FORM 2
THE PATENTS ACT, 1970
(39 of 1970)
&
THE PATENT RULES, 2003
PROVISIONAL SPECIFICATION (See Section 10; rule 13)
"HETEROLOGOUS PRODUCTION OF INTERLEUKIN IRA IN PICHIA PASTORIS"
RELIANCE LIFE SCIENCES PVT.LTD.
an Indian Company having its Registered office at
Chitrakoot, 2nd Floor,
Ganpatrao Kadam Marg,
Shree Ram Mills Compound,
Lower Parel, Mumbai 400 013,
Maharashtra, India
The following specification describes and ascertains the nature of this invention and the manner in which it is performed: -
1

FIELD OF THE INVENTION:
The present invention relates to an efficient process for the production of heterologous protein. The invention in particular relates to high yield production and expression of Interleukin 1 receptor antagonist (IL-lra) in Pichia Pastoris expression system.
BACKGROUND OF THE INVENTION Physiological role
Cytokines are low molecular weight, soluble proteins that are produced in response to an antigen and function as chemical messengers for regulating the innate and adaptive immune systems. They are produced by virtually all cells involved in innate and adaptive immunity, but especially by T helper (Th) lymphocytes. The activation of cytokine-producing cells triggers them to synthesize and secrete their cytokines. The cytokines, in turn, are then able to bind to specific cytokine receptors on other cells of the immune system and influence their activity in some manner. Cytokines are pleiotropic, redundant, and multifunctional.
Cytokines are cell intercellular messengers responsible for signalling an incredible variety of cell functions. Cytokines may have multiple functions and actions and different cytokines may have similar biological functions. A wide variety of intercellular regulatory proteins are produced by many different cells in the body, which ultimately control every aspect of body defense. Cytokines activate and deactivate phagocytes and immune defense cells, increase or decrease the functions of the different immune defense cells, and promote or inhibit a variety of nonspecific body defenses. Cytokine receptors broadly are grouped into several families depending on their characteristic structures. The most common type of receptor is the hemopoitein-receptor family, so called because it was initially characterized by an erythropoitein receptor (Virella, 1998). The receptors of this family are heterodimers or heterotrimers and include a α and a p chain, the latter is with longer intracytoplasmic segment and signaling functions. The receptors for interleukin (IL)-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-9 and IL-15 are included in this family. Some of them share subunits. Receptors for IL-3, IL-5, share a common P chain. A different P chain is shared by receptors for IL-6 and IL-11. Receptors for IL-2, IL-4, IL-7,
2

IL-9 and IL-15 share a third chain (y), which plays a significant role in signal transduction.
The other common chemokine receptor family whose common features is seven transmembrane domains including receptors for IL-8, platelet factor 4, and macrophage chemotactic and activating proteins. Chemokines comprise a large family of structurally homologous cytokines that share the ability to stimulate leukocyte motility (chemokinesis) and directed movement (chemotaxis). The name chemokines is a contraction of chemotactic cytokines. Members of this family are IL-8, monocyte chemo attractant protein-l (MCP-1), MCP-2, MCP-3. They act on neutrophil as mediators of acute inflammation (Abbas et al., 1999).
MCP-1 receptor has seven transmembrane spanning receptor which binds to human and murine macrophage inflammatory protein (MP)-l. This receptor mediates mobilization of intracellular calcium in response to MCP-1 but not to related chemokines (Charo et al., 1994).
IL-1 a and IL-1 |3 bind high affinity receptors, which are present on most nucleated cell types. The numbers of receptors range from 50 or fewer on T lymphocytes to several thousands on fibroblast (Ruscetti and Oppenheim, 1997).
Two distinct receptors have been characterized, both of which are transmembrane glycoproteins that bind IL-1 α and IL-1 β equally. These receptors share only 28% sequence similarity. IL-1 receptor type 1 (IL-1 Ri) is 517 amino acids long; it has a 217 amino acid cytoplasmic tail and transmit signals intra-cellularly when it binds IL-1. It is responsible for signaling in all IL-1 responsive cells. IL-1 receptor type II (IL-1 RII) has only 29 amino acids cytoplasmic and cannot transduce signals. The extracellular domain of IL1-RII is released in soluble form at sites of local inflammation and into the serum during systemic inflammation (Ruscetti and Oppenheim, 1997).
IL-1 receptor antagonist protein (IL-1Ra) is a substance on T lymphocyte and endothelial cells that inhibits IL-1 activity (Cruse and Lewis, 1999).
3

