deoxycholic acid) containing Complete Mini protease inhibitor (Roche, Nutley,
NJ) and incubated 15 minutes on ice. Insoluble material was removed by
centrifugation and the supernatants were stored at —80°C.
Example 8.3: Western Blot Analysis
[0208] Protein extracts were prepared from THP-1 cells or human macrophages
by lysing cells in lysis buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 5 mM
EDTA, 1 % Triton-X, 5 mM DTT) supplemented with protease inhibitor tablet
(Roche Diagnostics, Nutley, NJ). Cell lysates were subsequently cleared by
centrifugation. The supernatant was collected and resolved on SDS-PAGE gel.
The proteins were transferred to PVDF membranes (Bio-Rad, Hercules, CA)
and incubated with primary and secondary antibodies before ECL detection
(Roche Diagnostics, Nutley, NJ). Antibodies used include an anti-actin

polyclonal antibody (Santa Cruz Biotechnology, Santa Cruz, CA), and an anti-
legumain polyclonal antibody (R&D Systems, Minneapolis, MN).
Example 8.4: Legumain Activity Assay
[0209] A fluorimetric assay measuring legumain protease activity was
performed as previously described with some modifications (Johansen et al.
(1999) Anal. Biochem. 273: 278-83). Cell extract (20-50 μl) was added to each
well of 96- well plate, to which 150 μ1 of assay buffer containing 10nM of the
substrate Z-AAN-MCA (Peptide Institute) was added. The plate was incubated
at room temperature for 5 min and measured for fluorescence in a VICTOR 3™
fluorescence plate reader (PerkinElmer, Wellesley, MA) using an excitation
filter of 360 nm and an emission filter of 460 nm. Repeated measurements were
carried out once every 5 min over a period of 20 min at room temperature. The
increase of fluorescence over time was plotted.
Example 8.5: TAQMAN™ Real-time Quantitative PCR
[0210] RNA was isolated and purified from mouse tissues or THP-1 cells using
RNEASY™ kit (Qiagen, Valencia, CA) according to the manufacturer's
instructions. Using an ABI PRISM™ 7000 Sequence Detection System (PE
Applied Biosystems, Foster City, CA), legumain mRNA levels were measured
by TAQMAN™ real-time quantitative PCR as previously described (Lake et al.
(2005) J. Lipid Res. 46:2477-87) with custom-made TAQMAN™ reagents
(PE Applied Biosystems, Foster City, CA or Eurogentec, San Diego, CA). The
following primers were used: forward primer (SEQ ID NO: 14) and reverse
primer (SEQ ID NO: 15). Data were analyzed according to manufacturer's
instructions.
Example 8.6: Results
[0211] Compared with undifferentiated THP-1 monocytes, legumain mRNA
(FIG. 4A), protein (FIG. 4B), and protease activity (FIG. 4C) were markedly
increased in the differentiated THP-1 macrophages. In addition, human
macrophages differentiated with M-CSF also exhibited increased legumain
protein (FIG. 5A) and activity (FIG. 5C). By Western analysis, secreted
legumain (as pro-legumain) was detected in the conditioned media of M-CSF-

treated human macrophages (FIG. 5B). These results demonstrate that
differentiated macrophages express high levels of legumain and are capable of
secreting legumain into the extracellular environment.
Example 9: Legumain Chemoattractive Properties Towards Differentiated
Human Monocytes In Vitro
[0212] To determine whether the legumain released into the extracellular
environment acts as a chemoattractant molecule that contributes to monocyte
recruitment, migration of primary human monocytes towards the purified
proform of legumain was tested in modified Boyden chambers.
Example 9.1: Human Monocytes Migration Assay
[0213] Human monocytes were isolated from the blood of healthy donors using
the negative selection method with the Monocyte Isolation Kit (Miltenyi
Biotech) according to manufacturer's instructions. The purity of isolated
monocytes was confirmed by flow cytometry on CD14-stained cells. Cells were
tested in a modified Boyden chamber assay using Multi Screen 96-well
filtration plate (Millipore, 5.0uxn pore size). Serum-starved monocytes were
added to the top chamber (20,000 cells/well), and serum-free culture medium
was added to the bottom chamber with or without purified legumain (R&D
Systems). VEGF (R&D Systems) was used as a positive control. Cells that
migrated into the bottom chamber were quantified using.a luminescent cell
viability assay (CellTiter-Glo® Assay, Promega, Madison, WI) at 2 hours.
Example 9.2: Results
[0214] A dose-dependent increase in the migration of human monocytes
towards legumain was observed (FIG. 6). A dose of 25ng/mL was found to be
the minimal effective concentration of legumain, inducing a 2.3 fold increase in
migration of monocytes relative to control. The number of migrated cells in
response to legumain at 25ng/mL and VEGF at 10ng/mL was similar.
Example 10: Active Legumain is Expressed on the Cell Surface of
Recombinant Overexpressing Cells
[0215] In order to determine if legumain is expressed on cell surfaces, CHO
cells overexpressing mouse legumain were generated and assayed for cell

