Sign In to Follow Application
View All Documents & Correspondence

Herbal Formulation For Better Hair Growth, Nourishment And Better Conditioning Of Hairfollicles (Alocurmin)

Abstract: HERBAL FORMULATION FOR BETTER HAIR GROWTH, NOURISHMENT AND CONDITIONING OF HAIRFOLLICLES AND METHOD THEREOF ABSTRACT The present invention relates to an herbal formulation for better hair growth, nourishment, and better conditioning of hairs follicles. The formulation comprises an extract prepared from an admixture of pulverised coarsepowders ofAloevera, Menthaand curry leaves. The present invention further relates to a method of synthesizing the formulation comprising an extract of coarse powdered mix of atleast three herbs which improve hair condition and growth. FIG. 1 Dated this 28th day of July, 2022 For, SARVOTHAM CARE LIMITED BY THEIR AGENT (DR. BABITHA THARAPPAN) IN/PA-1614 ATV-LEGAL

Get Free WhatsApp Updates!
Notices, Deadlines & Correspondence

Patent Information

Application #
Filing Date
16 August 2021
Publication Number
07/2023
Publication Type
INA
Invention Field
BIO-CHEMISTRY
Status
Email
babitha@atvlegal.com
Parent Application

Applicants

Sarvotham Care Limited
Sarvotham Care Limited #1-20-248 1st Floor, Umajay Complex, Rasoolpura, Secunderabad Telengana India

Inventors

1. Dr. Baidyanath Mishra
#A-03, Royal Enclave Phase-1, Sidedahalli Main Road, Bangalore Karnataka India 560073
2. Dr. Srinivasa Reddy Yathapu
#Flat no- 304, PSLR Elite Apartments, Sri Ram Nagar Colony, Pipeline Road, Jeedimetla, Hyderabad Telangana India 500055

Claims

1. A method of preparing aherbal formulation for better hair growth, nourishment and conditioning of hairfollicles, comprises: a) preparing a mixture of herbs, wherein the herbs are Aloe barbadensis, MenthaSpps., and Murrayakoenigii; b) preparing a solvent solution, wherein the solvent solution is prepared by subjecting a mixture of water and glycerine in a ratio of 30:70 to a temperature of from 80°C to 30°C, preferably 40°C for 2 hours and cooling the mixture to a temperature of 30°C; c) soaking the mixture of herbs in the solvent solution for 24 hours; d) decanting a supernatant liquid; e) repeating the steps (c) and (d) thrice to obtain the formulation.

2. The method as claimed in claim 1, wherein the herbs are mixed in a ratio of 50: 25:25 respectively.

3. The method as claimed in claim 1, wherein the aloe vera is used in the form of dried leaves.

4. The method as claimed in claim 1, wherein the mint is used in the form of dried aerial parts.

5. The method as claimed in claim 1, whereinthe herbs are pulverisedin powder form having particle size 20-30 mesh.

6. Aherbal formulation for better hair growth, nourishment and conditioning of hairfollicles, comprises: an extract of coarsely powdered mixture of Aloe barbadensis, MenthaSpps., and Murrayakoenigii, wherein the Aloe barbadensis, MenthaSpps., and Murrayakoenigii are present in a ratio of 50:25:25 in a solvent, wherein the solvent is a treated solvent.

7. The herbal formulation as claimed in claim 6, wherein the treated solvent comprises water and glycerin in a ratio of 30:70.

8. The herbal formulation as claimed in claim 6, wherein the treated solvent solution is prepared by subjecting a mixture of water and glycerine in a ratio of 30:70 to a temperature of from 80°C to 30°C, preferably 40°C for 2 hours and cooling the mixture to a temperature of 30°C.

9. The herbal formulation as claimed in claim 6, wherein the extract is soaked thrice in the treated solvent and collected as supernatant liquid.

10. The herbal formulation as claimed in claim 6, wherein the formulation is effective on the human keratinocytes and has potency to increase the Collagen levels in Human Dermal Fibroblasts (HDF).

11. The herbal formulation as claimed in claim 6, wherein the formulationhas potency to decrease 5-a-Reductase levels in Human Keratinocytes cells, has potency to increase the AQP-3 levels in Human Keratinocytes (HaCaT) cell. Dated this 28th day of July, 2022 For, SARVOTHAM CARE LIMITED BY THEIR AGENT (DR. BABITHA THARAPPAN) IN/PA-1614 ATV-LEGAL

Specification

DESC:
FORM 2
The Patents Act 1970
(39 of 1970)
&
The Patent Rules 2003
COMPLETE SPECIFICATION
(See Section 10 and rule 13)

TITLE OF THE INVENTION:
HERBAL FORMULATION FOR BETTER HAIR GROWTH, NOURISHMENT AND CONDITIONING OF HAIRFOLLICLES AND METHOD THEREOF

APPLICANT
SARVOTHAM CARE LIMITED
#1-20-248, 1st Floor, Umajay Complex,
Rasoolpura, Secunderabad,
Telengana, India – 500003

PREAMBLE OF THE DESCRIPTION:
THE FOLLOWING SPECIFICATION PARTICULARLY DESCRIBES THE INVENTION AND THE MANNER IN WHICH IT IS TO BE PERFORMED

CROSS- REFERENCE TO RELATED APPLICATION
This application claims the priority of the provisional application with serial number 202141037012 filed on 14th of Aug, 2021 with the title, “HERBAL FORMULATION FOR BETTER HAIR GROWTH, NOURISHMENT AND BETTER CONDITIONING OF HAIRFOLLICLES (ALOCURMINTM)” and the contents of which is incorporated in entirety.

A) TECHNICAL FIELD OF INVENTION
[001] The present invention generally relates to herbal formulations and more particularly relates to herbal formulation for better hair growth, nourishment and conditioning of hair.

B) BACKGROUND OF INVENTION
[002] Hair grows on every external part of the body of mammals, except mucous membranes and glabrous skin. Human beings give the top-priority to the hairs as it enhances the looks of the person and gives a confident and good feeling. The health status of an individual can be predicted through the condition of hairs. Voluptuous shiny hairs are always found attractive. Hence having healthy thick hairs are considered necessity in the society.
[003] The growth of hair is cyclical process which is usually categorised into ‘anagen’, ‘catagen’, and ‘telogen’. There are the two distinct parts of hairs i.e.‘hair shaft’ which grows outside of the skin and ‘hair follicle’ (HF) which is present beneath the skin. The hair shaft is made up of non-living keratinized cells. The hair follicle(HF) is composed of outer and inner root sheaths, which helps in growth of hair.
[004] The hair loss or hair fall could be due to stress, diseases, nutritional deficiencies, hormonal effects specifically ‘androgenetic’, or due to any side-effects of medication, long-term treatments, etc. Nowadays, a remarkable change has been noticed in the lifestyle of human beings, especially in the urban areas. A dramatic change in environment, stress of various forms could be the contributors of hair fall or loss.
[005] Hence, there is a need to develop aformulation that provides better hair growth, nourishment and better conditioning of hair in today’s scenario. There have been prolonged research going on in this area wherein herbs are used to improve the condition of hairs. The herbs like Fenugreek seeds (methi dana), Curry leaves, Liquorice (Glycyrrhiza Glabera), mustard seed, sesame seed, gooseberry etc. have found to be effective in improving the condition of hairs. There have been prior arts which make the use of these herbs to develop formulations which are effective in hair conditions. But still these formulations are not very effective in improving the hair growth, nourishment and conditioning of hair follicles.
[006] Hence, there is a need to develop a more effective and improved herbal formulation which provides better hair growth, nourishment, and better conditioning of hair follicles. Also, there is a need to develop an herbal formulation which provides above properties along with no side effects.
[007] The above-mentioned shortcomings, disadvantages and problems are addressed herein, and which will be understood by reading and studying the following specification.