The agonist effects of IL-1 are partially regulated by IL-1Ra. IL-1Ra is released by monocytesa and tissue macrophages. IL-1Ra inhibits prostaglandin production by synovial cells and chondrocytes. In activated synovial cells, IL-1Ra inhibits Matrix metalloproteinase production (Smith et al., 1991).
Evidence suggests that IL-1 is an important mediator of inflammation and joint damage through cartilage resorption in experimental arthritis (Firestein et al., 1994). IL-1 induces prostaglanden (PGE2) release by synovial cells and regulate the production of numerous cytokines, involved in synovitis, such as IL-1, IL-4, IL-10, IL-5 and TNE a. IL-1 amplifies the T cell activation by inducing IL2 and IL-2 receptor gene expression, but is not required for T cell proliferation (Sany et al., 1999).
In IL-1 receptor type I deficient mice, splenocytes and lymph node cells produce increased amount of IL-4 and IL-10 after antigenic stimulation (Paleolog et al., 1996). These data demonstrate that IL-1 negatively regulates IL-4 and IL-10 expression and favours the Th-1 response. Although IL-1 is a known activator of collagenase and stromelysin, an important step in cartilage breakdown, the effects of IL-1 are counterbalanced by the neutral antagonist IL-lra and soluble IL-1 receptors I and II (Sany et al., 1999).
It is a known fact that recombinant human soluble IL-1 R1 when administrated to patients with rheumatoid arthritis (RA), failed to produce significant clinical improvement with reduction in monocyte surface.
IL-1 (Drevlow et al., 1996), in many cases worsened the disease. This may be due to recombinant soluble IL-1R1 binding to IL-lra. If this binding occurs, less IL-lra will bind to cell surface IL-1R1. These free IL-1R1 molecules will therefore engage with IL-1 itself, augmenting IL-1 induced cell activation and inflammation. As soluble IL-1 RII does not bind to IL-lra it may be a better therapeutic choice (Choy, 1998). Recombinant human IL-lra administered as subcutaneous (s.c.) injections has been tested in a double-blind placebo controlled multicenter trial (Bresnihan et al., 1996). A dose 150 mg/day
4

administered s.c. produced significant clinical improvement and slowed the progression of erosion (Choy et al, 1998).
Interleukin-1 receptor antagonist (IL-lra) is a recently described member of the IL-1 family. This unique human protein has 30% amino acid sequence homology to IL-1 beta and binds to human types I and II IL-1 receptors without apparent cellular activation. IL-lra blocks the in vitro stimulatory effects of IL-1 on thymocytes, fibroblasts, endothelial cells and bone cells. In addition, IL-lra is a potent inhibitor of the inflammatory effects of IL-1 in vivo. IL-lra represents the first naturally occurring cytokine inhibitor and may be important in modulating IL-1 effects in both normal and abnormal physiology.
The IL-1 family includes two agonists, IL-1α and IL-1β, and a naturally occurring receptor antagonist; IL-1Ra. IL-1Ra is produced locally in various tissues in response to infection or inflammation, and is present in high levels in the circulation secondary to hepatic production as an acute-phase protein.
Multiple isoforms of IL-1Ra have been described: a 17-kDa form secreted from monocytes and other cells as variably glycosylated proteins of 22-25kDa, and at least three intracellular molecules. The first described intracellular isoform of IL-1Ra (icIL-lRal) predominates in epithelial cells and fibroblasts, and is a delayed product of transcription in monocytes. The role in physiology of secretory IL-1Ra (sIL-1Ra) appears to be to inhibit competitively the local inflammatory effects of IL-1. Although icIL-1Ra isoforms may be released from dying cells and may also function as receptor blockers, other possible functions of icIL-1Ra isoforms inside cells may exist.
The role of cytokines in RA, and the rationale for inhibition of IL-1 and tumor necrosis factor (TNF)-α in this disease have been extensively reviewed. Much evidence indicates that both of these proinflammatory cytokines are overproduced in the rheumatoid joint and are key mediators in both inflammation and tissue destruction. The demonstrated success of the therapeutic administration of inhibitors of IL-1 and TNF-a offer further support for the importance of these cytokines in the rheumatoid disease process.
5

However, much less is known about the importance and role of natural mechanisms to counteract the effects of IL-1 and TNF-a in the joint, and whether an imbalance in these mechanisms may predispose to the development of RA. Endogenous inhibitors of IL-1 and TNF-a include their respective soluble receptors; IL-1 effects may be further blocked bylL-1Ra.
IL-1 RA consists of three linked genes mapping within a 430-kb region of the long arm of chromosome 2 in humans, encoding the secreted glycoproteins IL-1 a, IL-113 and IL-1 RA. All three molecules bind to IL-1 receptors. IL-la and IL-113 are potent proinflammatory cytokines, while IL-1 RA as an anti-inflammatory cytokine competes with IL-la and IL-lfi in binding to IL-1 receptors without intrinsic effects. Polymorphisms have been reported in all three genes. The polymorphism of IL-la, IL-1 ft and IL-1 RA produce alterations of the IL-la, IL-113 and IL-1 RA protein expression and it may have crucial effects on oncogenic processes.
Preparation of IL1ra
Hannum etal. in US patent 5,075,222 describes the method for preparing Interleukin-1 inhibitors and the recombinant methods for the production. The inhibitor was isolated in a purified form from monocyte conditioned medium with monocytes grown on IgG- coated plates. On SDS-PAGE, it was demonstrated that the protein as a 22-23 kD protein which eluted at 52 mM and 60 Mm NaCl, respectively from a Mono Q FPLC column under specified conditions. However, purifying a protein from E. coli has its inherent disadvantages, e.g. the process is cumbersome, too many steps, leading to loss in yields, lack f post translational modifications which might be needed for bioactivity etc.
Escherichia coli has been more frequently used as a host for several reasons. It is a single-celled organism that reproduces mainly through asexual reproduction. The simplicity of the organism makes it easy and cheap to work with. The carbon source is simple, and it does not require elaborate facilities for growth and maintenance. Its rapid growth cycle allows for a quick increase in the population size of a particular strain. However though the simplicity of E. coli makes it a desirable host for production of a
6

