The present invention relates to glucagon-like-1 compounds fused to proteins that havethe effect of extending the in vivo half-life of the peptides. These fusion proteins can beused to treat non-insulin dependent diabetes mellitus as well as a variety of otherconditions.
The present invention relates to glucagon-like peptides
including analogs and derivatives thereof fused to proteins
that have the effect of extending the in vivo half-life of
the peptides. These fusion proteins can be used to treat
non-insulin dependent diabetes mellitus as well as a variety
of other conditions.
Glucagon-Like Peptide 1 (GLP-1) is a 37 amino acid
peptide that is secreted by the L-cells of the intestine in
response to food ingestion. It has been found to stimulate
insulin secretion (insulinotropic action), thereby causing
glucose uptake by cells and decreased serum glucose levels
[see, e.g., Mojsov, S., (1992) Int. J. Peptide Protein
Research, 40:333-343]. However, GLP-1 is poorly active. A
subsequent endogenous cleavage between the 6th and 7th
position produces a more potent biologically active GLP-1(7-
37)OH peptide. Numerous GLP-1 analogs and derivatives are
known and are referred to herein as "GLP-1 compounds."
These GLP-1 analogs include the Exendins which are peptides
found in the venom of the GILA-monster. The Exendins have
sequence homology to native GLP-1 and can bind the GLP-1
receptor and initiate the signal transduction cascade
responsible for the numerous activities that have been
attributed to GLP-1(7-37)OH.
GLP-1 compounds have a variety of physiologically
significant activities. For example, GLP-1 has been shown
to stimulate insulin release, lower glucagon secretion,
inhibit gastric emptying, and enhance glucose utilization.
[Nauck, M.A.. et al. (1993) Diahetologia 36:741-744;
Gutniak, M. , et al. (1992) New England J. of Med. 326:1316-
1322; Nauck, M.A., et al., (1993) J. Clin. Invest. 91:301-
307] .
GLP-1 shows the greatest promise as a treatment for
non-insulin dependent diabetes mellitus (NIDDM). There are
numerous oral drugs on the market to treat the insulin
resistance associated with NIDDM. As the disease
progresses, however, patients must move to treatments that
stimulate the release of insulin and eventually to
treatments that involve injections of insulin. Current
drugs which stimulate the release of insulin, however, can
also cause hypoglycemia as can the actual administration of
insulin. GLP-1 activity, however, is controlled by blood
glucose levels. When levels drop to a certain threshold
level, GLP-1 is not active. Thus, there is no risk of
hypoglycemia associated with treatment involving GLP-1.
However, the usefulness of therapy involving GLP-1
peptides has been limited by their fast clearance and short
half-lives. For example, GLP-1(7-37) has a serum half-life
of only 3 to 5 minutes. GLP-1(7-36) amide has a time action
of about 50 minutes when administered subcutaneously. Even
analogs and derivatives that are resistant to endogenous
protease cleavage, do not have half-lives long enough to
avoid repeated administrations over a 24 hour period. Fast
clearance of a therapeutic agent is inconvenient in cases
where it is desired to maintain a high blood level of the
agent over a prolonged period of time since repeated
administrations will then be necessary. Furthermore, a
long-acting compound is particularly important for diabetic
patients whose past treatment regimen has involved taking
only oral medication. These patients often have an
extremely difficult time transitioning to a regimen that
involves multiple injections of medication.
The present invention overcomes the problems associated
with delivering a compound that has a short plasma half-
life. The compounds of the present invention encompass GLP-
1 compounds fused to another protein with a long circulating
half-life such as the Fc portion of an immunoglobulin or
albumin.
Generally, small therapeutic peptides are difficult to
manipulate because even slight changes in their structure
can affect stability and/or biological activity. This has
been especially true for GLP-1 compounds currently in
development. For example, GLP-1 (7-37)OH has a tendency to
undergo a conformational change from a primarily alpha helix
structure to a primarily beta sheet structure. This beta
sheet form results in aggregated material that is thought to
be inactive. It was, therefore, surprising that
biologically active GLP-1 fusion proteins with increased
half-lives could be developed. This was especially
unexpected given the difficulty of working with GLP-1(7-
37)OH alone and the large size of the fusion partner
relative to the small GLP-1 peptide attached.
Compounds of the present invention include heterologous
fusion proteins comprising a first polypeptide with a N-
terminus and a C-terminus fused to a second polypeptide with
a N-terminus and a C-terminus wherein the first polypeptide
is a GLP-1 compound and the second polypeptide is selected
from the group consisting of
a) human albumin;
b) human albumin analogs; and
c) fragments of human albumin,
and wherein the C-terminus of the first polypeptide is fused
to the N-terminus of the second polypeptide.
Compounds of the present invention also include a
heterologous fusion protein comprising a first
polypeptide with a N-terminus and a C-terminus fused to a
second polypeptide with a N-terminus and a C-terminus
wherein the first polypeptide is a GLP-1 compound and the
second polypeptide is selected from the group consisting of
a) human albumin;
b) human albumin analogs; and
c) fragments of human albumin,
and wherein the C-terminus of the first polypeptide is fused
to the N-terminus of the second polypeptide via a peptide
linker. It is preferred that the peptide linker is selected
from the group consisting of:
a) a glycine rich peptide;
b) a peptide having the sequence [Gly-Gly-Gly-Gly-Ser]n
where n is 1, 2, 3, 4, 5 or 6; and
c) a peptide having the sequence [Gly-Gly-Gly-Gly-
Ser]3.
Additional compounds of the present invention include a
heterologous fusion protein comprising a first polypeptide
with a N-terminus and a C-terminus fused to a second
polypeptide with a N-terminus and a C-terminus wherein the
first polypeptide is a GLP-1 compound and the second
polypeptide is selected from the group consisting of
a) the Fc portion of an immunoglobulin;
b) an analog of the Fc portion of an immunoglobulin;
and
c) fragments of the Fc portion of an immunoglobulin,
and wherein the C-terminus of the first polypeptide is fused
to the N-terminus of the second polypeptide. The GLP-1
compound may be fused to the second polypeptide via a
peptide linker. It is preferable that the peptide linker is
selected from the group consisting of:
a) a glycine rich peptide;
b) a peptide having the sequence [Gly-Gly-Gly-Gly-Ser]n
where n is 1, 2, 3, 4, 5 or 6; and
c) a peptide having the sequence [Gly-Gly-Gly-Gly-Ser]n-
It is generally preferred that the GLP-1 compound that
is part of the heterologous fusion protein have no more than
6 amino acids that are different from the corresponding
amino acid in GLP-1 (7-37)OH, GLP-1(7-36)OH, or Exendin-4.
It is even more preferred that the GLP-1 compound have no
more than 5 amino acids that differ from the corresponding
amino acid in GLP-1(7-37 )OH, GLP-1(7-36)OH, or Exendin-4.
It is most preferred that the GLP-1 compound have no more
than 4, 3, or 2 amino acids that differ from the
corresponding amino acid in GLP-1 (7-37)OH, GLP-1 (7-36)OH, or
Exendin-4. Preferably, a GLP-1 compound that is part of the
heterologous fusion protein has glycine or valine at
position 8.
The present invention also includes polynucleotides
encoding the heterologous fusion protein described herein,
vectors comprising these polynucleotides and host cells
transfected or transformed with the vectors described
herein. Also included is a process for producing a
heterologous fusion protein comprising the steps of
transcribing and translating a polynucleotide described
herein under conditions wherein the heterolgous fusion
protein is expressed in detectable amounts.
The present invention also encompasses a method for
normalizing blood glucose levels in a mammal in need thereof
comprising the administration of a therapeutically effective
amount of a heterologous fusion protein described herein.
The invention is further illustrated with reference to
the following drawings:
Figure 1: IgGl Fc amino acid sequence encompassing the
hinge region, CH2 and CH3 domains.
Figure 2: Human serum albumin amino acid sequence.
Figure 3: A.SDS-PAGE gel and immunoblot of same gel
illustrating the molecular weight of IgGl-Fc and GLP-1-Fc
fusion proteins (Lane 1, MW standards; Lane 2, Purified Fc;
lane 3, Mock transfected media; Lane 4, Val8-GLP-1-Fc; Lane
5, Exendin-4-Fc) B. SDS-PAGE gel and immunoblot of same gel
illustrating the molecular weight of human HSA and GLP-1-HSA
fusion proteins (Lane 1, MW standards; Lane 2, Purified HSA;
lane 3, Mock transfected media; Lane 4, Val8-GLP-1-HSA; Lane
5, Val8-GLP-1-[Gly-Gly-Gly-Gly-Ser]3-HSA; Lane 6, Exendin-4-
HSA; Lane 7, Exendin-4- [Gly-Gly-Gly-Gly-Ser]3-HSA) .
Figure 4: SDS-PAGE gel of purified Fc, albumin, and
GLP-1 fusion proteins (Lane 1, MW standards; Lane 2,
purified Fc; Lane 3, Val8-GLP-1-Fc; Lane 4, Exendin-4-Fc;
Lane 5, MW standard; Lane 6, Val8-GLP-1-HSA; Lane 7,
Exendin-4-HSA; Lane 8, Exendin-4-[Gly-Gly-Gly-Gly-Ser]3-
HSA) .
Figure 5: Expression cloning vector containing the Fc
regions illustrated in figure 1.
Figure 6: Expression cloning vector containing the
albumin sequence illustrated in figure 2.
Figure 7: Expression cloning vector containing DNA
encoding a 15 amino acid linker fused in frame and 5' of the
albumin sequence illustrated in figure 2.
Figure 8: In vitro dose response activity of GLP-1
fusion proteins.
Figure 9: Pharmacokinetics of GLP-1 Fc and HSA fusion
proteins.
Figure 10: Glucodynamic response to Exendin-Fc in two
normal fasted dogs.
Figure 11: Insulinotropic response to Exendin-Fc in two
normal fasted dogs.
Figure 12: DNA sequence encoding a human IgG1 Fc
region.
Figure 13: DNA sequence encoding a human albumin
protein.
The heterologous fusion proteins of the present
invention comprise a GLP-1 compound fused to human albumin,
a human albumin analog, a human albumin fragment, the Fc
portion of an immunoglobulin, an analog of the Fc portion of
an immunoglobulin, or a fragment of the Fc portion of an
immunoglobulin. The C-terminus of the GLP-1 compound may be
fused directly, or fused via a peptide linker, to the N-
terminus of an albumin or Fc protein. These heterologous
fusion proteins are biologically active and have an
increased half-life compared to native GLP-1.
It is preferred that the GLP-1 compounds that make up
part of the heterologous fusion protein encompass
polypeptides having from about twenty-five to about thirty-
nine naturally occurring or non-naturally occurring amino
acids that have sufficient homology to native GLP-1 (7-37)OH
such that they exhibit insulinotropic activity by binding to
the GLP-1 receptor on ß-cells in the pancreas. A GLP-1
compound typically comprises a polypeptide having the amino
acid sequence of GLP-1(7-37)OH, an analog of GLP-1 (7-37)OH,
a fragment of GLP-1(7-37)OH or a fragment of a GLP-1(7-37)OH
analog. GLP-1 (7-37)OH has the amino acid sequence of SEQ ID
NO: 1:
By custom in the art, the amino terminus of GLP-1 (7-
37) OH has been assigned number residue 7 and the carboxy-
terminus, number 37. The other amino acids in the
polypeptide are numbered consecutively, as shown in SEQ
ID NO: 1. For example, position 12 is phenylalanine and
position 22 is glycine.
GLP-1 compounds also encompass "GLP-1 fragments." A
GLP-1 fragment is a polypeptide obtained after truncation of
one or more amino acids from the N-terminus and/or C-
terminus of GLP-1(7-37)OH or an analog or derivative
thereof. The nomenclature used to describe GLP-1(7-37)OH is
also applicable to GLP-1 fragments. For example, GLP-1(9-
36)OH denotes a GLP-1 fragment obtained by truncating two
amino acids from the N-terminus and one amino acid from the
C-terminus. The amino acids in the fragment are denoted by
the same number as the corresponding amino acid in GLP-1(7-
37)OH. For example, the N-terminal glutamic acid in GLP-
1(9-36)OH is at position 9; position 12 is occupied by
phenylalanine; and position 22 is occupied by glycine, as in
GLP-1(7-37)OH. For GLP-1(7-36)OH, the glycine at position 37
of GLP-1(7-37)OH is deleted.
GLP-1 compounds also include polypeptides in which one
or more amino acids have been added to the N-terminus and/or
C-terminus of GLP-1(7-37)OH, or fragments or analogs
thereof. It is preferred that GLP-1 compounds of this type
have up to about thirty-nine amino acids. The amino acids
in the "extended" GLP-1 compound are denoted by the same
number as the corresponding amino acid in GLP-1(7-37)OH.
For example, the N-terminus amino acid of a GLP-1 compound
obtained by adding two amino acids to the N-terminal of GLP-
1(7-37)OH is at position 5; and the C-terminus amino acid of
a GLP-1 compound obtained by adding one amino acid to the C-
terminus of GLP-1(7-37)OH is at position 38. Thus, position
12 is occupied by phenylalanine and position 22 is occupied
by glycine in both of these "extended" GLP-1 compounds, as
in GLP-1(7-37)OH. Amino acids 1-6 of an extended GLP-1
compound are preferably the same as or a conservative
substitution of the amino acid at the corresponding position
of GLP-1(1-37)OH. Amino acids 38-45 of an extended GLP-1
compound are preferably the same as or a conservative
substitution of the amino acid at the corresponding position
of glucagon or Exendin-4.
GLP-1 compounds of the present invention encompass
"GLP-1 analogs." A GLP-1 analog has sufficient homology to
GLP-1(7-37)OH or a fragment of GLP-1(7-37)OH such that the
analog has insulinotropic activity. Preferably, a GLP-1
analog has the amino acid sequence of GLP-1(7-37)OH or a
fragment thereof, modified so that from one, two, three,
four or five amino acids differ from the amino acid in the
corresponding position of GLP-1(7-37)OH or a fragment of
GLP-1(7-37)OH. In the nonmenclature used herein to
designate GLP-1 compounds, the substituting amino acid and
its position is indicated prior to the parent structure.
For example, Glu22-GLP-1(7-37)OH designates a GLP-1 compound
in which the glycine normally found at position 22 of GLP-
1(7-37)OH has been replaced with glutamic acid; Val8-Glu22-
GLP-1(7-37)OH designates a GLP-1 compound in which alanine
normally found at position 8 and glycine normally found at
position 22 of GLP-1 (7-37) OH have been replaced with valine
and glutamic acid, respectively.
GLP-1 compounds of the present invention also include
"GLP-1 derivatives." A GLP-1 derivative is defined as a
molecule having the amino acid sequence of GLP-1 or of a
GLP-1 analog, but additionally having chemical modification
of one or more of its amino acid side groups, a-carbon
atoms, terminal amino group, or terminal carboxylic acid
group. A chemical modification includes, but is not limited
to, adding chemical moieties, creating new bonds, and
removing chemical moieties. Modifications at amino acid
side groups include, without limitation, acylation of lysine
e-amino groups, N-alkylation of arginine, histidine, or
lysine, alkylation of glutamic or aspartic carboxylic acid
groups, and deamidation of glutamine or asparagine.
Modifications of the terminal, amino group include, without
limitation, the des-amino, N-lower alkyl, N-di-lower alkyl,
and N-acyl modifications. Modifications of the terminal
carboxy group include, without limitation, the amide, lower
alkyl amide, dialkyl amide, and lower alkyl ester
modifications. Lower alkyl is C1-C4 alkyl. Furthermore,
one or more side groups, or terminal groups, may be
protected by protective groups known to the ordinarily-
skilled protein chemist. The a-carbon of an amino acid may
be mono- or dimethylated.
Any GLP-1 compound can be part of the heterologous
fusion proteins of the present invention as long as the GLP-
1 compound itself is able to bind and induce signaling
through the GLP-1 receptor. GLP-1 receptor binding and
signal transduction can be assessed using in vitro assays
such as those described in EP 619,322 and U.S. Patent No.
5,120,712, respectively.
Numerous active GLP-1 fragments, analogs and
derivatives are known in the art and any of these analogs
and derivatives can also be part of the heterologous fusion
proteins of the present invention. Some examples of novel
GLP-1 analogs as well as GLP-1 analogs and derivatives known
in the art are provided herein.
Some GLP-1 analogs and GLP-1 fragments known in the art
include, for example, GLP-K7-34) and GLP-1 (7-35) , GLP-M7-
36), Gln9-GLP-1(7-37), D-Gln9-GLP-1(7-37), Thr16-Lys18-GLP-
1(7-37), and Lys18-GLP-1(7-37). GLP-1 analogs such as GLP-
1(7-34) and GLP-1 (7-35) are disclosed in U.S. Patent No.
5,118,666. Biologically processed forms of GLP-1 which have
insulinotropic properties, such as GLP-1(7-36) are also
known. Other known biologically active GLP-1 compounds are
disclosed in U.S. Patent No 5,977,071 to Hoffmann, et al.,
U.S. Patent No. 5,545,618 to Buckley, et al., and Adelhorst,
et al., J. Biol. Chem. 269:6215 (1994).
A preferred group of GLP-1 analogs is composed of
GLP-1 analogs of formula I (SEQ ID NO: 2)
7 8 9 10 11 12 13 14 15 16 17
His-Xaa-Xaa-Gly-Xaa-Phe-Thr-Xaa-Asp-Xaa-Xaa-
18 19 20 21 22 23 24 25 26 27 28
Xaa-Xaa-Xaa-Xaa-Xaa-Xaa-Xaa-Xaa-Xaa-Xaa-Phe-
29 30 31 32 33 34 35 36 37 38 39
Ile-Xaa-Xaa-Xaa-Xaa-Xaa-Xaa-Xaa-Xaa-Xaa-Xaa-
40 41 42 43 44 45
Xaa-Xaa-Xaa-Xaa-Xaa-Xaa
Formula I (SEQ ID NO: 2)
wherein:
Xaa at position 8 is Ala, Gly, Ser, Thr, Leu, Ile, Val,
Glu, Asp, or Lys;
Xaa at position 9 is Glu, Asp, or Lys;
Xaa at position 11 is Thr, Ala, Gly, Ser, Leu, Ile, Val,
Glu, Asp, or Lys;
Xaa at position 14 is Ser, Ala, Gly, Thr, Leu, Ile, Val,
Glu, Asp, or Lys;
Xaa at position 16 is Val, Ala, Gly, Ser, Thr, Leu, Ile,
Tyr, Glu, Asp, Trp, or Lys;
Xaa at position 17 is Ser, Ala, Gly, Thr, Leu, Ile, Val,
Glu, Asp, or Lys;
Xaa at position 18 is Ser, Ala, Gly, Thr, Leu, Ile, Val,
Glu, Asp, Trp, Tyr, or Lys;
Xaa at position 19 is Tyr, Phe, Trp, Glu, Asp, Gln, or Lys;
Xaa at position 20 is Leu, Ala, Gly, Ser, Thr, Ile, Val,
Glu, Asp, Met, Trp, Tyr, or Lys;
Xaa at position 21 is Glu, Asp, or Lys;
Xaa at position 22 is Gly, Ala, Ser, Thr, Leu, Ile, Val,
Glu, Asp, or Lys;
Xaa at position 23 is Gln, Asn, Arg, Glu, Asp, or Lys;
Xaa at position 24 is Ala, Gly, Ser, Thr, Leu, Ile, Val,
Arg, Glu, Asp, or Lys;
Xaa at position 25 is Ala, Gly, Ser, Thr, Leu, Ile, Val,
Glu, Asp, or Lys;
Xaa at position 26 is Lys, Arg, Gln, Glu, Asp, or His;
Xaa at position 27 is Leu, Glu, Asp, or Lys;
Xaa at position 30 is Ala, Gly, Ser, Thr, Leu, Ile, Val,
Glu, Asp, or Lys;
Xaa at position 31 is Trp, Phe, Tyr, Glu, Asp, or Lys;
Xaa at position 32 is Leu, Gly, Ala, Ser, Thr, Ile, Val,
Glu, Asp, or Lys;
Xaa at position 33 is Val, Gly, Ala, Ser, Thr, Leu, Ile,
Glu, Asp, or Lys;
Xaa at position 34 is Asn, Lys, Arg, Glu, Asp, or His;
Xaa at position 35 is Gly, Ala, Ser, Thr, Leu, Ile, Val,
Glu, Asp, or Lys;
Xaa at position 36 is Gly, Arg, Lys, Glu, Asp, or His;
Xaa at position 37 is Pro, Gly, Ala, Ser, Thr, Leu, Ile,
Val, Glu, Asp, or Lys, or is deleted;
Xaa at position 38 is Ser, Arg, Lys, Glu, Asp, or His, or is
deleted;
Xaa at position 39 is Ser, Arg, Lys, Glu, Asp, or His, or is
deleted;
Xaa at position 40 is Gly, Asp, Glu, or Lys, or is deleted;
Xaa at position 41 is Ala, Phe, Trp, Tyr, Glu, Asp, or Lys,
or is deleted;
Xaa at position 42 is Ser, Pro, Lys, Glu, or Asp, or is
deleted;
Xaa at position 43 is Ser, Pro, Glu, Asp, or Lys, or is
deleted;
Xaa at position 44 is Gly, Pro, Glu, Asp, or Lys, or is
deleted;
and
Xaa at position 45 is Ala, Ser, Val, Glu, Asp, or Lys, or is
deleted;
provided that when the amino acid at position 37, 38,
39, 40, 41, 42, 43, or 44 is deleted, then each amino acid
downstream of that amino acid is also deleted.