C) OBJECTIVE OF INVENTION
[008] The primary object of the present invention is to provide aherbal formulation for better hair growth, nourishment and better conditioning of hair follicles.
[009] Another object of the present invention is to provide a herbal formulation which is absolutely free from synthetic chemicals.
[0010] Another object of the present invention is to provide a herbal formulation that prevents hair fall and improves the condition of hair roots and shaft.
[0011] Another object of the present invention is to provide a herbal formulation that has positive effects on the human kkeratinocytes.
[0012] Another object of the present invention is to providea herbal formulation that has potency to increase the collagen levels in Human Dermal Fibroblasts (HDF) cell line when treated at non-toxic concentration.
[0013] Another object of the present invention is to provide a herbal formulation thathas potency to decrease the 5-a-reductase levels in human keratinocytes when treated at non-toxic concentration.
[0014] Another object of the present invention is to provide a herbal formulation thathas potency to increase the AQP-3 levels in human keratinocytes cells when treated at non-toxic concentration.
[0015] Another object of the present invention is to provide a herbal formulation that exhibits promising modulatory effect on GSH levels against hydrogen peroxide induced oxidative stress in a dose-dependent manner in human keratinocytes.
[0016] These and other objectives and advantages of the embodiments herein will become readily apparent from the following detailed description taken in conjunction with the accompanying drawings.

D) SUMMARY OF INVENTION
[0017] The embodiments of the present invention provide a herbal formulation for the better hair growth, nourishment and conditioning of hairfollicles and a method of preparing the same.
[0018] According to an embodiment of the present invention, a method of preparing a herbal formulation for better hair growth, nourishment and conditioning of hair follicles comprises preparing a mixture of herbs (a), preparing a solvent solution (b), soaking the mixture of herbs in the solvent solution for 24 hours (c);decanting a supernatant liquid (d);repeating the steps (c) and (d) thrice to obtain the formulation (e).
[0019] According to an embodiment of the present invention, the herbs are Aloe barbadensis,Mentha Spps., and Murrayakoenigii.
[0020] According to an embodiment of the present invention, the treated solvent is prepared by mixing water and glycerine in a ratio of 30:70. The mixture of water and glycerine is subjected to a temperature of 80°C to 30°C, preferably 40°C for 2 hours followed by cooling the mixture to a temperature of 30°C.
[0021] According to an embodiment of the present invention, the herbs are mixed in a ratio of 50: 25:25 respectively.
[0022] According to an embodiment of the present invention, the aloe vera is used in the form of dried leaves.
[0023] According to an embodiment of the present invention, the mint is used in the form of dried aerial parts.
[0024] According to an embodiment of the present invention, the herbs are pulverised in powder form having particle size 20-30 mesh.
[0025] According to another embodiment of the present invention, aherbal formulation for better hair growth, nourishment and conditioning of hair follicles is provided. The formulation comprisesan extract of coarsely powdered mixture of Aloe barbadensis, Mentha Spps., andMurrayakoenigii, wherein the Aloe barbadensis, Mentha Spps., and Murrayakoenigii are present in a ratio of 50:25:25 in a solvent, wherein the solvent is a treated solvent.
[0026] According to an embodiment of the present invention, the treated solvent comprises water and glycerin in a ratio of 30:70.
[0027] According to an embodiment of the present invention, the treated solvent is prepared by subjecting a mixture of water and glycerine to a temperature of from about 80°C to about 30°C, preferably about 40°C for 2 hours followed by cooling the mixture to a temperature of about 30°C.
[0028] According to an embodiment of the present invention, the extract is soaked thrice in the treated solvent and collected as supernatant liquid.
[0029] These and other aspects of the embodiments herein will be better appreciated and understood when considered in conjunction with the following description and the accompanying drawings. It should be understood, however, that the following descriptions, while indicating preferred embodiments and numerous specific details thereof, are given by way of illustration and not of limitation. Many changes and modifications may be made within the scope of the embodiments herein without departing from the spirit thereof, and the embodiments herein include all such modifications.

E) BRIEF DESCRIPTION OF DRAWINGS
[0030] The other objectives, features and advantages will occur to those skilled in the art from the following description of the preferred embodiment and the accompanying drawings in which:
[0031] FIG. 1A is a flowchart showing the steps involved in the preparation of a herbal formulation for better hair growth, nourishment and conditioning of hair, according to an embodiment of the present invention.
[0032] FIG. 1B is a schematicshowing the steps involved in the preparation of a herbal formulation for better hair growth, nourishment and conditioning of hair, according to an embodiment of the present invention.
[0033] FIG. 2A and FIG. 2B show the anti-dandruff activity of test substance against M. furfur and C. albicans, according to an embodiment of the present invention.
[0034] FIG. 3A shows the effect of the Test Substance (RR211148) on Collagen transcripts in HDF, wherein Lane 1 is Untreated Control, Lane 2 is Hyaluronic acid (1000 µg /mL), and Lane 3 is Test substance (RR211148) at 500 µg/mL and Lane 4 is Test substance (RR211148) at 1000 µg/ mL, according to an embodiment of the present invention.
[0035] FIG. 3B shows the graph of semi-Quantitative gene expression analysis of gene transcripts for fold increase, the relative level of Collagen gene expression is normalized to GAPDH, according to an embodiment of the present invention.
[0036] FIG. 4A shows the effect of the Test Substance (RR211148) on 5-a-Reductase transcripts in HaCaT, wherein Lane 1 is for Untreated Control, Lane 2 is for Finasteride (1000 µg /mL), Lane 3 is for Test substance (RR211148) at 500 µg/ Ml and Lane 4 is for Test substance (RR211148) at 1000 µg/ mL, according to an embodiment of the present invention.
[0037] FIG. 4B shows a graph of semi-Quantitative gene expression analysis of gene transcripts for fold decrease, the relative level of 5-a-Reductase gene expression is normalized to GAPDH, according to an embodiment of the present invention.
[0038] FIG. 5A shows the effect of the Test Substance (RR211148) on AQP-3 transcripts in HaCaT, wherein Lane 1 is for Untreated Control, Lane 4 is forHyaluronic acid (1000 µg /mL), Lane 3 is for Test substance (RR211148) at 500 µg/ Ml and Lane 4 is for Test substance (RR211148) at 1000 µg/ mL, according to an embodiment of the present invention.
[0039] FIG. 5B shows a graph of semi-Quantitative gene expression analysis of gene transcripts for fold increase, the relative level of AQP-3 gene expression is normalized to GAPDH, according to an embodiment of the present invention.

