Sign In to Follow Application
View All Documents & Correspondence

"Improved Process For Expression, Purification And Enhanced Recovery Of Mycobacterial Recombinant Proteins"

Abstract: The present invention relates to cloning, expression in E coli and purification of mycobacterial antigens. The invention also in particular relates to expression and purification of two important mycobacterial proteins with serodiagnostic potential, namely, 38-kDa and Mtb81 antigens, in monomeric form which involves using a T7 promoter based expression vector under conditions of regulated and slow expression followed by 3-step column chromatography procedure to obtain highly purified proteins with enhanced yields of two proteins. The invention further relates to use of purified proteins in detecting antibodies in sera of tuberculosis patients .

Get Free WhatsApp Updates!
Notices, Deadlines & Correspondence

Patent Information

Application #
Filing Date
25 October 2004
Publication Number
25/2009
Publication Type
INA
Invention Field
BIOTECHNOLOGY
Status
Email
Parent Application
Patent Number
Legal Status
Grant Date
2014-11-19
Renewal Date

Applicants

UNIVERSITY OF DELHI
DEPT. OF BIOCHEMISTRY SOUTH CAMPUS, BENITO JUAREZ ROAD, NEW DELHI-110021, INDIA.

Inventors

1. CHAUDHARRY, VIJAY K
S/O SH. BRIJ NANDAN AGARWAL, 1 GF TYPE 5A FLATS UNIVERSITY OF DELHI SOUTH CAMPUS, NEW DELHI-110021, INDIA.
2. GUPTA, AMITA
D/O SH. P.K. GUPTA, C-1/ 1478, VASANT KUNJ, NEW DELHI-110070, INDIA.
3. TYAGI, ANIL K
S/O SH. RAM DUTTA SHASTRI 438, HAWA SINGH BLOCK, ASIAD VILLAGE, NEW DELHI-110049, INDIA.
4. KULSHRESTHA, ABHISHEK
S/O SH. YUVRAJ KULSHRESTHA, 49/15, CANAL ROAD, KISHANPUR, DEHRADUN UTTARANCFHAL-248001, INDIA.

Specification

IMPROVED PROCESS FOR EXPRESSION, PURIFICATION AND ENHANCED RECOVERY OF MYCOBACTERIAL RECOMBINANT PROTEINS
FIELD OF INVENTION
The present invention relates to an improved process for expression of Mycobacterial proteins in E. coli followed by purification and enhanced recovery of the recombinant proteins. The invention particularly relates to the expression and purification of several important mycobacterial proteins for sero-diagnosis of tuberculosis.
BACKGROUND AND PRIOR ART
Tuberculosis (TB) is a major disease in developing countries and the situation has become more alarming with TB becoming a major opportunistic infection in Human Immuno-deficiency Virus (HIV) infected individuals [1]. Early and effective drug treatments of the diseases are the keys to curtailing the spread of infection. Sensitive PCR methods are available for M. tuberculosis detection but the cost, requirement of instruments and skilled personnel are prohibitory in their large scale use in developing countries where tuberculosis is most prevalent [2]. Current tests used for TB diagnosis include culturing of bacteria from body fluids and smear testing of sputum for the presence of acid fast bacilli (AFB) [3]. Immunological test to detect antibodies and/or antigens in blood is a reliable approach to detect any infection [4]. The immunological tests for tuberculosis include tuberculin skin test, T cell stimulation assays in cells of patients using mycobacterial proteins and peptides, and detection of antibodies to M. tuberculosis antigens in the serum (serodiagnosis) of infected individuals [5-9]. However, for all these assays to be successful, immunodominant mycobacterial antigen(s) needs to be identified. Although antibodies are produced against a variety of M. tuberculosis antigens in infected individuals, heterogeneity exists in the response of different individuals to the same antigen [10]. Further, the immune response to various antigens is different in the same patient at different stages of the disease. Heterogenous response to the same antigen in different populations further adds to the difficulty in identification of antigens which can make reagents unsuitable for a large population. Therefore, antigens that give more uniform and sustained antibody response need to be identified. For this, it is imperative that a large number of mycobacterial proteins be purified and tested. Several M. tuberculosis proteins have been isolated or cloned and

expressed in E. coli and tested for sero-diagnostic potential [10-12]. The results indicate that a combination of mycobacterial antigens is likely to have better diagnostic value [12-13]. Availability of these antigens in sufficient quantities and evaluation in a given population will be useful in formulating a cocktail for highly sensitive and specific detection of M. tuberculosis infection.
Among various antigens which have shown promise in sero-diagnosis of tuberculosis, 38-kDa antigen and Mtb81 (malate synthase) have been found to be very useful. The 38-kDa antigen is a phosphate transport protein (PstS-1) [14]. This antigen has been used in the development of several commercial assays for the detection of TB [15-17]. While highly specific for TB, it lacks sensitivity, particularly in the detection of smear negative, TB infected individuals [18]. The sensitivity and specificity of 38-kDa antigen also varies with population. Therefore, it needs to be used in combination with other M. tuberculosis antigens. Mtb81 has been recently identified as a novel serological marker for tuberculosis and has been shown to be useful in detecting antibodies in patients infected with both HIV and M. tuberculosis [19-20].
In order to evaluate the potential of various mycobacterial antigens in serodiagnosis of TB in Indian population, we undertook a study to clone, over-express and purify several important mycobacterial antigens in E. coli. This paper describes cloning, high level expression and reproducible protocols for the purification of monomelic, soluble His6 tagged 38-kDa and Mtb81 antigens of M. tuberculosis in large quantities. The purified proteins when used alone or in combination showed strong reactivity with antibodies in serum of tuberculosis patients comprising of various categories including smear positive, smear negative and extra-pulmonary tuberculosis patients. The proteins were also evaluated for their specificity of M. tuberculosis detection using large number of normal serum samples.
Availability of genome sequence of Mycobacterium tuberculosis has accelerated identification of antigens for sero-diagnosis of tuberculosis and a number of new antigens are being tested in various combinations to produce cocktails with high sensitivity and specificity. For producing a highly specific diagnostic test, it is important that the recombinant antigens be highly pure, free of host protein and correctly folded so that they bind only to specific antibodies. Also, for commercial viability they need to be produced in high yields.

A large number of mycobacterial proteins with immunodiagnostic potential have been cloned and over-expressed in E. coli with different protocols for extraction and purification [10-12]. In many cases the expressed protein was insoluble and required denaturation and renaturation before purification, resulting in poor yields. Earlier reports show that 38-kDa antigen was expressed at high level but accumulated as inclusion bodies. Denaturation and renaturation yielded pure protein with properties similar to the native 38-kDa antigen from M. tuberculosis [25]. A protocol has been described for the expression of soluble 38-kDa antigen and its purification to near homogeneity [14]. However, there was no experiment to show the monomelic nature of the protein. In our case, the TSK G3000-SW gel filtration analysis of eluate from Ni-NTA column showed that the preparation contained approximately 20 % protein as dimer of 38-kDa antigen. This dimer eluted at higher salt concentration than the monomer on Q- Sepharose column chromatography and hence got separated. Further purification on gel filtration column ensured that the remaining aggregates were removed. This shows that presence of recombinant protein in high speed/ultra high-speed supernatant does not ensure the monomelic nature of the protein. In our case, dimers and multimers were removed by Ion-exchange and Gel filtration chromatography completely to obtain highly purified proteins in monomelic form as confirmed on TSK G3000-SW sizing column.
Purification protocols have been described for a large number of Histidine tagged recombinant antigens of M. tuberculosis; however, the reported yield of 38-kDa antigen is very low [11]. Mtb81 antigen has also been expressed as His-tagged protein in E. coli, as both soluble protein [26] and as insoluble protein [19]. However, the detailed methodology has not been described and yields also not reported.
Several expression strategies have been developed to aid the formation of the native protein structure by co-expressing molecular chaperones, reducing the rate of protein synthesis, growing bacterial cultures at lower temperatures, and using highly soluble polypeptides as fusion partner [21].
For large scale use of proteins in immunodiagnosis, production of recombinant proteins free of host proteins and degradation products is a very critical step. We have successfully used T7-Lac promoter based vectors for hyper-expression of several proteins of HIV-1 in soluble form which helps in devising simple chromatography protocols for obtaining highly pure and monomelic protein in high yields [22-23].The

