HIGHLY PRODUCTIVE ISOPROPYL ALCOHOL-PRODUCING BACTERIUM
Technical Field
[0001] The present invention relates to an isopropyl alcohol -producing bacterium and an
isopropyl alcohol producing method using the same.
Background Art
[0002] Propylene is an important basic raw material of synthetic resins such as
polypropylene and petrochemical products and used in a wide variety of products such as
automobile bumpers, food containers , films, and medical instruments.
Isopropyl alcohol produced from a plant-derived raw material can be converted to
propylene through a dehydration process. Therefore, isopropyl alcohol is promising as a raw
material for carbon-neutral propylene. At present, Kyoto Protocol mandates that developed
countries as a whole reduce carbon dioxide emissions by 5% as compared to 1990 levels in
the 2008 to 2012 period . Therefore, carbon-neutral propylene is extremely important in the
global environment because of its versatility.
[0003] Bacteria that assimilate a plant-derived raw material to produce isopropyl alcohol are
already known. For example, the pamphlet of W02009/008377 discloses a bacterium
modified to produce isopropyl alcohol from glucose as a raw material and described that the
bacterium has excellent properties as a biocatalyst for industrial production because of its high"
selectivity of isopropyl alcohol.
[0004] In an isopropyl alcohol-producing Escherichia cob, since the raw material for
isopropyl alcohol is glucose, a large number of compounds obtained by glycolysis and
catabolism can all be by-products. On the other hand, since those compounds may be
substances gssential for growth of Escherichia coil, it is impossible to completely suppress the
amount of glucose consumed by those secondary reactions. Accordingly, to increase the
production rate of isopropyl alcohol while minimizing by-products, it is necessary to
maximize metabolic flow to isopropyl alcohol while considering all metabolic reactions
occurring in Escherichia coif, and various techniques have been proposed from the viewpoint
of biological activity and substance production.
[0005] For example, the pamphlet of W02009/008377 discloses an isopropyl
alcohol-producing bacterium in which respective genes of acetoacetate decarboxylase,
isopropyl alcohol dehydrogenase, CoA transferase, and thiolase are introduced to allow
isopropyl alcohol to be produced from a plant-derived raw material. It is described that the
1
isopropyl alcohol-producing bacterium can achieve a production rate of 0.6 g/L/hr and an
amount of accumulation of 28.4 g/L.
[0006] The pamphlet of W02009/049274 and Appi. Environ. Bioiechnoi., 73(24), pp.
7814-7818, (2007) disclose Escherichia coif in which respective genes of acetyl-CoA
acetyltransferase, acetoacetyl CoA transferase, acetoacetate decarboxylase, and secondary
alcohol dehydrogenase are introduced to produce isopropyl alcohol. It is described that
those bacteria can achieve a production rate of 0.4 g/L/hr, a yield of 43.5%, and an amount of
accumulation of 4.9 g/L.
[0007] The pamphlet of W02009/028582 discloses Escherichia coil in which respective
genes of acetoacetate carboxylase, isopropyl alcohol dehydrogenase, acetyhCoA:acetate
CoA-transferase, and acetyl-CoA acetyl transferase are introduced to produce isopropyl
alcohol. It is described that the bacterium can achieve an amount of accumulation of 9.7
g/L.
[0008] Appl. Micmbiol. Biotechnol., 77(6), pp. 1219-1224, (2008) discloses Escherichia
coif in which respective genes of thio]ase, CoA-transferase, acetoacetate decarboxylase, and
primary secondary alcohol dehydrogenase are introduced to produce isopropyl alcohol It is
described that the bacterium can achieve a production rate of 0.6 g/L/hr, a yield of 51%, and
an amount of accumulation of 13.6 g/L.
[0009] The pamphlet of W02009/103026 discloses Escherichia coil in which respective
genes of acetoacetate decarboxylase, acetyl CoA:acetate CoA transferase, acetyl-CoA acetyl
transferase, and isopropyl alcohol dehydrogenase are introduced to allow the production of
isopropyl alcohol. It is described that the bacterium is expected to have the ability to achieve
a yield of 50%, a production rate of 0.4 g/L/hr, and an ultimate production of 14 g/L.
[0010] The pamphlet of W020091247217 discloses Escherichia coil in which respective
genes of acetoacetate decarboxylase, CoA transferase, thio]ase, and 2-propyl alcohol
dehydrogenase are introduced to allow the production of isopropyl alcohol. It is described
that the bacterium can achieve an ultimate production of 2 g/L.
[0011] Here, isopropyl alcohol dehydrogenase, secondary alcohol dehydrogenase,
primary-secondary alcohol dehydrogenase, and 2-propyl alcohol dehydrogenase are enzymes
that have different names but catalyze the same reaction. CoA transferase, acetoacetyl CoA
transferase, acetyl CoA:acetate CoA transferase, and CoA-transferase are enzymes that have
different names but catalyze the same reaction. In addition, acetoacetate decarboxylase and
acetoacetate decarboxylase are enzymes that have different names but catalyze the same
reaction, and thio]ase and acetyl CoA acetyl transferase are enzymes that have different names
but catalyze the same reaction. Accordingly, , although the productivity of the isopropyl
2
alcohohproducing Escherichia coif of the above-described documents varies, the enzymes
used to produce isopropyl alcohol are equivalent to the four enzymes - acetoacetate
decarboxylase, isopropyl alcohol dehydrogenase, CoA transferase, and thiolase described
in the pamphlet of W02009/008377. For purposes such as improvement of productivity and
yield, the four enzymes have been conventionally studied.
[0012] On the other hand, a method of deleting an enzyme malate dehydrogenase that a
microorganism possesses is known as a method for improving the yield and productivity in
substance production by the microorganism.
For example, the pamphlet of WO2009/023493 describes that, in the production of
1,4-butanediol by Escherichia coli, the yield is increased by disruption of a malate
dehydrogenase gene that the Escherichia coif possesses or by simultaneous disruption of a
malate dehydrogenase gene and a transhydrogenase gene that the Escherichia coli possesses.
[0013] Additionally, the pamphlet of WO2009/012210 describes that, in the production of
ethanol by Escherichia coli, the yield is increased by simultaneously disrupting a malate
dehydrogenase gene and a D-lactate dehydrogenase gene that the Escherichia coil possesses.
Furthermore, the pamphlet of W02009/111672 describes that, in the production of
dodecanol by yeast, productivity is effectively improved by simultaneously disrupting
acetaldehyde-CoA dehydrogenase gene, a D-lactate dehydrogenase gene, and a malate
dehydrogenase gene that the yeast possesses.
SUMMARY OF INVENTION
Problem to be solved by invention
[0014] However, any of the above-described bacteria capable of producing isopropyl alcohol
is not considered to have sufficient production ability. Thus, a major problem to be solved
has been how to improve the yield and rate of the production of isopropyl alcohol by an
isopropyl alcohol-producing bacterium.
It is an object of the present invention to provide an Escherichia coli capable of
producing isopropyl alcohol at high rate and with high yield and an isopropyl alcohol
producing method using the Escherichia coil.
Means for solving the problem
[0015] The present invention has been accomplished in view of the above-described
circumstances, and an isopropyl alcohol-producing Escherichia coli of the present invention
and an isopropyl alcohol producing method of the present invention are as follows:
[0016] [1] An isopropyl alcohol-producing Escherichia coli equipped with an isopropyl
alcohol production system, having at least one enhanced enzyme activity selected from the
3
group consisting of an enhanced malate dehydrogenase activity, an enhanced NAD(P)^
transhydrogenase (AB-specific) activity, and an enhanced thiolase activity.
[2] The isopropyl alcohohproducing Escherichia coif according to [1], wherein the
enhanced enzyme activity includes the enhanced malate dehydrogenase activity.
[3] The isopropyl alcohol-producing Escherichia coif according to [1], wherein the
enhanced enzyme activity includes the enhanced malate dehydrogenase activity and the
enhanced thiolase activity.
[4] The isopropyl alcohol-producing Escherichia coil according to [1], wherein the
enhanced enzyme activity includes the enhanced malate dehydrogenase activity and the
enhancedNAD(P)H transhydrogenase (AB-specific) activity.
[5] The isopropyl alcohol-producing Escherichia coil according to [1], wherein the
enhanced enzyme activity includes the enhanced malate dehydrogenase activity, the enhanced
NAD(P)+ transhydrogenase (AB-specific) activity, and the enhanced thiolase activity.
[6] The isopropyl alcohol-producing Escherichia coil according to any one of [1] to
[5], wherein the enhanced enzyme activity is derived from at least one of enhancement by an
enzyme gene introduced from outside a cell of the Escherichia coil and enhancement by
enhanced expression of an enzyme gene in the cell of the Escherichia coil.
[7] The isopropyl alcohol-producing Escherichia coif according to any one of [1] to
[6], wherein the enhanced enzyme activity is derived from at least one of enhancement in the
genome of a host Escherichia coil and enhancement by plasmid introduction.
[8] The isopropyl alcohol-producing Escherichia coil according to any one of [1] to
[7], wherein the enhanced enzyme activity is derived from a gene or genes derived from a
bacterium or bacteria of the genus Escherichia and encoding the enzyme or enzymes.
[9] The isopropyl alcohol-producing Escherichia coif according to any one of [1] to
[8], wherein the isopropyl alcohol production system is constructed by respective genes of
acetoacetate4ecarboxylase, isopropyl alcohol dehydrogenase, CoA transferase, and thiolase.
[10] The isopropyl alcohol-producing Escherichia coil according to any one of [1] to
[8], wherein the isopropyl alcohol production system is constructed by respective enzyme
genes of the acetoacetate decarboxylase, the isopropyl alcohol dehydrogenase, the CoA
transferase, and the thiolase, and each of the enzyme genes is independently derived from at
least one prokaryote selected from the group consisting of a bacterium of the genus
Clostridium, a bacterium of the genus Bacillus, and a bacterium of the genus Escherichia.
[11] The isopropyl alcohol-producing Escherichia coil according to any one of [1] to
[8], wherein the acetoacetate decarboxylase activity is derived from a gene that is derived
from Clostridium acelobutylicum and encodes the enzyme; the isopropyl alcohol
4
dehydrogenase activity is derived from a gene that is derived from Clostridium beijerincldi
and encodes the enzyme; and the CoA transferase activity, the thiolase activity, the malate
dehydrogenase activity, and the NAD(P)^ transhydrogenase (AB-specific) activity are derived
from genes that are derived from Escherichia coli and encode the respective enzymes.
[12], An isopropyl alcohol producing method including producing isopropyl alcohol
from a plant-derived raw material using the isopropyl alcohol-producing Escherichia coli
according to any one of [1] to[ll].
BRIEF DESCRIPTION OF DRAWINGS
[0017] Fig. 1 is a graph comparing IPA-producing abilities of various kinds of
IPA-producing Escherichia coli according to Evaluation Experiment 1 of the present
invention.