protein of interest, it also has its disadvantages as a host cell. E. coli is a prokaryote. Like all prokaryotes, E. coli does not have any of the membrane bound organelles found in Eukaryotes. In Eukaryotes a protein is often modified after it is initially produced. Some of the best-studied modifications occur in different organelles, such as the Endoplasmic Reticulum or the Golgi apparatus. These post-translational modifications, in many cases, are necessary to convert the protein to a functional form. Modifications, often involve addition of different forms of glycosylation. Any eukaryotic protein can be mass translated in E. coli, but many are not quite finished and hence, they are nonfunctional. E. coli would give the same primary structure, as occurs when that protein is initially produced in its own cell type. However the failure to modify that structure often means that the protein will not form as it would with the presence of certain organelles.
However the use of animal cells as a host cells also suffers from drawbacks. The amount of protein of interest produced is typically low, and for purification of protein considerable efforts are required. Also, since animal cells reproduce slowly and media used are expensive, culturing process is therefore time and cost intensive. Further it is difficult to scale up the culturing process using animal cells. Consequently, animal cells are not desirable as a host cell for producing protein of interest at an industrial scale.
Moreover as already known to those ordinary skilled in the art that though the expression levels in E.coli are high, difficulties associated with downstream purification often lead to loss of yield. The inclusion bodies in E.coli constitute a large portion of the total cell protein and such inclusion bodies can pose significant problems during purification affecting the final yield and activity of the protein. The methods for recovering IL-1Ra from the inclusion bodies requires a large number of additional steps and are still a cause of concern for improving the yield and correct folding of the protein.
Furthermore a problem associated with E.coli based expression system is the difficulty of producing material, which is acceptable for therapeutic use. The use of the complex media, antibiotic selection and potentially hazardous inducers such as IPTG may render the final product that is IL-IRA unacceptable to the regulatory authorities for the clinical
7

applications. Evidence demonstrated clearance of these agents from the final product must be provided in order to secure regulatory clearance and clearance of these agents is very expensive.
Besides in E.coli the translation of the protein begins with methionine. For eliminating methionine from the terminal amino end of the gene of interest is usually cloned as a fusion protein. The separation of the IL-1Ra from the fusion peptide requires an additional step involving the digestion of the peptide with specific protease. Otherwise, the methionine residue must be eliminated by cyanogen bromide (CNBr), which may lead to the residual CNBr. However it is known fact that cyanogen bromide has high acute toxicity and may be fatal. Hence such process with the use of cyanogen bromide would not be desirable.
Additionally, a result of the expression of recombinant DNA in E.coli is the accumulation of high concentration of acetate in the media, mainly during the induction phase. The accumulation of high concentration of acetate (greater than 5g/l) is known to have deleterious effect on cell growth and recombinant protein expression.
On account of the aforementioned demerits of the E.coli as a host, different host cells have been tried for synthesis of interleukin. Of the different types of host cells such as mammalian, insect, and yeast cells that have been studied for producing eukaryotic products, yeast cells have been considered as the most suitable. The yeast cells are believed to combine the ease of genetic manipulation and rapid growth characteristics of a prokaryotic organism with the subcellular machinery for performing post-translational protein modification of eukaryotic cells.
Since many proteins are of immense commercial value, numerous studies have focused on finding ways to produce them inexpensively, easily and in a fully functional form. E. coli is a prokaryote and lacks intracellular organelles, such as the endoplasmic reticulum and the golgi apparatus that are present in eukaryotes, which are responsible for modifications of the proteins being produced. Many eukaryotic proteins can be produced in E. coli but are produced in a nonfunctional, unfinished form, since glycosylation or
8

post-translational modifications do not occur. Therefore, the inventors of the present invention have turned to eukaryotic systems like yeast and mammalian expression systems for protein production Looking into the demand to provide a cost effective process for IL-lra, the present invention has addressed to improve the process by enhanced expression of IL-lra in suitable yeast host such as Pichia. Compared to other eukaryotic expression systems, Pichia offers many advantages, because it neither has the endotoxin problem associated with bacteria nor the viral contamination problem of proteins produced in animal cell culture. In view of the disadvantages of bacterial cells like E.coli and animal cells, yeast cells were used as an alternative host cells. As yeasts offer advantages over their prokaryotic counterparts, which include an intracellular environment that is more conducive for correct folding of eukaryotic proteins: Additionally yeasts, unlike prokaryotic hosts, have the ability to glycosylate proteins, which is important for both the stability and biological activity of the protein.
One of the alternative species that has been looked at is Pichia pastoris (current name Komagataella pastoris). Furthermore, P. pastoris can utilize methanol as a carbon source in the absence of glucose. The glyceraldehide 3-phosphate dehydrogenase promoter (PGAP) has been used for constitutive expression of several heterologous proteins. In GAP promoter expression system, the cloned heterologous protein will be expressed along with cell growth if the protein is not toxic for the cell. This system requires no washing to remove non-methanolic carbon sources, and no accurate optimization of the culture conditions as in methanol induction phase. This system is more suitable for large-scale production because the hazard and cost associated with the storage and delivery of large volumes of methanol are eliminated. These vectors allow for continuous production of the recombinant product avoiding the traditional P. pastoris fed-batch fermentations using the methanol inducible system. Thus, the features of the GAP expression system may contribute significantly to the development of cost-effective methods for large-scale production of heterologous recombinant proteins. This promoter has been characterized and incorporated into a series of P. pastoris expression vectors. Since the proteins produced in P. pastoris are typically folded correctly and secreted into the medium, the
9