surface legumain. To determine whether such cell surface legumain is
enzymatically active, HEK293 cells overexpressing legumain were assayed for
legumain protease activity.
Example 10.1: Immunofluorescence Staining of CHO Cells
[0216] CHO cells were infected with adenovirus expressing mouse legumain at
MOI of 500. Forty-eight hours post infection, cells were fixed with 2%
paraformaldehyde in PBS at 4°C for 20 minutes. After blocking cells with
blocking buffer (10% FBS, 3% BSA in PBS) at room temperature for 30
minutes, the cells were incubated with sheep anti-mouse legumain antibody
(R&D Systems, Minneapolis, MN) or control normal sheep IgG (Santa Cruz
Biotechnology, Santa Cruz, CA) at room temperature for 1 hour. The cells were
washed three times with PBS and incubated with Alexa488-conjugated donkey
anti-sheep antibody (Molecular Probes, Eugene, OR) at room temperature for 1
hour. After three washes with PBS, the cells were counterstained with Hoechst
dye (Molecular Probes, Eugene, OR) for 5 min at room temperature. The cells
were subsequently photographed under fluorescent microscope at 40 X
magnification.
Example 10.2: HEK293 Cell-Surface Legumain Activity Assay
[0217] HEK293 cells were plated in 96-well black tissue culture plate (BD
Biosciences) and infected with adenovirus expressing mouse legumain at MOI
of 10. 24 hours post infection, the cells were washed once with legumain assay
buffer [39.5mM citric acid, 125mM Na2HPO4 (pH 5.8), 1mM EDTA, 0.8% '
NaCl], and 50 ul of assay buffer containing lOnM of the substrate
Z-AAN-MCA (Peptide Institute, Louisville, KY) was added to each well. The
protease inhibitors cystatin C (R&D Systems, Minneapolis, MN) or E64
(Sigma) were included in the assay buffer at a concentration of 1 OOnM. The
plates were incubated at 37°C for 10 min and measured for fluorescence in a
VICTOR 3™ fluorescence plate reader (PerkinElmer, Wellesley, MA) using an
excitation filter of 360nm and an emission filter of 460 nm. Repeated
measurements were carried out once every 5 min over a period of 20 min at
room temperature. The increase of fluorescence over" time was plotted.

