Abstract: The invention is related to high cell density fermentation process for production of heterologous proteins in E. coli expression system. The invention is also related to the process for the production of heterologous proteins in E. coli using pBAD24T7g10 vector. The invention is also related to the vector pBAD24T7g10. The invention is also related to the process of preparation of the vector pBAD24T7g10. The fermentation may be performed using E. coli K12 cells.
FERMENTATION PROCESS FOR THE PREPARATION OF RECOMBINANT
HETEROLOGOUS PROTEINS
Field of the Invention
The invention is related to fermentation process for the production of heterologous proteins
in E: coli expression system. The invention is also related to the process for the production of
heterologous proteins in E. coli using pBAD24T7glO vector. The invention is further related
to the vector pBAD24T7glO. The invention is also related to the process of preparation of the
vector pBAD24T7g! 0 .
Background of the Invention
Production of heterologous proteins in E. coli by recombinant DNA technology has become
the choice for expression systems to most of the researchers. It has certain advantages over
other systems, such as very well characterized, relatively simple genetics, high growth,
production rate and low cost etc. However, the disadvantages are not less, like no posttranslational
modification and most importantly high level of expression causes the formation
of insoluble protein aggregates (known as inclusion bodies) which are mostly inactive
[Harrison: Innovations, 11:4-7 (2000)]. In order to get an active protein, optimization of the
expression conditions or the refolding studies are required which could be time consuming
and expensive. Various bacterial promoters like Tac, T7, Trp, lacUVS, araBAD have been
used for the heterologous protein expression in E. coli (Guzman et. al.1 995 J . Bacterid
77:41 2 1-30, Cronan et. al. 2006, 55:152-7).
Improving productivity is the major objective of fermentation in research and industry.
Productivity is a function of cell density and specific cell productivity. Specific cell
productivity refers to the amount of product formed per unit cell mass per unit time. Thus
increasing the cell density as well as specific cell productivity increases overall fermentation
productivity. Development of high cell density fermentation processes has resulted in
increased volumetric productivity of recombinant products in E. coli. Yee and Blanch,
Biotechnology and Bioengineering, 4 1: 221-230 (1993). High cell density cultures offer an
efficient means for the economical production of recombinant proteins. Depending upon the
mode of operation and host cell system being employed, a defined balanced batch and/or feed
medium must be devised which will allow for cell growth and expression of the recombinant
protein (Khalilzadeh et al Iran. J. Biotechnol. 2008 6(2), 63-84). The widely used inducer in
high cell density cultivation is isopropyl -P-D-thiogalactopyranoside (IPTG), which is
expensive for the large scale production.
Use of arabinose induced pBAD promoter in the high cell density cultivation has been
described by Khalilzadeh et al (Iran. J . Biotechnol. (2008) 6(2), 63-84) as having the
disadvantage of product quality decreasing with cell density thus making it a bad choice for
the high cell density fermentations. pBAD24 expression vector is reported by Guzman in
1995 (Guzman et al., J . Bacteriol. 77, 41214230, 1995; EMBL accession number X81838).
The pBAD24 vector has been reported to produce proteins by researchers o ly at the lab
scale, there is no report of pBAD24 being used in a high cell density fermentation
preparation of protein. Also it has been reported that pBAD24 gives low yields of proteins
for example aminopeptidase N, Staphylococcus aureus lysylphospliatidyl glycerol synthetase,
glutamate transport protein and putative O-antigen flippase (Golich 2006, Oku 2004, Jin
2006, Nelson 2006, Marolda 2004). The present inventors while working with the pBAD24
expression vector, did not observe any expression of proteins in spite of using the optimal
inducer concentration as reported by Guzman et. al 1995.
Fed-batch fermentation for the production of G-CSF in E.coli has been reported in several
patent documents for example in PCT publications WO 2006/067793A1; WO
2004/00 1056A1 ; WO 2007/1 02 174A2; WO 2008/096368A2; and US patent application US
2007/001 5248A1 .
The inventors while continuing their work with the pBAD24 vectors noticed that when the
pBAD24 vector s modified as described herein results in good yields of protein of interest.
Summary of the invention
In one aspect the invention is related to an industrial process for the production of protein of
interest from E. coli expression system comprising pBAD24T7g 10 vector.
In another aspect the invention is related to an industrial process for the production of protein
of interest in K12 cells of E. coli expression system comprising pBAD24T7glO vector.
In another aspect the invention is related to the modified pBAD24 vector called as
pBAD24T7glO having the following sequence in the 5' UTR of the translational start site
shown in SEQ ID .
SEQ D No.l
5' gctagcaataattttgtttaactttaagaggaggaattccatatg
3 .
In yet another aspect the invention is related to the process of preparation of the vector
pBAD24T7gl O.
In another aspect the invention is related to the fermentation process for the production of
protein of interest from E. coli, the process comprises the steps:
a) inoculating the fermenter with E. coli culture comprising pBAD24T7glO vector
encoding protein of interest;
b) adding suitable production medium in the substrate limiting fed batch mode;
c) inducing the fermentation with a suitable inducer;
c) adding feed solution; and
e) subjecting the cells for cell lysis to obtain inclusion bodies comprising the protein of
interest.
n an embodiment the fermentation is induced with a suitable inducer when the OD oo is in
the range of 30 to 80.
In another embodiment the feed solution i s added to the fermentation ediu i after 7 to 8 hrs
from inoculation.