It is preferred that the GLP-1 compound of formula I
contain less than six amino acids that differ from the
corresponding amino acid in GLP-1(7-37)OH or Exendin-4. It
is more preferred that less than five amino acids differ
from the corresponding amino acid in GLP-1(7-37)OH or
Exendin-4. It is even more preferred that less than four
amino acids differ from the corresponding amino acid in GLP-
1(7-37)OH or Exendin-4.
GLP-1 compounds of the present invention include
derivatives of formula I such as a C-1-6-ester, or amide, or
C-1-6-alkylamide, or C-1-6-dialkylamide thereof. WO99/43706
describes derivatives of GLP-1 compounds of formula I and is
incorporated by reference herein in its entirety. The
compounds of formula I derivatized as described in
WO99/43706 and underivatized are encompassed by the present
invention.
Another preferred group of GLP-1 compounds is composed
of GLP-1 analogs of formula II (SEQ ID NO: 3):
7 8 9 10 11 12 13 14 15 16 17
Xaa-Xaa-Xaa-Gly-Xaa-Xaa-Thr-Ser-Asp-Xaa-Ser-
18 19 20 21 22 23 24 25 26 27 28
Xaa-Tyr-Leu-Glu-Xaa-Xaa-Xaa-Ala-Xaa-Xaa-Phe-
29 30 31 32 33 34 35 36 37
Ile-Xaa-Xaa-Leu-Xaa-Xaa-Xaa-Xaa-R
Formula II (SEQ ID NO: 3)
wherein:
Xaa at position 7 is: L-histidine, D-histidine, desamino-
histidine, 2-amino-histidine, ß-hydroxy-histidine,
homohistidine, a-fluoromethyl-histidine or a-methyl-
histidine;
Xaa at position 8 is: Gly, Ala, Val, Leu, Ile, Ser, or Thr;
Xaa at position 9 is: Thr, Ser, Arg, Lys, Trp, Phe, Tyr,
Glu, or His;
Xaa at position 11 is: Asp, Glu, Arg, Thr, Ala, Lys, or His;
Xaa at position 12 is: His, Trp, Phe, or Tyr;
Xaa at position 16 is: Leu, Ser, Thr, Trp, His, Phe, Asp,
Val, Tyr, Glu, or Ala;
Xaa at position 18 is: His, Pro, Asp, Glu, Arg, Ser, Ala, or
Lys;
Xaa at position 22 is: Gly, Asp, Glu, Gin, Asn, Lys, Arg, or
Cys;
Xaa at position 23 is: His, Asp, Lys, Glu, Gln, or Arg;
Xaa at position 24 is: Glu, Arg, Ala, or Lys;
Xaa at position 26 is: Trp, Tyr, Phe, Asp, Lys, Glu, or His;
Xaa at position 27 is: Ala, Glu, His, Phe, Tyr, Trp, Arg, or
Lys;
Xaa at position 30 is: Ala, Glu, Asp, Ser, or His;
Xaa at position 31 is: Asp, Glu, Ser, Thr, Arg, Trp, or Lys;
Xaa at position 33 is: Asp, Arg, Val, Lys, Ala, Gly, or Glu;
Xaa at position 34 is: Glu, Lys, or Asp;
Xaa at position 35 is: Thr, Ser, Lys, Arg, Trp, Tyr, Phe,
Asp, Gly, Pro, His, or Glu;
Xaa at position 36 is: Thr, Ser, Asp, Trp, Tyr, Phe, Arg,
Glu, or His;
R at position 37 is: Lys, Arg, Thr, Ser, Glu, Asp, Trp, Tyr,
Phe, His, Gly, Gly-Pro, or is deleted.
Another preferred group of GLP-1 compounds is composed
of GLP-1 analogs of formula III (SEQ ID NO: 4):
7 8 9 10 11 12 13 14 15 16 17
Xaa-Xaa-Glu-Gly-Xaa-Xaa-Thr-Ser-Asp-Xaa-Ser-
18 19 20 21 22 23 24 25 26 27 28
Ser-Tyr-Leu-Glu-Xaa-Xaa-Xaa-Xaa-Lys-Xaa-Phe-
29 30 31 32 33 34 35 36 37
Ile-Xaa-Trp-Leu-Xaa-Xaa-Xaa-Xaa-R
formula III (SEQ ID NO: 4)
wherein:
Xaa at position 7 is: L-histidine, D-histidine, desamino-
histidine, 2-amino-histidine, ß-hydroxy-histidine,
homohistidine, a-fluoromethyl-histidine or a-methyl-
histidine;
Xaa at position 8 is: Gly, Ala, Val, Leu, Ile, Ser, or Thr;
Xaa at position 11 is: Asp, Glu, Arg, Thr, Ala, Lys, or His;
Xaa at position 12 is: His, Trp, Phe, or Tyr;
Xaa at position 16 is: Leu, Ser, Thr, Trp, His, Phe, Asp,
Val, Glu, or Ala;
Xaa at position 22: Gly, Asp, Glu, Gln, Asn, Lys, Arg, or
Cys;
Xaa at position 23 is: His, Asp, Lys, Glu, or Gln;
Xaa at position 24 is: Glu, His, Ala, or Lys;
Xaa at position 25 is: Asp, Lys, Glu, or His;
Xaa at position 27 is: Ala, Glu, His, Phe, Tyr, Trp, Arg, or
Lys;
Xaa at position 30 is: Ala, Glu, Asp, Ser, or His;
Xaa at position 33 is: Asp, Arg, Val, Lys, Ala, Gly, or Glu;
Xaa at position 34 is: Glu, Lys, or Asp;
Xaa at position 35 is: Thr, Ser, Lys, Arg, Trp, Tyr, Phe,
Asp, Gly, Pro, His, or Glu;
Xaa at position 36 is: Arg, Glu, or His;
R at position 37 is: Lys, Arg, Thr, Ser, Glu, Asp, Trp, Tyr,
Phe, His, Gly, Gly-Pro, or is deleted.
Another preferred group of GLP-1 compounds is composed
of GLP-1 analogs of formula IV (SEQ ID NO: 5) :
7 8 9 10 11 12 13 14 15 16 17
Xaa-Xaa-Glu-Gly-Thr-Xaa-Thr-Ser-Asp-Xaa-Ser-
18 19 20 21 22 23 24 25 26 27 28
Ser-Tyr-Leu-Glu-Xaa-Xaa-Ala-Ala-Xaa-Glu-Phe-
29 30 31 32 33 34 35 36 37
Ile-Xaa-Trp-Leu-Val-Lys-Xaa-Arg-R
formula IV (SEQ ID NO: 5)
wherein:
Xaa at position 7 is: L-histidine, D-histidine, desamino-
histidine, 2-amino-histidine, ß-hydroxy-histidine,
homohistidine, a-fluoromethyl-histidine or a-methyl-
histidine;
Xaa at position 8 is: Gly, Ala, Val, Leu, Ile, Ser, Met, or
Thr;
Xaa at position 12 is: His, Trp, Phe, or Tyr;
Xaa at position 16 is: Leu, Ser, Thr, Trp, His, Phe, Asp,
Val, Glu, or Ala;
Xaa at position 22 is: Gly, Asp, Glu, Gln, Asn, Lys, Arg, or
Cys;
Xaa at position 23 is: His, Asp, Lys, Glu, or Gln;
Xaa at position 26 is: Asp, Lys, Glu, or His;
Xaa at position 30 is: Ala, Glu, Asp, Ser, or His;
Xaa at position 35 is: Thr, Ser, Lys, Arg, Trp, Tyr, Phe,
Asp, Gly, Pro, His, or Glu;
R at position 37 is: Lys, Arg, Thr, Ser, Glu, Asp, Trp, Tyr,
Phe, His, Gly, Gly-Pro, or is deleted.
Another preferred group of GLP-1 compounds is composed
of GLP-1 analogs of formula V (SEQ ID NO: 6) :
7 8 9 10 11 12 13 14 15 16 17
Xaa-Xaa-Glu-Gly-Thr-Phe-Thr-Ser-Asp-Val-Ser-
18 19 20 21 22 23 24 25 26 27 28
Ser-Tyr-Leu-Glu-Xaa-Xaa-Xaa-Ala-Lys-Glu-Phe-
29 30 31 32 33 34 35 36 37
Ile-Xaa-Trp-Leu-Val-Lys-Gly-Arg-R
formula V (SEQ ID NO: 6)
wherein:
Xaa at position 7 is: L-histidine, D-histidine, desamino-
histidine, 2-amino-histidine, ß-hydroxy-histidine,
homohistidine, a-fluoromethyl-histidine or a-methyl-
histidine;
Xaa at position 8 is: Gly, Ala, Val, Leu, Ile, Ser, or Thr;
Xaa at position 22 is: Gly, Asp, Glu, Gln, Asn, Lys, Arg, or
Cys;
Xaa at position 23 is: His, Asp, Lys, Glu, or Gln;
Xaa at position 24 is: Ala, Glu, His, Phe, Tyr, Trp, Arg, or
Lys ;
Xaa at position 30 is: Ala, Glu, Asp, Ser, or His;
R at position 37 is: Lys, Arg, Thr, Ser, Glu, Asp, Trp, Tyr,
Phe, His, Gly, Gly-Pro, or is deleted.
Preferred GLP-1 compounds of formula I, II, III, IV,
and V comprise GLP-1 analogs or fragments of GLP-1 analogs
wherein the analogs or fragments contain an amino acid other
than alanine at position 8 (position 8 analogs). It is
preferable that these position 8 analogs contain one or more
additional changes at positions 9, 11/ 12, 16, 18, 22, 23,
24, 26, 27, 30, 31, 33, 34, 35, 36, and 37 compared to the
corresponding amino acid of native GLP-1(7-37)OH. It is
also preferable that these analogs have 6 or fewer changes
compared to the corresponding amino acids in native GLP-1(7-
37)OH or GLP-1(7-36)OH. More preferred analogs have 5 or
fewer changes compared to the corresponding amino acids in
native GLP-1(7-37)OH or GLP-1(7-36)OH or have 4 or fewer
changes compared to the corresponding amino acids in native
GLP-1(7-37)OH or GLP-1(7-36)OH. It is even more preferable
that these analogs have 3 or fewer changes compared to the
corresponding amino acids in native GLP-1 (7-37)OH or GLP-
1(7-36)OH. It is most preferable that these analogs have 2
or fewer changes compared to the corresponding amino acids
in native GLP-1(7-37)OH.
It has been found that the compounds of formula II,
III, IV, and V have a reduced propensity to aggregate and
generate insoluble forms. This is also important in the
context of a fusion protein wherein the relatively small
GLP-1 peptide must maintain an active conformation despite
being fused to a much larger protein. Preferred GLP-1
compounds of formula II, III, IV, and V encompassed by the
fusion proteins of the present invention comprise GLP-1
analogs or fragments of GLP-1 analogs in which glycine at
position 22 and preferably alanine at position 8 have been
replaced with another amino acid.
When position 22 is aspartic acid, glutamic acid,
arginine or lysine, position 8 is preferably glycine,
valine, leucine, isolecine, serine, threonine or methionine
and more preferably valine or glycine. When position 22 is
a sulfonic acid such as cysteic acid, position 8 is
preferably glycine, valine, leucine, isolecine, serine,
threonine or methionine and more preferably valine or
glycine.
Other preferred GLP-1 compounds include GLP-1 analogs
of formula IV (SEQ ID NO:5) wherein the analogs have the
sequence of GLP-1 (7-37)OH except that the amino acid at
position 8 is preferably glycine, valine, leucine,
isoleucine, serine, threonine, or methionine and more
preferably valine or glycine and position 30 is glutamic
acid, aspartic acid, serine, or histidine and more
preferably glutamatic acid.
Other preferred GLP-1 compounds include GLP-1 analogs
of formula TV (SEQ ID NO:5) wherein the analogs have the
sequence of GLP-1 (7-37)OH except that the amino acid at
position 8 is preferably glycine, valine, leucine,
isoleucine, serine, threonine, or methionine and more
preferably valine or glycine and position 37 is histidine,
lysine, arginine, threonine, serine, glutamic acid, aspartic
acid, tryptophan, tyrosine, phenylalanine and more
preferably histidine.
Other preferred GLP-1 compounds include GLP-1 analogs
of formula IV (SEQ ID NO:5) wherein the analogs have the
sequence of GLP-1(7-37)OH except that the amino acid at
position 8 is preferably glycine, valine, leucine,
isoleucine, serine, threonine, or methionine and more
preferably valine or glycine and position 22 is glutamic
acid, lysine, aspartic acid, or arginine and more preferably
glutamic acid or lysine and position 23 is lysine, arginine,
glutamic acid, aspartic acid, and histidine and more
preferably lysine or glutamic acid.
Other preferred GLP-1 compounds include GLP-1 analogs
of formula V (SEQ ID NO:6) wherein the analogs have the
sequence of GLP-1 (7-37)OH except that the amino acid at
position 8 is preferably glycine, valine, leucine,
isoleucine, serine, threonine, or methionine and more
preferably valine or glycine and position 22 is glutamic
acid, lysine, aspartic acid, or arginine and more preferably
glutamine acid or lysine and position 27 is alanine, lysine,
arginine, tryptophan, tyrosine, phenylalanine, or histidine
and more preferably alanine.
Other preferred GLP-1 compounds include GLP-1 analogs
of formula II wherein the analogs have the sequence of GLP-
1(7-37)OH except that the amino acid at position 8 and one,
two, or three amino acids selected from the group consisting
of position 9, position 11, position 12, position 16,
position 18, position 22, position 23, position 24, position
26, position 27, position 30, position 31, position 33,
position 34, position 35, position 36, and position 37,
differ from the amino acid at the corresponding position of
native GLP-1(7-37)OH.
Other preferred GLP-1 compounds of formula II include:
Val8-GLP-1(7-37)OH, Gly8-GLP-1(7-37)OH, Glu22-GLP-1(7-37)OH,
Asp22-GLP-1(7-37)OH, Arg22-GLP-1(7-37)OH, Lys22-GLP-1(7-
37)OH, Cys22-GLP-1(7-37)OH, Val8-Glu22-GLP-1(7-37)0H, Val8-
Asp22-GLP-1(7-37)OH, Val8-Arg22-GLP-1(7-37)OH, Val8-Lys22-
GLP-1(7-37)OH, Val8-Cys22-GLP-1(7-37)OH, Gly8-Glu22-GLP-1(7-
37)OH, Gly8-Asp22-GLP-1(7-37)OH, Gly8-Arg22-GLP-1(7-37)OH,
Gly8-Lys22-GLP-1(7-37)OH, Gly8-Cys22-GLP-1(7-37)OH, Glu22-
GLP-1(7-36)OH, Asp22-GLP-1(7-36)OH, Arg22-GLP-1(7-36)OH,
Lys22-GLP-1(7-36)OH, Cys22-GLP-1(7-36)OH, Val8-Glu22-GLP-
1(7-36)OH, Val8-Asp22-GLP-1(7-36)OH, Val8-Arg22-GLP-1(7-
36)OH, Val8-Lys22-GLP-1(7-36)OH, Val8-Cys22-GLP-1(7-36)OH,
Gly8-Glu22-GLP-1(7-36)OH, Gly8-Asp22-GLP-1(7-36)OH, Gly8-
Arg22-GLP-1(7-36)OH, Gly8-Lys22-GLP-1(7-36)OH, Gly8-Cys22-
GLP-1(7-36)OH, Lys23-GLP-1(7-37)OH, Val8-Lys23-GLP-1(7-
37)OH, Gly8-Lys23-GLP-1(7-37)OH, His24-GLP-1(7-37)OH, Val8-
His24-GLP-1(7-37)OH, Gly8-His24-GLP-1(7-37)OH, Lys24-GLP-
1(7-37)OH, Val8-Lys24-GLP-1(7-37)OH, Gly8-Lys23-GLP-1(7-
37)OH, Glu30-GLP-1(7-37)OH, Val8-Glu30-GLP-1(7-37)OH, Gly8-
Glu30-GLP-1(7-37)OH, Asp30-GLP-1(7-37)OH, Val8-Asp30-GLP-
1(7-37)OH, Gly8-Asp30_GLP-1(7-37)OH, Gln30_GLP-1(7-37)OH,
Val8-Gln30-GLP-1(7-37)OH, Gly8-Gln30-GLP-1(7-37)OH, Tyr30-
GLP-1(7-37)OH, Val8-Tyr30-GLP-1(7-37)OH, Gly8-Tyr30-GLP-1(7-
37)OH, Ser30-GLP-1(7-37)OH, Val8-Ser30-GLP-1(7-37)OH, Gly8-
Ser30-GLP-1(7-37)OH, His30-GLP-1(7-37)0H, Val8-His30-GLP-
1(7-37)OH, Gly8-His30-GLP-1(7-37)OH, Glu34-GLP-1(7-37)OH,
Val8-Glu34-GLP-1(7-37)OH, Gly8-Glu34-GLP-1(7-37)OH, Ala34-
GLP-1(7-37)OH, Val8-Ala34-GLP-1(7-37)OH, Gly8-Ala34-GLP-1(7-
37)OH, Gly34-GLP-1(7-37)OH, Val8-Gly34-GLP-1(7-37)OH, Gly8-
Gly34-GLP-1(7-37)OH, Ala35-GLP-1(7-37)OH, Val8-Ala35-GLP-
1(7-37)OH, Gly8-Ala35-GLP-1(7-37)OH, Lys35-GLP-1(7-37)OH,
Val8-Lys35-GLP-1(7-37)OH, Gly8-Lys35-GLP-1(7-37)OH, His35-
GLP-1(7-37)OH Val8-His35-GLP-1(7-37)OH, Gly8-His35-GLP-1(7-
37)OH, Pro35-GLP-1(7-37)OH, Val8-Pro35-GLP-1(7-37)OH, Gly8-
Pro35-GLP-1(7-37)OH, Glu35-GLP-1(7-37)OH Val8-Glu35-GLP-1(7-
37)OH, Gly8-Glu35-GLP-1(7-37)OH, Val8-Ala27-GLP-1(7-37)OH,
Val8-His37-GLP-1(7-37)OH, Val8-Glu22-Lys23-GLP-1(7-37)OH,
Val8-Glu22-Glu23-GLP-1(7-37)OH, Val8-Glu22-Ala27-GLP-1(7-
37)OH, Val8-Gly34-Lys35-GLP-1(7-37)OH, Val8-His37-GLP-1(7-
37)OH, Gly8-His37-GLP-1(7-37)OH, Val8-Glu22-Ala27-GLP-1(7-
37)OH, Gly8-Glu22-Ala27_GLP-1(7-37)OH, Val8-Lys22-Glu23-GLP-
1(7-37)OH, and Gly8-Lys22-Glu23-GLP-1(7-37)OH.