F) DETAILED DESCRIPTION OF EMBODIMENTS
[0040] In the following detailed description, a reference is made to the accompanying drawings that form a part hereof, and in which the specific embodiments that may be practiced is shown by way of illustration. The embodiments are described in sufficient detail to enable those skilled in the art to practice the embodiments and it is to be understood that the logical, mechanical, electronicand other changes may be made without departing from the scope of the embodiments. The following detailed description is therefore not to be taken in a limiting sense.
[0041] The various embodiments of the present invention provide a herbal formulation and a method of preparing the herbal formulation for better hair growth, nourishment and conditioning of hair. The formulation of the present invention improves hair growth by improving the condition of hair follicles.
[0042] FIG. 1A is a flowchart showing the steps involved in the preparation of a herbal formulation for better hair growth, nourishment and conditioning of hair, according to an embodiment of the present invention. With respect to FIG. 1A, the method comprises preparing a mixture of herbs (a), preparing a solvent solution (b), soaking the mixture of herbs in the solvent solution for 24 hours (c); decanting a supernatant liquid (d); repeating the steps (c) and (d) thrice to obtain the formulation (e). The herbs are Aloe barbadensis, Mentha Spps., andMurrayakoenigii. The treated solvent solution is prepared by mixing water and glycerine in a ratio of 30:70.The mixture of water and glycerine is subjected to a temperature of 80°C. to 30°C., preferably 40°C for 2 hours followed by cooling the mixture to a temperature of 30°C.The complete process takes 6 to 9 hours. The herbs are mixed in a ratio of 50: 25:25 respectively. The aloe vera is used in the form of dried leaves. The mint is used in the form of dried aerial parts. The herbs are pulverised in powder form having particle size 20-30 mesh.
[0043] According to an embodiment of the present invention, a herbal composition for better hair growth, nourishment and better conditioning of hair is provided. The composition comprises an extract obtained from admixture pulverised coarsepowdersof Aloe barbadensis, MenthaSpsand MurrayaKoenigii. The admixture prepared by addition of pulverised powders (20 – 30 mesh) of Aloe barbadensis miller, MenthaSpsand MurrayaKoenigiiat a ratio of 50:25:25.
[0044] According to an embodiment of the present invention, the driedleaf pulverised coarsepowder (20 – 30 mesh) ofAloe barbadensisis taken.
[0045] According to an embodiment of the present invention, the pulverised coarsepowder (20 – 30 mesh) ofdried aerial parts of Menthaare taken.
[0046] According to an embodiment of the present invention, pulverised coarsepowder (20 – 30 mesh) of dried leaves of curry pattaare taken.
[0047] According to an embodiment of the present invention, an admixture of coarsepowder is prepared by mixing all the three pulverised coarsepowdersat specified ratio of 50:25:25.
[0048] According to an embodiment of the present invention, solvent system is prepared by mixing the water and glycerin at a ratio of 30:70 and subjecting to heating at 40oC for 2 hours.
[0049] According to an embodiment of the present invention, extract is prepared by soaking the admixture of pulverised coarsepowders for 24h in cooled (30°C)hydro-glycerine solvent.Then the supernatant is decanted, whereinthe soaking and supernatant collection steps are repeated thrice using Hydro-Glycerine (30:70) solvent system. The pooled supernatant is subjected to obtain the powdered form of extract to prepare the deliverable form.
[0050] FIG. 1B shows a schematic showing the steps involved in the preparation of a herbal formulation for better hair growth, nourishment and better conditioning of hair, according to an embodiment of the present invention. With respect to FIG.1B, dried leavesof Aloe barbadensisare taken, cleaned and dried. Thedried leaves are pulverisedto obtain a coarsepowder of 20 – 30 mesh. The aerial parts of mint plant are taken, cleaned, grinded and dried. A pulverised coarsepowder of 20 – 30 mesh is obtained from the dried aerial parts of mint. The aerial parts of curry patta are taken, and leaves are separated followed by subjecting to cleaning and drying. The pulverisedcoarsepowder (20 – 30 mesh) is obtained from the dried leaves. The three pulverised coarse powders of Aloe vera,Menthaand Curry leaves are mixed in the ratio of 50:25:25.
[0051] According to an embodiment of the present invention, the formulation is an extract from an admixture comprised of pulverizedpowders of Aloe vera, Menthaand Curry leaves.
[0052] According to an embodiment of the present invention, the formulationis an extract obtained from an admixture subjected to Hydro-Glycerine solvent system (30:70).
[0053] According to an embodiment of the present invention, an efficacy of poly herbal compound (PHC) AlocurminTm as hair growth, conditioner and nourishment is evaluated.

EXPERIMENTAL DETAILS
[0054] The present invention comprises an extract obtained from combination of pulverized coarsepowders of Aloe barbadensis(Aloe vera), MenthaSpps.and Murrayakoenigii (Curry leaves) to evaluate the hair nourishment, growth, conditioning properties along with preventing the loss/fall of hair.
[0055] Aloe barbadensis: The dried leavesof Aloe barbadensiswere collected and subjected to cleaning and allowed for further drying. Thepulverized coarsepowder(20 – 30 mesh) wasprepared from dried leaves of Aloe vera.
[0056] MenthaSps: The aerial parts of Mentha/mint wereobtained and subjected to cleaning of soil & mud particles. Then, the grinded aerial parts werecollected. The aerial partsof Mentha were dried and converted into pulverizedcoarse powder from (20 – 30 mesh).
[0057] Murrayakoenigii: The matured aerial branches of M. koenigiiwere collected and graded. The branches were washed with water to remove any particulate matter and leaves were collected. The curry leaves are subjected to air drying and then obtained 20 – 30 mesh pulverizedcoarsepowder.
[0058] The admixture of Aloe vera, menthaand curry leaves was obtained bymixing these pulverized coarsepowders at a ratio of 50:25:25, respectively and was analyzed for characteristic active ingredients.
[0059] The mixture provided was evaluated for improved hair growth and quality of hair.
In vitro Cell Proliferative Property on Human Keratinocytes
[0060] The purpose of this study is to assess the test product for its In vitro Cell proliferation property by MTT assay.
[0061] The test substance was evaluated for its in vitro cell proliferation property on HaCaT (Human Keratinocytes) line. The cells were treated different concentrations of the test product ranging from 1000 to 32.5 µg/mL. In the present study, the test substance assayed was found to increase the cell viability on HaCaT cell line at the highest concentrations tested.
[0062] Table 1.1 shows the test substances used:
Table 1.1: Test substance information
[0063]
Test Substance Common name Name used in the
report Batch number Physical
appearance Storage
condition
RR211148 ACM-21 RR211148 ACM/AB/01/2021 Liquid RT

[0064] Table 1.2 shows the reference materials/chemicals used:
Table 1.2: Reference Material/Chemicals
Chemical Batch/Lot No. Manufacturer Expiry Date
MTT 0000228429 Hi-media -
Fetal Bovine Serum 42304534 Gibco Dec-2025
PBS 0000251865 Hi-Media Dec-2022
Trypsin 0000472777 Hi-Media Mar-2022
Antibiotics 0000251363 Hi-Media Dec-2022
DMSO 519350205AO FINAR --
DMEM-HG 0000446761 Hi-Media Aug- 2023

[0065] Table 1.3 shows the equipments used:
Table 1.3: Equipments
[0066] S. No. Name of the Instrument Make Instrument ID
1. Biosafety Cabinet Ascesension RRS/INS/CB/01
2. CO2 Incubator NUAIRE RRS/INS/CB/02
3. Inverted Tissue Culture
Microscope Motic China RRS/INS/CB/04
4. Automated Micro Plate
Reader Biotek RRS/INS/MB/05

METHOD
[0067] Outline of the method:The in vitro MTT assay was performed for the ACM-21 on HaCaT (Human Keratinocytes) cell line to determine the level of cell proliferation.
[0068] Preparation of test compound for cell proliferation screening:10 mg of test substance was weighed and dissolved in DMEM-HG medium supplemented with 2% inactivated FBS to obtain a stock solution of 10mg/mL. Furthermore, two fold serial dilutions were prepared from the stock solution to prepare lower concentrations for proliferation testing.
[0069] Cell line and culture medium:Human Keratinocytes cell line cell line was procured from American Type Culture Collection (ATCC), USA. Stock cells were cultured in DMEM-HG supplemented with 10% inactivated Fetal Bovine Serum (FBS), penicillin (100 IU/ml), streptomycin (100 µg/mL) and amphotericin B (5 µg/mL) in an humidified atmosphere of 5% CO2 at 37°C until confluent. The cells were dissociated with TPVG solution (0.2% Trypsin, 0.02% EDTA, 0.05% glucose in PBS). The stock cultures were grown in 25 cm2 culture flasks and all experiments were carried out in 96 well microtitre plates (Tarsons India Pvt. Ltd., Kolkata, India).
[0070] Determination of Cell viability by MTT Assay:The monolayer cell culture was trypsinized and the cell count was adjusted to 100,000 cells/ml using DMEM-HG containing 10% FBS. To each well of the 96 well microtitre plate,0.1 mL of the diluted cell suspension was added. After 24 h, when a partial monolayer was formed, the supernatant was flicked off, the monolayer washed once with medium and different test concentrations were added on to the partial monolayer in the microtitre plates. The untreated cells were maintained as cell control for comparison. The plates were then incubated at 37o C for 72 h in 5% CO2 atmosphere, and microscopic examination was carried out and observations were noted after 24h, the test solutions in the wells were discarded and 50 µL of MTT is added with DPBS was added to each well. The plates were gently shaken and incubated for 3 h at 37o C in 5% CO2 atmosphere. The supernatant was removed and 100 µL of DMSO was added and the plates were gently shaken to solubilize the formed formazan. The absorbance was measured using a microplate reader at a wavelength of 570 nm.
RESULTS
[0071] Table 1 below shows the Percentage cells viable after treatment with test substance compared to cell control, according to the embodiments of the present invention.
Table 1: Percentage cells viable after treatment with test substance compared to cell control
[0072]