fermentation of genetically engineered P. pastoris provides an excellent alternative to E. coli expression systems.
A number of proteins have been produced using this system, including tetanus toxin fragment, Bordatella pertussis pertactin, human serum albumin and lysozyme. There are several reasons that this particular species is appealing. Pichia pastoris has a strong, inducible promoter that can be used for protein production. It is capable of generating post-translational modifications that are more similar to human protein modifications than S. cerevisiae was capable of doing. Isolation of foreign protein is facilitated by the fact that P. pastoris does not secrete a lot of its own proteins. Additionally, contamination of a Pichia-derived product with endotoxins is not a concern, giving Pichia an extra advantage for the production of proteins of interest for therapeutic use compared with bacterial production systems. Moreover the proteins produced in P. pastoris are typically folded correctly and directly into the culture medium, thus P. pastoris provides a better alternative to other expression system.
The Chinese patent CN1712536 describes the expression of human Interleukin 24 from yeast cell by cloning IL-24 gene or IL-24 gene with base mutation which is constructed onto three expression carriers pPIC3.5K, pPIC9K or pA0815 and eight expression carriers are obtained using His-pichia GS115, KM71 or SMD1168 as host cell, endocellular soluble expressing or exocellular secretory expressing, and obtaining expression human interleukin 24.
The Chinese patent CN1670034 discloses a method for producing recombination human interleukin 11 in Pichia which consists of reversed phase column chromatography, hydrophobic column chromatography, gel column chromatography sequential combination purification. The method can be applied for mass preparation of high purity medicinal recombinant human interleukin 11 proteins.
The Chinese Patent CN1506463 describes a method for yeast cell to express human interleukin 10 (hIL-10) having the technological scheme including artificially
10

synthesizing all-gene sequence of hIL-10 including signal-carrying hIL-10 sequence, and no-signal hIL-10 sequence, adding the ends with EcorR I enzyme incising sequence and Not I enzyme incising sequence or with EcorR I enzyme incising sequences; double incising with EcorR I and Not I the integral expression vector pPIC3.5K and Ppic9K of destination gene shIL-10, nshIL-10 and Pichia yeast; constituting recombinant plasmid pPIC3.5K/shIL-10 and Ppic9K/nshIL-10; converting Pichia yeast cell via electrical perforation and plasmodic granule process; integrating recombinant plasmid and destination gene to yeast chromosome; and applying methanol to induce Pichia yeast for intracellular soluble expression and extracellular secretion type expression.
As there is no data on the use of Pichia as a expression vector/host for IL-lra, the present invention has focused more on improving the expression of 1L-1RA in yeast. As Pichia pastoris is a robust yeast expression system that produces high levels of recombinant proteins for a variety of pharmaceutical and industrial purposes. The Pichia system is stable, durable and cost-effective. Pichia grows on simple media and secretes low amounts of endogenous protein, making it easier to recover and purify desired proteins. Looking into the need for better expression yields and subsequent less processing steps the present invention has provided a simple and economical process for producing IL-1Ra, which is commercially viable.
OBJECT OF THE INVENTION
It is the object of the present invention to provide an efficient process for the production of IL-lra.
It is still further the object of the present invention to provide process for enhanced expression of IL1ra that is stable, durable and cost-effective.
It is the object of the present invention to provide a process for the expression of IL-lra in a host such as yeast, particularly pichia pastoris.
11

It is an object of the present invention to provide a IL-lra expressed in pichia pastoris which is similar to the protein expressed in other hosts such as E.Coli.
It is an object of the present invention to provide a method of preparing IL-lra by expressing in pichia using GAP promotor.
SUMMARY OF THE INVENTION
The present invention provides an efficient process by which IL-IRA can be secreted out into the medium in Pichia Pastoris making it easy to isolate and purify the protein. In particular, the present invention provides IL-IRA with enhanced biological activity which renders it applicable for therapeutic purposes.
The present disclosure provides an efficient process for expression of Interleukin 1 receptor antagonist (IL-lra).
In one embodiment, the present invention in particular relates to the production and expression of proteins in yeast expression system. In the preferred embodiments the yeast expression system used is pichia.
In one embodiment, the present invention provides an efficient process that is stable, durable and cost-effective.
In one embodiment, the present invention provides purification and characterization of IL-lra as herein described in the specification.
As used herein the term interleukin-lra means IL-lra polypetides and analogs thereof having substantial amino acid sequence identity to wild type mature mammalian IL-lra.
12

In the preferred embodiment, the nucleic acid encoding the protein is transfected into the host cell using the recombinant DNA technology. In the context of the present invention, the DNA includes a sequence encoding the proteins of the present invention. Suitable host cells include prokaryotic, yeast or higher eukaryotic. Preferred host cells are of Pichia pastoris
The present invention also provides a process for preparing the recombinant proteins of the present invention including culturing a host cell transformed with an expression vector comprising a DNA sequence that encodes the fusion protein of the present invention under conditions that promote expression, extracellularly. The desired protein is then purified from culture media.
As used herein the expression vectors are capable of expressing proteins composed of interleukin-IRA are inserted into vectors containing appropriates promoter such as Lac, tip, tac, PI, T3, T7, SP6, SV40 and the like or such DNA'S are ligated to these promoters and ribosomal binding sites, followed by construction of vector system through inserting them into various plasmids. DNAXS encoding the desired proteins or peptides are inserted into 3' terminus of these vectors, the resulting expression vectors are introduced into appropriate hosts and the constructed transformants are cultured to produce the desired fusion proteins.
The transformants are prepared by introducing the expression vectors producing the IL-1Ra proteins into suitable or appropriate hosts by the conventional method of Hanahan.
The present invention has provided a simple, cost effective procedure for the production of IL-1Ra using Pichia as a expression host. As Pichia has a GRAS status, the inventor have utilized it within the stated limits and have successfully expressed the protein to about 60% of the total protein. Further, the process requires a single step of purification followed by ultrafiltration to yield a pure protein with no native contaminant proteins.
13