use of small affinity tags has further facilitated the recovery and purification of recombinant proteins without affecting the properties of proteins [24].
OBJECTS OF THE INVENTION
The main object of the present invention relates to a process of cloning and expression of mycobacterial proteins in E. coli and purification of the recombinant proteins. The invention particularly relates to the expression and purification of several important mycobacterial proteins for sero-diagnosis, namely, 38-kDa, Mtb81, ESAT-6, CFP10, MTC28, 14-kDa antigens in monomelic form.
Yet another object of the present invention relates to DNA amplification of genes encoding antigenic proteins such as 38-kDa, Mtb81, ESAT6, CFP10, MTC28 and 14-kDa from Mycobacterium species.
Yet another object of the present invention relates to cloning of genes corresponding to 38-kDa, Mtb81, ESAT6, CFPIO, MTC28 and 14-kDa genes into a plasmid vector to generate recombinant plasmid vectors where the genes are under the control of T7-lac promoter for efficient control of expression.
Yet another object of the present invention relates the recombinant plasmid vectors generated herein, referred to as, pVNLMTB811101 (harboring 38-kDa), pVNLMTB381101 (harboring Mtb81 proteins), pVNLESAT64102 (harboring ESAT6), pVNLCFPlOllOl (harboring CFPIO), pVNLMTC284102 (harboring MTC28) and pVNLMTB141101 (harboring 14-kDa).
Yet another object of the present invention relates to transformation of E. coli strains with the recombinant plasmid vectors namely, pVNLMTB381101, pVNLMTB811101, pVNLESAT64102, pVNLCFPlOll0l, pVNLMTC284102 and pVNLMTB141101 followed by the inoculation of the transformed strains in LB medium.
Yet another object of the present invention relates to induction of protein expression by low concentration of inducer followed by incubation at critical temperature conditions to fine tune the induction of protein expression for the production of high levels of soluble proteins as monomers.
Yet another object of present invention relates to extraction of soluble proteins and analysis of various sub cellular fractions followed by their analysis through SDS-

PAGE for localization of recombinant antigens namely, 38-kDa, Mtb81, ESAT6, CFPIO, MTC28 and 14-kDa.
Yet another object of the present invention relates to the purification of the recombinant proteins following a three-step protocol comprising affinity chromatography, anion-exchange and gel-filtration chromatography to purify 38-kDa, Mtb81, ESAT6, CFPIO, MTC28 and 14-kDa.
Yet another object of the present invention relates to the use of purified recombinant proteins for sero-diagnosis of tuberculosis.
Yet another object of the present invention relates to the use of purified recombinant proteins in detecting antibodies with high sensitivity and specificity in sera of tuberculosis patients for cost effective immunodiagnostics.
SUMMARY OF INVENTION
The present invention relates to a process of cloning and expression of Mycobacterial proteins in E. coli and enhanced recovery and purification of the recombinant protein.
The invention particularly relates to the expression and purification of several important mycobacterial proteins useful in serodiagnosis, namely, 38-kDa and Mtb81, ESAT6, CFPIO, MTC28 and 14-kDa antigens in soluble monomeric form. The present invention further relates to DNA amplification of genes encoding antigenic proteins namely, 38-kDa, Mtb81, ESAT6, CFPIO, MTC28 and 14-kDa from genomic DNA of the Mycobacterium species using specific primers.
The present invention further involves cloning of the genes corresponding to 38-kDa, Mtb81, ESAT6, CFPIO, MTC28 and 14-kDa genes into a plasmid vector for generating recombinant plasmid vectors where the genes are under the control of T7-lac promoter. The present invention further relates to recombinant plasmid vectors pVNLMTB811101 (harboring 38-kDa), pVNLMTB381101 (harboring Mtb81 proteins), pVNLESAT64102 (harboring ESAT6), pVNLCFPl0110l (harboring CFPIO), pVNLMTC284102 (harboring MTC28) and pVNLMTB141101 (harboring 14-kDa), respectively.

The present invention further relates to transformation of E. coli strains with the recombinant plasmid vectors and the inoculation of the transformed strains in LB medium for growth.
The present invention further relates to induction of protein expression by low concentration of inducer namely IPTG followed by incubation at critical temperature conditions to fine tune the induction of protein expression and production of high levels of soluble proteins as monomers.
The present invention further relates to extraction of soluble recombinant proteins and analysis of various sub cellular fractions and their analysis by SDS-PAGE.
The present invention further relates to the purification of the recombinant proteins following a three-step protocol comprising of affinity, anion-exchange and gel filtration chromatography to purify the recombinant proteins. The present invention further relates to the use of purified recombinant proteins in detecting antibodies with high sensitivity and specificity in sera of tuberculosis patients for cost effective immunodiagnostics.
DESCRIPTION OF THE FIGURES
FIG. 1: Expression and sub-cellular localization of 38-kDa and Mtb81 antigens.
FIG. 2: Purification of 38-kDa antigen.
FIG. 3: Purification of Mtb81 antigen.
FIG. 4: Reactivity of sera from AFB smear-positive, smear-negative, extra-pulmonary TB patients and normal healthy blood donors.
FIG. 5: Reactivity of various M. tuberculosis antigens with sera from AFB smear-positive, smear-negative, extra-pulmonary TB patients.
DETAILED DESCRIPTION OF THE INVENTION
The present invention relates to an improved process of expression of Mycobacterium proteins in E. coli followed by enhanced recovery and purification of the recombinant proteins.
Proteins are macromolecules which are encoded by genes and comprise a group of entities which includes antigens, enzymes, storage proteins, transport proteins.

An embodiment of the present invention relates to an improved process for the expression, purification and enhanced recovery of recombinant proteins of Mycobacterium species, comprising steps of:
a) amplifying genomic DNA coding for proteins from and cloning the amplified DNA in a plasmid vector to obtain recombinant plasmid vector,
b) transforming E. coli cells with the recombinant plasmid vector to produce recombinant E. coli cells and growing the them at a temperature ranging between 18°C to 37°C for 5 to 8 hours, adding an inducer and allowing them to grow further for 4 to 6 hours at 18°C to 30° C to express recombinant protein,
c) harvesting the recombinant E. coli cells and isolating the recombinant protein by conventional methods, and
d) purifying the recombinant protein obtained at a temperature ranging between 4°C to 8°C by affinity chromatography followed by anion exchange chromatography and gel filtration chromatography to obtain enhanced yield of purified recombinant protein in a soluble monomelic form.
Another embodiment of the invention relates to cloning of DNA of Mycobacterium species selected from a group consisting of M. tuberculosis, M. bovis andM. smegmatis, M.bovis BCG.
Another embodiment of the present invention relates to the expression of recombinant proteins selected from a group consisting of 38-kDa, Mtb81, ESAT-6, CFP10, MTC28, 14-kDa, TPX, TB16.3, MTB48, ICDI, ICDII, MPT32, MPT51, MPT63, MPT70, 19-kDa, SODA, and Glutamine synthase.
Yet another embodiment of the invention relates to a pair of primers for amplification of genomic DNA from Mycobacterium species selected from a group consisting of SEQ ID NO:l and SEQ ID NO:2, SEQ ID NO: 3 and SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6, SEQ ID NO: 7 and SEQ ID NO: 8, SEQ ID NO: 9 and SEQ ID NO: 10, SEQ ID NO: 11 and SEQ ID NO: 12.