Another preferred group of GLP-1 analogs and
derivatives for use in the present invention is composed of
molecules of formula VI (SEQ ID NO: 7)
R1-X-Glu-Gly10-Thr-Phe-Thr-Ser-Asp15-Val-Ser-
Ser-Tyr-Leu20-Y-Gly-Gln-Ala-Ala25-Lys- Z -
Phe-Ile-Ala30-Trp-Leu-Val-Lys-Gly35-Arg-R2
formula VI (SEQ ID NO:7)
wherein: R1 is selected from the group consisting of L-
histidine, D-histidine, desamino-histidine, 2-amino-
histidine, ß-hydroxy-histidine, homohistidine, alpha-
fluoromethyl-histidine, and alpha-methyl-histidine; X is
selected from the group consisting of Ala, Gly, Val, Thr,
Ile, and alpha-methyl-Ala; Y is selected from the group
consisting of Glu, Gln, Ala, Thr, Ser, and Gly; Z is
selected from the group consisting of Glu, Gln, Ala, Thr,
Ser, and Gly; and R2 is Gly-OH.
Another preferred group of GLP-1 compounds for use
in the present invention is disclosed in WO 91/11457, and
consists essentially of GLP-1(7-34), GLP-1(7-35), GLP-1(7-
36), or GLP-1 (7-37), or the amide form thereof, and
pharmaceutically-acceptable salts thereof, having at least
one modification selected from the group consisting of:
(a) substitution of glycine, serine, cysteine,
threonine, asparagine, glutamine, tyrosine, alanine, valine,
isoleucine, leucine, methionine, phenylalanine, arginine, or
D-lysine for lysine at position 26 and/or position 34; or
substitution of glycine, serine, cysteine, threonine,
asparagine, glutamine, tyrosine, alanine, valine,
isoleucine, leucine, methionine, phenylalanine, lysine, or a
D-arginine for arginine at position 36;
(b) substitution of an oxidation-resistant amino
acid for tryptophan at position 31;
(c) substitution of at least one of: tyrosine for
valine at position 16; lysine for serine at position 18;
aspartic acid for glutamic acid at position 21; serine for
glycine at position 22; arginine for glutamine at position
23; arginine for alanine at position 24; and glutamine for
lysine at position 26; and
(d) substitution of at least one of: glycine,
serine, or cysteine for alanine at position 8; aspartic
acid, glycine, serine, cysteine, threonine, asparagine,
glutamine, tyrosine, alanine, valine, isoleucine, leucine,
methionine, or phenylalanin.e for glutamic acid at position
9; serine, cysteine, threonine, asparagine, glutamine,
tyrosine, alanine, valine, isoleucine, leucine, methionine,
or phenylalanine for glycine at position 10; and glutamic
acid for aspartic acid at position 15; and
(e) substitution of glycine, serine, cysteine,
threonine, asparagine, glutamine, tyrosine, alanine, valine,
isoleucine; leucine, methionine. or phenylalanine, or the D-
or N-acylated or alkylated form of histidine for histidine
at position 7; wherein, in the substitutions is (a), (b) ,
(d), and (e), the substituted amino acids can optionally be
in the D-form and the amino acids substituted at position 7
can optionally be in the N-acylated or N-alkylated form.
Because the enzyme, dipeptidyl-peptidase IV (DPP IV),
may be responsible for the observed rapid in vivo
inactivation of administered GLP-1, [see, e.g., Mentlein,
R., et al., Eur. J. Biochem., 214:829-835 (1993)], GLP-1
analogs and derivatives that are protected from the activity
of DPP IV in the context of a fusion protein are preferred,
and fusion proteins wherein the GLP-1 compound is Gly8-GLP-
1(7-37)OH, Val8-GLP-1(7-37)OH, a-methyl-Ala8-GLP-1(7-37)OH,
or Gly8-Gln21-GLP-1(7-37)OH are more preferred.
Another preferred group of GLP-1 compounds for use in
the present invention consists of the compounds of formula
VII (SEQ ID NO: 8) claimed in U.S. Patent No. 5,512,549,
which is expressly incorporated herein by reference.
wherein R1 is selected from the group consisting of 4-
imidazopropionyl, 4-imidazoacetyl, or 4-imidazo-
a, a dimethyl-ace tyl; R2 is selected from the group
consisting of C6-C10 unbranched acyl, or is absent; R3 is
selected from the group consisting of Gly-OH or NH2; and,
Xaa is Lys or Arg.
More preferred compounds of formula IV for use in the
present invention are those in which Xaa is Arg and R2 is
C6-C10 unbranched acyl. Even more preferred compounds of
formula IV for use in the present invention are those in
which Xaa is Arg, R2 is C6-C10 unbranched acyl, and R3 is
Gly-OH. Other highly-preferred compounds of formula IV for
use in the present invention are those in which Xaa is Arg,
R2 is C6-C10 unbranched acyl, R3 is Gly-OH, and R1 is 4-
imidazopropionyl. An especially preferred compound of
formula TV for use in the present invention is that in which
Xaa is Arg, R2 is C8 unbranched acyl, R3 is Gly-OH, and R1
is 4-imidazopropionyl.
Preferably, the GLP-1 compounds comprise GLP-1 analogs
wherein the backbone for such analogs or fragments contains
an amino acid other than alanine at position 8 (position 8
analogs). The backbone may also include L-histidine, D-
histidine, or modified forms of histidine such as desamino-
histidine, 2-amino-histidine, ß-hydroxy-histidine,
homohistidine, a-fluoromethyl-histidine, or a-methyl-
histidine at position 7. It is preferable that these
position 8 analogs contain one or more additional changes at
positions 12, 16, 18, 19, 20, 22, 25, 27, 30, 33, and 37
compared to the corresponding amino acid of native GLP-1(7-
37)OH. It is more preferable that these position 8 analogs
contain one or more additional changes at positions 16, 18,
22, 25 and 33 compared to the corresponding amino acid of
native GLP-1(7-37)OH.
In a preferred embodiment, the GLP-1 analog is GLP-1(7-
37)OH wherein the amino acid at position 12 is selected from
the group consisting of tryptophan or tyrosine. It is more
preferred that in addition to the substitution at position
12, the amino acid at position 8 is substituted with
glycine, valine, leucine, isoleucine, serine, threonine, or
methionine and more preferably valine or glycine. It is
even more preferred that in addition to the substitutions at
position 12 and 8, the amino acid at position 22 is
substituted with glutamic acid.
In another preferred embodiment, the GLP-1 analog is
GLP-1(7-37)OH wherein the amino acid at position 16 is
selected from the group consisting of tryptophan,
isoleucine, leucine, phenylalanine, or tyrosine. It is more
preferred that in addition to the substitution at position
16, the amino acid at position 8 is substituted with
glycine, valine, leucine, isoleucine, serine, threonine, or
methionine and more preferably valine or glycine. It is
even more preferred that in addition to the substitutions at
position 16 and 8, the amino acid at position 22 is
substituted with glutamic acid. It is also preferred that
in addition to the substitutions at positions 16 and 8, the
amino acid at position 30 is substituted with glutamic acid.
It is also preferred that in addition to the substitutions
at positions 16 and 8, the amino acid at position 37 is
substituted with histidine.
In another preferred embodiment, the GLP-1 analog is
GLP-1(7-37)OH wherein the amino acid at position 18 is
selected from the group consisting of tryptophan, tyrosine,
phenylalanine, lysine, leucine, or isoleucine, preferably
tryptophan, tyrosine, and isoleucine. It is more preferred
that in addition to the substitution at position 18, the
amino acid at position 8 is substituted with glycine,
valine, leucine, isoleucine, serine, threonine, or
methionine and more preferably valine or glycine. It is
even more preferred that in addition to the substitutions at
position 18 and 8, the amino acid at position 22 is
substituted with glutamic acid. It is also preferred that
in addition to the substitutions at positions 18 and 8, the
amino acid at position 30 is substituted with glutamic acid.
It is also preferred that in addition to the substitutions
at positions 18 and 8, the amino acid at position 37 is
substituted with histidine
In another preferred embodiment, the GLP-1 analog is
GLP-1(7-37)OH wherein the amino acid at position 19 is
selected from the group consisting of tryptophan or
phenylalanine, preferably tryptophan. It is more preferred
that in addition to the substitution at position 19, the
amino acid at position 8 is substituted with glycine,
valine, leucine, isoleucine, serine, threonine, or
methionine and more preferably valine or glycine. It is
even more preferred that in addition to the substitutions at
position 19 and 8, the amino acid at position 22 is
substituted with glutamic acid. It is also preferred that
in addition to the substitutions at positions 19 and 8, the
amino acid at position 30 is substituted with glutamic acid.
It is also preferred that in addition to the substitutions
at positions 19 and 8, the amino acid at position 37 is
substituted with histidine
In another preferred embodiment, the GLP-1 analog is
GLP-1(7-37)OH wherein the amino acid at position 20 is
phenylalanine, tyrosine, or tryptophan. It is more
preferred that in addition to the substitution at position
20, the amino acid at position 8 is substituted with
glycine, valine, leucine, isoleucine, serine, threonine, or
methionine and more preferably valine or glycine. It is
even more preferred that in addition to the substitutions at
position 20 and 8, the amino acid at position 22 is
substituted with glutamic acid. It is also preferred that
in addition to the substitutions at positions 20 and 8, the
amino acid at position 30 is substituted with glutamic acid.
It is also preferred that in addition to the substitutions
at positions 20 and 8, the amino acid at position 37 is
substituted with histidine
In another preferred embodiment, the GLP-1 analog is
GLP-1(7-37)OH wherein the amino acid at position 25 is
selected from the group consisting of valine, isoleucine,
and leucine, preferably valine. It is more preferred that
in addition to the substitution at position 25, the amino
acid at position 8 is substituted with glycine, valine,
leucine, isoleucine, serine, threonine, or methionine and
more preferably valine or glycine. It is even more
preferred that in addition to the substitutions at position
25 and 8, the amino acid at position 22 is substituted with
glutamic acid. It is also preferred that in addition to the
substitutions at positions 25 and 8, the amino acid at
position 30 is substituted with glutamic acid. It is also
preferred that in addition to the substitutions at positions
25 and 8, the amino acid at position 37 is substituted with
histidine.
In another preferred embodiment, the GLP-1 analog is
GLP-1(7-37)OH wherein the amino acid at position 27 is
selected from the group consisting of isoleucine or alanine.
It is more preferred that in addition to the substitution at
position 27, the amino acid at position 8 is substituted
with glycine, valine, leucine, isoleucine, serine,
threonine, or methionine and more preferably valine or
glycine. It is even more preferred that in addition to the
substitutions at position 27 and 8, the amino acid at
position 22 is substituted with glutamic acid. It is also
preferred that in addition to the substitutions at positions
27 and 8, the amino acid at position 30 is substituted with
glutamic acid. It is also preferred that in addition to the
substitutions at positions 27 and 8, the amino acid at
position 37 is substituted with histidine
In another preferred embodiment, the GLP-1 analog is
GLP-1(7-37)OH wherein the amino acid at position 33 is
isoleucine. It is more preferred that in addition to the
substitution at position 33, the amino acid at position 8 is
substituted with glycine, valine, leucine, isoleucine,
serine, threonine, or methionine and more preferably valine
or glycine. It is even more preferred that in addition to
the substitutions at position 33 and 8, the amino acid at
position 22 is substituted with glutamic acid. It is also
preferred that in addition to the substitutions at positions
33 and 8, the amino acid at position 30 is substituted with
glutamic acid. It is also preferred that in addition to the
substitutions at positions 33 and 8, the amino acid at
position 37 is substituted with histidine
The GLP-1 compounds have modifications at one or more
of the following positions: 8, 12, 16, 18, 19, 20, 22, 25,
27, 30, 33, and 37. These GLP-1 compounds show increased
potency compared with GLP-1(7-37)OH and comprise the amino
acid sequence of formula IX (SEQ ID NO:12)
Xaa7-Xaa8-Glu-Gly-Thr-Xaa12-Thr-Ser-Asp-Xaa16-Ser-
Xaa18-Xaa19-Xaa20-Glu-Xaa22-Gln-Ala-Xaa25-Lys-Xaa27-
Phe-Ile-Xaa30-Trp-Leu-Xaa33-Lys-Gly-Arg-Xaa37
Formula IX (SEQ ID NO: 12)
wherein:
Xaa7 is: L-histidine, D-histidine, desamino-histidine, 2-
amino-histidine, ß-hydroxy-histidine,
homohistidine, a-fluoromethyl-histidine, or a-
methyl-histidine;
Xaa8 is: Ala, Gly, Val, Leu, Ile, Ser, or Thr;
Xaa12 is: Phe, Trp, or Tyr;
Xaa16 is: Val, Trp, Ile, Leu, Phe, or Tyr;
Xaa18 is: Ser, Trp, Tyr, Phe, Lys, Ile, Leu, Val;
Xaa19 is: Tyr, Trp, or Phe;
Xaa20 is: Leu, Phe, Tyr, or Trp;
Xaa22 is: Gly, Glu, Asp, or Lys;
Xaa25 is: Ala, Val, Ile, or Leu;
Xaa27 is: Glu, Ile, or Ala;
Xaa30 is: Ala or Glu
Xaa33 is: Val, or He; and
Xaa37 is: Gly, His, NH2, or is absent.
Some preferred GLP-1 compounds of formula IX include
GLP-1(7-37)OH, GLP-1(7-36)-NH2, Gly8-GLP-1(7-37)OH, Gly8-GLP-
1(7-36)NH2, Val8-GLP-1(7-37)OH, Val8-GLP-1 (7-36)NH2, Leu8-
GLP-1(7-37)OH, Leu8-GLP-1(7-36)NH2, Ile8-GLP-1(7-37)OH, Ile8-
GLP-1(7-36)NH2, Ser8-GLP-1(7-37)OH, Ser8-GLP-1(7-36)NH2,
Thr8-GLP-1(7-37)OH, Thr8-GLP-1(7-36)NH2, Val8-Tyr12-GLP-1(7-
37)OH, Val8-Tyr12-GLP-1(7-36)NH2, Val8-Tyr16-GLP-1(7-37)OH,
Val8-Tyr16-GLP-1(7-36)NH2, Val8-Glu22-GLP-1(7-37)OH, Val8-
Glu22-GLP-l(7-36)NH2, Gly8-Glu22-GLP-1(7-37)OH, Gly8-Glu22-GLP-
1(7-36)NH2, Val8-Asp22-GLP-1(7-37)OH, Val8-Asp22-GLP-1(7-
36)NH2, Gly8-Asp22-GLP-1(7-37)OH, Gly8-Asp22-GLP-1(7-36)NH2,
Val8-Lys22-GLP-1(7-37)OH, Val8-Lys22-GLP-1(7-36)NH2, Gly8-
Lys22-GLP-1(7-37)OH, Gly8-Lys22-GLP-1(7-36)NH2, Leu8-Glu22-GLP-
1(7-37)OH, Leu8-Glu22-GLP-1(7-36)NH2, Ile8-Glu22-GLP-1(7-
37) OH, Ile8-Glu22-GLP-1(7-36)NH2, Leu8-Asp22-GLP-1(7-37) OH,
Leu8-Asp22-GLP-1(7-36)NH2, Ile8-Asp22-GLP-1(7-37)OH, Ile8-
Asp22-GLP-1(7-36)NH2, Leu8-Lys22-GLP-1(7-37)OH, LeuB-Lys22-GLP-
1(7-36)NH2, Ile8-Lys22-GLP-1(7-37)OH, Ile8-Lys22-GLP-1(7-
36)NH2, Ser8-Glu22-GLP-1(7-37)OH, Ser8-Glu22-GLP-1(7-36)NH2,
Thr8-Glu22-GLP-1(7-37)OH, Thr8-Glu22-GLP-1(7-36)NH2, Ser8-
Asp22-GLP-1(7-37)OH, Ser8-Asp22-GLP-1(7-36)NH2, Thr8-Asp22-GLP-
1(7-37)OH, Thr8-Asp22-GLP-1(7-36)NH2, Ser8-Lys22-GLP-1(7-
37)OH, Ser8-Lys22-GLP-1(7-36)NH2, Thr8-Lys22-GLP-1(7-37)OH,
Thr8-Lys22-GLP-1(7-36)NH2, Glu22-GLP-1(7-37)OH, Glu22-GLP-1(7-
36)NH2, Asp22-GLP-1(7-37)OH, Asp22-GLP-1 (7-36)NH2, Lys22-GLP-
1(7-37)OH, Lys22-GLP-1(7-36)NH2, Val8-Ala27-GLP-1(7-37)OH,
Val8-Glu22-Ala27-GLP-1(7-37)OH, Val8-Glu30-GLP-1(7-37)OH, Val8-
Glu30-GLP-1(7-36)NH2, Gly8-Glu30-GLP-1(7-37)OH, Gly8-Glu30-GLP-
1(7-36)NH2, Leu8-Glu30-GLP-1(7-37)OH, Leu8-Glu30-GLP-1(7-
36)NH2, Ile8-Glu30-GLP-1(7-37)OH, Ile8-Glu30-GLP-1(7-36)NH2,
Ser8-Glu30-GLP-1(7-37)OH, Ser8-Glu30-GLP-1(7-36)NH2, Thr8-
Glu30-GLP-1(7-37)OH, Thr8-Glu30-GLP-1(7-36)NH2, Val8-His37-GLP-
1(7-37)OH, Val8-His37-GLP-1(7-36)NH2, Gly8-His37-GLP-1(7-37)OH,
Gly8-His37-GLP-1(7-36)NH2, Leu8-His37-GLP-1(7-37)OH, Leu8-His37-
GLP-1(7-36)NH2, Ile8-His37-GLP-1(7-37)OH, Ile8-His37-GLP-1(7-
36)NH2, Ser8-His37-GLP-1(7-37)OH, Ser8-His37-GLP-1(7-36)NH2,
Thr8-His37-GLP-1(7-37)OH, Thr8-His37-GLP-1 (7-36)NH2.
Some preferred GLP-1 compounds of formula IX having
multiple substitutions include GLP-1(7-37)OH wherein
position 8 is valine or glycine, position 22 is glutamic
acid, position 16 is tyrosine, leucine or tryptophan,
position 18 is tyrosine, tryptophan, or isoleucine, position
25 is valine and position 33 is isoleucine. Other preferred
GLP-1 compounds include the following: Val8-Tyr16-GLP-1,(7-
37)OH, Val8-Tyr12-Glu22-GLP-1(7-37)OH, Val8-Tyr16-Phe19-GLP-
1(7-37) OH, Val8-Tyr16-Glu22-GLP-1(7-37)OH, Val8-Trp16-Glu22-
GLP-1(7-37)OH, Val8-Leu16-Glu22-GLP-1(7-37)OH, Val8-Ile16-
Glu22-GLP-1(7-37)OH, Val8-Phe16-Glu22-GLP-1(7-37)OH; Val8-
Trp18-Glu22-GLP-1(7-37)OH, Val8-Tyr18-Glu22-GLP-1(7-37)OH,
Val8-Phe18-Glu22-GLP-1(7-37)OH, and Val8-Ile18-Glu22-GLP-1(7-
37)OH.
The GLP-1 compounds of the present invention also
encompass Exendin compounds. Exendin-3 and Exendin-4 are
biologically active peptides first isolated from
Helodermatidae lizard venoms and have been shown to bind the
GLP-1 receptor and stimulate cAMP-dependent H+ production in
mammalian parietal cells. Exendin-3 and Exendin-4 are both
39 amino acid peptides which are approximately 53%
homologous to GLP-1. They act as potent agonists of GLP-1
activity. Notably, an N-terminally truncated derivative of
Exendin, known as Exendin(9-39 amino acids), is an inhibitor
of Exendin-3, Exendin-4 and GLP-1.
An Exendin compound typically comprises a polypeptide
having the amino acid sequence of Exendin-3, Exendin-4, or
an analog or fragment thereof. Exendin-3 and Exendin-4 are
disclosed in U.S. Patent No. 5,424,286.