DESCRIPTION OF EMBODIMENTS
[0018] An isopropyl alcohol-producing Escherichia coli of the present invention is an
isopropyl alcohol production system Escherichia coli, which is equipped with an isopropyl
alcohol production system and includes at least one enhanced enzyme activity selected from
the group consisting of an enhanced malate dehydrogenase activity, an enhanced NAD(P)+
transhydrogenase (AB-specific) activity, and an enhanced thiolase activity.
The isopropyl alcohol-producing Escherichia coli of the present invention has at least
one enhanced enzyme activity of the above-mentioned three enzyme activities, and therefore
allows rapid and high-yield production of isopropyl alcohol.,
[0019] Specifically, as the results of various investigations forimproving an activity of the
isopropyl alcohol production system ,the present invention has found that the production rate
of isopropyl alcohol as a product obtained by the Escherichia coli is increased and the yield of
production thereof is improved by enhancing at least any one of an activity of malate
dehydrogenase, which is one of the enzymes present in the glucose metabolic pathway, a
NAD(P)+ transhydrogenase (AB-specific) activity, which is an enzyme involved in
oxidation-reduction of NAD and NADP+, and a thiolase activity, which is one enzyme of the
isopropyl alcohol production system.
[0020] In the present invention, the expression: "enhancement" of "activity" or "ability"
broadly means that the respective enzyme activities in the isopropyl alcohol-producing
Escherichia coli after enhancement are higher than those before the enhancement.
The method for enhancement is not specifically restricted as long as the activities of
the respective enzymes originally present in the isopropyl alcohol-producing Escherichia coli
are enhanced, and examples of the enhancing method include enhancement by an enzyme
5
gene introduced from outside the bacterial cell, enhancement by enhanced expression of an
enzyme gene in the bacterial cell, or a combination thereof
[0021] Specific examples of the enhancement by an enzyme gene introduced from outside
the bacterial cell include : introducing a gene encoding a more active enzyme than a
host-derived enzyme from outside the bacterial cell of the host bacterium into the bacterial
cell so as to add the enzyme activity of the introduced enzyme gene, or so as to replace the
enzyme activity of the host-derived enzyme gene with the enzyme activity of the introduced
enzyme gene; increasing the number of host-derived enzyme genes or enzyme genes from
outside the bacterial cell to two or more; or any combination thereof.
Specific examples of the enhancement by enhanced expression of an enzyme gene in
the bacterial cell include introducing a base sequence that enhances the expression of the
enzyme gene from outside the bacterial cell of the host bacterium into the bacterial cell;
replacing the promoter of the enzyme gene that the host bacterium possesses on its genome
with another promoter so as to enhance the expression of the enzyme gene; or any
combination thereof.
In the present invention, the term "host" means an Escherichia coif that will become
the isopropyl alcohol-producing Escherichia toll of the present invention as the result of
introduction of one or more genes from outside the bacterial cell.
[0022] In addition, the scope of the term "process" in the present invention includes an
independent process as well as a process that cannot be clearly distinguished from another
process but achieves an intended effect of the process.
In the present specification, the range of numerical values described using "to"
indicates a range including numerical values described before and after the "to" as a minimum
value and a maximum value , respectively.
Hereinafter, the present invention will be described.
[0023 ] Thcmalate dehydrogenase in the present invention is classified under enzyme code
number: 1.1 . 1.40 based on the Report of the Commission on Enzymes , International Union of
Biochemistry (I.U.B) and is a generic name of enzymes that catalyze a reaction of producing
pyruvic acid and C O2 from L-malic acid.
Examples of the malate dehydrogenase include those derived from a protozoan of the
genus Tritrichomonas such as Tritrichomonas vaginalis, a Rhizobium bacterium such as
Rhizobium meliloti, a Sulfolobus bacterium such as Sulfolobus fataricus , a bacterium of the
genus Corynebacterium such as Corynebacterium glutamicum, a bacterium of the genus
Escherichia such as Escherichia toll, and a bacterium of the genus Sinorhizobium such as
Sinorhizobium meliloti.
6
[0024] As a gene of the malate dehydrogenase used in the present invention, a DNA having
the base sequence of a gene encoding the malate dehydrogenase of any of the
above-mentioned source organisms or a synthetic DNA sequence synthesized based on a
known base sequence of the gene can be used. Suitable examples include those derived
from prokaryotes such as Rhizobium bacteria, Sulfolobus bacteria, bacteria of the genus
Corynebacterium, bacteria of the genus Escherichia, and bacteria of the genus Sinorhizobium.
A DNA having the base sequence of an Escherichia coli-derived gene is particularly
preferable.
[0025] So far, there have been no report that malate dehydrogenase activity and the
expression of a gene encoding this enzyme were enhanced with an aim to improve the
production of a useful substance . Rather, it is generally thought that, in the production of a
substance using a microorganism, improvement of the productivity and yield requires the
deletion of the activity of malate dehydrogenase or a gene encoding this enzyme present in the
microorganism, as described in W02009/023493 W02009/012210, and W02009/111672.
Thus, improvement in the rate and yield of isopropyl alcohol production by enhancing the
malate dehydrogenase activity was completely unexpected.
[0026] The NAD(P)+ transhydrogenase (AB-specific) in the present invention is classified
under the enzyme code number: 1.6.1.2 based on the Report of the Commission on Enzymes,
International Union of Biochemistry (I.U.B) and is a generic name of enzymes catalyzing a
reaction as follows:
NADPH + NAD+ NADP+ + NADH
Here, NADP is nicotinamide adenine dinucleotide phosphate , and NADPH
represents a reduced form thereof Further, NAD is nicotinamide adenine dinucleotide, and
NADH represents a reduced formed thereof
[0027] Examples of the NAD(P)+transhydrogenase (AB-specific) include those derived
from bacteria of the genus Escherichia such as Escherichia coil, bacteria of the genus
Rhodobacter such as Rhodobacter sphaeroides and Rhodobacter capsulatus, and bacteria of
the genus Klebsiella such as Klebsiella pneumoniae.
As a gene of the NAD(P) transhydrogenase (AB-specific) used in the present
invention, a DNA having the base sequence of a gene encoding NAD(P)+ transhydrogenase
(AB-specific) obtained from any of the above-mentioned source organisms or a synthetic
DNA sequence synthesized based on a known base sequence of the gene can be used.
Suitable examples thereof include those derived from prokaryotes such as bacteria of the
genus Escherichia, bacteria of the genus Rhodobacter, and bacteria of the genus Klebsiella.
7
For example, a DNA having the base sequence of the gene of Escherichia coli can be
exemplified. A DNA having the base sequence of an Escherichia coli-derived gene is
particularly preferable.
[0028] The thiolase in the present invention is classified under the enzyme code number:
2.3.1.9 based on the Report of the Commission on Enzymes, International Union of
Biochemistry (LU.B) and is a generic name of enzymes that catalyze a reaction of producing
acetoacetyl CoA from acetyl CoA.
Examples of such thiolase include those derived from bacteria of the genus
Ciostridiu,u such as Clostridium acetobutylicum and Clostridium beijerinclcU, bacteria of the
genus Escherichia such as Escherichia coli, bacteria of Halobacterium species, bacteria of the
genus Zoogloea such as Zoogloea ramigera, Rhizobium species, bacteria of the genus
Bradyrhizobium such as Bradyrhizobium japonicum, bacteria of the genus Candida such as
Candida tropicalis, bacteria of the genus Caulobacter such as Caulobacter crescentus, bacteria
of the genus Streptomyces such as Streptomyces collinus, and bacteria of the genus
Enterococcus such as Enterococcus faecalis.
[0029] As a gene of the thiolase used in the present invention, a DNA having the base
sequence of a gene encoding thiolase obtained from any of the above-mentioned source
organisms or a synthetic DNA sequence synthesized based on a known base sequence of the
gene can be used. Suitable examples thereof include DNAs having the base sequences of the
genes derived from bacteria of the genus Clostridium such as Clostridium acetobutylicum and
Clostridium beijerinekii, bacteria of the genus Escherichia such as Escherichia eoli, bacteria
of Halobacterium sp., bacteria of the genus Zoogloea such as Zoogloea ramigera, bacteria of
Rhizobium sp., bacteria of the genus Bradyrhizobium such as Bradyrhizobium japonicum,
bacteria of the genus Candida such as Candida tropicalis, bacteria of the genus Caulobacter
such as Caulobacter crescentus, bacteria of the genus Streptomyces such as Streptomyces
collinus, and bacteria of the genus Enterococcus such as Enterococcus faecalis. More
suitable examples include those derived from prokaryotes such as bacteria of the genus
Ciostridiann or bacteria of the genus Escherichia. A DNA having the base sequence of a
gene derived from Clostridium acetobutyhcunz or Escherichia coli is particularly preferable.
[0030] The isopropyl alcohohproducing Escherichia coli of the present invention has at least
one enzyme activity from among the enhanced enzyme activities obtained by respectively
enhancing the above-described three enzyme activities. Among the three enhanced enzyme
activities, the thiolase activity is also one of the enzymes that form the isopropyl alcohol
production system, which will be described below. Thus, in a case in which the thiolase
activity is included as a target enhanced enzyme activity in the Escherichia tali, the thiolase
8
activity needs to he further enhanced. Examples of the enhancement include enhancement
of the expression of a gene encoding thiolase in a plasmid or the genome, an increase of the
number of copies of thiolase gene, and any combination thereof, as described above.
[0031] The isopropyl alcohohprodueing Escherichia coli in the present invention is an
Escherichia coli equipped with the isopropyl alcohol production system, and refers to an
Escherichia coli having an isopropyl alcohol production ability that has been introduced or
modified by genetic recombination. Such an isopropyl alcohol production system may be
any system that causes Escherichia coli of interest to produce isopropyl alcohol.
A preferable example is enhancement of an enzyme activity involved in the
production of isopropyl alcohol. In the isopropyl alcohohproducing Escherichia coli of the
present invention, more preferably, four enzyme activities - an acetoacetie acid
decarboxylase activity, an isopropyl alcohol dehydrogenase activity, a CoA transferase activity,
and the above-described thiolase activity - are imparted from outside the bacterial cell, or
the expression of the four enzyme activities is enhanced in the bacterial cell, or both of these
are carried out.
[0032] In the present invention, the scope of the expression "by genetic recombination
encompasses all cases in which any change in a base sequence occurs due to the insertion of
another DNA into the base sequence of an innate gene, a substitution or deletion of a certain
part of the gene, or any of combinations thereof, and encompasses, for example, a change in a
base sequence occurring as a result of mutation.
[0033] The acetoacetate decarboxylase in the present invention is classified under the
enzyme code number: 4.1.1.4 based on the Report of the Commission on Enzymes,
International Union of Biochemistry (TUB) and is a generic name of enzymes that catalyze a
reaction of producing acetone from acetoacetie acid.
Examples of the acetoacetate decarboxylase include those derived from bacteria of
the genus Clostridium such as Clostridium acetobutylicum and Clostridium beijerinclcii, and
bacteria of the genus Bacillus such as Bacillus polymyxa.