Still another embodiment of the present invention relates to the plasmid vectors either pVNLEBAP1306 or pVNLMTB194102 for cloning the amplified DNA from Mycobacterium species.
Another embodiment of the invention relates to the recombinant plasmid vector selected from a group consisting of pVNLMTB811101, pVNLMTB381101, pVNLESAT64102, PVNLCFP101101, pVNLMT284102 andpVNLMTB141101.
Another embodiment of the invention relates to the E. coli cells that are selected from a group consisting of BL21 (λDE3), DH5alpha, TGI, Novasene (λDE3), XL-1, and Top 10.
Further, another embodiment of the invention relates to the inducer which is selected from a group consisting of Isopropyl-ß-D- thiogalactoside, arabinose, lactose, galactose, tryptophan and tetracycline derivatives.
Still another embodiment of the present invention relates to the concentration of inducer in the range of 0.1 to 2.0mM.
The present invention particularly relates to expression and purification of several important mycobacterial proteins, namely, 38-kDa and Mtb81, ESAT6, CFP10, MTC28 and 14-kDa antigens in soluble monomelic form for sero-diagnosis.
Another embodiment of the invention relates to the expression and purification of several important mycobacterial proteins in soluble monomelic form using a T7 promoter based plasmid vector under conditions of regulated and slow expression followed by 3-step column chromatography procedure to obtain highly purified proteins with enhanced yields of the recombinant proteins.
Genes encoding antigenic proteins namely, 38-kDa, Mtb81, ESAT6, CFP10, MTC28 and 14-kDa are PCR amplified using specific primers from the genomic DNA of M. tuberculosis H37Rv as given in EXAMPLE 1 and EXAMPLE 5. Similarly, genomic DNA coding for different proteins of Mycobacterium species such as M. bovis, M. smegmatis, and M.bovis BCG can be amplified using the PCR protocols described.
Amplification of genomic DNA of Mycobacterium species
The gene corresponding to 8-kDa genes is amplified without its signal
sequence with the first cysteine at +1, 3changed to Methionine. The PCR is performed
using forward primer (FP1, SEQ ID NO: 1), 5'-

GCAGCGGCGCATATGGGCTCGAAACCACCGAGCGG-3' which includes an Nde I site (underlined) and reverse primer (RP1, SEQ ID NO: 2), 5'-GTCGCGTGGAATTCATTACTGCGCGCTGGAAATCGTCG-3' which includes a Bss HII site (underlined).
The gene corresponding to Mtb81 antigen is similarly amplified using a forward
primer (FP2, SEQ ID NO: 3), 5'-
AGGGAGGAACATATGACAGATCGCGTGTCGGTGG-3' which creates Nde I site (underlined) and reverse primer (RP2, SEQ ID NO: 4), 5'-CACAGCGGACGCGTTACGGGCCGCATCGTCACCGG-3' which creates Mlu I site (underlined).
The gene corresponding to ESAT6 antigen is amplified similarly using a
forward primer (FP3, SEQ ID NO: 5), 5'-
ACGGAGCAACGCGTCGACAGAGCAGCAGTGGAATT-3' which creates Mlu I site (underlined) and a reverse primer (RP3, SEQ ID NO: 6), 5'-CTCGGCGTGCGCGCCTGCGAAGATCCCAGTGACGTT-3' which creates Bss HII site (underlined).
The gene corresponding to CFP10 antigen is amplified similarly using a
forward primer (FP4, SEQ ID NO: 7), 5'-
AAGTAGTCCCATATGGCAGAGATGAAGAC -3' which creates Nde I site (underlined) and a reverse primer (RP4, SEQ ID NO: 8), 5'-CGTATTAGACGCGTTGAAGCCCATTTGCGAGGA-3' which creates Mlu I site (underlined).
The gene corresponding to MTC28 antigen is amplified similarly using a
forward primer (FP5, SEQ ID NO: 9), 5'-
GGAAGGCCCATATGGATCCCCTGCTGCCAC-3' which creates Nde I site and a
reverse primer (RP5, SEQ ID NO: 10), 5'-
GCCTCATCGGCGCGCGCCGCGCGGCGGCACTGGTGT-3' which creates Bss HII site (underlined).
The gene corresponding to 14-kDa antigen is amplified similarly using a
forward primer (FP6, SEQ ID NO: 11), 5'-
AGGAGGCATCATATGGCCACCACCCTTC-3'which creates Nde I site (underlined) and a reverse primer (RP6, SEQ ID NO: 12), 5'-

ACCCAGTGACGCGTTGGTGGACCGGATCTGAAT-3' which creates Mlu I site (underlined).
The details of the PCR experimental methods are provided in EXAMPLE 1 and EXAMPLE 5.
Similarly, the PCR methods described above can also be used in the amplification of genomic DNA of other antigens/proteins of the Mycobacterium species such as TPX, TBI6.3, MTB48, ICDI, ICDII, MPT32, MPT51, MPT63, MPT70, 19-kDa, SODA, and Glutamine synthase.
Purification of the amplified Product
The amplified product is purified using QiaPCR purification kit (Qiagen, Hilden, Germany) as provided in EXAMPLE 1. Purification of the amplified product can be also be carried out by other methods known in the art.
Restriction of amplified products and Cloning in Plasmid Vector
The purified amplified product corresponding to 38-kDa gene is digested with Nde I and Bss HII restriction enzymes, and mobilized into Nde l-Mlu I sites of linearized and dephosphorylated pVNLEBAP1306 to generate recombinant plasmid vector pVNLMTB381101. Similarly, purified amplified product corresponding to Mtb81 gene is digested with Nde I and Mlu I restriction enzymes and mobilized into Nde l-Mlu I sites of linearized and dephosphorylated pVNLEBAP1306 to generate recombinant plasmid vector pVNLMTB811101. The pVNLEBAP1306 is originally derived from plasmid pETlla and is a source of T7-lac promoter for efficient control of expression, synthetic DNA carrying Mlu I restriction site, sequence encoding six Histidine residues followed by a stop codon. The details of restriction of the amplified products corresponding to 38-kDa and Mtb81 mycobacterial proteins and their subsequent cloning in E. coli plasmid vectors to generate recombinant plasmid vectors pVNLMTB381101 and pVNLMTB811101 is provided in EXAMPLE 1.
The recombinants are sequenced using primers corresponding to T7 promoter and T7 terminator for 38-kDa, Mtb81 , ESAT6, CFP10, MTC28 and 14-kDa antigens coding sequence using Big dye terminator chemistry and automated DNA sequencer, (ABI Prism 3100) as is discussed in EXAMPLE 5 .