Exendin-3 has the amino acid sequence of SEQ ID NO: 9:
7 8 9 10 11 12 13 14 15 16 17
His-Ser-Asp-Gly-Thr-Phe-Thr-Ser-Asp-Leu-Ser-
18 19 20 21 22 23 24 25 26 27 28
Lys-Gln-Met-Glu-Glu-Glu-Ala-Val-Arg-Leu-Phe-
29 30 31 32 33 34 35 36 37 38 39
Ile-Glu-Trp-Leu-Lys-Asn-Gly-Gly-Pro-Ser-Ser-
40 41 42 43 44 45
Gly-Ala-Pro-Pro-Pro-Ser
(SEQ ID NO: 9)
Exendin-4 has the amino acid sequence of SEQ ID NO: 10:
7 8 9 10 11 12 13 14 15 16 17
His-Gly-Glu-Gly-Thr-Phe-Thr-Ser-Asp-Leu-Ser-
18 19 20 21 22 23 24 25 26 27 28
Lys-Gln-Met-Glu-Glu-Glu-Ala-Val-Arg-Leu-Phe-
29 30 31 32 33 34 35 36 37 38 39
Ile-Glu-Trp-Leu-Lys-Asn-Gly-Gly-Pro-Ser-Ser-
40 41 42 43 44 45
Gly-Ala-Pro-Pro-Pro-Ser
(SEQ ID NO: 10)
GLP-1 compounds also include Exendin fragments which
are polypeptides obtained after truncation of one or more
amino acids from the N-terminus and/or C-terminus of Exendin
or an Exendin analog. Furthermore, GLP-1 compounds include
Exendin polypeptides in which one or more amino acids have
been added to the N- terminus and/or C-terminus of Exendin or
fragments thereof. Exendin compounds of this type have up to
about forty-five amino acids.
GLP-1 compounds also include "Exendin analogs." An
Exendin analog has sufficient homology to Exendin-4,
Exendin-3, or a fragment thereof such that the analog has
insulinotropic activity. The activity of Exendin fragments
and/or analogs can be assessed using in vitro assays such as
those described in EP 619,322 and U.S. Patent No. 5,120,712.
Preferably, an Exendin analog has the amino acid
sequence of Exendin-4 or a fragment thereof, modified so
that from one, two, three, four or five amino acids differ
from the amino acid in corresponding position of Exendin-4
or the fragment of Exendin-4. In the nonmenclature used
herein to designate Exendin compounds, the substituting
amino acid and its position is indicated prior to the parent
structure. For example, Val8-Exendin-4 designates an
Exendin compound in which the glycine normally found at
position 8 of Exendin-4 has been replaced with valine.
Another preferred group of GLP-1 compounds is composed
of GLP-1/Exendin-4 analogs of formula VIII (SEQ ID NO:11).
7 8 9 10 11 12 13 14 15 16 17
Xaa-Xaa-Glu-Gly-Thr-Phe-Thr-Ser-Asp-Xaa-Ser-
18 19 20 21 22 23 24 25 26 27 28
Xaa-Xaa-Xaa-Glu-Xaa-Xaa-Ala-Xaa-Xaa-Xaa-Phe-
29 30 31 32 33 34 35 36 37
Ile-Xaa-Trp-Leu-Xaa-Xaa-Gly-Xaa-R
formula VIII (SEQ ID NO: 11)
wherein:
Xaa at position 7 is: L-histidine, D-histidine, desamino-
histidine, 2-amino-histidine, ß-hydroxy-histidine,
homohistidine, a-fluoromethyl-histidine or a-methyl-
histidine;
Xaa at position 8 is: Gly, Ala, or Val;
Xaa at position 16 is: Leu or Val;
Xaa at position 18 is Lys or Ser;
Xaa at position 19 is: Gln or Tyr;
Xaa at position 20 is: Met or Leu;
Xaa at position 22 is: Glu or Gln;
Xaa at position 23 is: Glu, or Gln;
Xaa at position 25 is: Val or Ala;
Xaa at position 26 is: Arg or Lys;
Xaa at position 27 is Leu or Glu;
Xaa at position 30 is: Glu or Ala;
Xaa at position 33 is: Val or Lys;
Xaa at position 34 is: Asn or Lys;
Xaa at position 36 is: Gly or Arg; and
R at position 37 is: Gly, Pro, Pro-Ser-Ser-Gly-Ala-Pro-Pro-
Pro-Ser, or is absent. The activity of 18 different species
that fall within this genus is provided in Table 6.
Further Exendin-analogs that are useful for the present
invention are described in PCT patent publications WO
99/25728 (Beeley et al.), WO 99/25727 Beeley et al.), WO
98/05351 (Young et al.), WO 99/40788 (Young et al.), WO
99/07404 (Beeley et al), and WO 99/43708 (Knudsen et al) .
The GLP-1 fusion proteins of the present invention can
comprise glycosylation sites. Glycosylation is a chemical
modification wherein sugar moieties are added to the protein
at specific sites. Glycosylation of proteins play a role in
ensuring the correct charge, confirmation, and stability of
maturing protein and can target the protein to the cell
surface and eventual secretion of the protein. Most
importantly, glycosylation effects the in vivo clearance
rate for many proteins. Sugars can be O-linked or N-linked.
Generally, O-linked sugars are added to the hydroxyl-group
oxygen of serine and threonine, while N-linked sugars are
added to the amide nitrogen of asparagine. The consensus
site for N-glycosylation is Asn X1 X2 wherein X1 is any
amino acid except Pro and X2 is Ser or Thr.
GLP-1 compounds are generally not glycosylated in vivo;
however, interestingly the GLP-1 fusion proteins of the
present invention that comprise a GLP-1 compound with a C
terminal extension fused to an Fc sequence is glycosylated
at the last serine in the C terminal extension (SSGAPPPS*)
and at threonine at position 11 in the N terminal region of
Fc (AEPKSCDKTHT*CPPC
Heterologous Fc fusion proteins:
The GLP-1 compounds described above can be fused
directly or via a peptide linker to the Fc portion of an
immunoglobulin.
Immunoglobulins are molecules containing polypeptide
chains held together by disulfide bonds, typically having
two light chains and two heavy chains. In each chain, one
domain (V) has a variable amino acid sequence depending on
the antibody specificity of the molecule. The other domains
(C) have a rather constant sequence common to molecules of
the same class.
As used herein, the Fc portion of an immunoglobulin has
the meaning commonly given to the term in the field of
immunology. Specifically, this term refers to an antibody
fragment which is obtained by removing the two antigen
binding regions (the Fab fragments) from the antibody. One
way to remove the Fab fragments is to digest the
immunoglobulin with papain protease. Thus, the Fc portion
is formed from approximately equal sized fragments of the
constant region from both heavy chains, which associate
through non-covalent interactions and disulfide bonds. The
Fc portion can include the hinge regions and extend through
the CH2 and CH3 domains to the C-terminus of the antibody.
Representative hinge regions for human and mouse
immunoglobulins can be found in Antibody Engineering, A
Practical Guide, Borrebaeck, C.A.K., ed., W.H. Freeman and
Co., 1992, the teachings of which are herein incorporated by
reference. The Fc portion can further include one or more
glycosylation sites. The amino acid sequence of a
representative Fc protein containing a hinge region, CH2 and
CH3 domains, and one N-glycosylation site at position 82 is
shown in Figure 1.
There are five types of human inununoglobulin Fc regions
with different effect or and pharmacokinetic properties:
IgG, IgA, IgM, IgD, and IgE. IgG is the most abundant
immunoglobulin in serum. IgG also has the longest half-life
in serum of any immunoglobulin (23 days) . Unlike other
immunoglobulins, IgG is efficiently recirculated following
binding to an Fc receptor. There are four IgG subclasses
G1, G2, G3, and G4, each of which have different effect or
functions. G1, G2, and G3 can bind C1q and fix complement
while G4 cannot. Even though G3 is able to bind C1q more
efficiently than G1, G1 is more effective at mediating
complement-directed cell lysis. G2 fixes complement very
inefficiently. The Clq binding site in IgG is located at
the carboxy terminal region of the CH2 domain.
All IgG subclasses are capable of binding to Fc
receptors (CD16, CD32, CD64) with Gl and G3 being more
effective than G2 and G4. The Fc receptor binding region of
IgG is formed by residues located in both the hinge and the
carboxy terminal regions of the CH2 domain.
IgA can exist both in a monomeric and dimeric form held
together by a J-chain. IgA is the second most abundant Ig
in serum, but it has a half-life of only 6 days. IgA has
three effect or functions. It binds to an IgA specific
receptor on macrophages and eosinophils, which drives
phagocytosis and degranulation, respectively. It can also
fix complement via an unknown alternative pathway.
IgM is expressed as either a pentamer or a hexamer,
both of which are held together by a J-chain. IgM has a
serum half-life of 5 days. It binds weakly to Clq via a
binding site located in its CH3 domain. IgD has a half-life
of 3 days in serum. It is unclear what effect or functions
are attributable to this Ig. IgE is a monomeric Ig and has
a serum half-life of 2.5 days. IgE binds to two Fc
receptors which drives degranulation and results in the
release of proinflammatory agents.
Depending on the desired in vivo effect, the
heterologous fusion proteins of the present invention may
contain any of the isotypes described above or may contain
mutated Fc regions wherein the complement and/or Fc receptor
binding functions have been altered. Thus, the heterologous
fusion proteins of the present invention may contain the
entire Fc portion of an immunoglobulin, fragments of the Fc
portion of an immunoglobulin, or analogs thereof fused to a
GLP-1 compound.
The fusion proteins of the present invention can
consist of single chain proteins or as multi-chain
polypeptides. Two or more Fc fusion proteins can be
produced such that they interact through disulfide bonds
that naturally form between Fc regions. These multimers can
be homogeneous with respect to the GLP-1 compound or they
may contain different GLP-1 compounds fused at the N-
terminus of the Fc portion of the fusion protein.
Regardless of the final structure of the fusion
protein, the Fc or Fc-like region must serve to prolong the
in vivo plasma half-life of the GLP-1 compound fused at the
N-terminus. Furthermore, the fused,GLP-1 compound must
retain some biological activity. An increase in half-life
can be demonstrated using the method described in Example 7
wherein the half-life of the fusion protein is compared to
the half-life of the GLP-1 compound alone. Biological
activity can be determined by in vitro and in vivo methods
known in the art. Representative biological assays are
described in Examples 6, 8, and 9.
Since the Fc region of IgG produced by proteolysis has
the same in vivo half-life as the intact IgG molecule and
Fab fragments are rapidly degraded, it is believed that the
relevant sequence for prolonging half-life reside in the CH2
and/or CH3 domains. Further, it has been shown in the
literature that the catabolic rates of IgG variants that do
not bind the high-affinity Fc receptor or C1q are
indistinguishable from the rate of clearance of the parent
wild-type antibody, indicating that the catabolic site is
distinct from the sites involved in Fc receptor or C1q
binding. [Wawrzynczak et al., (1992) Molecular Immunology
29:221]. Site-directed mutagenesis studies using a xnurine
IgG1 Fc region suggested that the site of the IgG1 Fc region
that controls the catabolic rate is located at the CH2-CH3
domain interface.
Based on these studies, Fc regions can be modified at
the catabolic site to optimize the half-life of the fusion
proteins. It is preferable that the Fc region used for the
heterologous fusion proteins of the present invention be
derived from an IgGl or an IgG4 Fc region. It is even more
preferable that the Fc region be IgG4 or derived from IgG4.
Preferably the IgG Fc region contains both the CH2 and CH3
regions including the hinge region.
Heterologous albumin fusion proteins:
The GLP-1 compounds described above can be fused
directly or via a peptide linker to albumin or an analog,
fragment, or derivative thereof.
Generally the albumin proteins making up part of the
fusion proteins of the present invention can be derived from
albumin cloned from any species. However, human albumin and
fragments and analogs thereof are preferred to reduce the
risk of the fusion protein being immunogenic in humans.
. Human serum albumin (HSA) consists of a single non-
glycosylated polypeptide chain of 585 amino acids with a
formula molecular weight of 66,500. The amino acid sequence
of human HSA is shown in figure 2. [See Meloun, et al.
(1975) FEBS Letters 58:136; Behrens, et al. (1975) Fed.
Proc. 34:591; Lawn, et al. (1981) Nucleic Acids Research
9:6102-6114; Minghetti, et al. (1986) J. Biol. Chem.
261:6747]. A variety of polymorphic variants as well as
analogs and fragments of albumin have been described. [See
Weitkamp, et al., (1973) Ann. Hum. Genet. 37:219]. For
example, in EP 322,094, the inventors disclose various
shorter forms of HSA. Some of these fragments include
HSA(1-373), HSA(l-388), HSAU-389), HSA(l-369) , and HSA(1-
419) and fragments between 1-369 and 1-419. EP 399,666
discloses albumin fragments that include HSA(1-177) and
HSA(l-200) and fragments between HSA(1-177) and HSA(1-200).
It is understood that the heterologous fusion proteins
of the present invention include GLP-1 compounds that are
coupled to any albumin protein including fragments, analogs,
and derivatives wherein such fusion protein is biologically-
active and has a longer plasma half-life than the GLP-1
compound alone. Thus, the albumin portion of the fusion
protein need not necessarily have a plasma half-life equal
to that of native human albumin. Fragments, analogs, and
derivatives are known or can be generated that have longer
half-lives or have half-lives intermediate to that of native
human albumin and the GLP-1 compound of interest.
The heterologous fusion proteins of the present
invention encompass proteins having conservative amino acid
substitutions in the GLP-1 compound and/or the Fc or albumin
portion of the fusion protein. A "conservative
substitution" is the replacement of an amino acid with
another amino acid that has the same net electronic charge
and approximately the same size and shape. Amino acids with
aliphatic or substituted aliphatic amino acid side chains
have approximately the same size when the total number
carbon and heteroatoms in their side chains differs by no
more than about four. They have approximately the same
shape when the number of branches in their side chains
differs by no more than one. Amino acids with phenyl or
substituted phenyl groups in their side chains are
considered to have about the same size and shape. Except as
otherwise specifically provided herein, conservative
substitutions are preferably made with naturally occurring
amino acids.
However, the term "amino acid" is used herein in its
broadest sense, and includes naturally occurring amino acids
as well as non-naturally occurring amino acids, including
amino acid analogs and derivatives. The latter includes
molecules containing an amino acid moiety. One skilled in
the art will recognize, in view of this broad definition,
that reference herein to an amino acid includes, for
example, naturally occurring proteogenic L-amino acids; D-
amino acids; chemically modified amino acids such as amino
acid analogs and derivatives; naturally occurring non-
proteogenic amino acids such as norleucine, ß-alanine,
ornithine, GABA, etc.; and chemically synthesized compounds
having properties known in the art to be characteristic of
amino acids. As used herein, the term "proteogenic"
indicates that the amino acid can be incorporated into a
peptide, polypeptide, or protein in a cell through a
metabolic pathway.
The incorporation of non-natural amino acids, including
synthetic non-native amino acids, substituted amino acids,
or one or more D-amino acids into the heterologous fusion
proteins of the present invention can be advantageous in a
number of different ways. D-amino acid-containing peptides,
etc., exhibit increased stability in vitro or in vivo
compared to L-amino acid-containing counterparts. Thus, the
construction of peptides, etc., incorporating D-amino acids
can be particularly useful when greater intracellular
stability is desired or required. More specifically, D-
peptides, etc., are resistant to endogenous peptidases and
proteases, thereby providing improved bioavailability of the
molecule, and prolonged lifetimes in vivo when such
properties are desirable. Additionally, D-peptides, etc.,
cannot be processed efficiently for major histocompatibility
complex class II-restricted presentation to T helper cells,
and are therefore, less likely to induce humoral immune
responses in the whole organism.
In addition to structure/function analyses of the
various polypeptides encompassed by the present invention,
there are numerous factors that can be considered when
selecting amino acids for substitution. One factor that can
be considered in making such changes is the hydropathic
index of amino acids. The importance of the hydropathic
amino acid index in conferring interactive biological
function on a protein has been discussed by Kyte and
Doolittle (1982, J. Mol. Biol., 157: 105-132). It is
accepted that the relative hydropathic character of amino
acids contributes to the secondary structure of the
resultant protein. This, in turn, affects the interaction
of the protein with molecules such as enzymes, substrates,
receptors, ligands, DNA, antibodies, antigens, etc. Based
on its hydrophobicity and charge characteristics, each amino
acid has been assigned a hydropathic index as follows:
isoleucine (+4.5); valine (+4.2); leucine (+3.8);
phenylalanine (+2.8); cysteine/cystine (+2.5); methionine
(+1.9); alanine (+1.8); glycine (-0.4); threonine (-0.7);
serine (-0.8); tryptophan (-0.9); tyrosine (-1.3); proline
(-1.6); histidine (-3.2);
glutamate/glutamine/aspartate/asparagine (-3.5); lysine
(-3.9); and arginine (-4.5).
As is known in the art, certain amino acids in a
peptide, polypeptide, or protein can be substituted for
other amino acids having a similar hydropathic index or
score and produce a resultant peptide, etc., having similar
or even improved biological activity. In making such
changes, it is preferable that amino acids having
hydropathic indices within ±2 are substituted for one
another. More preferred substitutions are those wherein the
amino acids have hydropathic indices within ±1. Most
preferred substitutions are those wherein the amino acids
have hydropathic indices within ±0.5.
Like amino acids can also be substituted on the basis
of hydrophilicity. U.S. Patent No. 4,554,101 discloses that
the greatest local average hydrophilicity of a protein, as
governed by the hydrophilicity of its adjacent amino acids,
correlates with a biological property of the protein. The
following hydrophilicity values have been assigned to amino
acids: arginine/lysine (+3.0); aspartate/glutamate (+3.0±1);
serine (+0.3); asparagine/glutamine (+0.2); glycine (0);
threonine (-0.4); proline (-0.5±1); alanine/histidine
(-0.5); cysteine (-1.0); methionine (-1.3); valine (-1.5);
leucine/isoleucine (-1.8); tyrosine (-2.3); phenylalanine
(-2.5); and tryptophan (-3.4). Thus, one amino acid in a
peptide, polypeptide, or protein can be substituted by
another amino acid having a similar hydrophilicity score and
still produce a resultant peptide, etc., having similar
biological activity, i.e., still retaining correct
biological function. In making such changes, amino acids
having hydropathic indices within ±2 are preferably
substituted for one another, those within ±1 are more
preferred, and those within ±0.5 are most preferred.
As outlined above, amino acid substitutions in the
fusion proteins of the present invention can be based on the
relative similarity of the amino acid side-chain
substituents, for example, their hydrophobicity,
hydrophilicity, charge, size, etc. Furthermore,
substitutions can be made based on secondary structure
propensity. For example, a helical amino acid can be
replaced with an amino acid that would preserve the helical
structure. Exemplary substitutions that take various of the
foregoing characteristics into consideration in order to
produce conservative amino acid changes resulting in silent
changes within the present peptides, etc., can be selected
from other members of the class to which the naturally
occurring amino acid belongs. Amino acids can be divided
into the following four groups: (1) acidic amino acids; (2)
basic amino acids; (3) neutral polar amino acids; and (4)
neutral non-polar amino acids.
General methods for making the heterologous fusion proteins
of the present invention.
Although the heterologous fusion proteins of the
present invention can be made by a variety of different
methods, recombinant methods are preferred. For purposes of
the present invention, as disclosed and claimed herein, the
following general molecular biology terms and abbreviations
are defined below. The terms and abbreviations used in this
document have their normal meanings unless otherwise
designated. For example, "°C" refers to degrees Celsius;
"mmol" refers to millimole or millimoles; "mg" refers to
milligrams; "µg" refers to micrograms; "ml or mL" refers to
milliliters; and "µl or µL" refers to microliters. Amino
acids abbreviations are as set forth in 37 C.F.R. § 1.822
(b)(2> (1994).
"Base pair" or "bp" as used herein refers to DNA or
RNA. The abbreviations A,C,G, and T correspond to the 5'-
monophosphate forms of the deoxyribonucleosides
(deoxy)adenosine, (deoxy)cytidine, (deoxy)guanosine, and
thymidine, respectively, when they occur in DNA molecules.
The abbreviations U,C,G, and A correspond to the 5'-
monophosphate forms of the ribonucleosides uridine,
cytidine, guanosine, and adenosine, respectively when they
occur in RNA molecules. In double stranded DNA, base pair
may refer to a partnership of A with T or C with G. In a
DNA/RNA, heteroduplex base pair may refer to a partnership
of A with U or C with G. (See the definition of
"complementary", infra.)