In another embodiment the process of the invention involves addition of the feed solution at
such a rate that the OD oo of fermentation solution is increased to more than 160 ± 5 over a
period of about 14 to about 5 hours.
In one aspect the invention is further related to the production of pure protein of interest from
the inclusion bodies obtained from the cell lysis after fermentation step.
In another aspect the invention also relates to pharmaceutical composition comprising
therapeutically effective amount of the biologically active protein of interest obtained
according to the process of the present invention.
The details of one or more embodiments of the inventions are set forth in the description
below. Other features, objects and advantages of the inventions will be apparent from the
description and claims.
Brief Description of the Drawings
Fig. 1: Plasmid map of pBAD24T7glO
Fig. 2 : Expression of rhGCSF as an inclusion body
Detailed Description of the Invention
As used herein, "heterologous protein" or "protein of interest" refers generally to peptides
and proteins exogenous i.e. foreign to the E. coli cells. Examples of the protein includes
molecules such as, colony stimulating factors (CSFs), for example -CSF, GM-CSF. and GCSF;
growth hormone, including human growth hormone; interferon such as interferonalpha,
-beta, and -gamma; interleukins (ILs), such as IL-2, IL-1 , IL-1RA; reteplase,
staphylokinase, Streptokinase DPP-4, DPP-8, PTH, PDGFAA, PDGFAB, PDGFBB and
fragments of any of the above-listed polypeptides.
As used herein, the term "inclusion bodies" refers to dense intracellular masses of aggregated
polypeptide of interest, which constitute a significant portion of the total cell protein,
including the cellular components. These aggregated polypeptides may be incorrectly folded
or partially correctly folded proteins.
The term "therapeutically effective amount" used herein refers to the amount of biologically
active protein which has the therapeutic effect of biologically active protein.
The term "biologically active protein" used herein refers to protein which is capable of
promoting the differentiation and proliferation of hematopoietic precursor cells and the
activation of mature cells of the hematopoietic system.
In an embodiment the invention provides a process for industrial preparation of recombinant
protein of interests from E. coli using pBAD24T7glO vector.
According to one embodiment of the invention there is provided a high cell density
fermentation process for the production of protein of interests from E. coli using
pBAD24T7glO vector.
The proteins synthesized using the process of the invention includes but not limited to GCSF,
reteplase, interleukins, human growth hormone, DPP-4, DPP-8, staphylokinase, interferon,
teriparatide.
Construction of the expression vector pBAD24T7glO:
The pBAD24 vector is digested with Nhel/EcoRI and ligated with the annealed oligo
carrying T7gl0 sequence elements which are already been digested with the same set of
enzymes. This construction allows to retain all the MCS present in pBAD24 along with
translational enhancer sequence of T7 phage. To this vector the protein of interest is cloned
as EcoRI/Hindlll fragment with an internally created Ndel site which provides initiation
codon for translation. The Figure 1 shows the plasmid map of pBAD24T7gl O.
Though pBAD24T7glO contains an inherent ampicillin (antibiotic) marker for selection of
transformants, other antibiotic markers like chloramphenicol (coded by chloramphenicol
acetyl trasnferase- CAT), Kanamycin (APH, phosphotransferases), tetracycline resistance
gene etc. can be used as antibiotic markers. These markers can be cloned either under a
constitutive promoter or under their own respective promoters at suitable restriction sites of
the pBAD24T7glO vector.
Fermentation
E. coli cells are transformed with suitable vector containing gene to synthesize rh-protein.
Various strains of E. coli may be used for the process of the present invention for example
cells which are protease deficient strains such as BL21, ER2566 and the protease expressing
strains of K12 derivatives such as HB O , JM109, LE392, C600, TOP 10, DH5 alpha and the
like. The culture of E.coli is used for the fermentation.
High expression of the proteins using the pBAD24T7gl0 vector f the present invention
depends on various parameters of the fermentation process. Some of the parameters are
fermentation media, concentration of the inducer, nutrient feed rate. Culture medium is
prepared for different stages of the fermentation as described below:
In an embodiment of the invention the batch medium of the fermentation process of the
invention has carbon to nitrogen ratio from 1 : 0.5 to 1 : 2.
In another embodiment of the invention the fed medium of the fermentation process of the
invention has carbon to nitrogen ratio from 1 : 0.05 to 1 .
Preferably the feed medium comprises 1 to 30 % carbon source and 1 to 20% nitrogen
source. The carbon source may comprise glucose, glycerol, sorbitol, maltose, sucrose or
starch, mannitol. Preferably the carbon source is mannitol, glucose or glycerol or mixture
thereof. The nitrogen source may comprise ammonia, nitrate, peptone, soy peptone, yeast
extract or tryptone. Preferably the nitrogen source is yeast extract, soya peptone or tryptone
or mixtures thereof.
Preferably the feed medium comprises of 0.005 to 0.02 % antibiotics and 1 to 10 % of
inorganic phosphates and trace elements.
The feed medium may comprise antibiotics such as ampicillin, tetracycline, any other
antibiotic such as kanamycin, tetracycline, chloramphenicol, hygromycin and the like
depending on the antibiotic marker of the vector.
Preferably, the expression of the protein of interests is induced at a cell density when OD oo
of the culture is 30 to 80. Preferably the production is induced with the L-(+)-arabmose as
inducer.