Test substance

ACM-21 (RR211148) Concentration (µg/mL)
Percentage cells viable after treatment

1000 138.25±0.16
500 130.81±3.89
250 124.74±1.63

125 119.19±4.29

62.5 100.38±0.73
31.25 100.13±0.86

Cell control Maintenance medium
(no treatment) 100

DISCUSSION AND CONCLUSION
[0073] The test substance ACM-21 was assayed for in vitro cell proliferative study against HaCaT cells (Human Keratinocytes) by exposing the cells to different concentrations ranging from 1000 to 31.25 µg/mL. MTT assay was employed to test the proliferative effect of selected concentrations (RR211148) on the cell viability of HaCaT cells by measuring the metabolic activity through a colorimetric determination. Cell viability is a measure of the proportion of live, healthy cells within a population. The MTT assay is usually carried out to detect the cells with constant mitochondrial activity, thereby; an increase or decrease in the number of viable cells is linearly related to mitochondrial activity. In the present study, the percentage viability of HaCaT cells was found to be 138.25±0.16% even at the highest concentration tested (1000 µg/mL). In comparison to the untreated cells (cell control), the cell viability was found to increase significantly till 125 µg/mL of ACM-21 (Table 1). Hence, ACM-21 (RR211148) was found to exhibit promising cell proliferative properties in HaCaT cell line.

Antidandruff activity against M.furfur and C.albicans by Minimum Inhibitory Concentration (MIC) method
[0074] To demonstrate the anti-dandruff activity of test substance against M. furfur and C. albicans by Minimum inhibitory Concentration (MIC) method.
[0075] The test sample was evaluated for anti-dandruff activity against M. furfur and C. albicans by Microtitre method at different concentrations. The MIC values of test substance were compared with the activity of standard antibiotic. The MIC value of test substance was compared with the activity of standard antibiotic and the results were indicated in Table 1.0.
[0076] Table 2.1 shows the Test substance information
Table 2.1: Test substance information

Test substance : ACM-21
Name to be used in the report : ACM-21
Test Item code by Test Facility : RR211148
Batch No. : NA
Physical appearance : Brown color liquid
Storage conditions : RT

[0077] Table 2.2 shows the microbial strains used in the evaluation study.
Table 2.2: Microbial Strains
S. No. Tester Strain Strain No.
1 M. furfur ATCC 14521
4. C. albicans ATCC 10231

[0078] Table 2.3 shows the Chemicals & Media used in the evaluation study.
Table 2.3: Chemical & Media
[0079]
Chemical Lot/Cat No. Manufacturer
Sodium Chloride DG8D681772 Merck Life Science Pvt Ltd,India
Demineralized water 645506 Spectrum Chemicals,India
Ketoconazole SD274 Himedia, India
RPMI 1640 0000393216 Himedia, India
Sabouraud Dextrose Agar 0000397263 Himedia, India
Resazurin Dye RM125 Himedia, India

[0080] Table 2.4 shows the equipments used in the present study.
Table 2.4: Equipments
[0081] S. No. Name of the Instrument Make Instrument ID
1 Weighing Balance Orion Automation
Systems ,India RRS/INS/MCR/05
2 Autoclave (Sterilization) Ascension Innovation
India RRS/INS/MCR/10
3 Autoclave
(decontamination) Ascension Innovation
India RRS/INS/MCR/20
4 Bacteriological Incubator -II Biovision India RRS/INS/MCR/21
5 Biological Safety Cabinet-II Thermocon,India RRS/INS/MCR/27
6 Micropipettes 05-50µl
2-200 µl
2-20 µl
100-1000 µl Nichipet Gilson
Gilson Gilson RRS/INS/MCR/16 RRS/INS/MCR/11
RRS/INS/MCR/17 RRS/INS/MCR/09
7 Refrigerator LG India RRS/INS/MCR/02
8 Microtitre Plate 96 well Tarson,India NA
9 Cyclomixer Remi,India RRS/INS/DTL/15
10 Sonicator Life Care ,India RRS/INS/DTL/33

METHOD
[0082] Preparation and Standardization of Stock cultures: A loopful culture of M. furfur and C. albicans were grown on growth media and incubated at 25 ±2°C for 48 hours respectively. Total numbers of cells was adjusted to 104 CFU/ml at 620nm in digital colorimeter counting.
[0083] Preparation of test sample: 3ml of test substance was weighed and added to 97 ml of Sterile distilled and vortexed thoroughly. This gives a concentration of 30mg/ml sample preparation.
[0084] Preparation of standard antibiotic solution: Ketoconazole was used as standard antibiotic for fungi and the standard antibiotic solution was prepared at 1.0 mg/mL concentration for both.0.1gm of Ketoconazole was weighed and added to 100mL of distilled and vortexed thoroughly. This gives 0.1% w/v standard antibiotic stock solution.
[0085] Preparation of resazurin solution: 2.7mg of resazurin was weighed and added to 5ml of sterile normal saline solution. 1ml of prepared stock solution was added to 4ml of sterile saline to get working solution and this was used for the test.
[0086] Determination of MIC by Microtitre method:
[0087] 1. Experiment was performed in triplicates under aseptic conditions.
[0088] 2. A volume of 100µl broth was added to all 96 wells except first three wells( A1B1C1) of the Microtitre plate. RPMI broth was used for M. Furfur and C.albicans.
[0089] 3. In first three wells (A1B1C1) of plate, 200µl of the test sample was added and double diluted till A12B12C12 to get the desired concentration.
[0090] 4. To the wells containing test sample, 10µl of M.furfur and C.albicans suspension of 104 CFU/ml was added.
[0091] 5. A growth control (10µl of microbial culture + 100µl broth medium) from G1 to G12 and broth control (only 100µl broth medium) from H1 to H12 was kept as negative control.
[0092] 6. The M.furfur and C. albicans plates were incubated at 25 ±2°C for 48 hours.
[0093] 7. After incubation, 20µl of working solution of resazurin was added to all wells.
[0094] 8. The plates was wrapped with aluminum film and incubated for 1hour.
[0095] 9. The color change was then assessed visually. Any color change from purple to pink or colorless was recorded as positive (growth).
[0096] 10. The lowest concentration at which there is no color change occurred was taken as the MIC value.
OBSERVATION
[0097] Table 2 shows the MIC of test substance against M.furfur and C.albicans
Table 2: MIC of test substance against M.furfurand C.albicans

RESULTS
[0098] FIG. 2A and FIG. 2B show the anti-dandruff activity of test substance against M. furfur and C. albicans, according to an embodiment of the present invention. With respect to FIG. 2A and FIG. 2B, thetest substance ACM-21 showed MIC value of 15mg/ml against M. Furfur and 7.5 mg/mL against Candidaalbicans respectively.