"Digestion" or "Restriction" of DNA refers to the
catalytic cleavage of the DNA with a restriction enzyme that
acts only at certain sequences in the DNA ("sequence-
specific endonucleases"). The various restriction enzymes
used herein are commercially available and their reaction
conditions, cofactors, and other requirements were used as
would be known to one of ordinary skill in the art.
Appropriate buffers and substrate amounts for particular
restriction enzymes are specified by the manufacturer or can
be readily found in the literature.
"Ligation" refers to the process of forming
phosphodiester bonds between two double stranded nucleic
acid fragments. Unless otherwise provided, ligation may be
accomplished using known buffers and conditions with a DNA
ligase, such as T4 DNA ligase.
"Plasmid" refers to an extrachromosomal (usually) self-
replicating genetic element. Plasmids are generally
designated by a lower case "p" followed by letters and/or
numbers. The starting plasmids herein are either
commercially available, publicly available on an
unrestricted basis, or can be constructed from available
plasmids in accordance with published procedures. In
addition, equivalent plasmids to those described are known
in the art and will be apparent to the ordinarily skilled
artisan.
"Recombinant DNA cloning vector" as used herein refers
to any autonomously replicating agent, including, but not
limited to, plasmids and phages, comprising a DNA molecule
to which one or more additional DNA segments can or have
been added.
"Recombinant DNA expression vector" as used herein
refers to any recombinant DNA cloning vector in which a
promoter to control transcription of the inserted DNA has
been incorporated.
"Transcription" refers to the process whereby
information contained in a nucleotide sequence of DNA is
transferred to a complementary RNA sequence.
"Transfeetion" refers to the uptake of an expression
vector by a host cell whether or not any coding sequences
are, in fact, expressed. Numerous methods of transfection
are known to the ordinarily skilled artisan, for example,
calcium phosphate co-precipitation, liposome transfection,
and electroporation. Successful transfection is generally
recognized when any indication of the operation of this
vector occurs within the host cell.
"Transformation" refers to the introduction of DNA into
an organism so that the DNA is replicable, either as an
extrachromosomal element or by chromosomal integration.
Methods of transforming bacterial and eukaryotic hosts are
well known in the art, many of which methods, such as
nuclear injection, protoplast fusion or by calcium treatment
using calcium chloride are summarized in J. Sambrook, et
al., Molecular Cloning: A Laboratory Manual, (1989).
Generally, when introducing DNA into Yeast the term
transformation is used as opposed to the term transfection.
"Translation" as used herein refers to the process
whereby the genetic information of messenger RNA (mRNA) is
used to specify and direct the synthesis of a polypeptide
chain.
"Vector" refers to a nucleic acid compound used for the
transfection and/or transformation of cells in gene
manipulation bearing polynucleotide sequences corresponding
to appropriate protein molecules which, when combined with
appropriate control sequences, confers specific properties
on the host cell to be transfected and/or transformed.
Plasmids, viruses, and bacteriophage are suitable vectors.
Artificial vectors are constructed by cutting and joining
DNA molecules from different sources using restriction
enzymes and ligases. The term "vector" as used herein
includes Recombinant DNA cloning vectors and Recombinant DNA
expression vectors.
"Complementary" or "Complementarity", as used herein,
refers to pairs of bases {purines and pyrimiddines) that
associate through hydrogen bonding in a double stranded
nucleic acid. The following base pairs are complementary:
guanine and cytosine; adenine and thymine; and adenine and
uracil.
"Hybridization" as used herein refers to a process in
which a strand of nucleic acid joins with a complementary
strand through base pairing. The conditions employed in the
hybridization of two non-identical, but very similar,
complementary nucleic acids varies with the degree of
complementarity of the two strands and the length of the
strands. Such techniques and conditions are well known to
practitioners in this field.
"Isolated amino acid sequence" refers to any amino acid
sequence, however, constructed or synthesized, which is
locationally distinct from the naturally occurring sequence.
"Isolated DNA compound" refers to any DNA sequence,
however constructed or synthesized, which is locationally
distinct from its natural location in genomic DNA.
"Isolated nucleic acid compound" refers to any RNA or
DNA sequence, however constructed or synthesized, which is
locationally distinct from its natural location.
"Primer" refers to a nucleic acid fragment which
functions as an initiating substrate for enzymatic or
synthetic elongation.
"Promoter" refers to a DNA sequence which directs
transcription of DNA to RNA.
"Probe" refers to a nucleic acid compound or a
fragment, thereof, which hybridizes with another nucleic
acid compound.
"Stringency" of hybridization reactions is readily
determinable by one of ordinary skill in the art, and
generally is an empirical calculation dependent upon probe
length, washing temperature, and salt concentration. In
general, longer probes require higher temperatures for proper
annealing, while short probes need lower temperatures.
Hybridization generally depends on the ability of denatured
DNA to re-anneal when complementary strands are present in an
environment below their melting temperature. The higher the
degree of desired homology between the probe and hybridizable
sequence, the higher the relative temperature that can be
used. As a result, it follows that higher relative
temperatures would tend to make the reactions more stringent,
while lower temperatures less so. For additional details and
explanation of stringency of hybridization reactions, see
Ausubel et al., Current Protocols in Molecular Biology, Wiley
Interscience Publishers, 1995.
"Stringent conditions" or "high stringency conditions",
as defined herein, may be identified by those that (1) employ
low ionic strength and high temperature for washing, for
example, 15 mM sodium chloride/1.5 mM sodium citrate/0.1%
sodium dodecyl sulfate at 50°C; (2) employ during
hybridization a denaturing agent, such as formamide, for
example, 50% (v/v) formamide with 0.1% bovine serum
albumin/0.1% ficoll/0.1% polyvinylpyrrolidone/50 mM sodium
phosphate buffer at pH 6.5 with 750 mM sodium chloride/75 mM
sodium citrate at 42°C; or (3) employ 50% formamide, 5X SSC
(750 mM sodium chloride, 75 mM sodium citrate), 50 mM sodium
phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5X Denhardt's
solution, sonicated salmon sperm DNA (50 µg/ml) , 0.1% SDS, and
10% dextran sulfate at 42°C with washes at 42°C in 0.2X SSC
(30 mM sodium chloride/3 mM sodium citrate) and 50% formamide
at 55°C, followed by a high-stringency wash consisting of 0.1X
SSC containing EDTA at 55°C.
"Moderately stringent conditions" may be identified as
described by Sambrook et al. [Molecular Cloning: A Laboratory
Manual, New York: Cold Spring Harbor Press, (1989)1, and
include the use of washing solution and hybridization
conditions (e.g., temperature, ionic strength, and %SDS) less
stringent than those described above. An example of
moderately stringent conditions is overnight incubation at
37°C in a solution comprising: 20% formamide, 5X SSC (750 mM
sodium chloride, 75 mM sodium citrate) , 50 mM sodium phosphate
at pH 7.6, 5X Denhardt's solution, 10% dextran sulfate, and 20
mg/mL denatured sheared salmon sperm DNA, followed by washing
the filters in 1X SSC at about 37-50°C The skilled artisan
will recognize how to adjust the temperature, ionic strength,
etc., as necessary to accommodate factors such as probe length
and the like.
"PCR" refers to the widely-known polymerase chain
reaction employing a thermally-stable DNA polymerase.
"Leader sequence" refers to a sequence of amino acids
which can be enzymatically or chemically removed to produce
the desired polypeptide of interest.
"Secretion signal sequence" refers to a sequence of
amino acids generally present at the N-terminal region of a
larger polypeptide functioning to initiate association of
that polypeptide with the cell membrane compartments like
endoplasmic reticulum and secretion of that polypeptide
through the plasma membrane.
Construction of DNA encoding the heterologous fusion
proteins of the present invention:
Wild-type albumin and Immunoglobulin proteins can be
obtained from a variety of sources. For example, these
proteins can be obtained from a cDNA library prepared from
tissue or cells which express the mRNA of interest at a
detectable level. Libraries can be screened with probes
designed using the published DNA or protein sequence for the
particular protein of interest. For example, immunoglobulin
light or heavy chain constant regions are described in
Adams, et al. (1980) Biochemistry 19:2711-2719; Goughet, et
al. (1980) Biochemistry 19:2702-2710; Dolby, et al. (1980)
Proc. Natl. Acad. Sci. USA 77:6027-6031; Rice et al. (1982)
Proc. Natl. Acad. Sci. USA 79:7862-7862; Falkner, et al.
(1982) Nature 298:286-288; and Morrison, et al. (1984) Ann.
Rev. Immunol. 2:239-256. Some references disclosing albumin
protein and DNA sequences include Meloun, et al. (1975) FEBS
Letters 58:136; Behrens, et al. (1975) Fed. Proc. 34:591;
Lawn, et al. (1981) Nucleic Acids Research 9:6102-6114; and
Minghetti, et al. (1986) J. Biol. Chem. 261:6747
Screening a cDNA or genomic library with the selected
probe may be conducted using standard procedures, such as
described in Sambrook et al., Molecular Cloning: A
Laboratory Manual, Cold Spring Harbor Laboratory Press, NY
(1989) . An alternative means to isolate a gene encoding an
albumin or immunoglobulin protein is to use PCR methodology
[Sambrook et al., supra; Dieffenbach et al., PCR Primer: A
Laboratory Manual, Cold Spring Harbor Laboratory Press, NY
(1995)] . PCR primers can be designed based on published
sequences.
Generally the full-length wild-type sequences cloned
from a particular species can serve as a template to create
analogs, fragments, and derivatives that retain the ability
to confer a longer plasma half-life on the GLP-1 compound
that is part of the fusion protein. It is preferred that
the Fc and albumin portions of the heterologous fusion
proteins of the present invention be derived from the native
human sequence in order to reduce the risk of potential
imntunogenicity of the fusion protein in humans.
In particular, it is preferred that the immunoglobulin
portion of a fusion protein encompassed by the present
invention contain only an Fc fragment of the immunoglobulin.
Depending on whether particular effect or functions are
desired and the structural characteristics of the fusion
protein, an Fc fragment may contain the hinge region along
with the CH2 and CH3 domains or some other combination
thereof. These Fc fragments can be generated using PCR
techniques with primers designed to hybridize to sequences
corresponding to the desired ends of the fragment.
Similarly, if fragments of albumin are desired, PCR primers
can be designed which are complementary to internal albumin
sequences. PCR primers can also be designed to create
restriction enzyme sites to facilitate cloning into
expression vectors.
DNA encoding the GLP-1 compounds of the present
invention can be made by a variety of different methods
including cloning methods like those described above as well
as chemically synthesized DNA. Chemical synthesis may be
attractive given the short length of the encoded peptide.
The amino acid sequence for GLP-1 has been published as well
as the sequence of the preproglucagon gene. [Lopez, et al.
(1983) Proc. Natl. Acad. Sci., USA 80:5485-5489; Bell, et
al. (1983) Nature, 302:716-718; Heinrich, G., et al. (1984)
Endocrinol, 115:2176-2181; Ghiglione, M., et al. 91984)
Diabetologia 27:599-600]. Thus, primers can be designed to
PCR native GLP-1 compounds and fragments thereof.
The gene encoding a fusion protein can then be
constructed by ligating DNA encoding a GLP-1 compound in-
frame to DNA encoding an albumin or Fc protein. The gene
encoding the GLP-1 compound and the gene encoding the
albumin or Fc protein can also be joined in-frame via DNA
encoding a linker peptide.
The in vivo function and stability of the heterologous
fusion proteins of the present invention can be optimized by
adding small peptide linkers to prevent potentially unwanted
domain interactions. Although these linkers can potentially
be any length and consist of any combination of amino acids,
it is preferred that the length be no longer than necessary
to prevent unwanted domain interactions and/or optimize
biological activity and/or stability. Generally, the
linkers should not contain amino acids with extremely bulky
side chains or amino acids likely to introduce significant
secondary structure. It is preferred that the linker be
serine-glycine rich and be less than 30 amino acids in
length. It is more preferred that the linker be no more
than 20 amino acids in length. It is even more preferred
that the linker be no more than 15 amino acids in length. A
preferred linker contains repeats of the sequence Gly-Gly-
Gly-Gly-Ser. It is preferred that there be between 2 and 6
repeats of this sequence. It is even more preferred that
there be between 3 and 4 repeats of this sequence.
The DNA encoding wild-type GLP-1, albumin, and Fc
polypeptides and fragments thereof can be mutated either
before ligation or in the context of a cDNA encoding an
entire fusion protein. A variety of mutagenesis techniques
are well known in the art. For example, a mutagenic PCR
method utilizes strand overlap extension to create specific
base mutations for the purposes of changing a specific amino
acid sequence in the corresponding protein. This PCR
mutagenesis requires the use of four primers, two in the
forward orientation (primers A and C) and two in the reverse
orientation (primers B and D) . A mutated gene is amplified
from the wild-type template in two different stages. The
first reaction amplifies the gene in halves by performing an
A to B reaction and a separate C to D reaction wherein the B
and C primers target the area of the gene to be mutated.
When aligning these primers With the target area, they
contain mismatches for the bases that are targeted to be
changed. Once the A to B and C to D reactions are complete,
the reaction products are isolated and mixed for use as the
template for the A to D reaction. This reaction then yields
the full, mutated product.
Once a gene encoding an entire fusion protein is
produced it can be cloned into an appropriate expression
vector. Specific strategies that can be employed to make
the GLP-1 fusion proteins of the present invention are
described in example 1.
General methods to recombinantly express the heterologous
fusion proteins of the present invention:
Host cells are transfected or transformed with expression
or cloning vectors described herein for heterologous fusion
protein production and cultured in conventional nutrient media
modified as appropriate for inducing promoters, selecting
transformants, or amplifying the genes encoding the desired
sequences. The culture conditions, such as media, temperature,
pH and the like, can be selected by the skilled artisan without
undue experimentation. In general, principles, protocols, and
practical techniques for maximizing the productivity of cell
cultures can be found in Mammalian Cell Biotechnology: A
Practical Approach, M. Butler, ed. (IRL Press, 1991) and
Sambrook, et al., supra. Methods of transfection are known to
the ordinarily skilled artisan, for example, CaPO4 and
electroporation. General aspects of mammalian cell host system
transformations have been described in U.S. Patent Mo.
4,399,216. Transformations into yeast are typically carried
out according to the method of van Solingen et al., J Bact.
130(2): 946-7 (1977) and Hsiao et al., Proc. Natl. Acad. Sci.
USA 76(8): 3829-33 (1979). However, other methods for
introducing DNA into cells, such as by nuclear microinjection,
electroporation, bacterial protoplast fusion with intact cells,
or polycations, e.g., polybrene or polyomithine, may also be
used. For various techniques for transforming mammalian cells,
see Keown, et al., Methods in Enzymology 185: 527-37 (1990) and
Mansour, et al., Nature 336(6197): 348-52 (1988).
Suitable host cells for cloning or expressing the nucleic
acid (e.g., DNA) in the vectors herein include prokaryote,
yeast, or higher eukaryote cells. Suitable prokaryotes
include but are not limited to eubacteria, such as Gram-
negative or Gram-positive organisms, for example,
Enterobacteriacea such as E. coli. Various E. coli strains
are publicly available, such as E. coli K12 strain MM294 (ATCC
3 1.446); E. coli X1 776 (ATCC 3 1.537); E. coli strain W3 110
(ATCC 27.325) and K5 772 (ATCC 53.635). Other suitable
prokaryotic host cells include Enterobacteriaceae such as
Escherichia, e.g.. E. cola, Enterobacter, Erwinia, Klebisella,
Proteus, Salmonella, e.g., Salmonella typhimurium, Serratia,
e.g., Serratia marcescans, and Shigeila, as well as Bacilli
such as B. subtilis and B. lichentformis (e.g., B.
licheniformis 4 1 P disclosed in DD266,7 10, published 12
April 1989), Pseudomonas such as p. aeruginosa, and
Streptomyces. These examples are illustrative rather than
limiting. Strain W3110 is one particularly preferred host or
parent host because it is a common host strain for recombinant
DNA product fermentations. Preferably, the host cell secretes
minimal amounts of proteolytic enzymes. For example, strain
W3 110 may be modified to effect a genetic mutation in the
genes encoding proteins endogenous to the host, with examples
of such hosts including E. coli W3110 strain 1A2, which has
the complete genotype ronA; E. coli W3 110 strain 9E4, which
has the complete genotype ton4 ptr3; E. coli W3110 strain 27C7
(ATCC 55,244), which has the complete genotype tonA, ptr3 phoA
E15 (argF-lac) 169 degP ompT /can'; E. coli W3110 strain 40B4,
which is strain 37D6 with a non-kanamycin resistant degP
deletion mutation; and an E. coli strain having mutant
periplasmic protease disclosed in U.S. Patent No. 4,946,783
issued 7 August 1990. Alternatively, in vivo methods of
cloning, e.g., PCR or other nucleic acid polymerase reactions,
are suitable.
In addition to prokaryotes, eukaryotic microbes such as
filamentous fungi or yeast are suitable cloning or expression
hosts for fusion protein vectors. Saccharomyces cerevisiae is
a commonly used lower eukaryotic host microorganism. Others
include Schizosaccharomyces pombe [Beach and Nurse, Nature
290: 140-3 (1981); EP 139,383 published 2 May 1995];
Muyveromyces hosts [U.S. Patent No. 4,943,529; Fleer, et al.,
Bio/Technology 9(10): 968-75 (1991)] such as, e.g., K lactis
(MW98-8C, CBS683, CBS4574) [de Louvencourt et al., J.
Bacteriol. 154(2): 737-42 (1983)]; K. fiagilis (ATCC 12,424),
K. bulgaricus (ATCC 16,045), K wickeramii (ATCC 24,178), K
waltii (ATCC 56,500), K. drosophilarum (ATCC 36.906) [Van den
Berg et al., Bio/Technology 8(2): 135-9 (1990)]; K.
thermotoierans, and K. marxianus; yarrowia (EP 402,226);
Pichia pastoris (EP 183,070) [Sreekrishna et al., J. Basic
Microbiol. 28(4): 265-78 (1988)]; Candid; Trichoderma reesia
(EP 244,234); Neurospora crassa [Case, et al., Proc. Natl.
Acad Sex. USA 76(10): 5259-63 (1979)]; Schwanniomyces such as
Schwanniomyces occidentulis (EP 394,538 published 31 October
1990); and filamentous fungi such as, e.g., Neurospora,
Penicillium, Tolypocladium (WO 91/00357 published 10 January
1991), and Aspergillus hosts such as A. nidulans [Ballance et
al., Biochem. Biophys. Res. Comm. 112(1): 284-9 (1983)]; .
Tilburn, et al., Gene 26(2-3): 205-21 (1983); Yelton, et al.
Proc. Natl. Acad. Sci. USA 81(5): 1470-4 (1984)] and A. niger
[Kelly and Hynes, EMBO J. 4(2): 475-9 (1985)]. Methylotropic
yeasts are selected from the genera consisting of Hansenula,
Candida, Kloeckera, Pichia, Saccharomyces, Torulopsis, and
Rhodotoruia. A list of specific species that are exemplary of
this class of yeast may be found in C. Antony, The
Biochemistry of Methylotrophs 269 (1982) .
Suitable host cells for the expression of the fusion
proteins of the present invention are derived from
multicellular organisms. Examples of invertebrate cells
include insect cells such as Drosophila S2 and Spodoptera Sp,
Spodoptera high5 as well as plant cells. Examples of useful
mammalian host cell lines include Chinese hamster ovary (CHO)
and COS cells. More specific examples include monkey kidney
CV1 line transformed by SV40 (COS-7, ATCC CRL 1651); human
embryonic kidney line [293 or 293 cells subcloned for growth
in suspension culture, Graham, et al., J. Gen Virol., 36(1):
59-74 (1977)]; Chinese hamster ovary cells/-DHFR [CHO, Urlaub
and Chasin, Proc. Natl. Acad. Sci. USA, 77(7): 4216-20
(1980)]; mouse sertoli cells [TM4, Mather, Biol. Reprod.