Example 10.3: Results
[0218] By imraunofluorescent staining, legumain expression was detected on
the surface of CHO cells infected with adenovirus expressing mouse legumain
(data not shown). Cells stained with legumain antibody were positive for the
protein, whereas the control normal sheep IgG stained cells only displayed
background staining (data not shown).
[0219] By using nonpermeable assay conditions, the cell surface legumain
activity in HEK293 cells infected with adenovirus expressing mouse legumain
was directly measured on live HEK293 cells overexpressing mouse legumain.
As shown in FIG. 7, the measured activity could be inhibited with cystatin C
but not E64, indicating the activity was specific for legumain. Mock-infected
HEK293 cells did not exhibit measurable activity in this assay (data not shown).
Thus, cells are capable of expressing legumain on their surfaces in an
enzymatically active form.
Example 11: Legumain-Mediated Endothelial Cell Migration and Proliferation
[0220] In order to determine if legumain is involved in cell migration and
proliferation, e.g., endothelial cell migration as occurs during atherogenesis, the
influence of legumain on wound healing was studied in HEK293 and HUVEC
cultures.
Example 11.1: In Vitro Wound-Healing Assay
[0221] HEK293 cells (ATCC, Manassas, VA) used at passage 10 and HUVECs
(Cambrex, Walkersville, MD) used at passage 3 were seeded onto single-
chamber slides (Lab-Tek cat# 177410, Campbell, CA). HEK293 cells were
cultured to >80% confluence in DMEM supplemented with 10% FBS and 1%
penicillin/streptomycin/L-glutamine (Cat# 10378-016, Gibco, Invitrogen,
Carlsbad, CA), and HUVECs were grown to >90% confluence in EGM (Cat#
CC-3124, Cambrex, East Rutherford, NJ). After washing the cells in serum-free
medium, the monolayers were mechanically wounded using a cell scraper (Cat#
3010, Costar [Corning], Fisher Scientific, Pittsburgh, PA) to obtain a
rectangular denuded area of 2.0 x 1.7 cm2. Wounded cells were then incubated
in serum-free medium supplemented with 0.05% delipidized BSA (BD

Biosciences, Bedford, MA) and with VEGF (10 ng/mL, R&D Systems,
Minneapolis, MN) or legumain (10 ng/mL or 25 ng/mL, R&D Systems,
Minneapolis, MN) for 24 hours (HEK293 cells) or 20 hours (HUVECs).
Wound healing was quantified by measuring the number of cells present in the
area of the initial wound using a luminescent cell viability assay (CellTiter-
Glo® Assay, Promega, Madison, WI).
Example 11.2: Results
[0222] The data presented in FIGs. 8 and 9 reveal an increase in cell migration
in response to stimulation with legumain at 10 ng/mL and 25 ng/mL relative to
control (5% FBS and VEGF). Thus, legumain appears to be involved in
endothelial cell migration; such migration occurs during atherogenesis, and may
be involved in angiogenesis. Methods, therapeutics, etc. designed to diagnose,
prognose, monitor, treat, ameliorate and/or prevent disorders and/or conditions
involving angiogenesis (including, but not limited to, cancer and inflammatory
disorders) are contemplated in the present invention.
Example 12: Legumain-Mediated Invasion of Endothelial Cells
[0223] In order to determine if legumain is also involved in endothelial cell
invasion, e.g., as related to angiogenesis, HUVECs were tested in a modified
Boyden chamber assay.
Example 12.1: Modified Boyden Chamber Assay
[0224] In a modified Boyden chamber assay, 25,000 serum starved HUVECs
loaded into the top chamber were allowed to invade a Matrigel coated PET
membrane (3.0um pore size, Becton Dickinson, BioCoat Angiogenesis System:
Endothelial Cell Invasion) in response to purified legumain added to the bottom
chamber. Cells that invaded through the Matrigel matrix were quantified using
a luminescent cell viability assay (CellTiter-Glo® Assay, Promega, Madison,
WI). VEGF was used a positive control.
Example 12.2: Results
[0225] When HUVECs were tested for their invasive properties in a modified
Boyden chamber assay, a dose-dependent increase in the number of cells