The percentage of dissolved oxygen is adjusted between 20%-60%. Preferably the
temperature of the fermentation broth is maintained between 30 C to 44 0 C and preferably
at 37 °C. Preferably pH of the fermentation broth is maintained at pH 6.5 - pH 7.5 and
preferably at pH 7.0. The fermentation may be carried out for a period of 12 to 24 hours.
Preparation of seed culture:
Typically the seed medium is inoculated with glycerol stock of the culture. Inoculated flask is
incubated at 37 °C, 200 rpm for 16 to 18 h . Seed medium used herein is composed of 1%
Tryptone or soy peptone, 0.5% yeast extract, 1% sodium chloride suspended in water and pH
of the seed medium is in the range of 7.2 to 7.4
Preparation and inoculation of fermenter medium:
To a suitable fermenter is added the fermentation medium. The fermentation medium is the
medium required for the growth and expression of rh-proteins at fermenter scale. Typically
the fermentation medium comprises of suitable salts, carbon source and nitrogen source
while antifoam (at 0.05%) may also be added. The suitable salts include ammonium chloride,
potassium di-hydrogen phosphate, di-sodium hydrogen phosphate, sodium chloride,
magnesium sulphate and the like. Suitable carbon sources include but not limited to one or
more of mannitol, glucose, arabinose or glycerol. Nitrogen sources which may be used
include but not limited to one or more are yeast extract, tryptone, soy peptone and the like.
In an embodiment of the invention the fermentation is carried out in the presence of zinc
ions. During fermentation the presence of zinc ions help prevent bacteriophage
contaminations. Additionally the presence of zinc may help in the activation of the
methionine aminopeptidase activity in E.coli as described in BBRC, 2003, 307, 172-79;
Protein Science, 1998, 7, 2684-87; both the references are incorporated herein in their
entirety.
In the present process of high cell density fermentation for production of recombinant
therapeutic proteins, non toxic surfactants may be added such as Tween 20, Tween-80.
Tween-20 at concentration of 0.05% is added in the medium, considering its role to prevent
bacteriophage contamination in -bacterial fermentations. The book, Biotechnological
Innovations in chemical synthesis by R. C. Van Dam Mieras, Chapter 8 Page No: 248 & a
paper by D. Perlman, Wayne W. Umbfeit Bacteriophages of the genus Clostridium in a
journal, Advances in Applied Microbiology, discloses addition of non toxic surfactants to
prevent bacteriophage contamination during bacterial fermentations, the reference is
incorporated herein in its entirety..
Typically, the fermenter medium is prepared using 1 to 3 % tryptone or soy peptone, 1.5 to 6
% yeast extract, 1 to 5 % mannitol, 0.05 to 0.2 % ammonium chloride, 0.1 to 0.5 %
potassium di-hydrogen phosphate, 0.5 to 3 % di-sodium hydrogen phosphate, 0.01 to 0.1 %
sodium chloride, 0.01 to 0.1 % magnesium sulphate, 0.00025% zinc, 0.01 to 0.2 % Tween-
20.
In an embodiment of the invention the suitable salts are dissolved in water in a transfer flask.
The required quantities of yeast extract and tryptone or soy peptone are mixed in water and
added to a fermeiiter vessel. Similarly required quantity of mannitol is dissolved in water in a
transfer flask: Magnesium sulphate is dissolved in another transfer flask. All the transfer
flasks and the fermenter are sterilized at 121 °C for 30 minutes in an autoclave. Fermenter
media is reconstituted aseptically after all the solutions in transfer flasks are cooled.
Feed solution used for growth and expression of rh-proteins at fermenter scale is prepared as
follows. The feed solution comprises of suitable salts, carbon source, nitrogen source,
inducer and antibiotic.
Typically the concentration of the feed solution comprises of 1 to 5 % Tryptone or soy
peptone, 5 to 20 % Yeast Extract, 5 to 30 % Mannitol, 0.1 to 0.5 % Ammonium chloride, 0.5
to 2 % Potassium di-hydrogen phosphate, 2 to 8 % di-Sodium hydrogen phosphate, 0.025 to
0.3 % Sodium chloride, 0:025 to 0.3 % Magnesium sulphate. L-(+)-arabinose is added as
inducer. Inducer is used in the range of about 3 to 25 M.
The feed solution is prepared by dissolving required quantities of salts in water as solution A.
The required quantities of yeast extract and tryptone or soy peptone are mixed and dissolve
in water as solution B. The solution of carbon source, mannitol is prepared by dissolving in
water as solution C. Solution D is prepared by dissolving magnesium sulphate in water. All
the solutions A, B, C and D in separate flasks are sterilized separately at 121 °C in an
autoclave and mixed together. To the prepared feed solution L-(+)-arabinose and antibiotic
such as ampicillin is also added.
The fermenter used for the invention is microbial fermenter having provision for oxygen
enrichment and is equipped with control devices comprising of sensors & controllers for
temperature, pH and oxygen while pumps for addition of feed medium, acid/base, inducer
and antifoam solutions. The pH is maintained using buffers preferably 30% Phosphoric acid
or 12% Ammonia solution. Antifoam used is 1510-US from Dow corning & is added drop
wise as per requirement.