Expression and sub-cellular localization of recombinant antigenic proteins of Mycobacterial species.
E. coli cells are transformed with pVNLMTB381101 and the plates are incubated at 30°C for 4 h and then at RT (room temperature; 25°C) for 24 hours as discussed in EXAMPLE 2.Transformed cells from six 100 mm plates (approximately 2000 colonies) are recovered and inoculated in 1 litre LB medium containing 100 ug/ml ampicillin and grown at 18°C with vigorous shaking. At an OD 600 nm of 1.0-1.2, IPTG (final concentration 0.25 mM) is added to induce protein expression and the incubation is continued for 6 h at 18°C as given in EXAMPLE 2.
After induction, the culture is chilled over ice and cells are harvested by centrifugation at 4000x g for 10 min at 4°C as detailed in EXAMPLE 2. For the expression of Mtb81 antigen, E. coli BL21 (A.DE3) cells are transformed with pVNLMTB811101 and the plates are incubated at 30°C for 16 h according to EXAMPLE 2. E.coli strains such as TGI, Novasene(λ,DE3), XL-1, Topl0 can also be used for transformation to express the recombinant proteins of Mycobacterium species. Transformed cells from six 100 mm plates (approximately 2000 colonies) are inoculated in 1 litre LB medium containing l00µg/ml ampicillin and grown at 30°C with vigorous shaking. At an OD 600 nm of 0.8-1.0, the expression of protein is induced for 3h by adding IPTG to a final concentration of 0.25 mM. Similarly, various compounds such as arabinose, lactose, galactose, tryptophan, tetracycline derivatives can be used as inducer for the expression of the recombinant proteins. After this the culture is chilled over ice and cells are harvested according to EXAMPLE 2.
The recombinant plasmid vectors namely, pVNLMTBCFPlOHOl, pVNLMTC284102 and pVNLMTB141101 are transformed in E. coli and grown at 30°C as described above for 38-kDa antigenic protein. The plasmid pVNLMTB381101, similarly, is transformed in E. coli cells and grown at 18°C as described above for Mtb81 antigenic protein. The cultures are grown at respective temperatures both before and after the induction with the inducer.
E. coli cells harboring recombinant plasmid pVNLMTB381101 expressed a recombinant protein of 38- kDa upon IPTG induction (Fig. 1A, lane 2) which corresponds to the calculated molecular weight of 38-kDa antigen. The expressed protein constitutes more than 20 % of the total cellular protein. The cells are broken by

sonication and the lysate is subjected to differential centrifugation. Initially, the culture is grown at 37°C and then at 30°C when the expressed protein gets localized. More than 90 % of the protein is found present in HSP (22,000 x g pellet) and negligible amount is present in HSS which further pellets out upon centrifugation at ultra-high speed (100,000x g) (data not shown). It is well documented that lowering of growth temperature leads to enhanced solubility and reduces aggregation of heterologous proteins expressed in E.coli [23]. A large proportion of 38-kDa antigen expressed at 18°C is localized in the HSP (22,000 x g pellet; Fig. 1 A, lane 4) but significant amount is also found in HSS (22,000x g supernatant; Fig. 1A, lane 3) indicating that a large amount of protein is expressed as aggregate. HSS contains soluble 38-kDa antigen along with other cellular proteins. Further, fractionation of HSS at ultra-high speed (100,000x g) reveals that a substantial amount of 38-kDa protein is localized in the supernatant (Fig. 1A, lane 5).
The E. coli) cells harboring recombinant plasmid pVNMTB811101 expresses a recombinant protein of 80-kDa upon IPTG induction at 30°C. The expressed protein constitutes approximately 20 % of the total cellular protein (Fig. IB, lane 2). Cellular localization by differential centrifugation shows that almost 100 % of the expressed Mtb81 protein is localized in 22,000 x g supernatant (HSS; Fig. IB, lane 3) and further in the 100,000 x g supernatant (UHSS; Fig.lB, lane 5) indicating that Mtb81 is completely soluble when expressed in E. coli.
For detailed description of E. coli harboring recombinant plasmid vectors
pVNLMTBCFPl0H0l, pVNLMTC284102, pVNLMTB141101 and
pVNLMTB381101, the expression and sub-cellular localization is provided in EXAMPLE 6.
Purification of recombinant antigenic proteins
Purification of the recombinant proteins is carried out at 4-8°C using chromatography columns attached to FPLC or AKTA system (Amersham Biosciences, Uppsala, Sweden). A three-step protocol consisting of Ni-NTA affinity chromatography (Ni-NTA column, Amersham Biosciences (Uppsala, Sweden), anion-exchange and gel filtration chromatography is performed to purify both 38-kDa and Mtb81 antigens. The details on the three step purification strategy are provided in EXAMPLE 4.

On Ni-NTA column, 38-kDa antigen binds tightly while majority of the other proteins elutes at 20 mM Imidazole. The 38-kDa antigen is eluted with 125 mM imidazole as a sharp peak (data not shown). The SDS-PAGE analysis of various fractions shows that 125 mM imidazole eluate contains 38-kDa antigen as the major protein with some high and low molecular weight contaminants (Fig. 1A, lane 7). The Ni-NTA eluate (15 ml) is desalted on Sephadex G-25 column and subjected to anion-exchange chromatography. The elution is carried out by a linear gradient of NaCl and protein elution is monitored for absorbance at 280 nm and fractions (4 ml) are analyzed by SDS-PAGE. A major protein peak elutes between 150-250 mM NaCl concentration (Fig. 2A). SDS-PAGE shows that fractions 7 to 14 contain a protein corresponding to 38-kDa antigen (data not shown). The majority of high and low molecular weight contaminants are removed (Fig. 1A, lane 8). The fraction 13 and 14 contain small molecular weight contaminants. Fractions 8-12 are pooled and concentrated using YM-30 membrane to 10 ml. The concentrated protein is loaded on Sephacryl S-200 gel filtration column to remove any aggregated protein or small molecular weight contaminants. The elution profile shows a symmetrical peak (Fig. 2B). SDS-PAGE analysis shows that fractions 71-78 contain a single band corresponding to 38-kDa antigen without any visible contaminant. The fractions 71 to 76 are pooled. The protein concentration is measured by absorbance at 280 nm and 10 mg of highly pure 38-kDa antigen is obtained from 2 litre of culture. The analysis of this purified preparation on TSK G3000-SW gel filtration column shows that the preparation contains only monomelic 38-kDa antigen.
The Mtb81 antigen is also purified using a similar 3-step protocol. On Ni-NTA column the Mtb81 antigen binds tightly. SDS-PAGE analysis shows that the 20 mM Imidazole eluate contains contaminants and very small quantity of protein corresponding to Mtb81 antigen (data not shown). The majority of Mtb81 antigen elutes at 125 mM imidazole and contains little amount of small molecular weight contaminants (Fig.IB, Lane 7). On anion exchange chromatography, the absorbance profile shows a single peak between 200-270 mM NaCl (Fig. 3A). SDS PAGE analysis shows that Mtb81 antigen elutes in fraction 18-24 with some bands of faster mobility. Fractions 18-22 are pooled (Fig.IB, Lane 8) and after concentrating on YM-30 membrane, are subjected to Sephacryl S-200 gel filtration chromatography. The elution profile at 280 nm shows a small peak (Fraction 50-53) followed by a large symmetrical peak (Fraction 54-64) (Fig.