BRIEF DESCRIPTION OF THE FIGURES
The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present disclosure, the inventions of which can be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein.
Figure 1: Illustrates the PCR amplification of c-DNA of IL-1Ra from HS-5 mammalian cell line wherein Lane-1 shows l00bp ladder (NEB) Lane-2 & 3 shows no amplification seen with HS-5 cells induced with PMA. Lane-4 shows amplification of IL-1RA from uninduced HS-5 cells.Lane-6 shows negative control (no template)
Figure 2: illustrates the PCR amplification product of cloned IL-1Ra into pGEMT vector with ends compatible for pGAPZA vector A. Lane 1&2 represent the Taq PCR product, Lane 3&4 represent the pfu PCR product and Lane 5 represents 1 Kb DNA ladder (NEB).
Figure 3: illustrates the Eco-R-1 digestion of recombinant pGEMT clones T1-T12.
Figure 4: illustrates the Eco R-l digestion of vector and plasmid carrying the insert
Figure 5: illustrates PCR AMPLIFICATION OF IL-lra USING pGAPZA FORWARD PRIMER AND IL-1RA* S REVERSE PRIMER
Lane-1 depicts 1 KB ladder (NEB)
Lane-2 depicts PCR products of positive clones cl.3, 7,8,10,16,19,20,22,25,29,30,31
Lane-15-negative control (no template)
Lane-16-lOObp ladder (NEB)
Figure 6: illustrates the alignment view, wherein one can compare the sequence of the cloned gene with that of the designed.
14

Figure 7: illustrates the genomic DNA PCR of the recombinant pichia pastoris strain showing integration of the gene into its host genome.
Figure 8:illustrates the SDS-PAGE profile of the partially purified protein.
Figure 9: illustrates the western blot analysis of the secreted proteins.
Lane 1- Rainbow Marker ( Invitrogen) RPN 755
Lane 2- Vector control (pGAPZaA/x-33)
Lane 3-24 hour supernatant clone 1
Lane 4- 48 hr supernatant clone 1
Lane 5- 72hr supernatant clone 1
Lane 6- 24 hr supernatant clone 7
Lane 7- 48 hr supernatant clone 7
Lane 8- 72 hr supernatant clone 7
Lane9-IL1RA Standard (Prospectany)
DETAILED DESCRIPTION OF PREFERRED EMBODIMENTS
The present invention provides an efficient process of production and expression of IL-1RA in yeast expression system , which can be secreted directly into the medium by pichia pastoris making it easy to isolate and purify the protein. As Pichia has a GRAS status, the inventor has utilized it within the stated limits and has successfully expressed the protein to about 60% of the total protein. Further, the process requires a single step of purification followed by ultrafiltration to yield a pure protein with no native contaminant proteins. The process developed by the present invention is stable, durable and cost-effective.
The present invention relates to the production and expression in pichia pastoris and further purification and characterization of IL-lra.
15

The present invention provides the method of producing IL-lra in high yields comprising the steps as given below:
1. Construction of cDNA
2. Insertion of the cDNA in plasmid
3. Expression in Pichia
4. Purification
5. Identification or assays
6. Activity
In one aspect of the present invention, E.coli BL21DE3 codon plus was transformed with the expression vector. The recombinant IL can be produced by culturing the transformed recombinant Pichia under suitable condition.
In another aspect of the present invention, x-33 was transformed with the expression vector. The transformed recombinant x-33 was cultured under suitable conditions producing the desired recombinant protein.
In still another aspect of the present invention, cell extracts were obtained by treatment with lysozyme digestion or freezing and thawing or ultrasonication or French press process, followed by methods, such as solubilization of extracts, ultrafiltration, dialysis, ion exchange chromatography, gel filtration, electrophoresis and affinity chromatography.
Further, the glyceraldehydes -3 phosphate (GAP) dehydrogenase enzyme is constitutively expressed in Pichia Pastoris and the yield of the desired protein obtained with this GAP promoter was found to be more as compared to AOX promoter
The cell density obtained by the present invention was much lower when compared to conventional fermentation procedures The present invention provides a 20-30 fold
16

increase in the yield of the protein of interest, by maintaining the per cell productivity
constant.
The present invention has provided a total concentration of the desired protein in culture
supernatant from transfected cells in the range of 0.1 to 0.2mg/lit.
The following examples are included to demonstrate preferred embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventor to function well in the practice of the invention, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.
EXAMPLES
I. CONSTRUCTION AND AMPLIFICATION OF cDNA
1. Total RNA preparation from HS-5 Cell line:
The HS-5 cells were directly lysed and the total lysate was applied to an RNEasy mini column and the total RNA was eluted.
2. cDNA preparation from HS-5 cell line
A cDNA was constructed by carrying out PCR of the eluted RNA using dNTP mix and Oligo dT pimers. The c-DNA made thus was used as a template further for PCR amplification.
3. PCR amplification of IL-1RA with Nde-1 and Bam H-l ends from above c-DNA
PCR amplification was carried out using the above template and following primers.
Forward primer for cloning IL-l-RA(ANAKINRA) with Nde-1 at 5" end.
TPG 317- 5 'd(CATATGCGACCCTCTGGGAGAAAATC) 3'
Reverse primer for cloning IL-l-RA(ANAKINRA) with Bam H 1 site at 3" end.
5'd(GGATCCTCTACTCGTCCTCCTGGAAG)3'
17