Fermenter with sterilized media is connected to its control panel; pH and DO probes and feed
pumps are checked for their calibration. Initially agitation is set at 300 rpm and is increased
to maximum of 800 rpm as to maintain dissolved oxygen in a range of 20 to 60 %. Aeration
is maintained at Ivvm of air. If required, air is supplemented with oxygen gas in the
proportion set by automatic controller of the instrument so as to maintain dissolved oxygen in
a range of 20 to 60 %. Temperature is maintained at 37°C by PID controller of the
instrument. Acid, base and sterile antifoam solution bottles are connected to respective ports
on to a fermenter with the help of silicon tubing and pumps. pH is maintained at 7.00 by
automatic addition of acid or base with the help of PID controller of the instrument.
Before inoculation of seed culture in a fermenter media, Filter sterilized ampicillin solution is
added at concentration of 100 g ml.
To start the fermentation process, 5 to 20 % V/v seed culture is inoculated to 2-liter fermenter
medium. Batch is monitored for its pH, optical cell density OD 6oo and other process
parameters like temperature, % of dissolved oxygen, agitation, volume of acid, base or feed
consumed, etc at the interval of every one hour. After about 6 to 8 hours of inoculation, when
OD 00 of the culture is in the range of 30 to 80, preferably in the range of 50 to 70, it is
induced with L-(+)-arabinose. A first dose of 10 ml stock solution ( 0%) of L-(+)-arabinose
is added to growing culture, followed by same dose at an interval of 1 hour up to 6 hours.
After 7 to 8 hours of initial growth fermentation process running in batch mode, the
fermentation is subsequently shifted as a fed batch process. Thus, volumetric addition of feed
solution is added in portions starting after 7-8 hours of initial growth to up to 14-15 hours.
The feed solution is added at such a rate that the OD 0o of fermentation solution is increases
to more than 160 ± 10 over a period of about 14 to 15 hours.
Cell pellet of 2 liter fermented broth is suspended in 800 ml to 1 liter of 10 mM Tris pH 8.0
and is mixed so as to get uniform mixture, having initial OD oo between 100 to 50.
Suspended cell pellet is subjected to homogenization in a homogenizer. Homogenization is
carried out at a pressure of 800 to 900 bars and is done for 3 to 4 cycles, which is for about
20 minutes. The entire operation is done under cooling conditions. The fall in optical density
of cell suspension is between 80 to 85%.
After this the cell lysate is chilled to about 5 to 8 C on ice for 30 ins and it is subjected to
centrifugation at 9000 PM for 30 minutes at 4 C. Supernatant is discarded while pellet i.e.
inclusion bodies of proteins are preserved at -20 C until further use for purification.
In an embodiment the invention further provides a process for production of pure protein of
interest from the inclusion bodies. For obtaining the pure proteins from the inclusion bodies
one skilled in the art can follow the procedures described in the literature. Typically the
process for the production of pure protein of interest from the inclusion bodies includes
solubilizing the inclusion bodies of proteins; refolding the said solubilized proteins; purifying
the refolded proteins; and isolating pure proteins. There are various methods reported in the
literature, one skilled in the art can follow one or more methods to obtain protein of interest.
Purification methods include but not limited to aqueous two phase extraction, various
chromatography techniques. The purification of GCSF is disclosed in our copending patent
application No. IN 865/KOL/2009 filed on June 16, 2009, which is incorporated herein by
reference in its entirety). The protein obtained using the aqueous two phase extraction
process may be further processed, to provide the protein or polypeptide having high purity.
Further purification may be necessary to remove related impurities. The impurities may
include oxidized forms, deamidated forms, aggregated proteins and also degraded forms such
as biologically inactive monomeric forms, incorrectly folded protein molecules, denaturated
forms of protein, host cell proteins, host cell substances such as DNAs, (lipo)polysaccharides
etc and additives which had been used in the preparation and processing of proteins. Such
higher purity may be required depending on the use for which the protein or polypeptide is
intended. For example, therapeutic uses of the protein will typically require further
purification following the extraction methods of the invention. All protein purification
methods known to the skilled artisan may be used for further purification. Such techniques
have been extensively described in Berger and Kimmel, Guide to Molecular Cloning
Techniques, Methods in Enzymology, Volume 152, Academic Press, San Diego, Calif.
(1987); Molecular Cloning: A Laboratory Manual, 2d ed., Sambrook, J., Fritsch, E. F., and
Maniatis, T. (1989); Current Protocols in Molecular Biology, John Wiley & Sons, all Viols.,
1989, and periodic updates thereof); New Protein Techniques: Methods in Molecular
Biology, Walker, J . M., ed., Humana Press, Clifton, N.J., 1988; and Protein Purification:
Principles and Practice, 3rd. Ed., Scopes, R. K., Springer-Verlag, New York, N.Y., 1987, the
above are incorporated herein by references in its entirety. In general, techniques including,
but not limited to, ammonium sulfate precipitation, centrifugation, ion exchange, reversephase
chromatography, affinity chromatography, hydrophobic interaction chromatography
may be used to further purify the protein.
The yield of the protein of interest from E. coli using pBAD24T7gl 0 vector using the
processes of the invention are in the range of 20 to 35% of the total cellular protein in the
bacterial cell.
The process of obtaining pure protein of interest as described herein further comprises of
forming the pure proteins into a finished dosage form for clinical use.