23(l):243-52 (1980)]; human lung cells (W138. ATCC CCL 75);
human liver cells (Hep G2, HB 8065); and mouse mammary tumor
(MMT 060562, ATCC CCL51) . The selection of the appropriate
host cell is deemed to be within the skill in the art.
The fusion proteins of the present invention may be
recombinantly produced directly, or as a protein having a
signal sequence or other additional sequences which create a
specific cleavage site at the N-terminus of the mature fusion
protein. In general, the signal sequence may be a component
of the vector, or it may be a part of the fusion protein-
encoding DNA that is inserted into the vector. The signal
sequence may be a prokaryotic signal sequence selected, for
example, from the group of the alkaline phosphatase,
penicillinase, 1pp, or heat-stable enterotoxin II leaders.
For yeast secretion the signal sequence may be, e.g., the
yeast invertase leader, alpha factor leader (including
Saccharomyces and Kluyveromyces cc-factor leaders, the latter
described in U.S. Patent No. 5,010,182), or acid phosphatase
leader, the C. albicans glucoamylase leader (EP 362,179), or
the signal described in WO 90/13646. In mammalian cell
expression, mammalian signal sequences may be used to direct
secretion of the protein, such as signal sequences from
secreted polypeptides of the same or related species as well
as viral secretory leaders.
Both expression and cloning vectors contain a nucleic
acid sequence that enables the vector to replicate in one or
more selected host cells. Such sequences are well known for a
variety of bacteria, yeast, and viruses. The origin of
replication from the plasmid pBR322 is suitable for most Gram-
negative bacteria, the 2u plasmid origin is suitable for
yeast, and various viral origins (SV40, polyoma, adenovirus,
VSV or BPV) are useful for cloning vectors in mammalian cells.
Expression and cloning vectors will typically contain a
selection gene, also termed a selectable marker. Typical
selection genes encode proteins that (a) confer resistance to
antibiotics or other toxins, e.g., ampicillin, neomycin,
methotrexate, or tetracycline, (b) complement autotrophic
deficiencies, or (c) supply critical nutrients not available
from complex media, e.g., the gene encoding D-alanine racemase
for Bacilli.
An example of suitable selectable markers for mammalian
cells are those that enable the identification of cells
competent to take up the fusion protein-encoding nucleic acid,
such as DHFR or thymidine kinase. An appropriate host cell
when wild-type DHFR is employed is the CHO cell line deficient
in DHFR activity, prepared and propagated as described [Urlaub
and Chasin, Proc. Natl. Acad. Sci. USA, 77(7): 4216-20
(1980)]. A suitable selection gene for use in yeast is the
trpl gene present in the yeast plasmid YRp7 [Stinchcomb, et
al., Nature 282(5734): 39-43 (1979); Kingsman, et al., Gene
7(2): 141-52 (1979); Tschumper, et al., Gene 10(2): 157-66
(1980)]. The trpl gene provides a selection marker for a
mutant strain of yeast lacking the ability to grow in
tryptophan, for example, ATCC No. 44076 or PEPC1 [Jones,
Genetics 85: 23-33 (1977)].
Expression and cloning vectors usually contain a promoter
operably linked to the fusion protein-encoding nucleic acid
sequence to direct mRNA synthesis. Promoters recognized by a
variety of potential host cells are well known. Promoters
suitable for use with prokaryotic hosts include the ß-
lactamase and lactose promoter systems [Chang, et al., Nature
275(5681): 617-24 (1978); Goeddel, et al., Nature 281(5732):
544-8 (1979)], alkaline phosphatase, a tryptophan (up)
promoter system [Goeddel, Nucleic Acids Res. 8(18): 4057-74
(1980); EP 36,776 published 30 September 1981], and hybrid
promoters such as the tat promoter [deBoer, et al., Proc.
Natl. Acad. Sci. USA 80(1): 21-5 (1983)]. Promoters for use
in bacterial systems also will contain a Shine-Dalgarno (S.D.)
sequence operably linked to the DNA encoding the fusion
protein.
Examples of suitable promoting sequences for use with
yeast hosts include the promoters for 3-phosphoglycerate
kinase [Hitzeman, et al., J. Biol. Chem. 255(24): 12073-80
(1980)] or other glycolytic enzymes [Hess et al., J. Adv.
Enzyme Reg. 7: 149 (1968); Holland, Biochemistry 17(23) : 4900-
7 (1978)], such as enolase, glyceraldehyde-3-phosphate
dehydrogenase, hexokinase, pyruvate decarboxylase,
phosphofructokinase, glucose-6-phosphate isomerase, 3-
phosphoglycerate mutase, pyruvate kinase, triosephosphate
isomerase, phosphoglucose isomerase, and glucokinase.
Other yeast promoters, which are inducible promoters
having the additional advantage of transcription controlled by
growth conditions, are the promoter regions for alcohol
dehydrogenase 2, isocytochrome C, acid phosphatase,
degradative enzymes associated with nitrogen metabolism,
metallothionein, glyceraldehyde-3-phosphate dehydrogenase, and
enzymes responsible for maltose and galactose utilization.
Suitable vectors and promoters for use in yeast expression are
further described in EP 73,657. Transcription of fusion
protein-encoding mRNA from vectors in mammalian host cells may
be controlled, for example, by promoters obtained from the
genomes of viruses such as polyoma virus, fowlpox virus,
adenovirus (such as Adenovirus 2) , bovine papilloma virus,
avian sarcoma virus, cytomegalovirus, a retrovirus, hepatitis-
B virus and Simian Virus 40 (SV40) , from heterologous
mammalian promoters, e.g., the actin promoter or an
immunoglobulin promoter, and from heat-shock promoters,
provided such promoters are compatible with the host cell
systems.
Transcription of a polynucleotide encoding a fusion
protein by higher eukaryotes may be increased by inserting an
enhancer sequence into the vector. Enhancers are cis-acting
elements of DNA, usually about from 10 to 300 bp, that act on
a promoter to increase its transcription. Many enhancer
sequences are now known from mammalian genes (globin,
elastase, albumin, a-ketoprotein, and insulin). Typically,
however, one will use an enhancer from a eukaryotic cell
virus. Examples include the SV40 enhancer on the late side of
the replication origin (bp 100-270), the cytomegalovirus early
promoter enhancer, the polyoma enhancer on the late side of
the replication origin, and adenovirus enhancers. The
enhancer may be spliced into the vector at a position 5' or 3'
to the fusion protein coding sequence but is preferably
located at a site 5' from the promoter.
Expression vectors used in eukaryotic host cells (yeast,
fungi, insect, plant, animal, human, or nucleated cells from
other multicellular organisms) will also contain sequences
necessary for the termination of transcription and for
stabilizing the mRNA. Such sequences are commonly available
from the 5' and occasionally 3' untranslated regions of
eukaryotic or viral DNAs or cDNAs. These regions contain
nucleotide segments transcribed as polyadenylated fragments in
the untranslated portion of the mRNA encoding the fusion
protein.
Various forms of a fusion protein may be recovered from
culture medium or from host cell lysates. If membrane-bound,
it can be released from the membrane using a suitable
detergent solution (e.g., Triton-X 100) or by enzymatic
cleavage. Cells employed in expression of a fusion protein
can be disrupted by various physical or chemical means, such
as freeze-thaw cycling, sonication, mechanical disruption, or
cell lysing agents.
Purification of the heterologous fusion proteins of the
present invention:
Once the heterologous fusion proteins of the present
invention are expressed in the appropriate host cell, the
analogs can be isolated and purified. The following
procedures are exemplary of suitable purification procedures:
fractionation on carboxymethyl cellulose; gel filtration such
as Sephadex G-75; anion exchange resin such as DEAE or Mono-Q;
cation exchange such as CM or Mono-S; protein A sepharose to
remove contaminants such as IgG; metal chelating columns to
bind epitope-tagged forms of the polypeptide; reversed-phase
HPLC; chromatofocusing; silica gel; ethanol precipitation; and
ammonium sulfate precipitation.
Various methods of protein purification may be employed
and such methods are known in the art and described, for
example, in Deutscher, Methods in Enzymology 182: 83-9 (1990)
and Scopes, Protein Purification: Principles and Practice,
Springer-Verlag, NY (1982). The purification step(s) selected
will depend on the nature of the production process used and
the particular fusion protein produced. For example, fusion
proteins comprising an Fc fragment can be effectively purified
using a Protein A or Protein G affinity matix. Low or high pH
buffers can be used to elute the fusion protein from the
affinity matrix. Mild elution conditions will aid in
preventing irreversible denaturation of the fusion protein.
Imidazole-containing buffers can also be used. Example 3
describes some successful purification protocols for the
fusion proteins of the present invention.
Characterization of the heterologous fusion proteins of the
present invention:
Numerous methods exist to characterize the fusion
proteins of the present invention. Some of these methods
include: SDS-PAGE coupled with protein staining methods or
immunoblotting using anti-IgG or anti-HSA antibodies. Other
methods include matrix assisted laser desporption/ionization-
mass spectrometry (MALDI-MS), liquid chromatography/mass
spectrometry, isoelectric focusing, analytical anion exchange,
chromatofocussing, and circular dichroism to name a few. A
representative number of heterologous fusion proteins were
characterized using SDS-PAGE coupled with immunoblotting as
well as mass spectrometry (See examples 4 and 5 and figures 3
and 4).
For example table 3 (see example 5) illustrates the
calculated molecular mass for a representative number of
fusion proteins as well as the mass as determined by mass
spectrometry. In addition, Figures 3 and 4 illustrate
molecular weights of a representative number of fusion
proteins as determined by SDS PAGE- All heterologous fusion
proteins tested were expressed and secreted transiently. In
addition, the IgK signal sequence was cleaved to yield
proteins with the correct N-terminus.
Further, table 3 illustrates that in some instances the
mass determined by mass spectrometry is greater than expected.
This is the result of glycosylation of the Fc portion and the
C terminal extension. Enzymatic digestion of the fusion
proteins followed by reversed-phase HPLC and mass spectrometry
can identify peptide fractions that contain sugar moieties.
These fractions can then be N-terminal amino acid sequenced to
identify the potential glycosylation site. For example,
characterization of Exendin-4-Fc (SEQ ID NO: 29) shows that
the serine at position 39 and threonine at position 50 are O-
linked glycosylated and the asaparagine at position 122 is N-
linked glycosylated.
A representative number of GLP-1 fusion proteins were
also tested for activity. Numerous methods exist to detect
GLP-1 activity in vitro and in vivo (see examples 6, 7, 8,and
9). Table 4 (example 6) illustrates GLP-1 receptor activity
associated with several GLP-1 fusions. The numbers are
relative to the activity associated with Val8 -GLP-1(7-37)OH.
All fusion proteins tested had GLP-1 receptor activity. A low
level of in vitro activity is not necessarily indicative of a
weak effect in vivo. Because of the substantial increase in
the half-life of these fusion proteins, weak in vitro activity
is not generally a predictor of weak in vivo activity. Figure
7 and example 7 illustrate the prolonged half-life associated
with the fusion proteins of the present invention. For
example, Val8-GLP-1-Fc had a half-life of approximately 45
hours in monkeys, Val8-GLP-1-HSA had a half-life of about 87
hours in monkeys, Gly8-Glu22-GLP-1-CEx-Linker-IgG1 had a half-
life after IV administration of approximately 55 hours in
dogs, and Gly8-Glu32-GLP-1-CEx-Linker-IgGl had a half-life
after SC administration of approximately 38 hours in dogs.
Compositions of the invention:
Physical stability is also an essential feature for
therapeutic protein formulations. GLP-1 compounds have been
especially difficult to manufacture and formulate due to
structural changes that occur during processing. For example,
some GLP-1 compounds have a general tendency to aggregate. In
addition, it has been shown that some GLP-1 compounds convert
from a soluble and active a-helix form to an insoluble and
potentially inactive ß-sheet form. The fusion of GLP-1
compounds to large proteins such as the Fc region of an IgG or
albumin not only acts to increase the half-life of the GLP-1
compound, but also contributes to the physical and
conformational stability of the GLP-1 compound. For example,
Val8-GLP-1-Linker-HSA in PBS is stable at 37°C out to about 30
days.
The heterologous fusion proteins of the present invention
may be formulated with one or more excipients. The active
fusion proteins of the present invention may be combined with
a pharmaceutically acceptable buffer, and the pH adjusted to
provide acceptable stability, and a pH acceptable for
administration such as parenteral administration.
Optionally, one or more pharmaceutically-acceptable anti-
microbial agents may be added. Meta-cresol and phenol are
preferred pharmaceutically-acceptable microbial agents. One
or more pharmaceutically-acceptable salts may be added to
adjust the ionic strength or tonicity. One or more excipients
may be added to further adjust the isotonicity of the
formulation. Glycerin is an example of an isotonicity-
adjusting excipient. Pharmaceutically acceptable means
suitable for administration to a human or other animal and
thus, does not contain toxic elements or undesirable
contaminants and does not interfere with the activity of the
active compounds therein.
A pharmaceutically-acceptable salt form of the
heterologous fusion proteins of the present invention may be
used in the present invention. Acids commonly employed to
form acid addition salts are inorganic acids such as
hydrochloric acid, hydrobromic acid, hydriodic acid, sulfuric
acid, phosphoric acid, and the like, and organic acids such as
p-toluenesulfonic acid, methanesulfonic acid, oxalic acid, p-
bromophenyl-sulfonic acid, carbonic acid, succinic acid,
citric acid, benzoic acid, acetic acid, and the like.
Preferred acid addition salts are those formed with mineral
acids such as hydrochloric acid and hydrobromic acid.
Base addition salts include those derived from inorganic
bases, such as ammonium or alkali or alkaline earth metal
hydroxides, carbonates, bicarbonates, and the like. Such
bases useful in preparing the salts of this invention thus
include sodium hydroxide, potassium hydroxide, ammonium
hydroxide, potassium carbonate, and the like.
Administration of Compositions:
Administration may be via any route known to be effective
by the physician of ordinary skill. Peripheral, parenteral is
one such method. Parenteral administration is commonly
understood in the medical literature as the injection of a
dosage form into the body by a sterile syringe or some other
mechanical device such as an infusion pump. Peripheral
parenteral routes can include intravenous, intramuscular,
subcutaneous, and intraperitoneal routes of administration.
The heterologous fusion proteins of the present invention
may also be amenable to administration by oral, rectal, nasal,
or lower respiratory routes, which are non-parenteral routes.
Of these non-parenteral routes, the lower respiratory route
and the oral route are preferred.
The fusion proteins of the present invention can be used
to treat a wide variety of diseases and conditions. The
fusion proteins of the present invention primarily exert their
biological effects by acting at a receptor referred to as the
"GLP-1 receptor." Subjects with diseases and/or conditions
that respond favorably to GLP-1 receptor stimulation or to the
administration of GLP-1 compounds can therefore be treated
with the GLP-1 fusion proteins of the present invention.
These subjects are said to "be in need of treatment with GLP-1
compounds" or "in need of GLP-1 receptor stimulation".
Included are subjects with non-insulin dependent diabetes,
insulin dependent diabetes, stroke (see WO 00/16797),
myocardial infarction (see WO 98/08531), obesity (see WO
98/19698), catabolic changes after surgery (see U.S. Patent
No. 6,006,753), functional dyspepsia and irritable bowel
syndrome (see WO 99/64060) . Also included are subjects
requiring prophylactic treatment with a GLP-1 compound, e.g.,
subjects at risk for developing non-insulin dependent diabetes
(see WO 00/07617). Subjects with impaired glucose tolerance
or impaired fasting glucose, subjects whose body weight is
about 25% above normal body weight for the subject's height
and body build, subjects with a partial pancreatectomy,
subjects having one or more parents with non-insulin dependent
diabetes, subjects who have had gestational diabetes and
subjects who have had acute or chronic pancreatitis are at
risk for developing non-insulin dependent diabetes.
An "effective amount" of a GLP-1 compound is the
quantity which results in a desired therapeutic and/or
prophylactic effect without causing unacceptable side-
effects when administered to a subject in need of GLP-1
receptor stimulation. A "desired therapeutic effect"
includes one or more of the following: 1) an amelioration of
the symptom(s) associated with the disease or condition; 2)
a delay in the onset of symptoms associated with the disease
or condition; 3) increased longevity compared with the
absence of the treatment; and 4) greater quality of life
compared with the absence of the treatment. For example, an
"effective amount" of a GLP-1 compound for the treatment of
diabetes is the quantity that would result in greater
control of blood glucose concentration than in the absence
of treatment, thereby resulting in a delay in the onset of
diabetic complications such as retinopathy, neuropathy or
kidney disease. An "effective amount" of a GLP-1 compound
for the prevention of diabetes is the quantity that would
delay, compared with the absence of treatment, the onset of
elevated blood glucose levels that require treatment with
anti-hypoglycaemic drugs such as sulfonyl ureas,
thiazolidinediones, insulin and/or bisguanidines.
The dose of fusion protein effective to normalize a
patient's blood glucose will depend on a number of factors,
among which are included, without limitation, the subject's
sex, weight and age, the severity of inability to regulate
blood glucose, the route of administration and
bioavailability, the pharmacokinetic profile of the fusion
protein, the potency, and the formulation.
The present invention comprises GLP-1 compounds that
have improved biochemical and biophysical properties by
virtue of being fused to an albumin protein, an albumin
fragment, an albumin analog, a Fc protein, a Fc fragment, or
a Fc analog. These heterologous proteins can be
successfully expressed in host cells, retain signaling
activities associated with activation of the GLP-1 receptor,
and have prolonged half-lives.
The following examples are presented to further
describe the present invention. The scope of the present
invention is not to be construed as merely consisting of the
following examples. Those skilled in the art will recognize
that the particular reagents, equipment, and procedures
described are merely illustrative and are not intended to
limit the present invention in any manner.
Example 1; Construction of DNA
encoding heterologous fusion proteins
Example la Construction of DNA encoding Val8-GLP-K7-37)-
Fc: A Fc portion of human IgG1 was isolated from a
cDNA library and contains the full hinge region and the CH2
and CH3 domains. A fragment: containing 696 base pairs of
this Fc portion of human IgGl was subcloned into the NheI
and Eco47III sites of mammalian expression vector pJBO2 to
create pJB02/Fc (see Figure 5). DNA encoding the Ig?
secretion signal sequence fused to Val8-GLP-1(7-37) was
generated by in vitro hybridization of four overlapping and
complementary oligonucleotides:
5' - CTAGCCACCATGGAGACAGACACACTCCTGCTATGGGTACTGCTGCTCTGGGTT
CCAGGTTCCACTGGTGACCAGTG - 3' [SEQ ID NO: 12]
5' - GAGGGCACCTTCACCTCCGACGTGTCCTCCTATCTGGAGGGCCAGGCCGCCAAGGA
GTTCATCGCCTGGCTGGTGAAGGGAAGAGGC - 3' [SEQ ID NO: 13]
5' - TGAAGGTGCCCTCCACGTGGTCACCAGTGGAACCTGGAACCCAGAGCAGCAGTA
CCCATAGCAGGAGTGTGTCTGTCTCCATGGTGG - 3' [SEQ ID
NO:14]
5' - GCCTCTTTCCCTTCACCAGCCAGGCGATGAACTCCrTGGCGGCCTGGCCCTCCAGA
TAGGAGGACACGTCGGAGG - 3' [SEQ ID NO:15]
The hybridization reaction was carried out using
equivalent amounts of each oligonucleotide (1 pm/µl final
concentration for each oligo) . The mixture of
oligonucleotides was heated for 5 min at 100°C in ligation
buffer (50 mM Tris-HCl, pH 7.5, 10 mM MgCl2, 10 mM DTT, 1mM
ATP, 25 µg/ml bovine serum albumin) and then cooled over at
least 2 hours to 30°C.
The resulting hybridization product was ligated for 2
hours at room temperature or overnight at 16°C to the
pJB02/Fc vector backbone which had been digested with NheI
and Eco47III. The ligation products were used to transform
competent XL-1 Blue cells (Stratagene). Recombinant
plasmids were screened for the presence of peptide coding
inserts by digesting clones with NcoI (encoding the Kozak
sequence and first Met of the signal peptide) and sequenced.
The resulting expression plasmid used for transfection
assays was denoted pJB02-V8-GLP-1-Fc (Figure 5).