Evaluation of modulatory effect on Collagen gene expression in Human Dermal Fibroblasts
[0099] The purpose of this study is to evaluate ACM-21 for its gene expression potency on Collagen gene in Human Dermal Fibroblasts cell line.
[00100] The ACM-21 was evaluated for its in vitro potency to induce gene expression in Human Dermal Fibroblasts cell line (HDF), the test substance was first evaluated for its cytotoxicity with different concentrations from 1000 – 7.8 µg/mL. The test substance exhibited a CTC50 value above 1000 µg/mL on the Human Dermal Fibroblasts. Hence non-toxic concentrations were taken for gene expression studies. In the gene expression study, the test substance at tested concentrations (1000 and 500 µg/mL) showed moderate increase in the level of Collagen gene expression as compared to the untreated control in the semi-quantitative RT-PCR procedure.
[00101] No deviation has been adapted during the conduct of the experiment.
MATERIALS
[00102] Table 3.1 show the Test substance information used in the evaluation study.
Table 3.1: Test substance information
Test substance/item ACM-21
Common name ACM-21
Name to be used in the report Test Substance- ACM-21
Test substance code RR211148
Batch No. ACM/AB/01/2021
Batch supplied by: M/s. Sarvotham Care Ltd.,
Physical appearance Liquid
Storage conditions RT

[00103] Table 3.2 shows the Reference Material/Chemicals used in the evaluation study.
Table 3.2: Reference Material/Chemicals
Chemical Batch/Lot No. Manufacturer Expiry Date
MTT 0000307556 Hi-Media -
Fetal Bovine serum 4222743 Gibco Sep-2026
DPBS 0000474192 Hi-Media March-2024
DMEM-HG 2365585 Gibco Feb-2024
Antibiotics 0000493609 Hi-Media Aug-2023
RNA Iso AKY1004N Takara Nov-2022
IPA DL0F702845 Merck -
Reverse Transcriptase 64393525 Bio-Rad Oct-2022
Primer 11400049148 Eurofins April-2022
PCR Mastermix 01064121 Invitrogen Dec- 2022

[00104] Table 3.3 shows the equipments used in the present study.
Table 3.3: Equipments
[00105] S. No. Name of the Instrument Make Instrument ID
1. Biosafety Cabinet Ascesension RRS/INS/CB/01
2. CO2 Incubator NUAIRE RRS/INS/CB/02
3. Invertedtissueculture microscope Motic China RRS/INS/CB/03
4. -20ºC Deep Freezer Vestfrost RRS/INS/MB/10
5. Thermal Cycler Bio-Rad USA RRS/INS/MB/01
6. Gel Electrophoresis Unit ChromousBiotech India RRS/INS/MB/02
7. GelDocumentation System SyngeneIngenius RRS/INS/MB/04

METHOD
[00106] Outline of the method:The effect of ACM-21 on modulation of Collagen was estimated by gene expression method, where the level of the expression of Collagen in Human Dermal Fibroblasts (HDF) cell line was determined with respect to untreated HDF cells.
[00107] Cell line and culture medium:HDF (Human Dermal fibroblasts cells) was procured from ATCC,U.S. Stock cells were cultured in DMEM-HG supplemented with 10% inactivated Fetal Bovine Serum (FBS), penicillin (100 IU/mL), streptomycin (100 µg/ml) and amphotericin B (5 µg/mL) in an humidified atmosphere of 5% CO2 at 37°C until confluent. The cells were dissociated withTPVG solution (0.2% trypsin, 0.02% EDTA, 0.05% glucose in PBS). The stock cultures were grown in 25 cm2 culture flasks and all experiments were carried out in 96 microtitre plates (Tarsons India Pvt. Ltd., Kolkata, India).
[00108] RNA isolation and cDNA synthesis:The HDF (Human Dermal fibroblasts cell) cells treated with test substances were subjected to cell lysis by treating with Tri-extract reagent. Chloroform was added, to isolate the total RNA from the sample and subjected for centrifugation. Out of the three distinct layers observed, upper layer was collected in fresh tube and equal volume of isopropanol was added and incubated at-20°C for 10mins. After the incubation followed by centrifugation, appropriate volume of ethanol was added to resuspend the pellet. After incubation and centrifugation, the pellet was air dried and appropriate volume of TAE buffer was added. The isolated total RNA was further used for cDNA synthesis. cDNA was synthesized by priming with oligo dT primers followed by reverse transcriptase enzyme treatment according to manufacturer’s protocol (Bio-Rad). The cDNA thus synthesized was taken up for PCR for the amplification of Collagen and GAPDH (internal control).
[00109] RT-PCR Procedure:The mRNA expression levels of Collagen were determined using semi-quantitative reverse transcriptase-polymerase chain reaction (RT-PCR). 50µL of the reaction mixture was subjected to PCR for amplification of Collagen. cDNA using specifically designed primers procured from Eurofins, India and as an internal control GAPDH (Housekeeping gene) was co-amplified with each reaction.
[00110] Amplification conditions for collagen gene:
[00111] Adiponectin: 95°C for 5 min followed by 35 cycles of denaturation at 95°C for 30 seconds, annealing Tm for 30 seconds and extension at 72°C for 45 seconds. This was followed by final extension at 72°C for 10 min.
[00112] Primer used:
[00113] For I strand synthesis: Oligo dT primer
[00114] For II nd strand synthesis:
[00115] Forward: 5’- ATGTCCGCAGACCTGGAGGA -3’
[00116] Reverse: 5’- CAAGGAATGGTGCTGCTCT-3’
[00117] Product size: 137 bp.
OBSERVATION/PARAMETERS FOR EVALUATION
[00118] FIG. 3A shows the effect of the Test Substance (RR211148) on Collagen transcripts in HDF, wherein Lane 1 is Untreated Control, Lane 2 is Hyaluronic acid (1000 µg /mL), and Lane 3 is Test substance (RR211148) at 500 µg/mL and Lane 4 is Test substance (RR211148) at 1000 µg/ mL, according to an embodiment of the present invention.
RESULTS
Table 3: The Quantitative gene expression level of Collagen normalized to GAPDH. Test Sample
Test Sample Regulation in Terms of Folds
COLLAGEN
Cell Control (Untreated) 1.00
Hyaluronic acid
(1000 µg/mL) 1.59
RR211148 (500 µg/ml)
(ACM-21) 1.20
RR211148 (1000 µg/ml)
(ACM-21) 1.40

[00119] FIG. 3B shows the graph of semi-Quantitative gene expression analysis of gene transcripts for fold increase, the relative level of Collagen gene expression is normalized to GAPDH, according to an embodiment of the present invention. The values shown depict arbitrary units.
DISCUSSION AND CONCLUSION
[00120] Test Substance, ACM-21, tested for in vitro cytotoxicity studies against HDF (Human Dermal fibroblasts cell) by MTT assay exposing the cells to different combinations of test substance. The CTC50 value of the test substance on HDF cell line was above 1000 µg/mL. Reverse Transcriptase-PCR experiment was performed by using Collagen specific primers. Semi-Quantitative RT-PCR analysis revealed that Collagen mRNA was increased moderately in a dose dependent manner over the control value. The values were comparable with the standard tested (Hyaluronic acid).
[00121] The results indicate that ACM-21 has potency to increase the Collagen levels in Human Dermal Fibroblasts (HDF) cell line when treated at non-toxic concentration.

5-a-reductase gene expression in Human Keratinocytes
[00122] The purpose of this study is to evaluate ACM-21 for its gene expression potency on 5-a-Reductase gene in Human Keratinocytes cell line.
[00123] The ACM-21 was evaluated for its in vitro potency to induce gene expression in Human Keratinocytes cell line (HaCaT), the test substance was first evaluated for its cytotoxicity with different concentrations from 1000 – 7.8 µg/mL. The test substance exhibited a CTC50 value above 1000 µg/mL in the Human Keratinocytes. Hence non-toxic concentrations were taken for gene expression studies. In the gene expression study, the test substance at tested concentrations (1000 and 500 µg/mL) showed moderate decrease in the level of 5-a-Reductase gene expression as compared to the untreated control in the semi-quantitative RT-PCR procedure.
[00124] Table 4.1 shows the list of Materials used in the present study.
Chemical Batch/Lot No. Manufacturer Expiry Date
MTT 0000307556 Hi-Media -
Fetal Bovine serum 4222743 Gibco Sep-2026
DPBS 0000474192 Hi-Media March-2024
DMEM-HG 2365585 Gibco Feb-2024
Antibiotics 0000493609 Hi-Media Aug-2023
RNA Iso AKY1004N Takara Nov-2022
IPA DL0F702845 Merck -
Reverse Transcriptase 64393525 Bio-Rad Oct-2022
Primer 11400049148 Eurofins April-2022
PCR Mastermix 01064121 Invitrogen Dec- 2022

[00125] Table 4.2 shows the list of Equipments used in the present study
[00126] S. No. Name of the Instrument Make Instrument ID
1. Biosafety Cabinet Ascesension RRS/INS/CB/01
2. CO2 Incubator NUAIRE RRS/INS/CB/02
3. Invertedtissueculture microscope Motic China RRS/INS/CB/03
4. -20ºC Deep Freezer Vestfrost RRS/INS/MB/10
5. Thermal Cycler Bio-Rad USA RRS/INS/MB/01
6. Gel Electrophoresis Unit ChromousBiotech India RRS/INS/MB/02
7. GelDocumentation System SyngeneIngenius RRS/INS/MB/04