The biologically active protein obtained by the entire process for the purification and/or
isolation of the present invention is suitable for the preparation of pharmaceutical
composition, which comprises the therapeutically effective amount of biologically active
protein and one or more pharmaceutical excipients and is suitable for clinical use. The
possibility of maintaining the active form of protein in a short purification and isolation
process contributes not only to an improved yield, but also to an improved purity and
effectiveness of the biologically active protein and the pharmaceutical composition
containing it. Suitable pharmaceutically acceptable excipients include but not limited to
suitable diluents, adjuvants and/or carriers and the similar useful in protein therapy.
In yet another embodiment the invention relates to pharmaceutical compositions containing
the proteins obtained according to the present invention. The proteins obtained can either be
stored in the form of a lyophilized powder or in liquid form. It is administered either
subcutaneously or intravenously.
The following examples are provided to further illustrate the present invention but are not
provided to in any way limit the scope of the current invention.
Example -1 : Construction of vector
pBAD24 plasmid was digested with Nhel/EcoRI and ligated with the annealed oligo carrying
T7gl0 sequence elements that has already been digested with the same set of enzymes. This
construction would allow retaining all the MCS present in pBAD24 along with translational
enhancer sequence of T7 phage. To this vector human GCSF gene was cloned as a
EcoRI/Hindlll fragment with an internally created Ndel site that would provide initiation
codon for translation.
Culture used was genetically engineered Escherichia coli K 12 cells transformed with
suitable vector containing gene to synthesize rh-proteins.
Sequence listing of pBAD24T7glO-GCSF (Sequence ID 2)
atcgatgcat aatgtgcctg tcaaatggac gaagcaggga ttctgcaaac cctatgctac
tccgtcaagc cgtcaattgt ctgattcgtt accaattatg acaacttgac ggctacatca
ttcacttttt cttcacaacc ggcacggaac tcgctcgggc tggccccggt gcatttttta
aatacccgcg agaaatagag ttgatcgtca aaaccaacat tgcgaccgac ggtggcgata
ggcatccggg tggtgctcaa aagcagcttc gcctggctga tacgttggtc ctcgcgccag
cttaagacgc taatccctaa ctgctggcgg aaaagatgtg acagacgcga cggcgacaag
caaacatgct gtgcgacgct ggcgatatca aaattgctgt ctgccaggtg atcgctgatg
tactgacaag cctcgcgtac ccgattatcc atcggtggat ggagcgactc gttaatcgct
tccatgcgcc gcagtaacaa ttgctcaagc agatttatcg ccagcagctc cgaatagcgc
ccttcccctt gcccggcgtt aatgatttgc ccaaacaggt cgctgaaatg cggctggtgc
gcttcatccg ggcgaaagaa ccccgtattg gcaaatattg acggccagtt aagccattca
tgccagtagg cgcgcggacg aaagtaaacc cactggtgat accattcgcg agcctccgga
tgacgaccgt agtgatgaat ctctcctggc gggaacagca aaatatcacc cggtcggcaa
acaaattctc gtccctgatt tttcaccacc ccctgaccgc gaatggtgag attgagaata
taacctttca ttcccagcgg tcggtcgata aaaaaatcga gataaccgtt ggcctcaatc
ggcgttaaac ccgccaccag atgggcatta aacgagtatc ccggcagcag gggatcattt
tgcgcttcag ccatactttt catactcccg ccattcagag aagaaaccaa ttgtccatat
tgcatcagac attgccgtca ctgcgtcttt tactggctct tctcgctaac caaaccggta
accccgctta ttaaaagcat tctgtaacaa agcgggacca aagccatgac aaaaacgcgt
aacaaaagtg tctataatca cggcagaaaa gtccacattg attatttgca cggcgtcaca
ctttgctatg ccatagcatt tttatccata agattagcgg atcctacctg acgcttttta
tcgcaactct ctactgtttc tccatacccg tttttttgg
gctagcaataattttgtttaactttaagaggaggaattccatatgacgccattaggtccagcttctagcctgccacagagctt
cttactgaag tgcttagaacaagtgcgcaagatccaaggcgatggtgccgccttacaggaaaagctgtgcgccacctacaagt
tatgccatccggaggagctggtgctgttaggtcactctttaggcattccatgggccccactgtcttcttgcccaagccaggcc
ctgcaactggccggctgtctgtctcagctgcattctggcctgtttctgtatcagggcttactgcaagcgctggagggcatcag
cccagaattaggtccaaccctggacaccttacaactggatgtggccgatttcgcgacgaccatttggcagcagatggaagagc
tgggtatggccccagcgttacagccaacgcagggtgccatgccggcctttgcgagcgcctttcaacgtcgtgcgggtggtgtt