II. PREPARATION OF PLASMIDS
1. Elution of the band from gel
The band of DNA was eluted out of the gel using manufacturer's instructions of Qiagens gel extraction kit.
2. Ligation of the fragment with pGEMT Vector.
The fragment was ligated to pGEMT vector in presence of T4 DNA ligase, rapid ligation buffer, at about 4°C, for about 16-18 hours.
3. Transformation of IL-1RA/pGEMT into XL-1 competent cells;
The above IL-1RA/pGEMT plasmid ligation mixture was transformed into competent XL-1 cells following standard transformation methods. The transformants were plated onto LB-IPTG-AMP plates and the plates were incubated at 37°C overnight.
4. Screening of the colonies.
Plenty of white colonies were seen on the plate, out of which 10 were inoculated into LB broth for plasmid preparation. Plasmids were made from these cultures by Qiagen method
5. Restriction mapping of the positive clones.
The plasmids were digested with EcoR-1. All of them released the right sized fragments.
6. Sequencing of the positive clones.
The positive clones were sent for sequencing. Sequences were perfectly aligning with the IL-1RA sequence of Genbank.(Annexure-l)
18

CLONING STUDIES IN EXPRESSION VECTORS EXPRESSION IN E.COLI
Subcloning ofIL-1RA into pET vector.
The positive clones were subjected to Nde-1- Bam 111 digestion and resolved on a 1.5% agarose gel. The Nde-1- Bam HI fragment was eluted from the gel and ligated to the expression vector, pET 24a. 5 ul of the insert, 1 ul of the vector, 1 ul of the ligase buffer and 1 ul of the T4 DNA ligase was mixed together in a tube and incubated at 16°C overnight.
Transformation of IL-1RA/pET 24A into TOP10F*
IL-lra/pET plasmid ligation mix was transformed into competent XL-1 cells following standard transformation protocols. The transformants were plated onto LB-kanamycin plates. The plates were incubated at 37°C. Eight colonies were picked up for plasmid preparation and further analysis. They were inoculated into LB broth and plasmids were made by Qiagen method. The plasmids were digested with Nde-1 and Bam H-l, six of them released the IL-1RA fragment of the expected size. The six DNA 'S were sent for sequencing .The sequences matched perfectly to the known IL-1RA sequence.
Screening of the colonies
Plenty of colonies were seen on the plate, out of which 10 were inoculated into LB broth for plasmid preparation. Plasmids were made from these cultures by Qiagen method
Restriction mapping of the positive clones
The clones were subjected to Nde-1-BamH-1 digestion and the clones that released the IL-1RA fragment were taken forward.
Transformation of positive plasmids into expression host BL21DE3
3 p.l of the plasmid preparation was transformed into competent BL21DE3 by standard transformation protocols and the transformants were plated on LB+ kanamycin plates.
19

Plenty of colonies could be seen on the plate. A couple of the positive clones were taken for expression studies.
Expression
IL-IRA BL21DE3 cl.20-1 and IL-IRA BL21DE3codon plus cl.20-1 were taken forward for shake flask expression studies. Three 500 ml flasks containing 100ml of LB kanamycin in each were inoculated with overnight cultures of clone1, clone2 and BL21DE3 transformed with pET24a vector alone which was our vector control respectively. The initial O.D. was adjusted to 0.1 by taking appropriate volume of inoculum. The culture was incubated at 37°C with shaking until the O.D. reached 0.8. The cultures were then induced with 0.5 Mm IPTG final concentrations and incubated at 37°C with constant shaking. Samples were collected at 0 hrs, 3hrs and 5 hrs, post induction. Culture volumes corresponding to 1 O.D. were taken and spun down. The pellets were stored at -20°C (The cultures after 5 hrs of induction were spun down at 4°C and the pellets stored at -70°C.)
The collected pellets were lysed by adding 100 (_il of B-PER reagent following manufacturer's instructions. 20 ul of 6x SDS loading dye was added and samples were boiled for 10 minutes. 10ul of the sample was loaded for SDS PAGE and 5ul of the same sample was loaded for western. After the samples were run on 15% gels, one of the gels was put in commassie stain and the other was put for electro blotting to transfer proteins onto nitrocellulose membrane. Western blotting was done according to standard protocols available.
The appearance of a highly expressed protein only in the IL-IRA clones and not in the control vector confirmed that it is indeed IL-IRA and the expression levels were very high even in the shake flask levels.
Although the expression of the heterologous protein IL-IRA was very high in both BL21DE3 and BL21DE3 codon plus hosts, there was expression seen in even the
20