[00127] Outline of the method:The effect of ACM-21 on modulation of 5-a-Reductase was estimated by gene expression method, where the level of the expression of 5-a-Reductase in Human Keratinocytes (HaCaT) cell line was determined with respect to untreated HaCaT cells.
[00128] Cell line and Culture medium:HaCaT (Human Keratinocytes cells) was procured from ATCC, U.S. Stock cells were cultured in DMEM-HG supplemented with 10% inactivated Fetal Bovine Serum (FBS), penicillin (100 IU/mL), streptomycin (100 µg/ml) and amphotericin B (5 µg/mL) in an humidified atmosphere of 5% CO2 at 37°C until confluent. The cells were dissociated withTPVG solution (0.2% trypsin, 0.02% EDTA, 0.05% glucose in PBS). The stock cultures were grown in 25 cm2 culture flasks and all experiments were carried out in 96 microtitre plates (Tarsons India Pvt. Ltd., Kolkata, India).
[00129] RNA isolation and cDNA synthesis:The HaCaT (Human Keratinocytes cell) cells treated with test substances were subjected to cell lysis by treating with Tri-extract reagent. Chloroform was added, to isolate the total RNA from the sample and subjected for centrifugation. Out of the three distinct layers observed, upper layer was collected in fresh tube and equal volume of isopropanol was added and incubated at-200C for 10mins. After the incubation followed by centrifugation, appropriate volume of ethanol was added to resuspend the pellet. After incubation and centrifugation, the pellet was air dried and appropriate volume of TAE buffer was added. The isolated total RNA was further used for cDNA synthesis. cDNA was synthesized by priming with oligo dT primers followed by reverse transcriptase enzyme treatment according to manufacturer’s protocol (Bio-Rad). The cDNA thus synthesized was taken up for PCR for the amplification of 5-a-Reductase and GAPDH (internal control).
[00130] RT-PCR Procedure: The mRNA expression levels of 5-a-Reductase were determined using semi-quantitative reverse transcriptase-polymerase chain reaction (RT-PCR). 50µL of the reaction mixture was subjected to PCR for amplification of 5-a-Reductase. cDNA using specifically designed primers procured from Eurofins, India and as an internal control GAPDH (Housekeeping gene) was co-amplified with each reaction.
[00131] Amplification conditions for 5-a-Reductase gene:
[00132] Adiponectin: 95°C for 5 min followed by 35 cycles of denaturation at 95°C for 30 seconds, annealing Tm for 30 seconds and extension at 72°C for 45 seconds. This was followed by final extension at 72°C for 10 min.
[00133] Primer used:
[00134] For I strand synthesis: Oligo dT primer
[00135] For II nd strand synthesis:
[00136] Forward: 5’- CATCCTCCTGGCCATGTTCC-3’
[00137] Reverse: 5’- ATAGCCACACCACTCCATGA-3’
[00138] Product size: 206 bp.
[00139] FIG. 4A shows the effect of the Test Substance (RR211148) on 5-a-Reductase transcripts in HaCaT, wherein Lane 1 is for Untreated Control, Lane 2 is for Finasteride (1000 µg /mL), Lane 3 is for Test substance (RR211148) at 500 µg/ Ml and Lane 4 is for Test substance (RR211148) at 1000 µg/ mL, according to an embodiment of the present invention.
RESULTS
Table 4: The Quantitative gene expression level of 5-a-Reductase normalized to GAPDH.

[00140] FIG. 4B shows a graph of semi-Quantitative gene expression analysis of gene transcripts for fold decrease, the relative level of 5-a-Reductase gene expression is normalized to GAPDH, according to an embodiment of the present invention.
[00141] Test Substance, ACM-21, was assayed for in vitro cytotoxicity studies against HaCaT (Human Keratinocytes cells) by MTT assay exposing the cells to different concentrations. The CTC50 value of the test substance on HaCaT cell line was above 1000 µg/mL. Reverse Transcriptase-PCR experiment was performed by using 5-a-Reductase specific primers. Semi-Quantitative RT-PCR analysis revealed that 5-a-Reductase mRNA was decreased moderately in a dose dependent manner over the control value. The values were comparable with the standard tested (Finasteride).
[00142] The results indicate that ACM-21 has potency to decrease the 5-a-Reductase levels in Human Keratinocytes (HaCaT) cell line when treated at non-toxic concentration.

AQP-3 gene expression in Human Keratinocytes
[00143] The purpose of this study is to evaluate ACM-21 for its gene expression potency on AQP-3 gene in Human Keratinocytes cell line.
[00144] The ACM-21 was evaluated for its in vitro potency to induce gene expression in Human Keratinocytes cell line (HaCaT), the test substance was first evaluated for its cytotoxicity with different concentrations from 1000 – 7.8 µg/mL. The test substance exhibited a CTC50 value above 1000 µg/mL on the Human Keratinocytes. Hence non-toxic concentrations were taken for gene expression studies. In the gene expression study, the test substance at tested concentrations (1000 and 500 µg/mL) showed moderate increase in the level of AQP-3 gene expression as compared to the untreated control in the semi-quantitative RT-PCR procedure.
[00145] Table 5.1 shows the list of materials used in the present study.
MATERIALS
Chemical Batch/Lot No. Manufacturer Expiry Date
MTT 0000307556 Hi-Media -
Fetal Bovine serum 4222743 Gibco Sep-2026
DPBS 0000474192 Hi-Media March-2024
DMEM-HG 2365585 Gibco Feb-2024
Antibiotics 0000493609 Hi-Media Aug-2023
RNA Iso AKY1004N Takara Nov-2022
IPA DL0F702845 Merck -
Reverse Transcriptase 64393525 Bio-Rad Oct-2022
Primer 11400049148 Eurofins April-2022
PCR Mastermix 01064121 Invitrogen Dec- 2022

[00146] Table 5.2 shows the list of equipments used in the present study.
[00147] S. No. Name of the Instrument Make Instrument ID
1. Biosafety Cabinet Ascesension RRS/INS/CB/01
2. CO2 Incubator NUAIRE RRS/INS/CB/02
3. Invertedtissueculture microscope Motic China RRS/INS/CB/03
4. -20ºC Deep Freezer Vestfrost RRS/INS/MB/10
5. Thermal Cycler Bio-Rad USA RRS/INS/MB/01
6. Gel Electrophoresis Unit ChromousBiotech India RRS/INS/MB/02
7. GelDocumentation System SyngeneIngenius RRS/INS/MB/04