3B). SDS-PAGE analysis shows that the fractions 50-53 contain a protein corresponding to Mtb81 antigen similar to one present in fractions 54-64 (data not shown). This result suggests that the small peak contained multimerised Mtb81 antigen. The fractions 55-63 are pooled and the protein content is estimated using Bradford's reagent. The total yield of >95 % pure monomelic Mtb81 antigen (Fig. 1B, lane 9) was 40 mg from 1 litre culture. The purified protein is analyzed on TSK G3000-SW gel filtration column (see EXAMPLE 4) to show that the preparation is found only as monomeric Mtb81. The N-terminal sequence of purified 38-kDa antigen is GSKPPSGS and of Mtb81 antigen is TDRVSVGNL. This is in accordance with the DNA sequence of the clones and indicates that the initiator methionine residue has been cleaved.
The purification of ESAT6, CFP10, MTC28 and 14-kDa proteins is described in EXAMPLE 6. Other antigens or proteins of Mycobacterium species such as TPX, TBI6.3, MTB48, ICDI, ICDII, MPT32, MPT51, MPT63, MPT70, 19-kDa, SODA, and Glutamine synthase expressing recombinant proteins can also be purified using the purification methods described in the examples.
Evaluation of purified recombinant antigenic proteins
The purified 38-kDa, Mtb81, ESAT6, CFP10, MTC28 and 14-kDa recombinant antigenic proteins were used in ELIS A for detecting antibodies in sera of patients with tuberculosis according to EXAMPLE 6. These proteins can be used for sero- diagnosis of tuberculosis described in the art.
i.) Evaluation of purified 38-kDa and Mtb81 recombinant antigenic proteins
Samples from healthy donors are analyzed to calculate mean and standard deviation. The cutoff for positive samples is set at mean +3SD and analysis is also carried out for samples with reactivity more than mean +6 SD. Fig. 4 shows the reactivity of serum samples from various categories of tuberculosis patients. The 38-kDa antigen detected 36 % of samples from pulmonary tuberculosis AFB smear positive patients with large number of the samples showing reactivities more than mean +6 SD. The samples from pulmonary tuberculosis AFB smear negative patients show weaker reactivity with 26 % samples showing reactivity higher than the cutoff and similar results are obtained with sera from patients having extra-pulmonary TB (EPTB) (Fig. 4A). These results are in line with those reported earlier for 38-kDa antigen in different settings [10]. The reactivity of Mtb81 is similar to 38-kDa for samples from pulmonary

tuberculosis AFB smear positive patients. But, Mtb81 detected more samples (50 %) from pulmonary tuberculosis AFB smear negative patients (Fig. 4B). In fact, when both the mycobacterial antigens are coated in the same well the sensitivity of detection of pulmonary tuberculosis smear positive patients increases to about 52 %, whereas, more than 60 % pulmonary tuberculosis smear negative patients can be detected (Fig. 4C). The use of combination of these two antigens (200 ng each) in the same well does not increase the cutoff indicating that both the proteins are highly pure. It is expected that addition of other highly purified mycobacterial proteins would not increase the cutoff value. These results clearly demonstrate the importance of purified antigens in serodiagnosis, and in combination with other mycobacterial antigens; they can result in an assay with high sensitivity and specificity.
ii.) Evaluation of purified ESAT-6, CFP10, MTC28, 14-kDa and a combination of (38-kDA+Mtb81) recombinant antigenic proteins
The detail of the evaluation of purified mycobacterial proteins for serodiagnostic analysis is provided in EXAMPLE 7. It is seen that the four antigens used for sero-diagnosis in this study does not show high sensitivity when used alone but shows an additive sensitivity when used with other antigens such as 38-kDa antigen. It is important to note that highly pure proteins of the present invention show negligible reactivity with normal healthy donors. Therefore, it indicates that a combination of some of these purified antigens along with 38-kDa and Mtb81 antigens increases the sensitivity of detection in various categories of tuberculosis patients.
It will be appreciated by persons skilled in the art that numerous variations and/or modifications may be made to the invention as shown in the specific embodiments without departing from the spirit or scope of the invention as described. The present embodiments are, therefore, to be considered in all respects as illustrative and not restrictive.
EXAMPLES EXAMPLE 1
Isolation of DNA fragments from Mycobacterium tuberculosis
Genes encoding 38-kDa and Mtb81 antigen from Mycobacterium tuberculosis are PCR amplified from the genomic DNA of M. tuberculosis H37Rv. The gene corresponding to 38-kDa genes is amplified without its signal sequence with the first

cysteine at +1, changed to Methionine. The PCR is performed using forward primer (FP1, SEQ ID NO: 1), 5'-GCAGCGGCGCATATGGGCTCGAAACCACCGAGCGG-3', which includes an Nde I site (underlined) and a reverse primer (RP1, SEQ ID NO: 2), 5'-GTCGCGTGGAATTCATTACTGCGCGCTGGAAATCGTCG-3', which includes a Bss HII site (underlined). The gene corresponding to Mtb81 antigen is amplified similarly using a forward primer (FP2, SEQ ID NO: 3), 5'-AGGGAGGAACATATGACAGATCGCGTGTCGGTGG-3'. which creates Nde I site (underlined) and a reverse primer, (RP2, SEQ ID NO: 4) 5'-CACAGCGGACGCGTTACGGGCCGCATCGTCACCGG 3', which creates Mlu I site (underlined).
The PCR reaction mix includes 10 ng of M. tuberculosis H37Rv genomic DNA as template with 2.0 units of Expand high fidelity (HF) from Roche Diagnostics (Mannheim, Germany) in a total volume of 100 ul using standard procedures well known in the art. For amplication of 38-kDa gene, the amplification is carried out with initial heating at 95°C for 4 min followed by 25 cycles of denaturation at 95°C for 30 sec, annealing at 55°C for 30 sec and polymerization at 68°C for 3 min with 2 sec extension in each cycle. The final polymerization is carried out for 5 min. Slight modifications are made in the PCR reaction parameters of Mtb81 gene by increasing the extension time by 2 sec, starting with 4 min, at each subsequent cycle.
Purification of amplified product
The amplified product was purified using Qia-PCR purification kit (Qiagen, Hilden, Germany).
Restriction of the purified amplified products and Cloning in plasmid vector
The purified amplified product corresponding to 38-kDa gene is digested with Nde I and Bss HII restriction enzymes, and mobilized into Nde l-Mlu I sites of linearized and dephosphorylated pVNLEBAP1306 to generate recombinant expression vector pVNLMTB381101. Similarly, purified amplified product corresponding to Mtb81 gene is digested with Nde I and Mlu I restriction enzymes, and mobilized into Nde l-Mlu I sites of linearized and de-phosphorylated pVNLEBAP1306 to generate recombinant plasmid vector pVNLMTB811101. The pVNLEBAP1306 was originally derived from plasmid pETlla and is a source of T7-lac promoter for efficient control of expression,