uninduced lanes. Hence it was transformed into BL21DE pLYSS strain. Four positive transformants were taken forward for expression studies.
As described earlier, induction was carried out with these four clones. 100 ul of B-PER lysis buffer was added to each sample and incubated on ice for 10 minutes. 20ul of 6x SDS PAGE dye was added to all the tubes and boiled for 10 minutes. 15 p.l and 7p.l of the above samples were loaded onto 15% SDS-PAGE gel for coomassie and western blot respectively. For western blotting, the proteins were transferred onto nitrocellulose membrane at l00 v for 1 hour and then blocked by 10 % skimmed milk powder in TBST for 1 hour. Probing was done with monoclonal primary antibody and secondary antibody raised in mouse conjugated with ALP.
As expected there was no detectable expression of IL-IRA in the uninduced lanes both in comassie and western blot. The level of expression was also comparable to BL21DE3 and BL21DE3 codon plus.
Purification;
Cell pellets were lysed using a homogenizer, inclusion bodies made, solubilised and then loaded onto a Q-sepharose column, which was washed with water and then equilibrated with 20 mM Tris buffer (pH 8.8). The column was washed with 20 mM Tris (pH8.8) and the protein was eluted with 200mMNaCl containing 20 mMTris.followed by a 500mM NaCl and 1 M NaCl.elution.The eluted fractions were resolved on a 15% SDS GEL.
B) EXPRESSION IN PICHIA PCR amplification of the cDNA:
PCR amplification was done using IL-lRa/pET24A (C1.20), with primers TPG 432 and 433.The Glu-Ala repeats were reconstructed beyond the Eco-R1 site in the primer for proper cleavage of alpha mating signal sequence. TPG-432-5M (GAATTCGAGGCTGAAGCTCGACCCTCTGGGAGAAAATC) 3'
21

TPG-433-5'D (CTCGAGCTACTCGTCCTCCTGGAAGT) 3'
The reaction mix comprised of 1 ul of template, 2.5 ul of each primer, 19 ul of water and 25 ul of Abgene's master mix. The PCR conditions were 95-2 minutes, 95-30 sec, 62-30 sec, 72-50 sec, followed by extension at 72 fro 5 minutes. This was cycled for 25 times. The band was extracted and cleaned using Qiagens gel extraction kit.
Ligation of the elutedDNA intopGAPZA vector
The EcoRla Fragment of clone T was ligated to pGAPZαA vector using T4 DNA ligase and incubated overnight at 16°C .The ligation mix was transformed into TOPI OF' cells and plated on LB low salt+zeocin plates. Around 30 colonies could be seen on the plates. The vector control plate had no colonies. A colony PCR was done for all the transformants to check for the presence of insert as well as orientation. pGAPZaA forward primer and IL-1Ra's reverse primer was used. The PCR conditions were 95-2', 95-30sec, 62-30 sec, 72-50 sec, followed by extension for 5 'and cycled for 25 times. Twelve clones were positive for the insert in the right orientation. A PCR was again done to reconfirm presence of insert using the plasmid as the template and all of them showed the expected band.cl.3, 20 and 22 were sent for sequencing and the sequence was perfect for cl.20 and that was taken forward for transformation into pichia pastoris.
Screening of the plasmids:
A plasmid with the correct in -frame sequence was selected for further characterization and studies. The DNA was linearised with AVR II. AVR II cuts in the GAP promoter region once to linearise the vector. AVR II was found not to cut in GCSF sequence. The linearisation was checked on the gel and once completely linearised, it was heat activated. Passing through min-elute reaction clean up kit from Qiagen, the DNA was eluted in a sterile water.
Transformation of the linearised IL-IRA into competent x-3 3 Pichia Pastoris cells.
PGAPZA/IL-1RA was mixed with x-3 3 cells to which solution of easy comp kit was added and vortexed well. The mixture was incubated at 30"C for 1 hour with intermittent
22

mixing every 15 minutes. The cells were heat shocked for 10 minutes and it was split into aliquots of 525 p.L each and mixed with 1ml of YEPD liquid medium. After incubation the cells were pelleted at 3000x g for 5 minutes at 37° C for 2-4 days and spread on YEPD+ zeocin plates and incubated.
Screening of the colonies:
Zeocin resistant transformants were checked for the presence of IL-1RA using PCR. The colonies growing on Zeocin ware picked up for further studies.
EXPRESSION
A single positive colony was inoculated in 10 ml YPD and incubated at 30°C with shaking overnight.0.1 ml of the O.N.culture was inoculated into 50 ml of YPD in a 250 ml flask and grown at 30°c in a shaking incubator .At 0 hr, 24 and 48 hours, 1 ml of the culture was taken in a 1.5 ml eppendorf tube .The cells were centrifuged at maximum speed for 3' at 30°C.The supernatant was aspirated and assayed for expression of IL-1Ra.
SDS/PAGE Analysis and western blot analysis:
Proteins were separated by home made SDS/PAGE (15%). Cell free supernatant (15ul) from 1 ml culture was loaded in each well. Coomassie staining revealed IL-1Ra protein.
For western blotting, cellular and secreted proteins were separated by SDS/PAGE. The samples were boiled for 5minutes in SDS-PAGE loading buffer; the proteins were separated by SDS/PAGE and transferred to nitrocellulose membrane. Additional protein binding was blocked by incubation with 5%(w/v) skimmed milk for 18 hrs at 4°c.Immunoreactive protein was detected by monoclonal antibody
against IL-lRa.ALP conjugated antibody was used as the secondary antibody and detected by substrate BCIP-NBT addition.
PURIFICATION
IL-lRa/pGAPZA.CL.7 's 48-hour culture was spun down and the supernatant thus obtained was loaded onto a Q-sepharose column, which was washed with water and then
23