[0034] An acetoacetate decarboxylase gene to be introduced into the host bacterium of the
present invention may be a DNA having the base sequence of a gene encoding acetoacetate
decarboxylase obtained from any of the above-described source organisms or a synthetic
DNA sequence synthesized based on a known base sequence of the gene. Suitable examples
thereof include those derived from bacteria of the genus Clostridizun or bacteria of the genus
Bacillus, and an example is a DNA having the base sequence of a gene derived from
Closiridiuin acetobutylicum or Bacillus polymyxa. A DNA having the base sequence of a
gene derived from Clostridium acetobulylicum is particularly preferable.
9
[0035] The isopropyl alcohol dehydrogenase in the present invention is classified under the
enzyme code number: 1.1.1.80 based on the Report of the Commission on Enzymes,
International Union of Biochemistry (1.U.B) and is a generic name of enzymes that catalyze a
reaction of producing isopropyl alcohol from acetone.
Examples of the isopropyl alcohol dehydrogenase include those derived from
bacterial of the genus Clostridium. such as Clostridium beijerinckii.
[0036] As an isopropyl alcohol dehydrogenase gene to be introduced into the host bacterium
of the present invention, a DNA having the base sequence of a gene encoding the isopropyl
alcohol dehydrogenase obtained from any of the above-mentioned source organisms or a
synthetic DNA sequence synthesized based on a known base sequence of the gene can be used.
Suitable examples thereof include those derived from bacteria of the genus Clostridium, such
as a DNA having the base sequence of a gene derived from Clostridium beijerinckii.
[0037] The CoA transferase in the present invention is classified under the enzyme code
number: 2.8.3.8 based on the Report of the Commission on Enzymes, International Union of
Biochemistry (LU.B) and is a generic name of enzymes that catalyze a reaction of producing
acetoacetic acid from acetoacetyl CoA.
Examples of the CoA transferase include those derived from bacteria of the genus
Clostridium such as Clostridium acetobutylicum and Clostridium beijerincizii, bacteria of the
genus Roseburia such as Roseburia intestinalis, bacteria of the genus Faecalibacterium such as
Faecalibacterium prausnitzii, bacteria of the genus Coprococcus, Trypanosoma such as
Tr ypanosoma brucei, and bacteria of the genus Escherichia such as Escherichia coli (the
colon bacillus).
[0038] Asa CoA transferase gene used in the present invention, a DNA having the base
sequence of a gene encoding the CoA transferase obtained from any of the above ^ Inenfioncd
source organisms or a synthetic DNA sequence synthesized based on a known base sequence
of the gene can be used. Suitable examples thereof include DNAs having the base sequences
of genes derived from bacteria of the genus Clostridium such as Clostridium acetobutylicum,
bacteria of the genus Roseburia such as Roseburia intestinalis , bacteria of the genus
Faecalibacterium such as Faecalibacterium prausnitzii , bacteria of the genus Coprococcus,
Trypanosoma such as Trypanosoma brucei , and bacteria of the genus Escherichia such as
Escherichia coli. Those derived from bacteria of the genus Clostridium or bacteria of the
genus Escherichia are more preferred. A DNA having the base sequence of a gene derived
from Clostridium acetobutylicum or Escherichia coli is particularly preferable.
[0039] As described above, the thiolase used to produce isopropyl alcohol in the present
invention is classified under the enzyme code number : 2.3.1.9 based on the Report of the
10
Commission on Enzymes, International Union of Biochemistry (I.U.B) and is the generic
name of the enzymes that catalyze the reaction of producing acetoacetyl CoA from acetyl
CoA. Regarding details of the thiolase, the above-described details thereof shall apply as
they are.
[0040] Among the above, it is preferable that each of the four enzymes is derived from at
least one selected from the group consisting of a bacterium of the genus Clostridium, a
bacterium of the genus Bacillus, and a bacterium of the genus Escherichia, from the
viewpoint of enzyme activity. In particular, a case in which acetoacetate decarboxylase and
isopropyl alcohol dehydrogenase are derived from a bacterium or bacteria of the genus
Clostridium and CoA transferase activity and thiolase activity are derived from a bacterium or
bacteria of the genus Escherichia, and a case in which all of the four enzymes are derived
from a bacterium or bacteria of the genus Clostridium, are more preferable.
[0041] In particular, from the viewpoint of enzyme activity, it is preferable that each of the
four enzymes in the present invention is derived from Clostridium acetobutylicum,
Clostridium beijerincldi, or Escherichia Coli, it is more preferable that acetoacetate
decarboxylase is an enzyme derived from Clostridium acetobutylicum, each of CoA
transferase and thiolase is an enzyme derived from Clostridium acetobutylicum or Escherichia
coli, and isopropyl alcohol dehydrogenase is an enzyme derived from Clostridium beijerinckii.
From the viewpoint of enzyme activity, the four enzymes are particularly preferably such that
the acetoacetate decarboxylase activity is derived from Clostridium acetobutylicum, the
isopropyl alcohol dehydrogenase activity is derived from Clostridium beijerinckii, and the
CoA transferase activity and the thiolase activity are derived from Escherichia coli.
[0042] In the present invention, as an example of the isopropyl alcohol-producing
Escherichia coli equipped with the isopropyl alcohol production system including a thiolase
activity, a pIPA/B strain or a plaaa/B strain described in W02009/008377 may be exemplified.
In addition, the Escherichia coli includes a strain (which may be referred to as pla/B::atoDAB
strain), in which, among the enzymes involving in the production of isopropyl alcohol, the
CoA transferase activity and the thiolase activity are enhanced by enhancing the expression of
each of these genes in the genome of the Escherichia coli and the isopropyl alcohol
dehydrogenase activity and the acetoacetic acid decarboxylase activity are enhanced by
enhancing the expression of each of these genes by using a plasmid.
[0043] In the present invention, it is preferable that an enhanced malate dehydrogenase
activity is included as an enhanced enzyme activity from the viewpoint of more effectively
improving isopropyl alcohol productivity. It is more preferable that an enhanced malate
dehydrogenase activity and an enhanced thiolase activity are included or an enhanced malate
11
debydrogenase activity and an enhanced NAD(P)+ transhydrogenase (AB-specific) activity
are included, and it is most preferable that all of an enhanced malate dehydrogenase activity,
an enhanced NAD(P)+ transhydrogenase (AB-specific) activity, and an enhanced thiolase
activity are included.
In the present invention, it is most preferable to enhance the expression of respective
genes encoding the malate dehydrogenase, the NAD(P)+ transhydrogenase (AB-specific), and
the thiolase. This enables drastic increase in the productivity and yield of isopropyl alcohol
as compared to a case of enhancing the activity of each enzyme singly.
[0044] A preferable embodiment of the isopropyl alcohol-producing Escherichia coli in the
present invention is a strain obtained by enhancing the malate dehydrogenase activity, or
simultaneously enhancing the malate dehydrogenase activity and the activity of the NAD(P)*
transhydrogenase (AB-specific) and/or the thiolase, in the pIPA/B strain, the plaaa/B strain, or
the pla/B::atoDAB strain described above. The thiolase activity in this strain may be an
activity achieved by enhancing the expression of a thiolase-encoding gene in the genome as
well as enhancing the expression of a thiolase-encoding gene by using a plasmid.
A more preferable embodiment thereof is a strain obtained by enhancing the malate
dehydrogenase activity, or simultaneously enhancing the malate dehydrogenase activity and
the activity of the NAD(P)+ transhydrogenase (AB-specific) and/or the thiolase, in the pIPA/B
strain, the plaaa/B strain, or the pla/B::atoDAB strain described above. In this strain, the
thiolase activity may be an activity achieved by enhancing the expression of a
thiolase-encoding gene in the genome as well as enhancing the expression of a
thiolase-encoding gene by using a plasmid.
[0045] A particularly preferable embodiment thereof is a strain obtained by simultaneously
enhancing the malate dehydrogenase activity, the NAD(P)+ transhydrogenase (AB-specific)
activity, and the thiolase activity in the pIPA/B strain, the plaaa/B strain, or the
pla/B::atoDAB strain described above. In this strain, the thiolase activity maybe an activity
achieved by enhancing the expression of a thiolase-encoding gene in the genome as well as
enhancing the expression of a thiolase-encoding gene by using a plasmid.
A most preferable embodiment thereof is a strain obtained by simultaneously
enhancing the malate dehydrogenase activity, the NAD(P)+transhydrogenase (AB-specific)
activity, and the thiolase activity in the above-described strain or in the pla/B::atoDAB strain.
In this strain, the thiolase activity may be an activity achieved by enhancing the expression of
a thiolase-encoding gene in the genome as well as the expression of a thiolase-encoding gene
is enhanced by using a plasmid.
12
[0046] The promoter for a gene in the present invention maybe any promoter capable of
controlling the expression of any of the genes described above. The gene promoter may be a
powerful promoter which constitutively functions in a microorganism and of which the
expression is hardly suppressed even in the presence of glucose. Specific examples thereof
include a promoter of glyceraldehyde-3-phosphate dehydrogenase (which may be hereinafter
referred to as GAPDH) and a promoter of serine hydroxymethyltransferase.
The promoter in the present invention refers to a region to which an RNA polymerase
having a sigma factor attaches to initiate transcription. For example, a GAPDH promoter
derived from Escherichia coli is shown in base numbers 397-440 in the base sequence
information of GenBank accession number X02662.
[0047] CoA transferase genes (atoD and atoA) and a thiolase gene (atoB) derived from
Escherichia coli form an operon in the order of atoD, atoA, and atoB in the genome of the
Escherichia coli (Journal ofBaceleriology Vol.169 pp 42-52 Lauren Sallus Jenkins el al).
Thus, the expression of the CoA transferase gene and the thiolase gene can be simultaneously
controlled by modifying the promoter for atoD.
Accordingly, when the CoA transferase activity and the thiolase activity are those
derived from the genomic genes of the host Escherichia coli, the expression of both enzyme
genes is preferably enhanced by, for example, substitution of another promoter for a promoter
responsible for the expression of both enzyme genes, from the viewpoint of acquiring
sufficient isopropyl alcohol production ability. Examples of a promoter used to enhance the
expression of the CoA transferase activity and the thiolase activity include the
above-mentioned Escherichia coli-derived GAPDH promoter.
[0048] The activities of these enzymes in the present invention may be activities introduced
from outside the bacterial cell into the bacterial cell, or activities achieved by enhancing the
expression of the enzyme genes by enhancement of the promoter activity for the enzyme
genes that the host bacterium possesses in its genome or by substitution of the promoter
activity with another promoter.