ctggttgcGaqccacctgcaatcttttttagaggtgagctaccgcgtgttacgtcatttagcgcagccgtaaaagcttggct
gttttggcgg
atgagagaag attttcagcc tgatacagat taaatcagaa cgcagaagcg gtctgataaa
acagaatttg cctggcggca gtagcgcggt ggtcccacct gaccccatgc cgaactcaga
agtgaaacgc cgtagcgccg atggtagtgt ggggtctccc catgcgagag tagggaactg
ccaggcatca aataaaacga aaggctcagt cgaaagactg ggcctttcgt tttatctgtt
gtttgtcggt gaacgctctc ctgagtagga caaatccgcc gggagcggat ttgaacgttg
cgaagcaacg gcccggaggg tggcgggcag gacgcccgcc ataaactgcc aggcatcaaa
ttaagcagaa ggccatcctg acggatggcc tttttgcgtt tctacaaact cttttgttta
tttttctaaa tacattcaaa tatgtatccg ctcatgagac aataaccctg ataaatgctt
caataatatt gaaaaaggaa gagtatgagt attcaacatt tccgtgtcgc ccttattccc
ttttttgcgg cattttgcct tcctgttttt gctcacccag aaacgctggt gaaagtaaaa
gatgctgaag atcagttggg tgcacgagtg ggttacatcg aactggatct caacagcggt
aagatccttg agagttttcg ccccgaagaa cgttttccaa tgatgagcac ttttaaagtt
ctgctatgtg gcgcggtatt atcccgtgtt gacgccgggc aagagcaact cggtcgccgc
atacactatt ctcagaatga cttggttgag tactcaccag tcacagaaaa gcatcttacg
gatggcatga cagtaagaga attatgcagt gctgccataa ccatgagtga taacactgcg
gccaacttac ttctgacaac gatcggagga ccgaaggagc taaccgcttt tttgcacaac
atgggggatc atgtaactcg ccttgatcgt tgggaaccgg agctgaatga. agccatacca
aacgacgagc gtgacaccac gatgcctgta gcaatggcaa caacgttgcg caaactatta
actggcgaac tacttactct agcttcccgg caacaattaa tagactggat ggaggcggat
aaag'ttgcag gaccacttct gcgctcggcc cttccggctg gctggtttat tgctgataaa
tctggagccg gtgagcgtgg gtctcgcggt atcattgcag cactggggcc agatggtaag
ccctcccgta tcgtagttat ctacacgacg gggagtcagg caactatgga tgaacgaaat
agacagatcg ctgagatagg tgcctcactg attaagcatt ggtaactgtc agaccaagtt
tactcatata tactttagat tgatttacgc gccctgtagc ggcgcattaa gcgcggcggg
tgtggtggtt acgcgcagcg tgaccgctac acttgccagc gccctagcgc ccgctccttt
cgctttcttc ccttcctttc tcgccacgtt cgccggcttt ccccgtcaag ctctaaatcg
ggggctccct ttagggttcc gatttagtgc tttacggcac ctcgacccca aaaaacttga
tttgggtgat ggttcacgta gtgggccatc gccctgatag acggtttttc gccctttgac
gttggagtcc acgttcttta atagtggact cttgttccaa acttgaacaa cactcaaccc
tatctcgggc tattcttttg atttataagg gattttgccg atttcggcct attggttaaa
aaatgagctg atttaacaaa aatttaacgc gaattttaac aaaatattaa cgtttacaat
ttaaaaggat ctaggtgaag atcctttttg ataatctcat gaccaaaatc ccttaacgtg
agttttcgtt ccactgagcg tcagaccccg tagaaaagat caaaggatct tcttgagatc
ctttttttct gcgcgtaatc tgctgcttgc aaacaaaaaa accaccgcta ccagcggtgg
tttgtttgcc ggatcaagag ctaccaactc tttttccgaa ggtaactggc ttcagcagag
cgcagatacc aaatactgtc cttctagtgt agccgtagtt aggccaccac ttcaagaact
ctgtagcacc gcctacatac ctcgctctgc taatcctgtt accagtggct gctgccagtg
gcgataagtc gtgtcttacc gggttggact caagacgata gttaccggat aaggcgcagc
ggtcgggctg aacggggggt tcgtgcacac agcccagctt ggagcgaacg acctacaccg
aactgagata cctacagcgt gagctatgag aaagcgccac gcttcccgaa gggagaaagg
cggacaggta tccggtaagc ggcagggtcg gaacaggaga gcgcacgagg gagcttccag
ggggaaacgc ctggtatctt tatagtcctg tcgggtttcg ccacctctga cttgagcgtc
gatttttg tg atgctcgtca ggggggcgga gcctatggaa aaacgccagc aacgcggcct
ttttacggtt cctggccttt tgctggcctt ttgctcacat gttctttcct gcgttatccc
ctgattctgt ggataaccgt attaccgcct ttgagtgagc tgataccgct cgccgcagcc
gaacgaccga gcgcagcgag tcagtgagcg aggaagcgga agagcgcctg atgcggtatt
ttctccttac gcatctgtgc ggtatttcac accgcatagg gtcatggctg cgccccgaca
cccgccaaca cccgctgacg cgccctgacg ggcttgtctg ctcccggcat ccgcttacag
acaagctgtg accg tctccg ggagctgcat gtgtcagagg ttttcaccgt catcaccgaa
acgcgcgagg cagcaaggag atggcgccca acagtccccc ggccacgggg cctgccacca
tacccacgcc gaaacaa'gcg ctcatgagcc cgaagtggcg agcccgatct tccccatcgg
tgatgtcggc gatataggcg ccagcaaccg cacctgtggc gccggtgatg ccggccacga
tgcgtccggc gtagaggatc tgctcatgtt tgacagctta tc
Example -2: Fermentation
Different media used for growth and production (expression) of rh-GCSF were.
1) Seed medium was the medium used for initial growth of the culture from the glycerol
stock of it. Seed medium was composed of 1% Tryptone or soy peptone, 0.5% Yeast Extract
1% Sodium chloride suspended in water while pH of this medium falls in the range of 7.2 to
7.4.