equilibrated with 20 mM Tris buffer (pH 8.8). The column was washed with 20 mM Tris (pH8.8) and the protein was eluted with 200mMNaCl containing 20 mMTris.followed by a 500mM NaCl and 1 M NaCl.elution.The eluted fractions were resolved on a 15% SDS GEL and silver stained. Only fraction 1 gave good intensity of the band. Hence this was loaded on SDS-PAGE gel and stained with commassie. Protein concentrations were determined with the protein assay reagent (Biorad,Richmond,California) by using bovine serum albumin as the standard. Fracton one showed a concentration of 45 mg/ml.
IV. COMPARATIVE RESULTS
Qualitative
N-terminal sequencing of the protein;
The partially purified protein was blotted onto PVDF membrane at 90 volts for 1 hour
and then stained in 0.02% coomassie blue in 40%methanol and 5%acetic acid for 20
seconds. It was destained for up to 1 minute in 40% methanol and 5% acetic acid. The
membrane was rinsed in water three times, dried between whatman papers, the band cut
out and sent for sequencing.
Quantitative
A 96-well micro titer plate was coated with serial two fold dilutions starting 200ng. After
blocking with 3% bovine serum albumin, the wells were incubated with the monoclonal IL-1RA antibody (dilute 1:5000) for 2 hours at 37°C. After washing with sodium chloride /Pi, Tween 20, the wells were incubated with a peroxidase conjugated secondary antibody. Subsequently to washing, the binding of the antibody was visualized by the addition of the substrate solution. The reaction was stopped by the addition of sulphuric acid and the absorbance was determined using an ELISA reader at 450 nm.
REFERENCES
1. Abbas AK., Lichtman AH. and Pober JS. (1999): General properties of cytokines in: Cellular and Molecular Immunology, third edition P. 263. W.B. SANNDERS Company.
2. Bresnihan B., Lookabaugh JWK. and Musikic P. (1996): Treatment with recombinant human interleukin-1 receptor antagonist in rheumatoid arthritis:
24

Result of randomised double blind placebo controlled multicenter trial. Arthritis and Rheum. 39 (Suppl.): 73A.
3. Charo F., Myers SJ., Herman A., Farnci C, Connolly AJ. and Coughline SR. (1994): Molecular cloning and functional expression of two monocyte chemoattractant protein -1 receptors reveals alternative splicing of the carboxyl-terminal trials. Proc. Natl. Acad. Sci. USA, 91:2752-2756.
4. Choy EHS., Kingsley GH. and Panayi GS (1998): Immunotherapies: In Rheumatology edited by Klippel JH and Dieppe PA, Chapter 10,
P.3 io.2- Mosby, London, Philadelphia St. Louis Sydney Tokyo.
5. Cruse MJ. and Lewis RE. (1999): Cytokines in: Atlas of Immunology, chapter 10, CRC PRESS-Springer P. 188.
6. Drevlow BE., Loris R. and Haag MA. (1996): Recombinant human interleukin-1 receptor type I in treatment of patients with active rheumatoid arthritis. Arthritis Rheum., 39:257-265.
7. Firestein GS., Boyle DL., YUC, Paine MIL, Whisenand TD. and Zvaibler NJ. (1994): Synovial interleukin -1 receptor antagonist and interleukin-1 balance in rheumatoid arthritis. Arthritis and Rheum., 37:644-652.
8. Paleolog EW., Hunt M., Elliott M., Feldmann M., Maini RM. and Woody J. (1996): Deactivation of vascular endothelium by monoclonal antitumor necrosis factor antibody in rheumatoid arthritis. Arthritis and Rheum.; 39:1082-1091.
9. Ruscetti WF. and Oppenheim JJ. (1997): Cytokines in: Medical Immunology edited by stites D.P, Terr AI and parslow I.G., ninth edition, chapter 10, prentice-Hall international Inc, P. 199.
10. Sany J., Apparailly F. and Jorgensen C. (1999): Immunological evaluation of cytokine and anticytokine immunotherapy in vivo. What have we learn? Ann. Rheum Dis., 58:136-141.
11. Smith RJ., Chin JE. and Sam LM. (1991): Biologic effects of an inter leukin-1 receptor antagonist protein on interleukin -1 receptor stimulated cartilage erosion and choudrocyte responsiveness. Arthritis and Rheum. 34:78.
12. Virella G. (1998): Cell mediated immunity in: Introduction to Medical Immunology, 4th edition P.200, Marcel Dekker, INC. New York. Basel. H.Kong.
25

For Reliance Life Sciences Pvt. Ltd.
All of the compositions and methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this invention have been described in terms of preferred embodiments, it will be apparent to those of skill in the art that variations may be applied to the compositions and/or methods and in the steps or in the sequence of steps of the methods described herein without departing from the concept, spirit and scope of the invention. More specifically, it will be apparent that certain agents that are chemically or physiologically related may be substituted for the agents described herein while the same or similar results would be achieved. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the invention.


ABSTRACT
The invention in particular relates to the production and expression of Interleukin 1 receptor antagonist (IL-lra) in Pichia Pastoris. The present invention in particular relates to a engineered Pichia strain x-33/pGAPZ/IL-lRa constructed by cloning the gene in pGAPZA and transforming the recombinant vector into Pichia Pastoris x-33. This strain gave soluble and better yields of IL-1RA as compared to E.Coli derived IL-1RA. Further the present invention also provides an IL-lra derived from Pichia pastoris with better stability against serum elastases and pH variation.
27