The introduction of enzyme activity can be performed by, for example, introduction
of an enzyme-encoding gene from outside the bacterial cell of the host bacterium into the
bacterial cell using a genetic recombination technique. In this case, the enzyme gene to be
introduced may be either homologous or heterologous to the host cell. The preparation of a
genomic DNA necessary for the introduction of a gene from outside the bacterial cell into the
bacterial cell, the cleavage and ligation of DNA, transformation, PCR (polymerase chain
reaction), the design and synthesis of oligonucleotides used as primers, etc. can be carried out
by methods well known to those skilled in the art. Such methods are described in, for
13
example, Sambrook, 3., et al., "Molecular Cloning A Laboratory Manual, Second Edition",
Cold Spring Harbor Laboratory Press,(1989).
[0049] In the present invention, the Escherichia coli having an enhanced enzyme activity
refers to an Escherichia coli in which the enzyme activity is enhanced by a certain method.
Such Escherichia coli can be produced by methods such as the introduction of a gene
encoding the enzyme and protein from outside the bacterial cell into the bacterial cell using a
plasmid according to the same genetic recombination technique as described above, or
enhanced expression of an enzyme gene by enhancement of the promoter activity for the
enzyme gene in the genome of the host Escherichia coli or by substitution of the promoter
activity with another promoter.
[0050] In the present invention, the term "Escherichia coli" means an Escherichia coli that
can be made to possess the ability to produce isopropyl alcohol from a plant-derived raw
material by using a certain means, regardless of whether or not the E. coli inherently has the
innate ability to produce isopropyl alcohol from a plant-derived raw material.
[0051] Herein, the Escherichia coli to be subjected to the above-mentioned genetic
recombination may be an Escherichia coli that does not have the isopropyl alcohol production
ability, and may be any Escherichia coli capable of introduction and modification of each of
the above-described genes.
The Escherichia coli may be more preferably an Escherichia coli with the isopropyl
alcohol production ability that has been imparted in advance, which can achieve more
efficient isopropyl alcohol production.
[0052] Examples of such an isopropyl alcohol-producing Escherichia coli include an
isopropyl alcohol-producing Escherichia coli to which an acetoacetate decarboxylase activity,
an isopropyl alcohol dehydrogenase activity, a CoA transferase activity, and a thiolase activity
are imparted, and which can produce isopropyl alcohol to from a plant-derived aw material.
[0053] The isopropyl alcohol producing method of the present invention includes producing
isopropyl alcohol from a plant-derived raw material using the above-described isopropyl
alcohol-producing Escherichia coli. Specifically, the isopropyl alcohol producing method of
the invention includes a process of contacting the isopropyl alcohol-producing Escherichia
coli with a plant-derived raw material and culturing the isopropyl alcohol-producing
Escherichia coli, and a, recovery process of recovering isopropyl alcohol obtained by the
contact.
[0054] The plant-derived raw material used in the isopropyl alcohol producing method is a
carbon source obtained from a plant and is not specifically restricted as long as it is a
plant-derived raw material. The plant-derived raw material in the present invention refers to
14
an organ such as root, stem, trunk,, branch, leaf, flower, or seed, a plant body including them,
or a decomposition product of any of the plant organs. In addition, the scope of the
plant-derived raw material also encompasses carbon sources that can be utilized as carbon
sources by microorganisms during cultivation from among carbon sources obtained from the
plant body, the plant organs, or the decomposition products thereof.
[0055] General examples of carbon sources that the scope of the plant-derived raw material
encompasses include saccharides such as starch, sucrose, glucose, fructose, xylose, and
arabinose, wood and herbaceous decomposition products and cellulose hydrolysates
containing these ingredients at high proportion, and combinations thereof. In addition, the
scope of the carbon source in the present invention also encompasses plant oil-derived
glycerin or fatty acid.
[0056] Preferable examples of the plant-derived raw material in the present invention
include agricultural products such as crops, corn, rice, wheat, soybean, sugarcane, beet, cotton,
and combinations thereof. The usage form as a raw material is not particularly limited, and
maybe an unprocessed product, juice, a crushed product, or the like. It is also possible to
use only the above-described carbon source as the raw material.
[0057] At the culturing process, the isopropyl alcohol-producing Escherichia colt and the
plant-derived raw material are contacted with each other generally by culturing the isopropyl
alcohol-producing Escherichia coli in a culture medium including the plant-derived raw
material.
[0058] The density of contact between the plant-derived raw. material and the isopropyl
alcohol-producing Escherichia coli varies depending on the activity of the isopropyl
alcohol-producing Escherichia coli. In general, the concentration of the plant-derived raw
material in the culture medium may be set such that the initial sugar concentration in terms of
glucose may be set to 20% by mass or less with respect to the total mass of the mixture, and,
from the viewpoint of the sugar resistance of the Escherichia coli, the initial sugar
concentration is preferably set to 15% by mass or less. Other components may be added in
amounts usually added to culture media of microorganism, without particular restriction.
[0059] The content of the isopropyl alcohol-producing Escherichia coli in the culture
medium varies depending on the kind and activity of the Escherichia coli. In general, the
initial bacterial concentration may be set to be from 0.1 to 30% by mass with respect to the
culture medium, and, from the viewpoint of controlling culture conditions, the initial bacterial
concentration is preferably set to be from 1 to 10% by mass with respect to the culture
medium.
[0060] The culture medium to be used for cultivation of the isopropyl alcohol-producing
15
Escherichia coli may be any commonly used culture medium that includes a carbon source, a
nitrogen source, and an inorganic ion, as well as organic minor elements, nucleic acid,
vitamins etc. required by the microorganism for the production of lactic acid, without
particular restriction.
[0061] The culture conditions for the culturing in the invention are not specifically restricted,
and cultivation may be carried out, for example, under aerobic conditions with appropriate pH
and temperature control within a range of pH 4 to 9, preferably pH 6 to 8, and a temperature
of 20 to 50°C, preferably 25 to 42°C.
[0062] The aeration amount of gas into the mixture is not particularly restricted. Ina case
in which only air is used as the gas, the aeration amount is generally from 0.02 to 2.0 vvm
(vvm; aeration volume [mL]/liquid volume [mL]/time [min]), and preferably from 0.1 to 2.0
vvm from the viewpoint of suppressing physical damage to the Escherichia coli.
[0063] The culturing process may be continued from the start of the cultivation until the
plant-derived raw material in the mixture is depleted or until the activity of the isopropyl
alcohol-producing Escherichia coli disappears. The duration of the culturing process varies
depending on the number and activity of the isopropyl alcohol-producing Escherichia coli and
the amount of the plant-derived raw material, but the duration may generally be 1 hour or
more, and preferably 4 hours or more. Although the culturing period can be unlimitedly
continued by additional feeding of the plant-derived raw material or the isopropyl
alcohol-producing Escherichia coli, the culturing period may. generally be set to 5 days or less,
and preferably 72 hours or less, from the viewpoint of processing efficiency. Regarding
other conditions, conditions used for usual cultivation may directly be applied.
[0064] The method for recovering isopropyl alcohol accumulated in the culture medium is
not particularly restricted. For example, a method may be employed in which the bacterial
cells are removed from the culture medium by, for example, centrifugation, and then
isopropyl alcohol is separated by a usual separation technique such as evaporation or film
separation.
[0065] The isopropyl alcohol producing method of the present invention may include, before
the culturing process for isopropyl alcohol production, a preculturing process of obtaining an
appropriate number or appropriate active state of isopropyl alcohol-producing Escherichia
coli cells for use. The preculturing process may be any cultivation under usually-employed
culture conditions suitable for the kind of isopropyl alcohol-producing bacterium.
[0066] The isopropyl alcohol producing method of the present invention preferably includes
a culturing process of culturing the isopropyl alcohol-producing Escherichia coli while
supplying a gas into a mixture containing the isopropyl alcohol-producing bacterium and a
16
plant-derived raw material, and a recovery process of separating and recovering isopropyl
alcohol produced by the culturing from the mixture.
[0067] According to this method, the Escherichia coli for production is cultured while
supplying a gas into the mixture (aeration culturing). By the aeration culturing, the
isopropyl alcohol produced is released into the mixture and evaporates from the mixture, as a
result of which the isopropyl alcohol produced can be easily separated from the mixture.
Further, since the isopropyl alcohol produced is continuously separated from the mixture,
increase in the concentration of isopropyl alcohol in the mixture can be suppressed. Thus,
there is no particular need to consider the resistance of the isopropyl alcohol-producing
Escherichia co/i against isopropyl alcohol.
The mixture in the present method may contain a basic culture medium generally
used for culturing Escherichia coli as the major component. Regarding culture conditions,
the details thereof described above shall directly apply.
[0068] At the recovery process, the isopropyl alcohol produced in the culturing process and
separated from the mixture is recovered. The recovery method may be any method that can
collect isopropyl alcohol in the gaseous or droplet form that has been evaporated from the
mixture by usual cultivation. Examples of such a method include recovering isopropyl
alcohol in a collection member such as a commonly used airtight container. In particular, the
recovery method is preferably includes bringing a capture liquid for capturing isopropyl
alcohol into contact with isopropyl alcohol separated from the mixture, from the viewpoint of
allowing high-purity recovery of only isopropyl alcohol.
[0069] In this method, isopropyl alcohol can be recovered in the state of being dissolved in
the capture liquid or the mixture. Examples of such a recovery method include a method
described in the pamphlet of WO 2009/008377. The recovered isopropyl alcohol can be
identified using a usual detection means such as HPLC. The recovered isopropyl alcohol
may further be purified, as necessary. The purification method may be, for example,
distillation or the like.
When the recovered isopropyl alcohol is in the state of aqueous solution, the
isopropyl alcohol producing method may further include a dehydration process in addition to
the recovery process. The dehydration of isopropyl alcohol maybe performed by a usual
method.
[0070] An example of an apparatus applicable to the method for producing isopropyl alcohol
that can be recovered in the form of being dissolved in the capture liquid or the mixture is a
production apparatus shown in Fig. I of the pamphlet of W02009/008377.
In the production apparatus, an injection tube for injecting a gas from outside the
17
apparatus is connected to a culture"tank that houses a culture medium including an isopropyl
alcohol-producing bacterium and a plant-derived raw material, thereby allowing aeration into
the culture medium.
In addition, the culture tank is connected to, via a connection tube, a trap tank that
houses a trap liquid as a capture liquid. In this case, a gas or a liquid that has moved to the
trap tank contacts with the trap liquid to cause bubbling.
As a result of this, isopropyl alcohol produced in the culture tank by aeration culture
is evaporated by the aeration and easily separated from the culture medium, and is captured
by the trap liquid in the trap tank. As a result, isopropyl alcohol can be produced
continuously and easily in a more purified form.
[00711 According to the isopropyl alcohol producing method of the present invention,
isopropyl alcohol can be rapidly produced, and the production rate usually obtained by the
same method is higher than in a case in which the present invention is not applied. The
production rate varies depending on the conditions for the production method and the state of
the isopropyl alcohol-producing Escherichia coli to be used, but a production rate of from 0.7
to 2.0 g/L/hr, preferably 0.9 to 1.9 g/L/hr, can be obtained. Further, according to the
isopropyl alcohol producing method of the present invention, isopropyl alcohol can be
effectively produced from glucose, and the yield usually obtained by the same method is
higher than in a case in which the present invention is not applied. The yield varies
depending on the conditions for the production method and the state of the isopropyl
alcohol-producing Escherichia coli to be used, and a yield of from 51 to 80%, preferably from
51 to 66%, can be obtained at the termination of the culturing process.