synthetic DNA carrying Mlu I restriction site, sequence encoding 6 Histidine residues followed by a stop codon.
EXAMPLE 2
Protein Expression
E. coli BL21 (λDE3) cells are transformed with pVNLMTB381101 and the plates are incubated at 30°C for 4 h and then at RT (room temperature; 25°C) for 24 h. Transformed cells from six 100 mm plates (approximately 2000 colonies) are recovered and inoculated in 1 litre LB medium containing 100 ug/ml ampicillin and grown at 18°C with vigorous shaking. At an OD 600 nm of 1.0-1.2, IPTG (final concentration 0.25 mM) is added to induce protein expression and incubation is continued for 6 h at 1°C. After induction, the culture is chilled over ice and cells are harvested by centrifugation at 4000x g for 10 min at 4°C. For the expression of Mtb81 antigen, E. coli BL21 (XDE3) cells are transformed with pVNLMTB811101 and the plates are incubated at 30°C for 16 h. Transformed cells from six 100 mm plates (approximately 2000 colonies) are inoculated in 1 litre LB medium containing 100 (µg/ml ampicillin and grown at 30°C with vigorous shaking. At an OD 600 nm of 0.8-1.0, the expression of protein is induced for 3 h by adding IPTG to a final concentration of 0.25 mM. After this the culture is chilled over ice and cells are harvested.
EXAMPLE 3
Protein Extraction
For extracting soluble proteins, the cells from 1 litre culture are suspended in 50 ml of cold PBS (20 mM sodium phosphate, pH 7.6 containing 140 mM NaCl) containing 0.1 mM PMSF (phenylmethyl sulfonyl fluoride) and the cells are disrupted by sonication (Misonix, Model X L2020). The sonicated cell suspension is centrifuged at 22000x g for 30 min at 4 °C. The pellet and supernatant are labeled as high speed pellet (HSP) and high speed supernatant (HSS), respectively. HSS is again centrifuged at 100,000x g for 1 h at 4°C. The pellet and the supernatant are labeled as ultra high speed pellet (UHSP) and ultra high speed supernatant (UHSS). Various sub cellular fractions are analyzed by SDS-PAGE for localization of recombinant 38-kDa and Mtb81 antigens.

EXAMPLE 4
Purification of His6 tagged 38-kDa and Mtb81 antigen of M. tuberculosis
Purification is carried out at 4-8°C using chromatography columns attached to FPLC or AKTA system (Amersham Biosciences, Uppsala, Sweden). A three-step protocol consisting of Ni-NTA affinity chromatography (Ni-NTA column, Amersham Biosciences (Uppsala, Sweden), anion-exchange and gel filtration chromatography is developed to purify both 38-kDa and Mtb81 antigens. The UHSS (50ml) containing soluble 38-kDa antigen is mixed with DNAase I (5 units per ml UHSS) and RNase A (5 units per ml UHSS) and incubated at RT for 30 min and diluted by adding equal volume of 2x loading buffer (40 mM phosphate buffer, pH 7.6, containing 1 M NaCl) for Ni-NTA chromatography. The sample is filtered through 0.4 (im filter and loaded on a 8 ml Ni-NTA Sepharose Superflow column at a flow rate of 1 ml/min. The absorbance of the eluate is monitored at 280 nm. The column is washed with lx loading buffer till absorbance returns to the base line. This is followed by washing of column with 20 mM imidazole in lx loading buffer. After passing 5 ml of 20 mM imidazole in lx loading buffer, the flow is stopped for 5 min. The washing is continued till absorbance of the flow through returns to the base line. The protein is eluted with 125 mM imidazole in lx loading buffer (elution buffer). For this, first five ml of elution buffer is passed followed by 10 minutes incubation. The elution is continued and fractions of 5 ml are collected. The fractions are analyzed by SDS-PAGE. The fractions containing 38-kDa antigen are pooled (Ni-NTA pool, 15 ml) and subjected to desalting on 60 ml SephadexG-25 column (Amersham Biosciences (Uppsala, Sweden) equilibrated in 20 mM Tris pH 8.5 (Buffer A). The desalted sample (20 ml) is loaded on a 10 ml Q-Sepharose fast flow column (HR 10/10, Amersham Biosciences (Uppsala, Sweden) pre-equilibrated in Buffer A. The column is washed with 20 ml of Buffer A containing 100 mM NaCl at a flow rate of 4 ml/min. The protein is eluted with a 80 ml linear gradient of NaCl (100-500 mM) in Buffer A. The elution is monitored at 280 nm and 4 ml fractions are collected and analyzed by SDS-PAGE under reducing conditions. The fractions containing 38-kDa antigen are pooled (Q-Sepharose pool) and concentrated to approximately 10 ml using stirred cell fitted with YM30 membrane (Millipore, Bedford, USA) and loaded on a 480 ml Sephacryl S-200 column (XK 26/100, Amersham Biosciences, Uppsala, Sweden) equilibrated in PBS. The column is developed with PBS at a flow rate of 1 ml/min. The elution is monitored at 280 nm and 4 ml fractions are collected. The fractions are

analyzed by SDS-PAGE under reducing conditions and fractions containing 38-kDa antigen are pooled.
The Mtb81 antigen is purified using a protocol similar to the one used for the purification of 38-kDa antigen. The Q-Sepharose column is equilibrated in Buffer A and after sample loading the column is washed again with 20 ml of Buffer A at a flow rate of 4 ml/min. The protein is eluted with an 80 ml linear gradient of NaCl (0-500 mM) in Buffer A.
The analysis of the purified recombinant protein purification is performed on TSK G3000-SW gel filtration column (purchased from TOSOHAAS, Japan) to confirm the molecular weight of the purified protein.
EXAMPLE 5
Expression and purification of the other recombinant proteins/antigens of Mycobacterium tuberculosis, namely, ESAT-6, CFP10, MTC28,14-kDa.
i) Expression vectors and cloning of DNA encoding mycobacterial antigens
Two different derivatives of a T7 promoter based plasmid vector are used for cloning of different mycobacterial antigen encoding sequences (Refer Table 1 for details). Each vector carried same backbone which is derived from pET vectors as is described earlier in EXAMPLE 1. The pVNLMTB194102 is similar to pVNLEBAP1306 and carries an Nde l-Eco RI insert with Nde I site immediately followed by Mlu I site, sequence encoding 19-kDa antigen of M. tuberculosis, Bss HII site, sequence encoding hexahistidine tag, translational stop (TAA) and Eco RI site. This vector is used for cloning a gene as Mlu l-Bss HII or Nde l-Bss HII insert for expression of protein with C-terminal (His)6 tag. This vector encodes extra amino acids MNAS at the N terminus and amino acids GAQ in between the insert-encoded protein and the hexahistidine tag. The plasmid pVNLDl 101 carries a Nde l-Eco RI insert having Nde I site, sequence encoding D protein of bacteriophage, Mlu I site followed by codons for six histidine residues, translational stop and Eco RI site. This vector is used for cloning DNA fragments as Nde I- Mlu I inserts for expression of proteins with C-terminal (His6) tag. This vector encodes only initiator methionine at the N terminus and amino acids NAS in between the insert-encoded protein and the hexahistidine tag. Therefore, for high levels of expression of recombinant proteins, low copy number T7 promoter based vectors have been used. The design of our vectors has been further improved for cloning inserts as Mlu l-Bss HII