2) Fermenter medium used for growth and expression of rh-GCSF at fermenter scale, it is
composed of 1.8% tryptone or soy peptone, 3.6% yeast Extract, 1% (1.5 %) Mannitol, 0.1%
Ammonium chloride, 0.3% Potassium di-hydrogen phosphate, 1.2% di-Sodium hydrogen
phosphate, 0.05% Sodium chloride, 0.05% Magnesium sulphate, 0.00025% zinc and 0.05%
Tween-20.
3) Feed solution used for growth and expression of rh-GCSF at fermenter scale and is
composed of 3.9 % Tryptone or soy peptone ,' 7.8 % Yeast Extract, 20 % mannitol, 0.325%
Ammonium chloride, 0.976% Potassium di-hydrogen phosphate, 4.162% di-Sodium
hydrogen phosphate, 0.162% Sodium chloride, 0.162% Magnesium sulphate. Inducer used
was 20mM L-(+)-arabinose. Fermenter used was Biostat B plus (M/s Sartorius) microbial
fermenter having provision for oxygen enrichment. For maintaining the pH during process
either 30% Phosphoric acid or 12% Ammonia solution was used. Antifoam used was 151 0-
US from Dow corning & was added drop wise as per requirement
Preparation of seed culture: 200ml seed medium, composition as described above was
inoculated with glycerol stock of the culture. Inoculated flask was incubated on rotary shaker
at 37°C, 200 rpm for 16 to 18 hours.
Preparation and inoculation of fermenter medium: 2-liter Fermentation medium in a
fermenter vessel with 5-liter capacity was prepared as follows.
A-Required quantities of salts as described in the fermenter medium were dissolved in 700
ml of water and were added to a transfer flask.
B- Required quantities of yeast extract, tryptone or soy peptone & Tween-20 were mixed and
dissolved in 850ml of water. This solution was prepared in a fermenter vessel.
C- Required quantity of mannitol was dissolved in 200ml of water. This solution was
prepared in a transfer flask.
D- Required quantity of magnesium sulphate was dissolved in 50ml of water
A, B, C & D were sterilized separately at 121°C for 30 minutes in an autoclave, after cooling
all three were mixed aseptically in a fermenter.
Preparation of feed solution:
E-Required quantities of salts as described in the feed solution were dissolved in 200ml of
water
F- Required quantities of Yeast extract and Tryptone or soy peptone were mixed and
dissolved in 280ml of water.
G- Required quantity of Mannitol was dissolved in 250 ml of water.
H- Required quantity of MgS0 4 was dissolved in 50 ml of water.
E, F, G & H were prepared in the separate flasks, sterilized separately at 121°C for 30
minutes in an autoclave and were pooled together to make 800ml feed solution. In addition to
all this, 2.4 g inducer L-(+)-arabinose was dissolved in 20ml of water, filter sterilized & was
added to feed solution.
Filter sterilized ampicillin solution was added to a feed solution as well as to a fermenter
batch medium at concentration of 100 /h. 1. L-(+)-arabinose required for 2 liter of
fermentation media at concentration of 20mM was dissolved in 60ml of water and was filter
sterilized, in a sterile transfer flask. Fermenter with sterilized media was connected to its
control panel; pH and DO probes and feed pumps were checked for their calibration. Initially
agitation was set at 300 rp and was increased to maximum of 800 rpm as to maintain
dissolved oxygen above 30%. Aeration was maintained at Ivvm of air. If required, air was
supplemented with oxygen gas in the proportion set by automatic controller of the instrument
so as to maintain dissolved oxygen above 30%.
Temperature was maintained at 37 °C by PID controller of the instrument. Acid, base and
sterile antifoam solution bottles were connected to respective ports on to a fermenter with the
help of silicon tubing and pumps. pH was maintained at 7.00 by automatic addition of acid or
base with the help of PID controller of the instrument.
To start the fermentation process, 20 ml seed culture was inoculated to a 2-liter fermenter
medium. Batch was monitored for its pH, optical cell density D oo and other process
parameters like temperature, % of dissolved oxygen, agitation, volume of acid, base or feed
consumed, etc at the interval of every one hour. After about 6 to 7 hours of inoculation, when
OD oo of the culture reaches -65, culture was induced with L-(+)-arabinose. A first dose of
0ml stock solution of L-(+)-arabinose was added to growing culture, followed by same dose
at an interval of 1 hour for 6 hours
Volume feed added to fermenter was as follows.
OD oo of culture was gradually increased to 160 over a period 14 to 15 hours. Cell pellet of 2
liter fermented broth was suspended in 800 ml to 1 liter of 10 niM Tris pH 8.0 and was
mixed so as to get uniform mixture of it having initial OD oo between 100 to 50. Suspended
cell pellet was subjected to homogenization.
Homogenization was carried out at a pressure of 800 to 900 bars and was done for 3 to 4
cycles, which was about 20 minutes. The entire operation was done under cooling conditions.
Optical cell density falls in a range of 20 to 30. Cell lysate was chilled to about 5 to 8 °C on
ice for 30 mins.
Chilled cell lysate was subjected to centrifugation at 9000 rp for 30 minutes at 4 °C.
The supernatant obtained is separated and discarded while the pellet fraction i.e. inclusion
bodies are preserved at -20 °C.
While the present invention has been described in terms of its specific embodiments, certain
modifications and equivalents will be apparent to those skilled in the art and are intended to
be included within the scope of the present invention.
CLAIMS
1. A vector pBAD24T7glO having the following sequence in the 5'UTR of the translational
start site, shown in SEQ ID 1,
' GCTAGCAATAATTTTGTTTAACTTTA AGAGGAGGAATTCC ATATG
.