[0072] In the present invention, the term "yield" represents a conversion rate based on a
stoichiometric equation for the conversion of glucose as a substrate to isopropyl alcohol as a
metabolite. In the isopropyl alcohol-producing Escherichia coli, 1 mot of isopropyl alcohol
is produced from 1 mot of glucose. Accordingly, considering the molecular weights of
glucose and isopropyl alcohol (glucose = 180; isopropyl alcohol = 60), even if 180 g of
glucose is all converted to isopropyl alcohol, the amount of isopropyl alcohol produced will
be only 60 g, and can never be more than that. This theoretically maximum conversion rate
is defined as yield 100% in the present invention.
[0073] As described above, the isopropyl alcohol-producing Escherichia coli of the present
invention can produce isopropyl alcohol rapidly with high yield. Therefore, for example,
when producing isopropyl alcohol using the Escherichia coif of the present invention as a
catalyst, 97 g/L or more of isopropyl alcohol can be accumulated in 72 hours of culture, so
that a remarkably higher productivity than in the conventional catalysts can be achieved.
18
EXAMPLES
[0074] Hereinafter, examples of the present invention will be described, but the invention is
not restricted thereto. In the description, "%" is based on mass unless otherwise specified.
[Example 1]
<[B::pntA]: Production of Escherichia Coli B put Genome-Enhanced Strain
A pntA gene promoter in the genorne of an Escherichia coli B strain was substituted
with a GAPDH promoter to enhance the expression of pntA gene.
The entire base sequence of the genomic DNA of an Escherichia coli MG1655 strain
is known (GenBank accession number U00096), and the base sequence of a gene encoding an
NAD(P)+ transhydrogenase (AB-specific) a subunit of Escherichia coli (which may be
hereinafter abbreviated to pntA) has also been reported (GenBank accession number X04195).
In addition, it is known that pntA and a membrane transhydrogenase (3 subunit (pntB) form an
operon in the genomic DNA of Escherichia coli MG] 655 strain.
[0075] Asa base sequence of a promoter necessary to allow the expression of the gene, a
promoter sequence of glyceraldehyde 3-phosphate dehydrogenase (which may be hereinafter
referred to as GAPDH) derived from Escherichia coli described in 397 to 440 in the base
sequence information of GenBank accession number X02662 can be used, To obtain the
GAPDH promoter, amplification by PCR method was carried out using the genomic DNA of
Escherichia coil MG1655 strain as a template, and using cgctcaattgcaatgattgacacgattccg (SEQ
ID NO: 1) and acagaattegctatttgttagtgaataaaagg (SEQ ID NO: 2). The DNA fragment
obtained was digested with restriction enzymes Mfel and EcoRI to obtain a DNA fragment
with a size of approximately 100 bp encoding the GAPDH promoter. The obtained DNA
fragment and a fragment obtained by digesting plasmid pUC19 (GenBank accession number
X02514) with restriction enzyme EcoRI and further processing with alkaline phosphatase
were mixed together, and are ligated using a ligase. Escherichia coli DHSa competent cells
(DNA-903 manufactured by Toyobo Co., Ltd.) were transformed with the resultant ligation
product, as a result of which a transformant growing on an LB agar plate containing 50 μg/mL
of ampicillin was obtained. Ten of the obtained colonies were each cultured overnight at
3 7°C in an LB liquid medium containing 50 μg/ml, of ampicillin, and plasmids were
recovered. A plasmid from which the GAPDH promoter was not cutout when digested with
the restriction enzymes EcoRI and Kpnl was selected, and the DNA sequence thereof was
confirmed. The plasmid in which the GAPDH promoter was appropriately inserted was
named pUCgapP. The pUCgapP obtained was digested with restriction enzymes EcoRI and
Hindlll.
19
[0076] Furthermore, in order to obtain a pntA, amplification by PCR was carried out using
the genomic DNA of Escherichia colt MGI655 strain as a template, and using
geageaattgctggtggaacatatgegaattggcataceaag (SEQ ID NO: 3) and
ggacaagettaatttttgcggaacattttcagc (SEQ ID NO: 4). The DNA fragment obtained was
digested with restriction enzymes Mfel and Hindlll to obtain a pntA fragment with a size of
approximately 1.6 kbp. This DNA fragment was mixed with the pUCgapP that had been
previously digested with restriction enzymes EcoRl and HindIIi, and ligated using a ligase.
Escherichia colt DHSa competent cells (DNA-903 manufactured by Toyobo Co., Ltd.) were
transformed with the ligation product, as a result of which a transformant growing on an LB
agar plate containing 50 μg/mL of ampicillin was obtained. Aplasmid was recovered from
the bacterial cells obtained, and the correct insertion of pntA was confirmed. This plasmid
was named pGAPpntA.
Here, Escherichia coli MG1655 strain is available from the American Type Culture
Collection.
[0077] As mentioned above, the genomic DNA of the Escherichia colt MG1655 strain has
been clarified, and the base sequence near pntA has also been reported. Using
atggtaccgcagtaatacgctggttgc (SEQ ID NO: 5) and cctctagacttccatcggttttattgatgatgg (SEQ ID
NO: 6) prepared based on the gene information of the near 5' region of pntA of the
Escherichia colt MG1655 strain, PCR was carried out with the genomic DNA template of the
Escherichia colt MG 1655 strain to amplify a DNA fragment with a size of approximately 1.0
lcbp. This DNA fragment was treated with restriction enzymes KpnI and Xbal.
[0078] In addition, using a primer of ggtctagagcaatgattgacacgattccg (SEQ ID NO: 7)
prepared based on the sequence information of the GAPDI-I promoter of the Escherichia coli
MG1655 strain and the primer of SEQ ID NO: 4 prepared based on the sequence information
of pntA of the Escherichia coli MG1655 strain, PCR was carried out using, as a template, the
previously prepared expression vector pGAPpntA, as a result of which a DNA fragment with
a size of approximately 1.7 kbp including the GAPDH promoter and pntA was obtained.
The DNA fragment was treated with restriction enzymes Xbal and HindlIl.
[0079] The DNA fragment of the near 5' region of pntA and the DNA fragment including the
GAPDH promoter and pntA thus obtained were mixed with a DNA fragment obtained by
digesting a temperature-sensitive plasmid pTH18cs1 (GenBank accession number AB019610)
[Hashimoto-Gotoh, T., Gene, 241, 185-191 (2000)] with Kpnl and HindIll, and then ligated
using a ligase. DHSa strain was transformed with the ligation product, as a result of which a
transformant growing at 30°C on an LB agar plate containing 10 pg/ml of chloramphenicol
20
was obtained. The colonies obtained were cultured overnight at 30°C in an LB liquid
medium containing 10 pg/ml of chloramphenicol. Then, a plasmid was recovered from the
bacterial cells obtained, and the proper insertion of the near 5' region of pntA, the GAPDH
promoter and pntA was confirmed. Escherichia coli B strain (ATCC 11303) was transformed
with this plasmid, and cultured overnight at 30°C on an LB agar plate containing 10 μg/ml of
chloramphenicol to obtain a transformant. The transformant obtained was inoculated in an
LB liquid medium containing 10 μg/ml of chloramphenicol, and cultured overnight at 30°C.
The cultured bacterial cells obtained were applied onto an LB agar plate containing 10 tg/ ml
of chloramphenicol, and cultured at 42°C to obtain colonies. The colonies obtained were
cultured in an LB liquid medium containing no antibiotic at 30°C for 4 hours, and applied
onto an LB agar plate containing no antibiotic, as a result of which colonies capable of
growing at 42°C were obtained.
[0080] From the colonies that appeared, 100 colonies were randomly picked up. Each of
them was allowed to grow on an LB agar plate containing no antibiotic and on an LB agar
plate containing 10 μg/ml of chloramphenicol, and chloramphenicol-sensitive clones were
selected. Further, from the genomic DNA of these clones, a fragment with a size of
approximately 1.7 kbp including the GAPDH promoter and pntA was amplified by PCR, and
then a strain in which the pntA promoter region was substituted with the GAPDH promoter
was selected. A clone satisfying all the above was named Escherichia coli B pntA-deleted
GAPppntA genome-inserted strain (which may be hereinafter abbreviated to B::pnt strain).
Here, Escherichia coli B strain (ATCC11303) is available from the American Type
Culture Collection, which is a bank of cells, microorganisms, and genes.
[0081] [Example 2]
<[pGAP-laaa/B::pnt]: Preparation of Escherichia Coli B pmt Genome-Enhanced Strain to
which Expression Vector for Escherichia Coli-Derived Thiolase Gene, Escherichia
Coli-DerivedCoA Transferase Gene, Acetoacetate Decarboxylase Gene Derived from
Bacterium of the Genus Clostridium, and Isopropyl Alcohol Dehydrogenase Gene Derived
from Bacterium of the Genus Clostridium was Introduced>
An isopropyl alcohol-producing Escherichia coli having enhanced expression of
NAD(P)+ transhydrogenase (AB-specific) gene (pnt) was prepared as follows.
The B::pnt strain produced in Example 1 was transformed with pGAP-Iaaa described
in Example 4 of W02009/008377, to obtain a pGAP-Iaaa/B::pnt strain. The pGAP-Iaaa is
an expression vector plasmid capable of enhancing the expression of an Escherichia
coli-derived thiolase gene, an Escherichia coli-derived CoA transferase gene, a Clostridium
21
acelobulylicum-derived acetoacetate decarboxylase gene, and a Clostridium
beijerinckli-derived isopropyl alcohol dehydrogenase gene using the promoter of Escherichia
coli-derived glyeeraldehyde-3-phosphate dehydrogenase (GAPDH). The method for
preparing pGAP-Iaaa is described in Example 4 of W02009/008377.
[0082] [Example 3]
<[B::atoDAB]: Preparation of Escherichia Coli B atoDAB Genome-Enhanced Strain>
The CoA transferase genes (atoD and atoA) and the thiolase gene (atoB) derived
from Escherichia coli form an operon in the genmrne of the Escherichia coli in the order of
atoD, atoA, and atoB (Journal of Baceteriology Vol.169 pp 42-52 Lauren Sallus Jenkins et al).
Accordingly, by modifying the promoter of atoD, the expression of the CoA transferase gene
and the thiolase gene can be simultaneously controlled. Thus, the promoter of atoD gene in
the genome of the host Escherichia coli was substituted with the GAPDH promoter to prepare
an Escherichia coli having enhanced expression of atoD gene, atoA gene, and atoll gene.