[00148] Outline of the method:The effect of ACM-21 on modulation of AQP-3 was estimated by gene expression method, where the level of the expression of AQP-3 in Human Keratinocytes (HaCaT) cell line was determined with respect to untreated HaCaT cells.
[00149] Cell line and Culture medium:HaCaT (Human Keratinocytes cells) was procured from ATCC,U.S. Stock cells were cultured in DMEM-HG supplemented with 10% inactivated Fetal Bovine Serum (FBS), penicillin (100 IU/mL), streptomycin (100 µg/ml) and amphotericin B (5 µg/mL) in an humidified atmosphere of 5% CO2 at 37°C until confluent. The cells were dissociated withTPVG solution (0.2% trypsin, 0.02% EDTA, 0.05% glucose in PBS). The stock cultures were grown in 25 cm2 culture flasks and all experiments were carried out in 96 microtitre plates (Tarsons India Pvt. Ltd., Kolkata, India).
[00150] RNA isolation and cDNA synthesis:The HaCaT (Human Keratinocytes cell) cells treated with test substances were subjected to cell lysis by treating with Tri-extract reagent. Chloroform was added, to isolate the total RNA from the sample and subjected for centrifugation. Out of the three distinct layers observed, upper layer was collected in fresh tube and equal volume of isopropanol was added and incubated at-200C for 10mins. After the incubation followed by centrifugation, appropriate volume of ethanol was added to resuspend the pellet. After incubation and centrifugation, the pellet was air dried and appropriate volume of TAE buffer was added. The isolated total RNA was further used for cDNA synthesis. cDNA was synthesized by priming with oligo dT primers followed by reverse transcriptase enzyme treatment according to manufacturer’s protocol (Bio-Rad). The cDNA thus synthesized was taken up for PCR for the amplification of AQP-3 and GAPDH (internal control).
[00151] RT-PCR Procedure:The mRNA expression levels of AQP-3 were determined using semi-quantitative reverse transcriptase-polymerase chain reaction (RT-PCR). 50µL of the reaction mixture was subjected to PCR for amplification of AQP-3. cDNA using specifically designed primers procured from Eurofins, India and as an internal control GAPDH (Housekeeping gene) was co-amplified with each reaction.
[00152] Amplification conditions for AQP-3 gene
[00153] Adiponectin: 95°C for 5 min followed by 35 cycles of denaturation at 95°C for 30 seconds, annealing Tm for 30 seconds and extension at 72°C for 45 seconds. This was followed by final extension at 72°C for 10 min.
[00154] Primer used:
[00155] For I strand synthesis: Oligo dT primer
[00156] For II nd strand synthesis:
[00157] Forward: 5’- GCTGTCACTTGGGCATCCTG -3’
[00158] Reverse: 5’- GCGTCTGTGCCAGGGTGTAG-3’
[00159] Product size: 150 bp.
[00160] FIG. 5A shows the effect of the Test Substance (RR211148) on AQP-3 transcripts in HaCaT, wherein Lane 1 is for Untreated Control, Lane 4 is for Hyaluronic acid (1000 µg /mL), Lane 3 is for Test substance (RR211148) at 500 µg/ Ml and Lane 4 is for Test substance (RR211148) at 1000 µg/ mL, according to an embodiment of the present invention.
RESULTS
Table 5: The Quantitative gene expression level of AQP-3 normalized to GAPDH.

[00161] FIG. 5B shows a graph of semi-Quantitative gene expression analysis of gene transcripts for fold increase, the relative level of AQP-3 gene expression is normalized to GAPDH, according to an embodiment of the present invention.
[00162] Test Substance, ACM-21, was assayed for in vitro cytotoxicity studies against HaCaT (Human Keratinocytes cells) by MTT assay exposing the cells to different concentrations. The CTC50 value of the test substance in HaCaT cell line was above 1000 µg/mL. Reverse Transcriptase-PCR experiment was performed by using AQP-3 specific primers. Semi-Quantitative RT-PCR analysis revealed that AQP-3 mRNA was increased moderately in a dose dependent manner over the control value. The values were comparable with the standard tested (Hyaluronic acid).
[00163] The results indicate that ACM-21 has potency to increase the AQP-3 levels in Human Keratinocytes (HaCaT) cell line when treated at non-toxic concentration.

In vitro Modulatory Effect on GSH by Test formulation against H2O2 induced oxidative stress in Human Keratinocytes
[00164] The purpose of this study is to evaluate the Modulatory property of the test formulation (ACM-21) against Hydrogen peroxide induced toxicity in Human Skin Keratinocyte cells.
[00165] The test formulation was evaluated for its In vitro Modulatory activity on GSH in Human Skin Keratinocyte cells. From the previous cell proliferation study conducted, the highest dilutions (1000 and 500 µg/mL) were chosen for the modulatory assay on GSH levels.Treatment of Human Keratinocytes with Hydrogen peroxide significantly increased the oxidative stress thereby reducing the GSH levels. However, the test formulation exhibited antioxidant property by significantly increasing the levels of GSH compared to H2O2 control.
Table 6.1 shows the Reference Material/Chemicals used
Chemical Batch/ LotNo. Manufacturer Expiry Date
MTT 0000307556 Hi-media, India -
Fetal Bovine serum 42F1190K Gibco, USA Jan-2024
PBS 0000370943 Hi-Media, India Jan-2022
Trypsin 000047277 Hi-Media, India March-2023
Antibiotics 0000416266 Hi-Media, India Mar-2022
DMEM-HG 0000446761 Hi-Media Aug- 2023
GSH assay kit 855AK17GB1 Elabscience, China July-2022

Table 6.2 shows the list of equipments used
[00166] S. No. Name of the Instrument Make Instrument ID
1. Biosafety Cabinet Ascesension, India RRS/INS/CB/01
2. CO2 Incubator NUAIRE, USA RRS/INS/CB/02
3. Invertedtissueculture microscope Motic, China RRS/INS/CB/04
4. Automatedmicroplate reader Biotek, USA RRS/INS/MB/05
5. -20 Deep Freezer Vestfrost, Denmark RRS/INS/MB/01

[00167] Outline of the method: The in vitro modulatory activity on GSH was performed for the test formulation in Human Keratinocytes to evaluate the effect of test substance against Hydrogen peroxide induced oxidative stress.
[00168] Preparation of test solution: For studies, 10 mg of test substance was dissolved in DMSO and volume was made up with DMEM-HG supplemented with 2% inactivated FBS to obtain a stock solution of 10 mg/ml concentration, followed by sterilization by syringe filtration. Two-fold serial dilutions were prepared from this for carrying out cytotoxic studies.
[00169] Cell Line and Culture medium:Human Keratinocytes (HaCaT) was obtained from American Type Culture Collection (ATCC, USA)) and were cultured in DMEM-HG media supplemented with 10% inactivated Fetal BovineSerum (FBS), penicillin (100 IU/mL), streptomycin (100 µg/mL) and amphotericin B (5 µg/mL) in a humidified atmosphere of 5% CO2 at 37°C until confluent. The cells were dissociated with TPVG solution (0.2% trypsin, 0.02% EDTA, 0.05% glucose in PBS). The stock cultures were grown in 25 cm2 culture flasks and all experiments were carried out in 96 well microtitre plates (Tarsons India Pvt. Ltd., Kolkata, India).
[00170] H2O2 induced cytotoxicity assay:The monolayer of cells were trypsinized and the cell count was adjusted to 2.0 x 105 cells/ml using respective media viz., DMEM-HG containing 10% FBS. The test formulations were assayed for GSH modulatory activity post H2O2 treatment. To each well of the 12 well plates, 1.0 mL of the diluted cell suspension was added. After 24 h, when a partial monolayer was formed, the supernatant was flicked off; the monolayer was washed once with medium. The cells were treated with H2O2 (500 µM) and incubated for 3h, followed by addition of the non-toxic concentrations (Table 5) of the test formulation (prepared in medium with 2% FBS). Ascorbic acid was used as the positive control (standard) for the experiment at a concentration of 100 µM.
[00171] GSH modulation assay: The cell culture supernatant was collected from different treatment wells, centrifuged for 20 min at 1000Xg at 2-8ºC. The samples were analyzed to estimate the levels of GSH using Elabscience GSH ELISA kit by following the manufacturer’s instruction.
RESULTS
Table 5: Modulatory activity on GSH by test substance in HaCaT cells against Hydrogen peroxide induced oxidative stress