2. A process for the preparation of recombinant protein from E. coli using the
pBAD24T7g 10 vector as claimed in claim 1.
3. The process of claim 2, wherein the process comprising the steps of:
a) inoculating the fermenter with E. coli culture comprising pBAD24T7glO vector
encoding protein of interest;
b) adding suitable production medium in the substrate limiting fed batch mode;
c) inducing the fermentation with an inducer;
d) adding feed solution; and
e) subjecting the cells for cell lysis to obtain inclusion bodies comprising the protein of
interest.
4. The process as claimed in claim 2 or 3, wherein the E. coli host cells are selected from the
group consisting of BL21, ER2566, K12 derivatives such as HB101 , JM109, LE392,
C600, TOP10 and DH5 alpha.
5. The process as claimed in claim 2 or 3, wherein the E. coli host cells are K12 derivatives.
6 . The process as claimed in claim 2 or 3, further comprises obtaining the pure protein of
interest from the inclusion bodies.
7 . The process as claimed in claim 3, wherein the inducer is arabinose.
8. The process as claimed in claim 3, wherein the fermentation is induced with an inducer
when the OD6oo is in the range of about 30 to about 80.
9 . The process as claimed in claim 3, wherein the fermentation is carried out in the presence
of zinc ions.
0. The process as claimed in claims 2 to 9, wherein the protein of interest is GCSF.
. The process as claimed in claims 2 to 9, wherein the batch medium has carbon to nitrogen
ratio from 1 : 0.5 to 1 : 2.
12. The process as claimed in claims 2 to 9, wherein the fed medium has carbon to nitrogen
ratio from : 0.05 to 1 : .
13. The process as claimed in claim 2 to 9, wherein OD oo of the fermentation medium is
about 160 in a period of about 14 to about 15 hours..
| # | Name | Date |
|---|---|---|
| 1 | Other Document [15-09-2016(online)].pdf | 2016-09-15 |
| 2 | Form 13 [15-09-2016(online)].pdf | 2016-09-15 |
| 3 | 1916-MUMNP-2012-FORM 3 [11-04-2018(online)].pdf | 2018-04-11 |
| 4 | 1916-MUMNP-2012-OTHERS [28-06-2018(online)].pdf | 2018-06-28 |
| 5 | 1916-MUMNP-2012-FER_SER_REPLY [28-06-2018(online)].pdf | 2018-06-28 |
| 6 | 1916-MUMNP-2012-CLAIMS [28-06-2018(online)].pdf | 2018-06-28 |
| 7 | 1916-MUMNP-2012-ABSTRACT [28-06-2018(online)].pdf | 2018-06-28 |
| 8 | 1916-MUMNP-2012.pdf | 2018-08-11 |
| 9 | 1916-MUMNP-2012-GENERAL POWER OF ATTORNEY.pdf | 2018-08-11 |
| 10 | 1916-MUMNP-2012-FORM 5.pdf | 2018-08-11 |
| 11 | 1916-MUMNP-2012-FORM 3.pdf | 2018-08-11 |
| 12 | 1916-MUMNP-2012-FORM 2[TITLE PAGE].pdf | 2018-08-11 |
| 13 | 1916-MUMNP-2012-FORM 18(6-1-2014).pdf | 2018-08-11 |
| 14 | 1916-MUMNP-2012-FORM 1.pdf | 2018-08-11 |
| 15 | 1916-MUMNP-2012-FER.pdf | 2018-08-11 |
| 16 | 1916-MUMNP-2012-CORRESPONDENCE.pdf | 2018-08-11 |
| 17 | 1916-MUMNP-2012-CORRESPONDENCE(6-1-2014).pdf | 2018-08-11 |
| 18 | 1916-MUMNP-2012-CLAIMS.pdf | 2018-08-11 |
| 19 | 1916-MUMNP-2012-HearingNoticeLetter.pdf | 2019-02-01 |
| 20 | 1916-MUMNP-2012-FORM-26 [28-02-2019(online)].pdf | 2019-02-28 |
| 21 | 1916-MUMNP-2012-Written submissions and relevant documents (MANDATORY) [16-03-2019(online)].pdf | 2019-03-16 |
| 22 | 1916-MUMNP-2012-Proof of Right (MANDATORY) [16-03-2019(online)].pdf | 2019-03-16 |
| 23 | 1916-MUMNP-2012-PETITION UNDER RULE 137 [16-03-2019(online)].pdf | 2019-03-16 |
| 24 | 1916-MUMNP-2012-PatentCertificate28-06-2019.pdf | 2019-06-28 |
| 25 | 1916-MUMNP-2012-IntimationOfGrant28-06-2019.pdf | 2019-06-28 |
| 26 | 1916-MUMNP-2012-ORIGINAL UR 6(1A) AFFIDAVIT-200319.pdf | 2020-01-15 |
| 27 | 1916-MUMNP-2012-RELEVANT DOCUMENTS [16-01-2020(online)].pdf | 2020-01-16 |
| 28 | 1916-MUMNP-2012-RELEVANT DOCUMENTS [21-09-2022(online)].pdf | 2022-09-21 |
| 29 | 1916-MUMNP-2012-RELEVANT DOCUMENTS [04-08-2023(online)].pdf | 2023-08-04 |
| 1 | 1916searchstrgy_08-02-2018.pdf |