[0083] The entire base sequence of the genomic DNA of the Escherichia coli MG1655 strain
is known (GenBank accession number U00096), and the base sequence of a gene (which may
be hereinafter abbreviated to atoD) encoding a CoA transferase a subunit of the Escherichia
coli MG1655 strain has also been reported. Specifically, atop is described in 2321469 to
2322131 of the genome sequence of the Escherichia coli MG1655 strain shown at GenBank
accession number U00096.
[0084] As a base sequence of a promoter necessary to allow the expression of the above
gene, a promoter sequence of glyeeraldehyde 3-phosphate dehydrogenase (GAPDH) derived
from Escherichia coli described in 397 to 440 in the base sequence information of GenBank
accession number X02662 can be used. In order to obtain the GAPDH promoter,
amplification by PCR was carried out using the genomic DNA of Escherichia coli MG1655
strain as a template and using cgctcaattgcaatgattgacacgattccg (SEQ ID NO: 1) and
acagaattcgctatttgttagtgaataaaagg (SEQ ID NO: 2). The DNA fragment obtained was
digested with restriction enzymes Mfel and EcoRl to obtain a DNA fragment with the size of
approximately 100 bp encoding the GAPDH promoter. The DNA fragment obtained was
digested with restriction enzymes Mfel and EcoRI to obtain a DNA fragment with a size of
approximately 100 bp encoding the GAPDH promoter. The DNA fragment obtained and a
fragment obtained by digesting plasmid pUC19 (GenBank accession number X02514) with
restriction enzyme EcoRl and further treating with alkaline phosphatase were mixed together,
and ligated using a ligase. Escherichia coli DH5a competent cells (DNA-903 manufactured
by Toyobo Co., Ltd.) were transformed with the ligation product, as a result of which.a
transformant growing on an LB agar plate containing 50 μg/mL of ampicillin was obtained.
22
Ten of the obtained colonies were each cultured overnight at 37°C in an LB liquid medium
containing 50 hg/mL of ampicillin, and plasmids were recovered. A plasmid from which the
GAPDH promoter was not cut out when digested with restriction enzymes EcoRI and KpnI
was selected. The DNA sequence thereof was confirmed, and a plasmid in which the
GAPDH promoter was properly inserted was named pUCgapP. The pUCgapP obtained was
digested with restriction enzymes EcoRI and IKpnl.
[0085] Furthermore, to obtain atoD, using the genomic DNA of Escherichia coli MG1655
strain as a template, amplification was performed by PCR with
cgaattcgctggtggaacatatgaaaacaaaattgatgacattacaagac (SEQ ID NO: 8) and
geggtacettatttgctctcetgtgaaacg (SEQ ID NO:9). The obtained DNA fragment was digested
with the restriction enzymes EcoRI and Kpnl to obtain an atoD fragment with a size of
approximately 690 bp. The DNA fragment was mixed with the pUCgapP that had been
previously digested with the restriction enzymes EcoRI and Kpnl to be ligated using a ligase,
and transformed Escherichia coli DHSa competent cells (DNA-903 manufactured by Toyobo
Co., Ltd.) to obtain a transformant growing on an LB agar plate containing 50 μg/mL of
ampicillin. A plasmid was recovered from the obtained bacterial cells and confirmation was
made as to whether atoD was appropriately inserted. The plasmid was named pGAPatoD.
Here, Escherichia coli MG1655 strain is available from the American Type Culture
Collection.
[0086] As mentioned above, the base sequence of atoD in the genomic DNA of the
Escherichia coli MG1655 strain has also been reported. Using
gctctagatgctgaaatccactagtettgtc (SEQ ID NO: 10) and tactgcagcgttccagcaccttatcaacc (SEQ ID
NO: 11) prepared based on the gene information of the near 5' region of atoD in the
Escherichia coli MGI 655 strain, PCR was carried out with the genomic DNA template of the
Escherichia coli MG1655 strain to amplify a DNA fragment with a size of approximately 1.1
kbp.
[0087] In addition, using a primer of ggtctagagcaatgattgacacgattccg (SEQ ID NO: 12)
prepared based on the sequence information of the GAPDH promoter of the Escherichia coli
MG1655 strain and the primer of SEQ ID NO: 9 prepared based on the sequence information
of atoD of the Escherichia coli MG1655 strain, PCR was carried out using, as a template, the
previously prepared expression vector pGAPatoD , to obtain a DNA fragment with a size of
approximately 790 bp including the GAPDH promoter and atoD.
[0088] The fragments thus obtained were digested with restriction enzymes Pstl and Xbal,
and with restriction enzymes Xbal and KpnI, respectively, and mixed with a fragment
obtained by digesting the temperature-sensitive plasmid pTH18csI (GenBank accession
23
number AB019b10) [Hashimoto-Gotoh, T., Gene, 241, 185-191 (2000)] with Pstl and ICpnI,
and ligated using a ligase. DH5a strain was transformed with the ligation product, as a
result of which a transformant growing at 30°C on an LB agar plate containing 10 pg/ml of
chloramphenicol was obtained. The colonies obtained were cultured overnight at 30°C in an
LB liquid medium containing 10 μg/rnl of chloramphenicol, and then, a plasmid was
recovered from the bacterial cells obtained. Escherichia coli B strain (ATCC11303) was
transformed with this plasmid, and cultured overnight at 30°C on an LB agar plate containing
10 pg/ml of chloramphenicol to obtain a transformant. The obtained transformant was
inoculated in an LB liquid medium containing 10 μg/ml of chloramphenicol, and cultured
overnight at 30°C. The cultured bacterial cells obtained were applied onto an LB agar plate
containing 10 μg/ml of chloramphenicol, and cultured at 42°C to obtain colonies. The
obtained colonies were cultured in an LB liquid medium containing no antibiotic at 30°C for
2 hours and applied onto an LB agar plate containing no antibiotic, as a result of which
colonies capable of growing at 42°C were obtained.
[0089] From the colonies that appeared, 100 colonies were randomly picked up. Each of
them was allowed to grow on an LB agar plate containing no antibiotic and on an LB agar
plate containing 10 μg/ml of chloramphenicol, and then chloramphenicolhsensitive clones
were selected. Further, from the chromosome DNA of these clones, a fragment with a size
of approximately 790 bp including the GAPDH promoter and atoD was amplified by PCR,
and a strain in which the atoD promoter region was substituted with the GAPDH promoter
was selected. A clone satisfying all the above was named Escherichia coli B atoD-deleted
GAPpatoD genome-inserted strain (which may be hereinafter abbreviated to B::atoDAB
strain).
[0090] [Example 4]
< Construction of Expression Vector for Acetoacetate Decarboxylase Gene Derived from
Bacterium of the Genus Clostridium and Isopropyl Alcohol Dehydrogenase Gene Derived
from Bacterium of the Genus Clostridium>
In order to obtain an isopropyl alcohol dehydrogenase gene (IPAdh), amplification by
PCR was carried out using the genomic DNA of Clostridium beijerinckii NRRL B-593 as a
template and using aatatgcatgctggtggaacatatgaaaggttttgcaatgctagg (SEQ ID NO: 13) and
gcggatccctcgagttataatataactactgctttaattaagtc (SEQ ID NO: 14). The DNA fragment obtained
was digested with restriction enzymes Sphl and BamHI to obtain an isopropyl alcohol
dehydrogenase fragment with a size of approximately 1.1 kbp. The DNA fragment obtained
was mixed with a fragment obtained by digesting pBRgapP (described in Example 4 of
24
W02009/008377) with restriction enzymesSphl and BamHl. The mixture was ligated using
a ligase, and Escherichia coli DH5a competent cells (DNA-903 manufactured by Toyobo Co.,
Ltd.) were transformed with the ligation product, as a result of which a transformant growing
on an LB agar plate containing 50 μg/mL of ampicillin was obtained. The obtained colonies
were cultured overnight at 37°C in an LB liquid medium containing 50 μg/mL of ampicillin.
A plasmid was recovered from the obtained bacterial cells, and proper insertion of IPAdh was
confirmed. This plasmid was named pGAP-IPAdh.
[0091] In order to obtain an acetoacetate deearboxylase gene (adc), amplification by PCR
was carried out using the genomic DNA of Clostridium acetobutylicum ATCC824 as a
template and using eactcgaggctggtggaacatatgttaaaggatgaagtaattaaacaaattage (SEQ ID NO: 15)
and ggaatteggtaccgtcgactctagaggatccttacttaagataatcatatataacttcagc (SEQ ID NO: 16). The
DNA fragment obtained was digested with restriction enzymes Xhol and EcoRI to obtain an
acetoacetate decarboxylase fragment with a size of approximately 700 bp. The obtained
DNA fragment was mixed with a fragment obtained by digesting the previously prepared
plasmid pGAP-IPAdh with restriction enzymes Xhol and EcoRl. The mixture was ligated
using a ligase, and Escherichia coli DH5a competent cells (DNA-903 manufactured by
Toyobo Co., Ltd.) were transformed with the ligation product, as a result of which a
transformant growing on an LB agar plate containing 50 μg/mL of ampicillin was obtained.
The obtained colonies were cultured overnight at 37°C in an LB liquid medium containing 50
μg/mL of ampieillin. A plasmid was recovered from the bacterial cells obtained, and proper
insertion of adc was confirmed. This plasmid was named pGAP-la.
Here, Clostridium beijerinckii NRRL B-593 is available from the VTT Culture
Collection, which is a bank of cells and microorganisms.
[0092] [Example 5]
<[pGAP-la-gapP-atoB]: Construction of Expression Vector for Acetoacetate Decarboxylase
Gene Derived from Bacterium of the Genus Clostridium, Isopropyl Alcohol Dehydrogenase
Gene Derived from Bacterium of the Genus Clostridium, and Escherichia Coli-Derived
Thiolase Gene>
The entire base sequence of the genomic DNA of the Escherichia coli B strain is
known (GenBank accession number CP000819), and the base sequence of a gene encoding
thiolase (acetyl-CoA C- acetyltransferase) of Escherichia coli (atoB) has also been reported
(GenBank accession number U08465). In order to perform cloning of atoB (1,185 bp), two
oligonucleotide primers shown as cgggatccttaattcaaccgttcaatcac (SEQ ID NO: 17) and
ttccatatgaaaaattgtgtcatcgtc (SEQ ID NO: 18) were synthesized. The primer of SEQ ID NO:
25
17 has an Ndell-recognition site at the 5'end side thereof and the primer of SEQ ID NO: 18
has a BamHI-recognition site at the 5'end side thereof, respectively.
The genomic DNA of Escherichia coli B strain (ATCC 11303) was prepared using a
DNeasy Tissue kit manufactured by QIAGEN Co. Ltd. Using the obtained genornic DNA as
a template, a DNA fragment with a size of approximately 1.2 kb (which may be hereinafter
referred to as atoB fragment) was amplified by PCR with a pair of primers of SEQ ID NO. 17
and SEQ ID NO: 18. The atoB fragment was separated and recovered by agarose gel
electrophoresis, and digested with Ndel and BalnHl. The digestion fragment was mixed
with an Ndel-BamHl-digested product of pBRgapP, and the mixture was reacted with T4DNA
ligase. Escherichia coli DH5a competent cells (manufactured by Toyobo Co., Ltd.) was
transformed with the ligation product, as a result of which a transformant growing at 37°C on
an LB agar plate containing 50 pg/ml of ampicillin was obtained. The colonies obtained
were cultured overnight at 37°C in an LB liquid medium containing 50 μg/mL of ampicillin.