invading a Matrigel coated membrane was observed in response to legumain,
with 25ng/mL legumain inducing a response similar to 10ng/mL VEGF during a
22 hour period (FIG. 10).
Example 13: Legumain is Highly Expressed in Diseased Paws of the Collagen-
Induced Arthritis (CIA) Mouse Model of Arthritis
[0226] To determine if legumain plays a role in other disorders marked by
increased macrophage and monocyte activity, e.g., tuberculosis and rheumatoid
arthritis, the expression of legumain in the Collagen-Induced Arthritis (CIA)
model of arthritis was examined.
Example 13.1: Collagen-Induced Arthritis (CIA) Model
[0227] Male DBA/1 mice were obtained from Jackson Laboratories, Bar
Harbor, Maine. Arthritis was induced using bovine collagen type II (Chondrex,
Redmond, WA) dissolved in 0.1 M acetic acid and emulsified in an equal
volume of Complete Freund's Adjuvant (Sigma) containing 1 mg/ml
Mycobacterium tuberculosis (strain H37RA). Mice were injected
subcutaneously with a 100 μg of the collagen mixture in the base of the tail. On
day 21 mice received an additional subcutaneous injection in the base of the tail
with 100 μg of bovine collagen II in 0.1M acetic acid mixed with an equal
volume of Incomplete Freund's Adjuvant (Sigma). Naive animals received no
collagen. Mice were monitored at least three times a week for disease severity.
Limbs were assigned a clinical score based on the index:0 = normal; P =
prearthritic characterized by focal erythema on the tips of digits; 1 = visible
erythema accompanied by 1-2 swollen digits; 2 = pronounced erythema, paw
swelling and/or multidigit swelling; 3 = massive swelling extending into ankle
or wrist joint; 4 = difficulty in using limb or joint rigidity; resulting in a
maximum total body score of 16. At various intervals post onset of disease
animals were sacrificed, tissues were harvested, paws were fixed in 4%
paraformaldehyde pH 7.47, decalcified in 20% EDTA (pH 8.0) and embedded
in paraffin for in situ hybridization.

Example 13.2: Results
[0228] Legumain signal was strongly positive in diseased paws (clinical score
3) in CIA mice, but absent in normal control paws, indicating that legumain
expression was upregulated with disease in this arthritis model (data not shown).
These results suggest the involvement of legumain in inflammatory disorders in
which macrophages and monocytes are chronically involved.
Example 14: Identification and Characterization of the Legumain Splice
Variant ZB-1
[0229] To determine if additional legumain proteins or transcripts may
contribute to vascular and inflammatory disorders, cDNAs from human adrenal
glands were screened to identify proteins with high homology to human
legumain.
Example 14.1: Isolation of ZB-1 From Human Adrenal Gland
[0230] cDNAs from human adrenal gland were subcloned into the Adori
expression vector. With the Adori vector, expression is controlled by the
cytomegalovirus (CMV) immediate early promoter and enhancer. Ad5 El a
deleted recombinant adenovirus was generated by homologous recombination in
a human embryonic kidney cell line 293 (HEK293, ATCC, Manassas, VA).
Recombinant adenovirus was isolated and subsequently amplified on 293 cells.
The virus was released from infected 293 cells by three cycles of freeze
thawing. The virus was further purified by two cesium chloride centrifugation
gradients and dialyzed against phosphate buffered saline (PBS) pH 7.2 at 4°C. •
Following dialysis, glycerol was added to a concentration of 10 % and the virus
was stored at - 80°C until use. The virus was characterized by assessing the
following parameters; expression of the transgene, plaque forming units on 293
cells, particles/ml, endotoxin measurements, PCR analysis of the virus and
sequence analysis of the legumain or ZB-1 coding region in the virus.
Adenoviruses were tested for expression of recombinant protein by
radiolabeling virus infected HEK293 cells and monitoring protein expression.
[0231] In order to monitor protein synthesis, cells were labeled for 6 hours with
35S-methionine and 35S-cysteine. HEK293 cells were plated in P60 culture

plates at a density of 7.5 x 10s cells/plate in 4 ml of complete medium
(Dulbecco's Modified Eagle's Media (DME) + 10% heat inactivated fetal bovine
serum (FBS) + Penicillin/Streptomycin (Penn/Strep) + Glutamine at 2 mM).
Twenty-four hours later the media was replaced with 2 ml of reduced serum
medium (DME + 2%FBS + Penn/Strep + Glutamine) containing adenovirus at
an MOI of 20-100. Plates were incubated for 2 hours and then fed 3 ml of
complete media and incubated for an additional 24 hours. The following day
medium was removed and replaced with 2 mis of serum free-,
methionine/cysteine free-DME. Cells were incubated for one hour, then the
medium was removed and replaced with 1 ml of serum free-DME supplemented
with 35S-methionine and 35S-cysteine. Cells were incubated for 15 minutes and
1 ml of DME containing methionine and cysteine + 2% FBS + aprotonin (1:100
aprotonin; Sigma-6279) was added. Cells were incubated for an additional 4
hours, after which the 2 ml of medium was collected and centrifuged at a low
speed to remove cells that may have detached during labeling. The cleared
medium was transferred to a clean tube containing soybean trypsin inhibitor (1
mg/ml) and 20 μl phenylmethylsulphonylfluoride (1 mM). Radiolabeled
conditioned media was stored at —2°C for later analysis by SDS polyacrylamide
gel electrophoresis and autoradiography.
Example 14.2: Results
[0232] As shown in FIG. 11, ZB-1 encodes a novel secreted protein expressed
in human adrenal gland. ZB-1 appears to be a splice variant of human
legumain, with 100% identity to human legumain, except for the 57 amino acid
residues deleted (equivalent to amino acids 341-397 of legumain). ZB-1 is a
secreted protein that was found in the medium of HEK293 cell cultures infected
with adenovirus overexpressing ZB-1 (data not shown).