or Nde I- Bss HII or Nde l-Mlu I fragments. Mlu I and Bss HII being compatible sites will ease cloning to create chimeric antigens and reduce the cost of production.
DNA encoding various mycobacterial antigens are amplified by PCR using primer pairs which created two different cloning sites as shown in the Table 1. The PCR reaction contained 10 ng of M. tuberculosis H37Rv genomic DNA as template in a total volume of 100 ul with 2.0 U of Expand HF enzyme. The amplification was carried out with initial heating at 95°C for 4 min followed by 25 cycles of denaturation at 95°C for 30 sec, annealing at 55°C for 30 sec and polymerization at 72°C for 1 min with 2 sec extension in each cycle. The final polymerization is carried out for 3 min. Each PCR product after purification using QiaPCR purification kit is digested with appropriate enzymes and cloned in respective T7 promoter based expression vector (Refer Table 1 for details). The resultant recombinants are characterized by restriction enzyme digestion and DNA sequencing using T7 promoter and T7 terminator primers using Big dye terminator chemistry and automated DNA sequencer (ABI Prism 3100).
ii) Protein Expression and Localization
Escherichia coli BL21 (1DE3) cells are transformed with various recombinant plasmid vectors, pVNLMTBCFPl0110l, pVNLMTC284102 and pVNLMTB141101. The transformed cells are grown at 30°C as described earlier for pVNLMTB811101 (EXAMPLE 2) while pVNLMTBESAT64102 transformed cells were processed at 18°C as described for pVNLMTB381101 (EXAMPLE 2). The cultures were grown at respective temperatures both before and after the induction with IPTG. For extracting soluble proteins, the cells from 1 litre culture are suspended in 50 ml 1 X LB (20 mM sodium phosphate, pH 7.6, containing 500 mM NaCl) containing 0.1 mM PMSF (phenylmethyl sulfonyl fluoride) and the suspension is frozen overnight at -80°C. The suspension is thawed over ice and lysozyme (20mg dissolved in 1 ml lxLB) is added followed by incubation for 30 min on ice to reduce the time of sonication. The cells are broken by sonication (Misonix, Model XL 3000). The sonicated cell suspension is mixed with DNase I (5 U/ml suspension) and RNase A (5 U/ml suspension) and incubated for 1 hour at 4°C and processed to obtain various subcellular fractions including High speed supernatant (HSS, 20,000 x g supernatant) and Ultra high speed supernatant (UHSS, 100,000 x g supernatant). The various sub-cellular fractions were analysed by SDS-PAGE for localization of recombinant mycobacterial antigens.

iii) Purification of Mycobacterial antigens
Purification was carried out at 5-8°C using chromatography columns attached to AKTA system (GE-Amersham Health Sciences, Uppsala, Sweden). For ESAT-6, 25 ml UHSS (equivalent to 500 ml culture) was diluted by adding equal volume of lx LB containing 40 mM imidazole and filtered through a 0.22 µm filter. The solution was loaded at 1 ml per min on 1 ml HisTrap column equilibrated in lx LB containing 20 mM imidazole. Following loading, the column was washed with 20 ml of 40 mM imidazole in lx LB to remove unbound proteins. The bound ESAT6 was eluted with 150 mM imidazole in lx LB. For this, 1 ml of 150 mM imidazole was passed followed by 5 min incubation. The elution was continued and fractions of 1ml were collected. The column was then washed in reverse direction with 8 ml 500mM imidazole in lx LB and fractions of 4 ml were collected. The fractions were analyzed by SDS-PAGE. The fractions containing ESAT-6 were pooled (HisTrap pool, 4 ml) diluted by adding 2 ml Buffer A (20mM Tris, pH 8.0) and desalted on a 22 ml Sephadex G-25 (fine) column (HR16/10) pre-equilibrated in Buffer A. The desalted sample (7 ml) was loaded on a 4 ml Source 30Q column (Tricon 10/50) pre-equilibrated in Buffer A. The column was washed with 8 ml of Buffer A and 4 ml fractions were collected. The protein was eluted with a 40 ml (10 CV) linear gradient of NaCl (0-500 mM) in Buffer A. The elution was monitored at 280 nm and fractions of 1 ml were collected and analysed by SDS-PAGE under reducing conditions. The fractions containing ESAT-6 were pooled (Source 30Q Pool) and loaded on a 480 ml Superdex 75 column (XK 26x100) equilibrated in PBS (20 mM sodium phosphate, pH 7.2, containing 140 mM NaCl). The column was developed at a flow rate of 2ml/min. The elution was monitored at 280 nm and 2 ml fractions were collected. The fractions were analysed by SDS-PAGE and fractions containing ESAT-6 were pooled (Superdex 75 pool).CFP-10 was purified from 25 ml UHSS (equivalent to 500 ml culture) using a protocol similar to the one used for the purification of ESAT-6, except that the HisTrap column was washed with 20 mM imidazole in IxLB before elution of protein in 150 mM imidazole. MTC28 was purified using 100 ml of UHSS (equivalent to 2 litre culture) and 4 ml 0.5 M imidazole in lx LB was added to UHSS to make final imidazole concentration 20 mM. The sample was loaded on a 2 ml Ni-Sepharose HP column (Tricon 10/20) at 1 ml per minute. Following loading, the column was washed with 30 ml (15 CV) of 40 mM imidazole in lx LB. The bound protein was eluted with 20 ml (10 CV) of 200 mM imidizole in lx LB. For this, 2.0 ml of 200 mM imidazole was

passed followed by 5 min incubation, the elution was continued and fractions of 1 ml were collected. The column was then washed in reverse direction with 12 ml of 500 mM imidazole in lx LB and 4 ml fractions were collected. The desalting on Sephadex G-25 (fine) and chromatography on Source 30Q and Superdex 75 was performed as described for ESAT-6. 14-kDa antigen was purified from 16 ml UHSS (equivalent to 300 ml culture) following a protocol used earlier for 38-kDa antigen which involved Ni-NTA Sepharose superflow (8 ml) and anion exchange chromatography on Q-Sepharose fast flow (8 ml). After anion exchange chromatography the 14-kDa antigen was more than 95% pure and size exclusion chromatography was not performed.
EXAMPLE 6
Serodiagnosis using ELISA
The 96 well micro-titre plates (Maxisorp, Nunc, Roskilde, Denmark) are coated overnight at 4°C with 100 ul of single mycobacterial antigens at 200 ng/ well and a cocktail of antigens at 200 ng each/ well in 0.1 M carbonate-bicarbonate buffer, pH 9.6. This is followed by incubation at RT (25°C) for 2 hours. Plates are then aspirated, blocked with 2 % (w/v) BSA solution in PBS containing 0.1 % Tween-20 (PBST) for 2 h at RT and washed extensively with PBST. Serum samples are diluted 1:100 in PBST containing 0.1 % BSA and 100 Dl of diluted serum is added to antigen-coated wells in duplicate and incubated for 30 min at RT. The plates are washed 6 times with PBST and then incubated with 100 µ1 of 1:10000 dilution of HRP conjugated Goat anti-Human IgG + IgM (Jackson Immuno-research, Pennsylvania, USA), for 30 min at RT. The plates are washed six times with PBST and three times with PBS. 100 JJ.1 of 1 mg/ml ABTS (2, 2'-azino-bis, 3-benzthiazoline-6-sulfonic acid) in phosphate citrate buffer (pH 4.5) containing hydrogen peroxidase (1 µl/mi) is added to the wells for 15 min at RT. The reaction is stopped by adding 100 µl 10% SDS and the optical density at 405 nm is measured with microplate reader (Ceres 900, Biotek, USA). The cutoff values are calculated as the mean of OD 405 nm values obtained with sera from healthy donors plus 3 or 6 standard deviation (SD)( Refer Fig. 4 for details). In Fig. 4 the horizontal solid
( ), dotted lines(—) lines in each panel denote the cut off value determined as mean
OD405, mean OD405 plus 3 SD, and mean OD405 plus 6 SD, respectively, using sera of healthy blood donors. Numbers in the parentheses denote number of samples having reactivity more than mean + 3 SD and total number of samples.