A plasmid was recovered from the bacterial cells obtained, and proper insertion of atoB was
confirmed. This plasmid was named pGAP-atoB. The plasmid pGAP-atoB obtained was
digested with BglII and BamHI, and a fragment including the GAPDH promoter and atoB
was separated and recovered by agarose gel electrophoresis. This fragment was named
gapP-atoB. The fragment gapP-atoB was mixed with a fragment obtained by digesting the
plasmid pGAP-la prepared in Example 4 with restriction enzyme BamHI. The mixture was
ligated using a ligase, and Escherichia coli DH5a competent cells (DNA-903 manufactured
by Toyobo Co., Ltd.) was transformed with the ligation product, as a result of which a
transformant growing on an LB agar plate containing 50 pghnL of ampicillin was obtained.
The colonies obtained were cultured overnight at 37°C in an LB liquid medium containing 50
pg/mL of ampicillin. A plasmid was recovered from the bacterial cells obtained, and proper
insertion of gapP-atoB was confirmed. This plasmid was named pGAP-la-gapP-atoB.
[0093] [Example 6]
<[pGAP-Ia-gapP-atoB/B::atoDAB Strain]: Preparation of Escherichia coli B atoDAB
Genome-Enhanced Strain by Introduction of pGAP-la-gapP-atoB>
The B::atoDAB strain prepared in Example 3 was transformed with the
pGAP-la-gapP-atoB described in Example 5 above, to obtain an isopropyl alcohol-producing
Escherichia coli pGAP-la- gapP-atoB/B::atoDAB strain in which the expression of the
thiolase gene (atoB) is enhanced in the genome as well as enhanced by using the plasmid.
[0094] [Example 7]
<[pGAP-la-maeB]: Construction of Expression Vector for Acetoacetate Decarboxylase Gene
26
Derived from Bacterium of the Genus Clostridium, Isopropyl Alcohol Dehydrogenase Gene
Derived from Bacterium of the Genus Clostridium, and Escherichia Coli-Derived Malate
Dehydrogenase Gene>
In order to obtain a malate dehydrogenase gene, amplification by PCR was carried
out using the genome DNA of the Escherichia colt B strain (ATCC11303) as a template and
using cgggatcccggagaaagtcatatggatgaccagttaaaacaaag (SEQ ID NO: 19) and
gctctagattacagcggttgggtttgegc (SEQ ID NO: 20). The DNA fragment obtained was digested
with restriction enzymes .BamHI and Xbal to obtain a malate dehydrogenase fragment with a
size of approximately 2300 bp. The obtained DNA fragment was mixed with a fragment
obtained by digesting the plasmid pGAP-Ia prepared in Example 4 with restriction enzymes
Xbal and BamHI, and the mixture was ligated using a ligase. Escherichia coli DHSa
competent cells (DNA-903 manufactured by Toyobo Co., Ltd.) were transformed with the
ligation product, as a result of which a transformant growing on an LB agar plate containing
50 μg/mL of ampicillin was obtained. The colonies obtained were cultured overnight at
37°C in an LB liquid medium containing 50 μg/mL of ampicillin. A plasmid was recovered
from the bacterial cells obtained, and proper insertion of the malate dehydrogenase gene was
confirmed. This plasmid was named pGAP-Ia-maeB.
[0095] [Example 8]
<[pGAP-la-maeB/B::atoDAB Strain]: Preparation of Escherichia Coli B atoDAB
Genome-Enhanced Strain by Introduction of pGAP-Ia-maeB>
The B::atoDAB strain prepared in Example 3 was transformed with the
pGAP-la-maeB described in Example 7 above, to obtain an isopropyl alcohol-producing
Escherichia coli pGAP-Ia-maeB/B::atoDAB strain having enhanced expression of the malate
dehydrogenase gene (maeB).
[0096] [Example 9]

A fragment obtained by digesting the plasmid pGAP-Ia-maeB produced in Example
7 above with restriction enzyme BamHI and the DNA fragment gapP-atoB obtained in the
same manner as in Example 5 were mixed together, and ligated using a ligase. Then,
Escherichia coli DH5a competent cells (DNA-903 manufactured by Toyobo Co., Ltd.) was
transformed with the ligation product, as a result of which a transformant growing on an LB
27
agar plate containing 50 μg/mL. ofampicillin was obtained. The colonies obtained were
cultured overnight at 37°C in an LB liquid medium containing 50 μg/mL of ampicillin. A
plasmid was recovered from the bacterial cells obtained, and proper insertion of gapP-atoB
was confirmed. This plasmid was named pGAP-la-maeB-gape-atoB.
[0097] [Example 10]
<[pGAP-Ia-maeB-gapP-atoB/B::atoDAB Strain]: Preparation of Escherichia Coli B atoDAB
Genome-Enhanced Strain by Introduction of pGAP-Ia-maeB-gapP-atoB>
The B::atoDAB strain prepared in Example 3 was transformed with the
pGAP-Ia-maeB-gapP-atoB described in Example 9 above, to obtain an isopropyl
alcohol-producing Escherichia coli pGAP-Ia-maeB-atoB/B::atoDAB strain having enhanced
expression of both the malate dehydrogenase gene (macB) and the thiolase gene (atoB).
[0098] [Example 11]
<[B::atoDAB::pnt] Preparation of Escherichia Coli B atoDAB and pnt-Genome Enhanced
Strain>
The B::atoDAB strain prepared in Example 3 was transformed with a plasmid
obtained by introducing the DNA fragment of the pntA near-5' region and the DNA fragment
including the GAPDH promoter and pntA into the temperature-sensitive plasmid pTII18cs1 in
the same manner as in Example 1, and was cultured overnight at 30°C on an LB agar plate
containing 10 μg/ml of chloramphenicol, to obtain a transformant. The obtained
transformant was inoculated in an LB liquid medium containing 10 μg/ml of chloramphenicol,
and cultured overnight at 30°C. The cultured bacterial cells obtained were applied onto an
LB agar plate containing 10 μg/ml of chloramphenicol, and cultured at 42°C to obtain
colonies. The obtained colonies were cultured in an LB liquid medium containing no
antibiotic at 30°C for 2 hours, and applied onto an LB agar plate containing no antibiotic, as a
result of which colonies capable of growing at 42°C were obtained.
[0099] From the colonies that appeared, 100 colonies were randomly picked up. Each of
them was allowed to grow on an LB agar plate containing no antibiotic and on an LB agar
plate containing 10μg/ml of chloramphenicol, and chloramphenicol-sensitive clones were
selected. Further, from the chromosome DNA of those clones, a fragment with a size of
approximately 1.7 kbp including the GAPDH promoter and pntA was amplified by PCR, and
a strain in which the pntA promoter region was substituted with the GAPDH promoter was
selected. A clone satisfying all the above was named Escherichia coli B atoD-deleted
GAPpatoDGAPppntA genome-inserted strain (which may be hereinafter abbreviated to
B::atoDAB::pnt strain).
28
[0100] [Example 12]
<[pGAP-Ia-maeB/B::atoDAB::pnt]: Preparation of Escherichia Coli B atoD-Deleted
GAPpatoDGAPppntA Genome-Inserted Strain by Introduction of pGAP-la-maeB>
The B::atoDAB::pnt strain prepared in Example I1 was transformed with the
pGAP-Ia-maeB described in Example 7, to obtain an isopropyl alcohol-producing Escherichia
coli pGAP-Ia-maeB/B::atoDAB::pnt strain having enhanced expression of both the malate
dehydrogenase gene (maeB) and the NAD(P)-'- transhydrogenase (AB-specific) gene (pnt).
[0101] [Example 13]
<[pGAP-Ia-gapP-atoB/B::atoDAB::pnt]: Preparation of Escherichia Coli B atoD-Deleted
GAPpatoDGAPppntA Genome-Inserted Strain by Introduction of pGAP-Ia-gapP-atoB>
The B::atoDAB::pnt strain prepared in Example 11 was transformed with the
pGAP-Ia- gapP-atoB described in Example 5, to obtain an isopropyl alcohol-producing
Escherichia coli pGAP-la-gapP-atoB/B::atoDAB::pnt in which the expression of the thiolase
gene (atoB) was enhanced in the genome as well as enhanced by the plasmid, and in which
the expression of the NAD(P)i transhydrogenase (AB-specific) gene (put) was enhanced.
[0102] [Example 14]
<[pGAP-Ia-maeB-gapP-atoB/B::atoDAB::pnt Strain]: Preparation of Escherichia Coli B
Genome-Enhanced atoDAB and pntA Strain by Introduction of pGAP-Ia-maeB-gapP-atoB>
The B::atoDAB::pnt strain produced in Example 11 was transformed with the
pGAP-Ia-maeB-gapP-atoB described in Example 9 above, to obtain an isopropyl
alcohol-producing Escherichia coli pGAP-Ia-maeB-gapP-atoB/B::atoDAB::pnt strain in
which the expression of the malate dehydrogenase gene (maeB) and the NAD(P)+
transhydrogenase (AB-specific) gene (pnt) was enhanced, and in which the expression of the
thiolase gene (atoB) was enhanced in the genome as well as enhanced by the plasmid.
[0103] [Evaluation Experiment 1]

In the present evaluation experiment, isopropyl alcohol was produced using the
production apparatus shown in Fig. 1 of the pamphlet of W02009/008377. The culture tank
used had a 3 L capacity, and the trap tank used had a 10 L capacity. The culture tank, the
trap tank, the injection tube, the connection tube, and the discharge tube were all made of
glass. Water as a trap liquid (trap water) in an amount of 9 L was injected into the trap tank.
29
In addition, the culture tank was provided with a waste solution disposal tube to discharge a
culture solution, of which the amount was increased due to flow addition of sugar and a
neutralizer, to the outside of the culture tank as needed.
[0104] Each of the pGAP-laaa/B strain described in the pamphlet of W2009/008377, the
pGAP-Iaaa/B::pnt strain prepared in Example 2 above, the pGAP-la-gapP-atoB/B::atoDAB
strain prepared in Example 6 above, the pGAP-la-maeB/B::atoDAB strain prepared in
Example 8, the pGAP-la-maeB-gapP-atoB/B::atoDAB strain prepared in Example 10, the
pGAP-1a-maeB/B::atoDAB::pnt strain prepared in Example 12, the
pGAP-la-gapP-atoB/B::atoDAB::pnt strain prepared in Example 13, and the
pGAP-la-maeB-gapP-atoB/B::atoDAB::pnt strain prepared in Example 14 was inoculated, for
preculturing, into a 500 mL capacity Erlenmeyer flask that contained 100 ML of an LB Broth,
Miller culture solution (Difco 244620) containing 50 pm/ml, of ampicillin, and was
precultured overnight at a culture temperature of 30°C while stirring at a rate of 120 rpm.