Sl. No Samples Concentration tested % Increase in GSH leveloverH2O2control

1.
RR211148 (ACM-21)
1000 µg/mL
500 µg/mL
85.97±0.57
70.24±1.05
2. Ascorbic acid 100 µM(17.61
µg/mL) 90.78±0.19

[00172] The test formulation (ACM-21) was assayed for in vitro proliferative study against HaCaT cell line by MTT assay. The cells were exposed to different concentrations of test substances (1000 µg/ml to 31.25 µg/ml). The ACM-21 formulation was found to be safe in HaCaT cells even at the highest concentration tested (1000 µg/mL). The test formulation at 1000 and 500 µg/mL exhibited a remarkable increase in the levels of GSH over hydrogen peroxide control.
[00173] The findings of the study suggest that the given compounds could exhibit promising modulatory effect on GSH levels against hydrogen peroxide induced oxidative stress in a dose-dependent manner in Human keratinocytes.
[00174] According to an embodiment of the present invention, the dried pulverized coarse powder of Aloe vera have Aloin / Carbohydrates / flavonoids / pectins etc. These active ingredients promote the hair growth through increase in ‘Hair Follicle’ formation. Further, they strengthen hair root, regeneration of hair strand, lipid-protein-lipid strengtheningand avoid hair loss.
[00175] Thus, according to an embodiment of the present invention, about 3% of Peppermint oil (Mint MenthaSpps.) has no toxic effects and promotes the blood circulation along with vascularization of hair papillae thereby increasing hair growth through induction of early anagen stage.
[00176] According to another embodiment of the present invention, the Curry leaves possess higher levels of beta-carotene and protein content. Application of oil extract of curry leaves prevents hair loss and hair thinning. The essential aminoacids for hair growth are through strengthening of hair fiber.
[00177] The various embodiments of the present invention provide a herbal formulation for better hair growth, nourishment and conditioning of hairs. The formulation comprises an extract obtained from admixture of Aloe barbadensis(Aloe vera), Menthasps and Murrayakoenigii (Curry leaves) pulverised powder. The pulverised coarse powder (20-30 mesh) of Aloe barbadensis(Aloe vera), Mentha Spps and Murrayakoenigii (Curry leaves) are present in the ratio of 50:25:25.
[00178] According to another embodiment of the present invention, a herbal formulation for better hair growth, nourishment and better conditioning of hair is provided. The method comprises taking the dried leaves of Aloe barbadensis. The leaves of Aloe barbadensis miller are cleaned and dried, followed by subjecting to pulverization and obtaining coarse powder of 20-30 mesh. The aerial parts of Mentha plants are taken, cleaned, graded and dried. A pulverised coarse powder of 20 – 30 mesh is obtained from the dried leaves. The aerial parts of curry patta are taken, cleaned and dried. Leaves are collected and subjected to drying. A pulverised (20-30 mesh) coarse powder is obtained from the dried leaves. The pulverised coarse powders of Aloe vera, Mentha and Curry leaves are mixed at a ratio of 50:25:25 to obtain an ‘admixture’.

G) ADVANTAGES OF INVENTION
[00179] The present invention provides a herbal formulation having beneficial effects viz. nourishing, growth, preventing loss of hair, conditioning property of the hair and hair follicles. The additive effect of extract is, as it was prepared from ‘admixture’ of pulverised coarse powders of Aloe barbadensis,MenthaSpps., and Murrayakoenigiiwhich provides nourishing, growth, conditioning, and prevents hair loss.
[00180] The present invention has positive effects on the human keratinocytes and has potency to increase the Collagen levels in Human Dermal Fibroblasts (HDF) cell line when treated at non-toxic concentration.
[00181] The herbal formulation of the present invention has potency to decrease the 5-a-Reductase levels in Human Keratinocytes when treated at non-toxic concentration.
[00182] The herbal formulation of the present invention has potency to increase the AQP-3 levels in Human Keratinocytes cells when treated at non-toxic concentration.
[00183] The herbal formulation of the present invention exhibits promising modulatory effect on GSH levels against hydrogen peroxide induced oxidative stress in a dose-dependent manner in Human keratinocytes.
[00184] It is to be understood that the phraseology or terminology employed herein is for the purpose of description and not of limitation. Therefore, while the embodiments herein have been described in terms of preferred embodiments, those skilled in the art will recognize that the embodiments herein can be practiced with modification within the spirit and scope of the claims presented in the complete specification or non-provisional application.

For, SARVOTHAM CARE LIMITED

BY THEIR AGENT
(DR. BABITHA THARAPPAN)
IN/PA-1614
ATV-LEGAL
,CLAIMS:WE CLAIM:
1. A method of preparing aherbal formulation for better hair growth, nourishment and conditioning of hairfollicles, comprises:
a) preparing a mixture of herbs, wherein the herbs are Aloe barbadensis, MenthaSpps., and Murrayakoenigii;
b) preparing a solvent solution, wherein the solvent solution is prepared by subjecting a mixture of water and glycerine in a ratio of 30:70 to a temperature of from 80°C to 30°C, preferably 40°C for 2 hours and cooling the mixture to a temperature of 30°C;
c) soaking the mixture of herbs in the solvent solution for 24 hours;
d) decanting a supernatant liquid;
e) repeating the steps (c) and (d) thrice to obtain the formulation.

2. The method as claimed in claim 1, wherein the herbs are mixed in a ratio of 50: 25:25 respectively.

3. The method as claimed in claim 1, wherein the aloe vera is used in the form of dried leaves.

4. The method as claimed in claim 1, wherein the mint is used in the form of dried aerial parts.

5. The method as claimed in claim 1, whereinthe herbs are pulverisedin powder form having particle size 20-30 mesh.
6. Aherbal formulation for better hair growth, nourishment and conditioning of hairfollicles, comprises:
an extract of coarsely powdered mixture of Aloe barbadensis, MenthaSpps., and Murrayakoenigii, wherein the Aloe barbadensis, MenthaSpps., and Murrayakoenigii are present in a ratio of 50:25:25 in a solvent, wherein the solvent is a treated solvent.

7. The herbal formulation as claimed in claim 6, wherein the treated solvent comprises water and glycerin in a ratio of 30:70.

8. The herbal formulation as claimed in claim 6, wherein the treated solvent solution is prepared by subjecting a mixture of water and glycerine in a ratio of 30:70 to a temperature of from 80°C to 30°C, preferably 40°C for 2 hours and cooling the mixture to a temperature of 30°C.

9. The herbal formulation as claimed in claim 6, wherein the extract is soaked thrice in the treated solvent and collected as supernatant liquid.

10. The herbal formulation as claimed in claim 6, wherein the formulation is effective on the human keratinocytes and has potency to increase the Collagen levels in Human Dermal Fibroblasts (HDF).

11. The herbal formulation as claimed in claim 6, wherein the formulationhas potency to decrease 5-a-Reductase levels in Human Keratinocytes cells, has potency to increase the AQP-3 levels in Human Keratinocytes (HaCaT) cell.

Dated this 28th day of July, 2022

For, SARVOTHAM CARE LIMITED

BY THEIR AGENT
(DR. BABITHA THARAPPAN)
IN/PA-1614
ATV-LEGAL

Documents

Application Documents

# Name Date
1 202141037012-PROVISIONAL SPECIFICATION [16-08-2021(online)].pdf 2021-08-16
2 202141037012-PROOF OF RIGHT [16-08-2021(online)].pdf 2021-08-16
3 202141037012-POWER OF AUTHORITY [16-08-2021(online)].pdf 2021-08-16
4 202141037012-FORM FOR SMALL ENTITY(FORM-28) [16-08-2021(online)].pdf 2021-08-16
5 202141037012-FORM FOR SMALL ENTITY [16-08-2021(online)].pdf 2021-08-16
6 202141037012-FORM 1 [16-08-2021(online)].pdf 2021-08-16
7 202141037012-FIGURE OF ABSTRACT [16-08-2021(online)].jpg 2021-08-16
8 202141037012-EVIDENCE FOR REGISTRATION UNDER SSI(FORM-28) [16-08-2021(online)].pdf 2021-08-16
9 202141037012-EVIDENCE FOR REGISTRATION UNDER SSI [16-08-2021(online)].pdf 2021-08-16
10 202141037012-DRAWINGS [16-08-2021(online)].pdf 2021-08-16
11 202141037012-DECLARATION OF INVENTORSHIP (FORM 5) [16-08-2021(online)].pdf 2021-08-16
12 202141037012-DRAWING [28-06-2022(online)].pdf 2022-06-28
13 202141037012-COMPLETE SPECIFICATION [28-06-2022(online)].pdf 2022-06-28
14 202141037012-FORM 18 [30-05-2023(online)].pdf 2023-05-30
15 202141037012-PRE GRANT OPPOSITION DOCUMENT [15-01-2024(online)].pdf 2024-01-15
16 202141037012-RELEVANT DOCUMENTS [19-12-2024(online)].pdf 2024-12-19
17 202141037012-POA [19-12-2024(online)].pdf 2024-12-19
18 202141037012-FORM 13 [19-12-2024(online)].pdf 2024-12-19