WHAT IS CLAIMED IS:
1. A polynucleotide comprising the nucleic acid sequence set forth in SEQ
ID NO:11.
2. A polypeptide comprising the amino acid sequence set forth in SEQ ID
NO:12, amino acids 21 to 323 of SEQ ID NO:12, or amino acids 25 to 323 of
SEQ ID NO: 12.
3. An antibody or antigen binding fragment thereof that specifically binds a
mammalian ZB-1 polypeptide or a fragment of a mammalian ZB-1 polypeptide.
4. The antibody or antigen binding fragment thereof as in claim 3, wherein
the mammalian ZB-1 polypeptide or the fragment of a mammalian ZB-1
polypeptide is derived from a human.
5. Use of a legumain antagonist and/or a ZB-1 antagonist for the preparation
of a pharmaceutical composition for use in a method of treating, ameliorating, or
preventing a vascular disorder or an inflammatory disorder, wherein the
pharmaceutical composition comprises a therapeutically effective amount of the
legumain antagonist and/or the ZB-1 antagonist, and a pharmaceutically
acceptable carrier.
6. The use of a legumain antagonist and/or a ZB-1 antagonist of claim 5,
wherein the legumain antagonist and/or ZB-1 antagonist is selected from the
group consisting of inhibitory polynucleotides, inhibitory polypeptides, small
molecules, antagonistic antibodies and antigen binding fragments thereof.
7. A method for treating, ameliorating, or preventing a vascular disorder or
an inflammatory disorder in a mammal comprising administering to the mammal
a therapeutically effective amount of a legumain antagonist and/or a ZB-1
antagonist.

8. The method of claim 7, wherein the Iegumain antagonist and/or ZB-1
antagonist is selected from the group consisting of inhibitory polynucleotides,
inhibitory polypeptides, small molecules, antagonistic antibodies, and antigen
binding fragments thereof.
9. A method for treating, ameliorating, or preventing a vascular disorder or
an inflammatory disorder in a mammal comprising contacting a cell or cell
population of the mammal with a therapeutically effective amount of a Iegumain
antagonist and/or a ZB-1 antagonist.
10. The method claim 9, wherein the cell or cell population comprises a
macrophage, a monocyte, a vascular endothelial cell, a foam cell, or a mixture of
monocytes, macrophages, vascular endothelial cells and/or foam cells.
11. The method of claim 10, wherein the cell or cell population secretes
Iegumain and/or ZB-1.
12. A method for decreasing the level of Iegumain and/or ZB-1 activity,
expression, and/or secretion in a mammal comprising administering to the
mammal a Iegumain antagonist and/or a ZB-1 antagonist in an amount sufficient
to decrease the level of activity, expression, and/or secretion of Iegumain and/or
ZB-1 in the mammal.
13. A method for monitoring the course of a treatment for a vascular disorder
or inflammatory disorder in a patient, comprising:

(a) measuring the level of activity, expression and/or secretion of
Iegumain and/or ZB-1 in a cell or cell population from the patient;
(b) administering a Iegumain antagonist and/or a ZB-1 antagonist to
the patient; and
(c) measuring the level of activity, expression and/or secretion of
Iegumain and/or ZB-1 in a cell or cell population from the patient following
administration of the Iegumain antagonist and/or ZB-1 antagonist,

wherein a lower level of activity, expression and/or secretion of legumain
and/or ZB-1 in the cell or cell population from the patient following
administration of the legumain antagonist and/or ZB-1 antagonist, in comparison
to the level of activity, expression and/or secretion of legumain and/or ZB-1 in
the cell or cell population from the patient prior to administration of the legumain
antagonist and/or ZB-1 antagonist, provides a positive indication of the effect of
the treatment for the vascular disorder or inflammatory disorder in the patient.
14. A method for inhibiting cell migration in a mammal comprising
administering to the mammal a legumain antagonist and/or a ZB-1 antagonist.
15. The method of claim 14, wherein the legumain antagonist and/or ZB-1
antagonist is selected from the group consisting of inhibitory polynucleotides,
inhibitory polypeptides, small molecules, antagonistic antibodies, and antigen
binding fragments thereof.
16. A method for promoting wound healing in a mammal comprising
administering to the mammal a legumain agonist and/or a ZB-1 agonist.
17. A method for inhibiting angiogenesis in a mammal comprising
administering to the mammal a legumain antagonist and/or a ZB-1 antagonist.
18. The method of claim 17, wherein the legumain antagonist and/or ZB-1
antagonist is selected from the group consisting of inhibitory polynucleotides,
inhibitory polypeptides, small molecules, antagonistic antibodies, and antigen
binding fragments thereof.
19. A method for inhibiting proliferation of endothelial cells in a mammal
comprising administering to the mammal a legumain antagonist and/or a ZB-1
antagonist.
20. A method for inhibiting tumor metastasis in a mammal comprising
administering to the mammal a legumain antagonist and/or ZB-1 antagonist.

The present invention provides isolated and purified polynucleotides, polypeptides, and antibodies related to mammalian
(e.g., mouse and human) legumain and the novel legumain splice variant, ZB-I. The invention further relates to the use of these
isolated and purified polynucleotides, polypeptides, and antibodies, as well as other legumain and ZB-I agonists and antagonists, in
modulating legumain and/or ZB-I activity, expression, and/or secretion in a cell or cell population, e.g., monocytes, macrophages,
foam cells, vascular endothelial cells, kidney proximal tubule cells, arterial endothelial cells, sites of inflammatory cell invasion into
a vessel intima, and neointimal lesional areas of an artery. The invention also provides legumain and ZB-I antagonists, e.g., antagonistic
small molecules, antibodies and antibody fragments to legumain and ZB-I, legumain and ZB-I inhibitory polypeptides, and
legumain and ZB-I inhibitory polynucleotides. The present invention is also directed to novel methods for diagnosing, prognosing,
monitoring, treating, ameliorating and/or preventing vascular disorders / diseases and inflammatory disorders / diseases.

Documents

Application Documents

# Name Date
1 abstract-4365-kolnp-2008.jpg 2011-10-08
2 4365-kolnp-2008-specification.pdf 2011-10-08
3 4365-kolnp-2008-pct request form.pdf 2011-10-08
4 4365-kolnp-2008-pct priority document notification.pdf 2011-10-08
5 4365-kolnp-2008-international search report.pdf 2011-10-08
6 4365-kolnp-2008-international publication.pdf 2011-10-08
7 4365-kolnp-2008-gpa.pdf 2011-10-08
8 4365-kolnp-2008-form 5.pdf 2011-10-08
9 4365-kolnp-2008-form 3.pdf 2011-10-08
10 4365-KOLNP-2008-FORM 3-1.1.pdf 2011-10-08
11 4365-kolnp-2008-form 1.pdf 2011-10-08
12 4365-kolnp-2008-drawings.pdf 2011-10-08
13 4365-kolnp-2008-description (complete).pdf 2011-10-08
14 4365-kolnp-2008-correspondence.pdf 2011-10-08
15 4365-KOLNP-2008-CORRESPONDENCE-1.1.pdf 2011-10-08
16 4365-kolnp-2008-claims.pdf 2011-10-08
17 4365-KOLNP-2008-ASSIGNMENT.pdf 2011-10-08
18 4365-kolnp-2008-abstract.pdf 2011-10-08