In addition, the pGAP-laaa/B strain described in the pamphlet of W2009/008377 is
provided with only the thiolase activity in order to produce isopropyl alcohol, and
enhancement of both the malate dehydrogenase activity and the NAD(P)+ transhydrogenase
(AB-specific) activity has not been carried out. Therefore, the pGAP-laaa/B strain does not
read on the isopropyl alcohol-producing Escherichia coli of the present invention.
[0105] The preculture product (45 mL) obtained was transferred into a 3 L capacity culture
tank (BMS-PI: a culture apparatus manufactured by ABLE Corporation) containing 855 g of a
culture medium having the composition shown below, and was cultured. The cultivation
was performed under atmospheric pressure, at an aeration rate of 0.9 L/min, a stirring speed
of 550 rpm, a culture temperature of 30°C, and pH 7.0 (adjusted with an aqueous NH3
solution). During the period from the start of the culture until 8 hours thereafter, a 45%
wt/wt glucose aqueous solution was added at a flow rate of 7.5 g/L/hour. After that, the 45%
wt/wt glucose aqueous solution was added at a flow rate of 20 g/L/hour. The bacterial cell
culture solution was sampled a few times during the period from the start of the culture until
72 hours thereafter,, and bacterial cells were removed by centrifugal operation. The amounts
of isopropyl alcohol accumulated in the obtained culture supernatant and the trap water were
measured by HPLC according to a usual method. The measurement values show the total
value of the accumulation amounts in the culture solution and the trap water (9L) after the
culturing. The results are shown in Fig. I and Table 1. In addition, the production rates,
the yields, and the amounts of isopropyl alcohol accumulated are all shown in Fig. 2.
[0106] The values in Table I are given in g/L. The symbols in Fig. 1 are defined as
follows:
30
Black circle: pGAP-la-maeB-gapP-atoB:B::atoDAB:: put strain;
Black square: pGAP-la-maeB-gapP-atoB/B::atoDAB strain;
White circle: pGAP-la-maeB/B::atoDAB strain;
White triangle: pGAP-la-gapP- atoB/B::atoDAB strain;
White square: pGAP-Iaaa/B::pnt strain;
x: pGAP-Iaaa/B strain;
White rhombus: pGAP-Ia-maeB/B::atoDAB::pnt strain; and
Black rhombus : pGAP-la-gapP-atoB/B::atoDAB::pnt strain.
[0107]
Corn steep liquor (manufactured by Nihon Shokuhin Kako Co., Ltd.): 20 g/L
Fe2SO4 • 7FI2O: 0.1 g/L
K2HPO4: 2 g/L
KH2PO4: 2 g/L
MgSO4 • 7H2O: 2 g/L
(NH4)2 SO4: 2 gIL
ADEKANOL LG126 (Asahi Denka Co. Ltd.): 0.1 g/L
(Balance: water)
[0108] [Table 1]
pGAP-laaa
/B strain
pGAP-la- pGAP-la g
pGAP-la- pGAP-Ia- pGAP-lamaeB-
gap apP-atoB
gapP-ato maeB/B:: maeB/B::at
P-a toB/I /B::atoDA
B/B::ato atoDAB oDAB::pnt
B::atoDAB B::pnt
DAB strain strain strain
strain strain
72.7 1 82.5
pGAP-lamaeB-
gap
P-atoB/B::
atoDAB::
pat
strain
31
[0109] [Table 2]
pGAP Ia- pGAP-la pGAP la
pGAP lapGAP-]
a pGAP-la gapP-ato
pGAP lamaeB-
ga
pGAP-lagapP-
ato
maeB-ga
Name of aa/B as/B::pnt B/B::ato
maeB/ B::
PatoB/B
maeB/B::
B/B::ato
pP-atoB/
strain
strain A strain DAB atoDAB
:: atoDAB
atoDAB::
DAB::pnt
B::atoDA
strain
strain
strain
put strain'
strain
B::pnt
strain
Production
rate 0.6 0.9 1.0 1.2 1.4 1.1 1.16 1.9
(g-TPA /L/hr
Yield
_
_--m ---
(mol-IPA/mol- 30.9 28.1 42.7 39.6 67.1 50.9 45.5 65.6
glucose)%
Amount of
34.7 59.6 70.7 72.7 82.5 80.5 83.5 97.4
accumulation
(72 hr) (72 hi') (72 hr) (72 hr) (72 hr) (72 hr) (72 hr) (72 hr)
(g-TPA/L)
[0110] As shown in these results, the strain (pGAP-Iaaa/B::pntA strain) in which only the
expression of the NAD(P)+ transhydrogenase (AB-specific) gene (pnt) was enhanced in the
conventional isopropyl alcohol-producing Escherichia coli (pGAP-Iaaa/B strain), the strain
(pGAP-Ia-gapP-atoB/B::atoDAB strain) in which only the expression of the thiolase gene
(atoB) was enhanced by both the introduction and the genomic enhancement in the
conventional pGAP-Iaaa/B strain, and the strain (pGAP-Ia-maeB/B::atoDAB strain) in which
only the expression of the malate dehydrogenase gene (macB) was enhanced in the
conventional pGAP-Iaaa/B strain all showed higher productivity than the conventional
isopropyl alcohol-producing Escherichia coli, and the respective amounts of accumulation of
isopropyl alcohol were approximately 1.7 times, approximately, 2.0 times, and approximately
2.1 times that of the conventional isopropyl alcohol-producing Escherichia coli, respectively.
In the strain (pGAP-Ia-maeB/B::atoDAB strain) in which only the expression of the malate
dehydrogenase gene (maeB) was enhanced, by-products such as acetone, formic acid, and
acetic acid were reduced.
[0111] Furthermore, the strain (pGAP-Ia-maeB-gapP-atoB/B::atoDAB strain) in which both
atoB and maeB are enhanced, the strain (pGAP-la-maeB/B::atoDAl3::pnt) in which the
expression of both maeB and put is enhanced, the strain
(pGAP-Ia-gapP-atoB/B::atoDAB::pnt) in which atoB and put are enhanced, and the strain in
which the expression of all of the three enzyme genes: atoB, maeB, and put is enhanced
further improved productivity of isopropyl alcohol. The respective amounts of accumulation
of isopropyl alcohol were approximately 2.4 times, approximately 2.3 times, approximately
2.4 times, and approximately 2.8 times that of the conventional isopropyl alcohol-producing
Escherichia coli, respectively. Particularly, in the case in which the expression of the
NAD(P)+ transhydrogenase (AB-specific) (pnt), the thiolase gene (atoB), and the malate
dehydrogenase gene (macB) was simultaneously enhanced, the production rate was 3.4 times
32
that of the pGAP-laaa/B strain, the yield was 2.1 times that of the pGAP-laaa/B strain, and the
amount of accumulation of isopropyl alcohol was 2.8 times that of the pGAP-laaa/B strain,
which are drastic improvements.
[0112] The disclosure of Japanese Patent Application No: 2010-052249 filed on March 9,
2010 is incorporated herein by reference in its entirety.
All publications, patent applications, and technical standards mentioned in this
specification are incorporated herein by reference to the same extent as if each individual
publication, patent application, and technical standard were specifically and individually
indicated to be incorporated by reference.

CLAIMS
1. An isopropyl alcohol-producing Escherichia coif equipped with an isopropyl
alcohol production system, comprising at least one enhanced enzyme activity selected from
the group consisting of
an enhanced malate dehydrogenase activity;
an enhanced NAD(P)+ transhydrogenase (AB-specific) activity; and
an enhanced thiolase activity.
2. The isopropyl alcohol-producing Escherichia coli according to claim 1, wherein
the enhanced enzyme activity comprises the enhanced malate dehydrogenase activity.
3. The isopropyl alcohol-producing Escherichia coli according to claim 1, wherein
the enhanced enzyme activity comprises the enhanced malate dehydrogenase activity and the
enhanced thiolase activity.
4. The isopropyl alcohol-producing Escherichia coli according to claim 1, wherein
the enhanced enzyme activity comprises the enhanced malate dehydrogenase activity and the
enhanced NAD(P)' transhydrogenase (AB-specific) activity.
5. The isopropyl alcohol-producing Escherichia coli according to claim 1, wherein
the enhanced enzyme activity comprises the enhanced malate dehydrogenase activity, the
enhanced NAD(P)+ transhydrogenase (AB-specific) activity, and the enhanced thiolase
activity.
6. -=The isopropyl alcohol=producing Escherichia coli according to any one of claims
1 to 5, wherein the enhanced enzyme activity is derived from at least one of enhancement by
an enzyme gene introduced from outside the cell of the Escherichia coli or enhancement by
enhanced expression of an enzyme gene in the cell of the Escherichia coif.
7. The isopropyl alcohol-producing Escherichia coli according to any one of claims
1 to 6, wherein the enhanced enzyme activity is derived from at least one of enhancement in
the genome of a host Escherichia coli or enhancement by plasmid introduction.
8. The isopropyl alcohol-producing Escherichia coif according to any one of claims
34
I to 7, wherein the enhanced enzyme activity is derived from a gene or genes derived from a
bacterium or bacteria of the genus Escherichia and encoding the enzyme or enzymes.
9. The isopropyl alcohol-producing Escherichia coli according to any one of claims
1 to 8, wherein the isopropyl alcohol production system is constructed by genes of each of
acetoacetate decarboxylase, isopropyl alcohol dehydrogenase, CoA transferase, and thiolase
enzymes.
10. The isopropyl alcohol-producing Escherichia coli according to any one of
claims 1 to 8, wherein the isopropyl alcohol production system is constructed by enzyme
genes of each of the acetoacetate decarboxylase, the isopropyl alcohol dehydrogenase, the
CoA transferase, and the thiolase, and the respective genes of the enzymes are
independently derived from at least one prokaryote selected from the group consisting of a
bacterium of the genus Clostridium, a bacterium of the genus Bacillus, and a bacterium of the
genus Escherichia.
11. The isopropyl alcohol-producing Escherichia colt according to any one of
claims 1 to 8, wherein the acetoacetate decarboxylase activity is derived from a gene that is
derived from Clostridium acetobutylicum and encodes the enzyme; the isopropyl alcohol
dehydrogenase activity is derived from a gene that is derived from Clostridium beijerinckii
and encodes the enzyme; and the CoA transferase activity, the thiolase activity, the analate
dehydrogenase activity, and the NAD(P) ' transhydrogenase (AB-specific) activity are derived
from genes that are derived from Escherichia coli and encode the respective enzymes.
12. An isopropyl alcohol producing method comprising producing isopropyl
alcohol from a plant-derived raw material using the isopropyl alcohol-producing Escherichia
coli according to any one of claims I to 11.