Example 1b Construction of DNA encoding Val8-GLP-K7-37)-
HSA: The plasmid HSA/pcDNA3. 1GS was purchased from
Invitrogen (Catalog # H-M12523M-pcDNA3.1/GS) and used as a
template to isolate the cDNA encoding human serum albumin
(HSA) . The HSA cDNA was prepared using PCR wherein the DNA
encoding the leader sequence as well as the six amino acid
pro-peptide was removed from the 5' end. In addition, stop
codons were added directly at the 3' end of the HSA coding
sequence. Finally, restriction enzyme sites were engineered
at the 5' and 3' end to facilitate cloning. The HSA DNA
sequence present in the original vector purchased from
Invitrogen contained a single base change in the 3' region
of the gene (position 667) compared to the native human
sequence. This change would result in a codon for Asn
instead of Asp. Thus, using the strand overlapping PCR
mutagenesis method discussed above, the codon was changed to
code for Asp at this position. The resulting HSA encoding
DNA was cloned into the NheI and HindIII sites of pJB02 to
create pJB02-HSA (Figure 6).
The IgK leader sequence fused to the Val8 -GLP-(7-37)
sequence was generated as discussed in Example 1a. This DNA
was ligated into the NheI and FspI sites of pJB02-HSA to
create pJB02- Val8-GLP-1-HSA.
Example lc Construction of DNA encoding Val8-GLP-K7-37)-
linker-HSA:
The vector pJB02-HSA was prepared as discussed in
Example lb. DNA encoding the linker sequence [GGGGS]3 was
ligated in frame to the 5' end of the HSA encoding DNA to
create pJB02-linker-HSA (Figure 7). DNA encoding the Ig?
leader sequence and fused to the Val8-GLP-1(7-37) sequence
and the 5' part of the linker sequence was generated as
discussed in Example la. This DNA was ligated into the NheI
and BspEI sites of pJB02 to create pJB02- Val8-GLP-1-linker-
HSA.
Example 1d Construction of DNA encoding Exendin-4-Fc:
The plasmid pJB02/Fc was prepared as described in
Example 1a. DNA encoding the Ig? signal sequence fused to
Exending-4 was generated by in vitro hybridization of the
- following overlapping and complementary oligonucleotides:
5' - CTAGCCACCATGGAGACAGACACACTCCTGCTATGGGTACTGCTGCTCTG
GGTTCCAGGTTCCACCGGTCAC - 3' [SEQ ID NO: 16]
- 5' - GGAGAGGGAACCTTCACCAGCGACCTGAGCAAGCAGATGGAGGAGGAGGCCGT
GAGACTG - 3' [SEQ ID NO: 17]
5' - TTCATCGAGTGGCTGAAGAACGGAGGACCAAGCAGCGGAGCCCCTCCTCCT
AGC - 3' [SEQ ID NO: 18]
5' - GAACCTGGAACCCAGAGCAGCAGTACCCATAGCAGGAGTGTGTCTGTCTCCA
TGGTGG - 3' [SEQ ID NO:19]
5' - CTCCTCCTCCATCTGCTTGCTCAGGTCGCTGGTGAAGGTTCCCTCTCCGTGA
CCGGTG - 3' [SEQ ID NO:20]
5' - GCTAGGAGGAGGGGCTCCGCTGCTTGGTCCTCCGTTCTTCAGCCACTCGAT
GAACAGTCTCACGGC - 3' [SEQ ID NO:21]
The hybridization reaction was carried out as described
in Example la. . The hybridized product was ligated to the
pJB02 vector which had been digested with NheI and Eco47III
as described in Example la to create pJB02-Exendin-4-Fc.
Example 1e Construction of DNA encoding Exendin-4-HSA:
The plasmid pJB02-HSA was prepared as described in
Example 1b. DNA encoding the Ig? signal sequence fused to
Exending-4 was generated by in vitro hybridization of the
same overlapping and complementary oligonucleotides
described in Example 1d. Hybridization reactions were also
carried out as described above. DNA was cloned into unique
NheI and FspI sites in pJB02-HSA to create pJB02-Exendin-4-
HSA.
Example 1f Construction of DNA encoding Exendin-4-linker-
HSA:
The plasmid pJB02-linker-HSA was constructed as
described in Example 1c. DNA encoding the IgK signal
sequence fused to Exendin-4 and the 5' part of the linker
sequence was generated as in Example 1d. This DNA was
cloned into unique NheI and BspEI sites in pJB02-linker-HSA
to create pJB02-Exendin-4-linker-HSA.
Example 1g Construction of DNA encoding Val8-GLP-1/C-Ex-Fc:
The plasmid pJB02-Exendin-4-Fc was prepared as
described in Example 1d. The Exendin-4 encoding DNA was
excised from the vector with AgeI and Eco47III. The Val8-
GLP-1/C-Ex encoding DNA was generated by in vitro
hybridization of the following overlapping and complementary
oligonucleotides:
5' -CCGGTCACGTGGAGGGCACCTTCACCTCCGACGTGTCCTCCTATCTGGA
GGGCCAGGCCGCCA - 3' [SEQ ID NO:22]
5' - AGGAATTCATCGCCTGGCTGGTGAAGGGCCGGGGCAGCAGCGG
AGCCCCTCCTCCTAGC - 3' [SEQ ID NO:23]
5' - CTCCAGATAGGAGGACACGTCGGAGGTGAAGGTGCCCTCCAC
GTGA - 3' [SEQ ID NO:24]
5' - GCTAGGAGGAGGGGCTCCGCTGCTGCCCCGGCCCTTCACCAGCCAGGCGA
TGAATTCCTTGGCGGCCTGGCC - 3' [SEQ ID NO:25]
The hybridization reaction was carried out as described
in Example la. The hybridized product was ligated in place
of Exendin-4 in the pJB02-Exendin-4-Fc expression vector to
create pJB02-Val8-GLP-1/C-Ex-Fc.
Example 1h Construction of DNA encoding Val8-Glu22-GLP-1-Fc:
The plasmid pJB02-Exendin-4-Fc was prepared as
described in Example 1d. The Exendin-4 encoding DNA was
excised from the vector with AgeI and Eco47III. The Val8-
Glu22-GLP-1 encoding DNA was generated by in vitro
hybridization of the following overlapping and complementary
oligonucleotides:
5' -CCGGTCACGTGGAGGGCACCTTCACCTCCGACGTGTCCTCCTATCTCGA
GGAGCAGGCCGCCA - 3' [SEQ ID NO:26]
5' - AGGAGTTCATCGCCTGGCTGGTGAAGGGCCGGGGC - 3' [SEQ ID NO:27]
5' - GCCCCGGCCCTTCACCAGCCAGGCGATGAACTCCTTGGCGGCC
TGCTC - 3' [SEQ ID NO:28]
5' - CTCGAGATAGGAGGACACGTCGGAGGTGAAGGTGCCCT
CCACGTGA - 3' [SEQ ID NO:29]
The hybridization reaction was carried out as described
in Example 1a. The hybridized product was ligated in place
of Exendin-4 in the pJB02-Exendin-4-Fc expression vector to
create pJB02-Val8 -Glu22 -GLP-1-Fc.
Example 1i Construction of DNA encoding Val8 -Glu22GLP-1/C-
Ex-Fc:
The plasmid pJB02-Exendin-4-Fc was prepared as
described in Example 1d. The Exendin-4 encoding DNA was
excised from the vector with AgeI and Eco47III. The Val8-
Glu22 GLP-1/C-Ex encoding DNA was generated by in vitro
hybridization of the following overlapping and complementary
oligonucleotides:
5' - CCGGTCACGTGGAGGGCACCTTCACCTCCGACGTGTCCTCCTATCTCGA
GGAGCAGGCCGCCA - 3' [SEQ ID NO:30]
5' - AGGAATTCATCGCCTGGCTGGTGAAGGGCCGGGGCAGCAGCGGA
GCCCCTCCTCCTAGC - 3' [SEQ ID NO:31]
5' - CTCGAGATAGGAGGACACGTCGGAGGTGAAGGTGCCC
TCCACGTGA - 3'[SEQ ID NO:32]
5' - GCTAGGAGGAGGGGCTCCGCTGCTGCCCCGGCCCTTCACCAGCCAGGCGA
TGAATTCCTTGGCGGCCTGCTC - 3' [SEQ ID NO:33]
The hybridization reaction was carried out as described
in Example 1a. The hybridized product was ligated in place
of Exendin-4 in the pJB02-Exendin-4-Fc expression vector to
create pJB02-Val8-Glu-GLP-1/C-Ex-Fc.
Example 1j Construction of DNA encoding Gly8-GLP-1-Fc:
The plasmid pJB02-Exendin-4-Fc was prepared as
described in Example 1d. The Exendin-4 encoding DNA was
excised from the vector with AgeI and Eco47III. The Gly8-
GLP-1 encoding DNA was generated by in vitro hybridization
of the following overlapping and complementary
oligonucleotides:
5' - CCGGTCACGGCGAGGGCACCTTCACTAGTGACGTGTCCTCCTATCTGGA
GGGCCAGGCCGCCA - 3' [SEQ ID NO:34]
5' - AGGAGTTCATCGCCTGGCTGGTGAAGGGCCGGGGC - 3' [SEQ ID NO:35]
5' - CTCCAGATAGGAGGACACGTCACTAGTGAAGGTGCCCTC
GCCGTGA - 3' [SEQ ID NO:36]
5' - GCCCCGGCCCTTCACCAGCCAGGCGATGAACTCCTTGGCGGC
CTGGCC - 3' [SEQ ID NO:37]
The hybridization reaction was carried out as described
in Example 1a. The hybridized product was ligated in place
of Exendin-4 in the pJB02-Exendin-4-Fc expression vector to
create pJB02-Gly8-GLP-1-Fc.
Example 2: Expression of heterologous fusion proteins
Expression of the fusion proteins encoded by the DNA
constructs of Example 1 was carried out by transiently
transfecting HEK 293EBNA cells (both adherent and
suspension). Cells were counted and seeded 24 hours prior
to transfection. The transfection cocktail was prepared by
mixing FuGene™6 transfection reagent (Roche Molecular
Biochemicals, catalog # 1814443) with OptiMEM (Gibco/BRL)
and incubating at room temperature for 5 min at which point
DNA was added and the cocktail was incubated for an
additional 15 min. Immediately before transfection, fresh
growth media was added to the plate. Tables 1 and 2 provide
further transfection details.
Table 1: Reagents used in transient transfections of 293EBNA
cells.
Tissue culture vessel Number of cells seeded DNA (µg) FuGene (µl) OptiMEM media (ml) Vol. of growth medium (ml)
35 mm 5X10 5 1.5 9 0.102 2
100 mm 2 X 10 6 12 73 0.820 10
700 cm2 (RB) 2 X 10 7 65 400 4.0 100
Table 2: Media composition
Growth and transfaction medium Harvesting medium
DMEM F12 3:1 Hybritech base
5 % FBS 1 mK Ca 2+
20 mM HEPES 20 mM HEPES
2 mM L-glutamine 1 µg/ml Nuselin (human insulin)
50 µg/ml geneticin (G418 NEO) 1 µg/ml human transferrin
50 µg/ml tobronycin 50 µg/ml tobromycin
For small-scale transfections (35mm - 10mm vessels),
cells were rinsed with PBS and switched to harvesting media
24 hours post- transfection and media was collected and
replaced every 24 hours for several days. In the case of
large-scale transfections (700 cm2 roller bottles), the
roller bottles were rinsed with PBS 48 hours post-
transfection and changed to harvesting media. Media was
collected and changed every 24 hours for at least 10
consecutive days. Routinely, only 10 harvests were used for
subsequent protein purification.
Example 3: Purification of heterologous fusion proteins
Example 3a purification of Val-GLP-1-Fc
Approximately 4.5 liters of conditioned medium (fusion
protein expression level approximately 20 µg/ml) from large-
scale transfections was filtered using a CUNO filter system
and concentrated to 250 ml using a ProFlux tangential flow
filtration system with a 10 K filter membrane. Val8-GLP-1-Fc
was captured with a 5 ml HiTrap protein A column in 1x PBS,
pH 7.4 at a flow rate of 2 ml/min and eluted with 50 mM
citric acid pH 3.3. Fractions (1 ml) were collected in tubes
containing 4 ml lx PBS and 100µl 1M Tris pH 8.
Fractions containing the fusion protein, as determined
by SDS-PAGE and reverse phase-HPLC on Zorbax C8, were pooled
and applied to a Superdex 75 60/60 column in 1x PBS pH 7.4
at a flow rate of 10 ml/min. Positive fractions (20
mis/tube) were collected and pooled. Pooled fractions were
then subjected to C4 Reverse Phase Chromatography in 0.1
%TFA water at a flow rate of 3 ml/min. Val8-GLP-1-Fc was
eluted using a gradient from 5% B (0.1% TFA in acetonitrile)
to 100% B in 70 min. Eluant fractions (3 mis/tube) were
collected. Acetonitrile was removed by vacuum drying and 1
ml of H2O was added. The purified sample (approximately 32
mls) was dialyzed twice against 4 liters of lx PBS pH7.4.
The dialyzed sample was then filtered using a MILLEX-GV
0.22 urn Filter Unit and concentration was determined using
absorption at 280 nm.
Example 3b purification of Val8-GLP-1-HSA or Val8-GLP-1-
Linker-HSA
Approximately 6.5 liters of conditioned medium (fusion
protein expression level approximately 10µg/ml) was filtered
using a CUNO filter system and concentrated to 380 mls using
a ProFlux tangential flow filtration system with a 10 K
filter membrane.
The fusion protein was captured using a 50 ml Past Flow
Q column (Pharmacia) in 20 mM Tris pH 7.4 at a flow rate of
5ml/min. Protein was eluted using a gradient: from 0% to 50%
20mM Tris pH 7.4, 1M NaCl in 10 CV, then to 100%B in 2 CV.
Fractions containing the fusion protein were pooled and
subjected to C4 Reverse Phase Chromatography in 0.1% TFA
water at a flow rate of 5 ml/min. The fusion protein was
eluted using a gradient from 20% B (0.1% TFA in
acetonitrile) to 90% B in 120min. Fractions (3.5 ml/tube)
were collected. Acetonitrile was removed by vacuum drying.
Approximately 9 mls of pooled sample was diluted with
1x PBS pH 7.4 to 40ml and dialyzed against 4 liters of 1x
PBS pH 7.4 overnight. The sample was filtered and
concentration was determined by absorption at 280nm.
Example 3c purification of Exendin-4-Fc:
Approximately 4 liters of conditioned medium (fusion
protein expression level approximately 8 µg/ml) was filtered
using a CUNO filter system and concentrated to 250 mls using
a ProFlux tangential flow filtration system with a 3OK
filter membrane.
Exendin-4-Fc was captured with a 5 ml HiTrap protein A
column in lx PBS, pH 7.4 at a flow rate of 2 ml/min and
eluted with 50 mM citric acid pH 3.3. Fractions containing
the fusion protein were pooled, filtered, and dialyzed
against 4 liters of 1 x PBS over night. The dialyzed sample
was then applied to a Superdex 75 60/60 column in lx PBS
PH7.4, 0.5M NaCl at a flow rate of 10 ml/min. Fractions (20
ml/tube) containing the fusion protein were collected,
pooled, and concentrated to about 1 mg/ml. Concentrated
samples were then filtered using a MILLEX-GV 0.22 urn Filter
Unit.
Example 3d purification of Exendin-4-HSA and Exendin-4-
linker-HSA:
Approximately 1.1 liters of conditioned medium (fusion
protein expression level approximately 6µg/ml) was filtered
using a CUNO filter system and concentrated to 175 mls using
a ProFlux tangential flow filtration system with a 30k
filter membrane.
The fusion protein was captured using a 5 ml HiTrap Q-
sepharose column (Pharmacia) in 20 mM Tris pH 7.4 at a flow
rate of 2 ml/min. Protein was eluted using a gradient from
0% to 50% 20rnM Tris pH 7.4, 1M NaCl in 12 CV and then to
100%B in 4 CV.
Fractions containing the fusion protein were pooled and
subjected to C4 Reverse Phase Chromatography in 0.1% TFA
water at a flow rate of 5 ml/min. The fusion protein was
eluted using a gradient from 10% B (0.1% TFA in
acetonitrile) to 100% B in 70 min. Fractions (10 ml/tube)
containing the fusion protein were collected. Acetonitrile
was removed using a vacuum dryer.
Approximately 8 mls of pooled sample was dialyzed
against 4 liters of 1x PBS pH 7.4 overnight. The sample was
filtered and concentration was determined by absorption at
280nm. The dialyzed sample was then applied to a Superdex
200 26/60 column in 1x PBS pH 7.4, 0.5 M NaCl at a flow rate
of 2 ml/min. Fractions (3 ml/tube) containing the fusion
protein were collected, pooled, concentrated, and filtered.
Example 4: Characterization of fusion proteins by SDS PAGE:
SDS-PAGE followed by immunoblotting was used to analyze
both purified fusion protein as well as conditioned medium
from cells transfected with various fusion protein
expression vectors. SDS-PAGE was performed on a Novex
Powerease 500 system using Novex 16% Tris-Glycine Precast
gels (EC6498), running buffer (10x, LC2675) and sample
buffer (L2676) . Samples were reduced with 50 mM DTT and
heated 3-5 min at 95°C prior to loading.
After running the SDS-PAGE gel, water and transfer
buffer (1X Tris-Glycine Seprabuff (Owl Scientific Cat. No.
ER26-S) with 20% methanol) were used to rinse SDS from the
gels. A Novex transfer apparatus was used with PVDF (BioRad,
Cat. No. 162-0174) and nitrocellulose membranes (BioRad,
Cat. No. 1703965 or 1703932). Transfer was carried out at
room temperature for 90 min at 30-35 V. Membranes were
blocked in 1X PBS with 0.1% Tween-20 (Sigma, Cat. No. P-
7949) and 5% Milk (BioRad, Cat. No. 170-6404) for 1-12 hours
at 4°C. Antibodies are diluted into 1x PBS +5% Milk and the
blots are incubated in these solutions for 1-2 h at 4°C.
Between incubations, the blots are washed four times for 5
min each with 1X PBS and 0.2% Tween-20 at room temperature.
PBS was made from either GIBCO 10X PBS (Cat No. 70011), to
give a final composition of 1 mM monobasic potassium
phosphate, 3 mM dibasic sodium phosphate, 153 mM sodium
chloride, pH 7.4, or PBS pouches from Sigma (Cat. No. 1000-
3), to give 120 mM NaCl, 2.7 mM KC1 and 10 mM phosphate, pH
7.4 at 25°C.
The primary antibodies were either a polycolonal goat
anti-IgG1 or rabbit anti-HSA. The secondary antibody was
either an anti-goat IgG HRP or an anti-rabbit IgG HRP. The
secondary antibody was diluted 1:5000. An BCL system
(Amersham Pharmacia Biotech, Cat. No. RN2108 and Cat. No.
RPN1674H) was used for developing blots.
Figure 3A compares purified Pc protein to conditioned
media from pJB02-Val8-GLP-1-Fc and pJB02-Exendin-4-Fc
transfected cells. The decrease in mobility is consistent
with the increased size due to the GLP-1 portion of the
fusion protein. Figure 3B similarly compares purified HSA
with conditioned media from cells transfected with pJB02-
Val8-GLP-2-HSA, pJB02- Val8-GLP-1-Linker-HSA, pJB02-Exendin-
4-HSA, or pJB02-Exendin-4-Linker-HSA. Figure 4 identifies
purified fusion protein preparations.
Example 5; Characterization of fusion
proteins using mass spectrometry:
All experiments were performed on a Micromass TofSpec-
2E mass spectrometer equipped with Time Lag Focusing
electronics, a Reflectron (used in analysis of the 0-8000 Da
peptide range), a Linear detector (used during high mass /
good signal analysis), and Post Acceleration Detector (or
P.A.D., used for high mass / extremely low signal analysis)
The effective path length of the instrument in Linear mode
is 1.2 meters, in Reflectron mode it is 2.3 meters. Two
dual micro-channel plate detectors are fitted for linear and
reflectron mode detection. The laser used is a Laser
Science Inc. VSL-337i nitrogen laser operating at 337 nm at
5 laser shots per second. All data were acquired using a 2
GHz, 8 bit internal digitizer and up to 50 laser shots were
averaged per spectrum.
The instrument was operated in linear mode for the
analysis of the GLP-1 fusion proteins in question. The
linear detector is a device that detects ions that travel
down the flight tube of the MALDI-ToF-MS instrument. It
measures the ion abundance over time and sends a signal to
the digitizer for conversion. The digitizer is an analog-
to-digital converter that allows the signal from the mass
spectrometer to be transferred to the computer, where it is
reconstructed into a usable m/z spectrum.
A recrystallized saturated sinapinic acid solution
(diluted in 50/50 Acn / H2O and 0.1% TFA) was utilized as
the ionization matrix. Sinapinic acid is a proper matrix for
proteins above 10 kDa. Mass appropriate reference proteins
were used for internal and external calibration files in
order to obtain accurate mass determinations for the samples
analyzed. Samples were all analyzed using a 1:2 sample to
matrix dilution. The instrument was initially set up under
the following linear detector conditions:
Source Voltage: 20.0 keV Pulse Voltage: 3.0 keV
Extraction Voltage: 20.0 keV Laser Coarse: 50
Focus Voltage: 16.0 keV Laser Fine: 50
Linear detector: 3.7 keV
P.A.D.: (off line)
These settings were modified (as needed) to give the
best signal/noise ratio and highest resolution. Table 3
provides a characterization of different GLP-1 fusion
proteins.
CEx refers to a C-terminal extension and comprises the
sequence of Ser-Ser-Gly-Ala-Pro-Pro-Pro-Ser.
Linker is Gly-Gly-Gly-Gly-Ser-Gly-Gly-Gly-Gly-Ser-Gly- Gly-
Gly-Gly-Ser.
Example 6: Activity of heterologous fusion proteins:
The ability of the fusion proteins of the present
invention to activate the GLP-1 receptor was assessed using
in vitro assays such as those described in EP 619,322 to
Gelfand, et al., and D.S. Patent No. 5,120,712,
respectively. The activity of these compounds relative to
the activity of Val8-GLP-1(7-37)OH is reported in Table 4.
Figure 8 represents in vitro dose response curves for Val8-
GLP-1 and Exendin-4 fusion proteins. In addition, Table 5a
and 5b provide the in vitro activity of a large group of
GLP-1 analogs that can be fused to an Fc or an albumin
protein to make biologically active fusion proteins. These
activities are compared to GLP-1(7-37)OH.
Table 4: In vitro activity of GLP-1 fusion proteins
Fusion Protein In Vitro Activity (% of Val8-GLP-1)
Val8-GLP-1-IgG1 1
Exendin-4-IgG1 240
Val8-GLP-1-Linker-HSA 0.2
Exendin-4-HSA 20
Exendin-4-Linker-HSA 90
Exendin-4 500
Val8-Glu22-GLP-1-IgG1 3.7
Gly8-GLP-1-IgG1 3.3
Val8-GLP-1-CEx-IgG1 3.3
Val8-Glu-GLP-1-CEx-IgG1 29
Gly8-Glu22-GLP-1-C2-IgG1 75
Gly8-Glu22-GLP-1-CEx-Linker-IgG1 150
Exendin-4-C2-IgG1 250
Exendin-4-Linker-IgG1 330
Gly8-Glu22-GLP-1-CEx-Linker-HSA 4
Gly8-Glu22-GLP-1-CEx-Linker-IgG4 80
CEx refers to a C-terminal extension and comprises the
sequence of Ser-Ser-Gly-Ala-Pro-Pro-Pro-Ser.
Linker is Gly-Gly-Gly-Gly-Ser-Gly-Gly-Gly-Gly-Ser-Gly- Gly-
Gly-Gly-Ser
C2 is Ser-Ser-Gly-Ala-Ser-Ser-Gly-Ala.
The amino acid sequences of the fusion proteins
described in Tables 3 and 4 are represented in SED ID NO: 13
to SEQ ID NO: 31.
Val8-GLP-1-Human serum albumin amino acid sequence is
Val8-Ala16-GLP-1(7-37)OH 0.112
Val8-Tyr16-GLP-1(7-37)OH 1.175
Val8-Lys20-GLP-1(7-37)OH 0.33
Gln22-GLP-1(7-37)OH 0.42
Val8-Ala22-GLP-1(7-37)OH 0.56
Val8-Ser22-GLP-1(7-37)OH 0.50
Val8-Asp22-GLP-1(7-37)OH 0.40
Val8-Glu22-GLP-1(7-37)OH 1.29
Val8-Lys22-GLP-1(7-37)OH 0.58
Val8-Pro22-GLP-1(7-37)OH 0.01
Val8-His22-GLP-1(7-37)OH 0.14
Val8-Lys22-GLP-1(7-36)NH2 0.53
Val8-Glu22-GLP-1(7-36)NH2 1.0
Gly8-Glu22-GLP-1(7-37)OH 1.07
Val8-Lys23-GLP-1(7-37)OH 0.18
Val8-His24-GLP-1(7-37)OH 0.007
Val8-Lys24-GLP-1(7-37)OH 0.02
Val8-His26-GLP-1(7-37)OH 1.6
Val8-Glu26-GLP-1(7-37)OH 1.5
Val8-His27-GLP-1(7-37)OH 0.37
Val8-Ala27-GLP-1(7-37)OH 0.47
Gly8-Glu30-GLP-1(7-37)OH 0.29
Val8-Glu30-GLP-1(7-37)OH 0.29
Val8-Asp30-GLP-1(7-37)OH 0.15
Val8-Ser30-GLP-1(7-37)OH 0.19
Val8-His30-GLP-1(7-37)OH 0.19
Val8-Glu33-GLP-1(7-37)OH 0.039
Val8-Ala33-GLP-1(7-37)OH 0.1
Val8-Gly33-GLP-1(7-37)OH 0.01
Val8-Glu34-GLP-1(7-37)OH 0.17
Val8-Pro35-GLP-1(7-37)OH 0.094
Val8-His35-GLP-1(7-37)OH 0.41
Val8-Glu35-GLP-l(7-37)OH 0.15
Val8-Glu36-GLP-1(7-37)OH 0.11
Val8-His36-GLP-1(7-37)OH 0.22
Val8-His37-GLP-1(7-37)OH 0.33
Val8-Leu16-Glu26-GLP-1(7-37)OH 0.23
Val8-Lys22-Glu30-GLP-1(7-37)OH 0.37
Val8-Lys22-Glu23-GLP-1(7-37)OH 0.35
Val8-Glu22-Ala27-GLP-1(7-37)OH 1.02
Val8-Glu22-Lys23-GLP-1(7-37)OH 1.43
Val8-Lys33-Val34-GLP-1(7-37)OH 0.08
ValB-Lys33-Asn34-GLP-1(7-37)OH 0. 09
Val8-Gly34-Lys35-GLP-1(7-37)OH 0.34
Val8-Gly36-Pro37-GLP-1(7-37)NH2 0.53
8
Example 7: In vivo pharmacokinetics of Val -GLP-1-IgGl
and Val -GLP-1-HSA:
--------------8 8
A pharmacokinetic study of Val -GLP-1-lgGl and Val -
GLP-1-HSA was performed in cynomologus monkeys. Monkeys
8
were dosed at 5.6 nmoles/kg with either purified Val -GLP-1-
g
IgGl- or Val -GLP-1-HSA . The compounds were administered as
an intravenous bolus administration. Blood was collected
pre-dose and at 0.083, 0.25, 0.5, 1, 4, 8, 12, 24, 48, 72,
96, 120, 144, 168, and 216 hours post-dose into tubes
containing EDTA. Plasma concentrations of immunoreactive
8
Val -GLP-1 were determined using a radioimmunoassay that
utilizes a polyclonal antiserum whose primary specificity is
for the N-terminal (7-16) region of Val -GLP-K7-37) .
8
Figure 9 depicts the plasma concentration of Val -GLP-1-Fc
and Val -GLP-1-Linker-HSA following a single intravenous
dose to two cynomologus monkeys. The Fc fusion protein had
a half-life of approximately 45 hours and the albumin fusion
had a half-life of approximately 87 hours.
Example 8; In vivo pharmacodynamics of Exendin-4-IgG1:
Two chronically cannulated normal male beagle dogs were
studied after an overnight fast. Arterial and venous
vascular access ports were accessed, and a catheter was
inserted percutaneously into a cephalic vein and secured.
Animals were placed in cages, and their catheters were
attached to a swivel/tether system. A solution containing
the fusion protein Exendin-4-IgG1 (11.8 µm) was injected
intravenously (1.0 nmol/kg) through the cephalic vein
catheter. The catheter was then cleared with 10 ml of
saline. Two hours later, a hyperglycemic (150 mg/d1) clamp
was initiated and continued for three hours. Arterial blood
samples were drawn throughout this 5-hour period for
determination of plasma concentrations of the fusion
protein, glucose, and insulin.
The results of this study were compared to those from a
similar, previous study in which both of the animals had
received a bolus of saline, s.c, and three hours later were
studied using a 3-hour hyperglycemic (150 mg/dl) clamp.
In both sets of studies, plasma glucose concentrations
were determined using a Beckman glucose analyzer. Plasma
insulin concentrations were determined by employees of Linco
Research, Inc. using an RIA kit developed in their
laboratories. The data is illustrated in Figures 10 and 11.
Example 9: In vivo pharmacokinetics of
Gly8-Glu22-GLP-1-CEx-Linker-IgG1:
Two groups of three normal male beagle dogs received
0.1 mg/kg of Gly8-Glu22-GLP-1-CEx-Linker-IgGl by subcutaneous
(SC) or intravenous (IV) administration. Plasma
concentrations of Gly8-Glu22-GLP-1-CEx-Linker-IgG1
immunoreactivity were determined by radioimmunoassay in
samples collected from 30 minutes predose to 216 hours
postdose for both the IV and SC groups. These
concentrations were subsequently used to determine the
reported pharmacokinetic parameters. The mean elimination
half-life of IV administered Gly8-Glu22-GLP-1-CEx-Linker-IgG1
was approximately 55 hours and the total body clearance was
1.5 mL/h/kg. The mean elimination half-life of SC
administered Gly8-Glu22-GLP-1-CEx-Linker-IgGl was
approximately 38 hours.
We claim
1. A heterologous fusion protein comprising a first polypeptide with a N-terminus and
a C-terminus fused to a second polypeptide with a N-terminus and a C-terminus
wherein the first polypeptide is a GLP-1 compound and the second polypeptide is
selected from
a) the Fc portion of an immunoglobulin;
b) an analog of the Fc portion of an immunoglobulin; and
c) fragments of the Fc portion of an immunoglobulin
and wherein the C-terminus of the first polypeptide is fused to the N-terminus of the
second polypeptide.
2. The heterologous fusion protein of claim 1 wherein the C-terminus of the first
polypeptide is fused to the N-terminus of the second polypeptide via a peptide
linker.
3. The heterologous fusion protein of claim 2 wherein the peptide linker is selected
from
a) a glycine rich peptide;
b) a peptide having the sequence [Gly-Gly-Gly-Gly-Ser]n where n is 1, 2,
3, 4, 5 or 6; and
c) a peptide having the sequence [Gly-Gly-Gly-Gly-Ser]3
4. The heterologous fusion protein of any one of the preceding claims wherein the
GLP-1 compound comprises the sequence of formula 1 [SEQ ID NO: 2]
7 8 9 10 11 12 13 14 15 16 17
His-Xaa-Xaa-Gly-Xaa-Phe-Thr-Xaa-Asp-Xaa-Xaa-
18 19 20 21 22 23 24 25 26 27 28
Xaa-Xaa-Xaa-Xaa-Xaa-Xaa-Xaa-Xaa-Xaa-Xaa-Phe-
29 30 31 32 33 34 35 36 37 38 39
Ile-Xaa-Xaa-Xaa-Xaa-Xaa-Xaa-Xaa-Xaa-Xaa-Xaa-
40 41 42 43 44 45
Xaa-Xaa-Xaa-Xaa-Xaa-Xaa
Formula I (SEQ ID NO: 2)
wherein:
Xaa at position 8 is Ala, Gly, Ser, Thr, Leu, IIe, Val, Glu, Asp, or Lys;
Xaa at position 9 is Glu, Asp, or Lys;
Xaa at position 11 is Thr, Ala, Gly, Ser, Leu, IIe, Val, Glu, Asp, or Lys;
Xaa at position 14 is Ser. Ala, Gly, Thr, Leu, IIe. Val, Glu, Asp, or Lys;
Xaa at position 16 is Val, Ala, Gly, Ser, Thr, Leu, Ile, Tyr, Glu, Asp, Tip, or Lys;
Xaa at position 17 is Ser, Ala, Gly, Thr, Leu, IIe, Val, Glu, Asp, or Lys;
Xaa at position 18 is Ser, Ala, Gly, Thr, Leu, IIe, Val, Glu, Asp, Trp, Tyr, or Lys;
Xaa at position 19 is Tyr, Phe, Trp, Glu, Asp, Gln, or Lys;
Xaa at position 20 is Leu, Ala, Gly, Ser, Thr, Ile, Val, Glu, Asp, Met, Trp, Tyr, or
Lys;
Xaa at position 21 is Glu, Asp, or Lys;
Xaa at position 22 is Gly, Ala, Ser, Thr, Leu, He, Val, Glu, Asp, or Lys;
Xaa at position 23 is Gln, Asn, Arg, Glu, Asp, or Lys;
Xaa at position 24 is Ala, Gly, Ser, Thr, Leu, IIe, Val, Arg, Glu, Asp, or Lys;
Xaa at position 25 is Ala. Gly, Ser, Thr, Leu, IIe, Val. Glu, Asp, or Lys;
Xaa at position 26 is Lys, Arg. Gln, Glu, Asp, or His;
Xaa at position 27 is Leu. Glu, Asp, or Lys;
Xaa at position 30 is Ala. Gly, Ser, Thr, Leu, IIe. Val. Glu, Asp, or Lys;
Xaa at position 31 is Trp. Phe, Tyr, Glu, Asp, or Lys;
Xaa at position 32 is Leu, Gly, Ala, Ser, Thr, IIe, Val, Glu, Asp, or Lys;
Xaa at position 33 is Val, Gly, Ala, Ser, Thr, Leu, He, Glu, Asp, or Lys;
Xaa at position 34 is Asn, Lys, Arg, Glu, Asp. or His;
Xaa at position 35 is Gly, Ala, Ser, Thr, Leu, IIe, Val, Glu, Asp, or Lys;
Xaa at position 36 is Gly, Arg, Lys, Glu, Asp, or His;
Xaa at position 37 is Pro, Gly, Ala, Ser, Thr, Leu, He, Val, Glu, Asp, or Lys, or is
deleted;
Xaa at position 38 is Ser, Arg, Lys, Glu, Asp, or His, or is deleted;
Xaa at position 39 is Ser, Arg, Lys, Glu, Asp, or His, or is deleted;
Xaa at position 40 is Gly, Asp, Glu, or Lys, or is deleted;
Xaa at position 41 is Ala. Phe, Trp, Tyr, Glu, Asp, or Lys, or is deleted;
Xaa at position 42 is Ser, Pro, Lys. Glu, or Asp, or is deleted;
Xaa at position 43 is Ser, Pro, Glu. Asp, or Lys, or is deleted;
Xaa at position 44 is Gly, Pro, Glu, Asp, or Lys, or is deleted; and
Xaa at position 45 is Ala, Ser, Val, Glu, Asp, or Lys, or is deleted;
provided that when the amino acid at position 37, 38, 39, 40. 41, 42, 43, or 44 is
deleted, then each amino acid downstream of that amino acid is also deleted.
5. The heterologous fusion protein of any one of the preceding claims wherein the
GLP-1 compound has no more than 6 amino acids that are different from the
corresponding amino acid in GLP-1 (7-37)OH, GLP-1 (7-36)OH, or Exendin-4.
6. The heterologous fusion protein of claim 5 wherein the GLP-1 compound has no
more than 5 amino acids that differ from the corresponding amino acid in GLP-1(7-
37)OH, GLP-1(7-36)OH, or Exendin-4.
7. The heterologous fusion protein of claim 6 wherein the GLP-1 compound has no
more than 4 amino acids that differ from the corresponding amino acid in GLP-1(7-
37)OH, GLP-1(7-36)OH, or Exendin-4.
8. The heterologous fusion protein of claim 7 wherein the GLP-1 compound has no
more than 3 amino acids that differ from the corresponding amino acid in GLP-1(7-
37)0H, GLP-1(7-36)OH, or Exendin-4.
9. The heterologous fusion protein of claim 8 wherein the GLP-1 compound has no
more than 2 amino acids that differ from the corresponding amino acid in GLP-1 (7-
37)OH, GLP-1(7-36)OH, or Exendin-4.
10. The heterologous fusion protein of any one of claims 5 to 9 wherein Xaa at position
8 is glycine or valine.
11. The heterologous fusion protein of any one of claims 1 to 10 wherein the second
polypeptide is the Fc portion of an Ig selected from: IgG1, IgG2, IgG3, IgG4, IgE,
IgA, IgD, or IgM.
12. The heterologous fusion protein of claim 11 wherein the second polypeptide is the
Fc portion of an Ig selected from: IgG1, IgG2, IgG3, and IgG4.
13. The heterologous fusion protein of claim 12 wherein the second polypeptide is the
Fc portion of an IgGl immunoglobulin.
14. The heterologous fusion protein of claim 12 wherein the second polypeptide is the
Fc portion of an IgG4 immunoglobulin.
15. The heterologous fusion protein of 12 wherein the IgG is human.
16. The heterologous fusion protein of claim 11 wherein the Fc portion comprises the
hinge, CH2, and CH3 domains.
17. The heterologous fusion protein of claim 1 wherein the second polypeptide has the
sequence of SEQ ID NO: 32.
18. A pharmaceutical formulation adapted for the treatment of patients with non-insulin
dependent diabetes or obesity comprising a heterologous fusion protein of any one of
claims 1 to 17 with excipients, diluents, carriers, pharmaceutically acceptable agents.
The present invention relates to glucagon-like-1 compounds fused to proteins that have
the effect of extending the in vivo half-life of the peptides. These fusion proteins can be
used to treat non-insulin dependent diabetes mellitus as well as a variety of other
conditions.
| # | Name | Date |
|---|---|---|
| 1 | 546-kolnp-2003-granted-translated copy of priority document.pdf | 2011-10-06 |
| 2 | 546-kolnp-2003-granted-specification.pdf | 2011-10-06 |
| 3 | 546-kolnp-2003-granted-sequence listing.pdf | 2011-10-06 |
| 4 | 546-kolnp-2003-granted-reply to examination report.pdf | 2011-10-06 |
| 5 | 546-kolnp-2003-granted-form 5.pdf | 2011-10-06 |
| 6 | 546-kolnp-2003-granted-form 3.pdf | 2011-10-06 |
| 7 | 546-kolnp-2003-granted-form 26.pdf | 2011-10-06 |
| 8 | 546-kolnp-2003-granted-form 2.pdf | 2011-10-06 |
| 9 | 546-kolnp-2003-granted-form 18.pdf | 2011-10-06 |
| 10 | 546-kolnp-2003-granted-form 13.pdf | 2011-10-06 |
| 11 | 546-kolnp-2003-granted-form 1.pdf | 2011-10-06 |
| 12 | 546-kolnp-2003-granted-examination report.pdf | 2011-10-06 |
| 13 | 546-kolnp-2003-granted-drawings.pdf | 2011-10-06 |
| 14 | 546-kolnp-2003-granted-description (complete).pdf | 2011-10-06 |
| 15 | 546-kolnp-2003-granted-correspondence.pdf | 2011-10-06 |
| 16 | 546-kolnp-2003-granted-claims.pdf | 2011-10-06 |
| 17 | 546-kolnp-2003-granted-abstract.pdf | 2011-10-06 |
| 18 | 546-KOLNP-2003-FORM 27.pdf | 2011-10-06 |
| 19 | 546-KOLNP-2003-CORRESPONDENCE.pdf | 2011-10-06 |
| 20 | 546-KOLNP-2003-30-01-2023-LETTER OF PATENT.pdf | 2023-01-30 |