EXAMPLE 7
Evaluation of purified mycobacterial antigens for serodiagnostic potential
Purified ESAT-6, CFP10, MTC28 and 14-kDa antigen of M.tuberculosis were used in ELISA for detecting antibodies in sera of patients with tuberculosis. First samples from healthy donors were analyzed to calculate mean and standard deviation.
(Refer Fig.5 for details). In Fig. 5, the horizontal dotted lines (-—) and solid line ( ) in
each panel denote the mean reactivity and mean reactivity plus 3SD determined for each antigen or antigen combination using sera of 80 healthy blood donors. The number of sample tested is given in Table 2. (•) in ESAT-6, (■) in CFP10, (▲) in 14 KDa, and (x) in MTC28 represent samples not detected by combination of 38kDa and Mtb81 antigens but detected by the respective antigen. The cut off for positive sample was set at mean plus 3SD. In the same assay, samples were also tested for reactivity with a combination of 38-kDa and Mtb81 antigens. Some of the samples were same which were tested earlier with 38-kDa antigen and Mtb81 antigen [13]. Again, it was found that a combination of 38-kDa and Mtb81 antigens was able to detect 50, 68 and 29 percent samples from pulmonary tuberculosis AFB smear positive, AFB smear negative and extra-pulmonary tuberculosis patients, respectively (Table 2). The four antigens described in this paper did not show high sensitivity with sera from different categories of TB patients. However, each of the four antigens detected several samples which were not detected by a combination of 38-kDa and Mtb81 antigens. The previous literature also suggests that the four antigens selected in this study do not show the high sensitivity when used alone but shows an additive sensitivity when used with other antigens such as 38-kDa antigen [13]. It is important to note that highly pure proteins obtained in this study show very low reactivity with normal healthy donors. Therefore, it can be inferred that a combination of some of these newly purified antigens along with 38-kDa and Mtb81 antigens should increase the sensitivity of detection in various categories of tuberculosis patients without jeopardizing the specificity.
Further it will be recognized that the compositions and procedures provided in the description can be effectively modified by those skilled in art without departing from the spirit of the invention embodied above.

REFERENCES
[1]. World Health Organization. The current global situation of the HIV/AIDS pandemic.
Wkly. Epidemiol. Rec. 69 (1994) 191-192.
[2], J. Foulds, R. O'Brien. New tools for the diagnosis of tuberculosis: the perspective of
developing countries. Int J Tuberc Lung Dis 2 (1998) 778-83.
[3]. Centers for Disease Control and Prevention. Guidelines for preventing the
transmission of Mycobacterium tuberculosis in health care facilities. Morbid. Mortal.
Weekly Rep. 43 (1994) 64-65.
[4]. K. James. Immunoserology of infectious diseases. Clin Microbiol Rev 3 (1990) 132-
52.
[5]. K. Lyashchenko, C. Manca, R. Colangeli, A. Heijbel, A. Williams, M. L. Gennaro.
Use of Mycobacterium tuberculosis complex-specific antigen cocktails for a skin test
specific for tuberculosis. Infect Immun 66 (1998) 3606-10.
[6]. A. Campos-Neto, V. Rodrigues-Junior, D. B. Pedral-Sampaio, E. M. Netto, P. J.
Ovendale, R. N. Coler, Y. A. Skeiky, R. Badaro, S. G. Reed. Evaluation of DPPD, a single
recombinant Mycobacterium tuberculosis protein as an alternative antigen for the Mantoux
test. Tuberculosis (Edinb) 81 (2001) 353-8.
[7]. E. D. Chan, L. Heifets, M. D. Iseman. Immunologic diagnosis of tuberculosis: a
review. Tuber Lung Dis 80 (2000) 131-40.
[8]. American Thoracic Society. The tuberculin skin test. Am. Rev.Respir.Dis. 124
(1981)356-363.
[9]. A. Lalvani, A. A. Pathan, H. McShane, R. J. Wilkinson, M. Latif, C. P. Conlon, G.
Pasvol, A. V. Hill. Rapid detection of Mycobacterium tuberculosis infection by enumeration
of antigen-specific T cells. Am J Respir Crit Care Med 163 (2001) 824-8.
[10]. K. Lyashchenko, R. Colangeli, M. Houde, H. Al Jahdali, D. Menzies, M. L.
Gennaro. Heterogeneous antibody responses in tuberculosis. Infect Immun 66 (1998) 3936-
40.
[11]. R Colangeli, A. Heijbel, A. M. Williams, C. Manca, J. Chan, K. Lyashchenko, M. L.
Gennaro. Three-step purification of lipopolysaccharide-free, polyhistidine-tagged
recombinant antigens of Mycobacterium tuberculosis. J Chromatogr B Biomed Sci Appl 714
(1998)223-35.
[12]. R. L. Houghton, M. J. Lodes, D. C. Dillon, L. D. Reynolds, C. H. Day, P. D.
McNeill, R. C. Hendrickson, Y. A. Skeiky, D. P. Sampaio, R. Badaro, K. P. Lyashchenko, S.
G. Reed. Use of multiepitope polyproteins in serodiagnosis of active tuberculosis. Clin
Diagn Lab Immunol 9 (2002) 883-91.

[13]. M. L. Gennaro. Immunologic diagnosis of tuberculosis. Clin Infect Dis 30 Suppl 3
(2000) S243-6.
[14]. Z. Chang, A. Choudhary, R. Lathigra, F. A. Quiocho. The immunodominant 38-kDa
lipoprotein antigen of Mycobacterium tuberculosis is a phosphate-binding protein. J Biol
Chem 269 (1994) 1956-8.
[15]. M. P. Grobusch, D. Schurmann, S. Schwenke, D. Teichmann, E. Klein. Rapid
immunochromatographic assay for diagnosis of tuberculosis. J Clin Microbiol 36 (1998)
3443.
[16]. J. R. Reddy, J. Kwang, K. F. Lechtenberg, N. C. Khan, R. B. Prasad, M. M.
Chengappa. An immunochromatographic serological assay for the diagnosis of
Mycobacterium tuberculosis. Comp Immunol Microbiol Infect Dis 25 (2002) 21-7.
[17]. M. D. Perkins, M. B. Conde, M. Martins, A. L. Kritski. Serologic diagnosis of
tuberculosis using a simple commercial multiantigen assay. Chest 123 (2003) 107-12.
[18]. R. J. Wilkinson, K. Haslov, R. Rappuoli, F. Giovannoni, P. R. Narayanan, C. R.
Desai, H. M. Vordermeier, J. Paulsen, G. Pasvol, J. Ivanyi, M. Singh. Evaluation of the
recombinant 38-kilodalton antigen of Mycobacterium tuberculosis as a potential
immunodiagnostic reagent. J Clin Microbiol 35 (1997) 553-7.
[19]. R. C. Hendrickson, J. F. Douglass, L. D. Reynolds, P. D. McNeill, D. Carter, S. G.
Reed, R. L. Houghton. Mass spectrometric identification of mtb81, a novel serological
marker for tuberculosis. J Clin Microbiol 38 (2000) 2354-61.
[20]. S. Laal, K. M. Samanich, M. G. Sonnenberg, J. T. Belisle, J. O'Leary, M. S.
Simberkoff, S. Zolla-Pazner. Surrogate marker of preclinical tuberculosis in human
immunodeficiency virus infection: antibodies to an 88-kDa secreted antigen of
Mycobacterium tuberculosis. J Infect Dis 176 (1997) 133-43.
[21]. F. Baneyx. Recombinant protein expression in Escherichia coli. Curr Opin
Biotechnol 10(1999)411-21.
[22]. S. Gupta, K. Arora, A. Gupta, V. K. Chaudhary. Gag-derived proteins of HIV-1
isolates from Indian patients: cloning, expression, and purification of pl7 of B- and C-
subtypes. Protein Expr Purif 21 (2001) 378-85.
[23]. S. Gupta, K. Arora, A. Gupta, V. K. Chaudhary. Gag-derived proteins of HIV-1
isolates from Indian patients: cloning, expression, and purification of p24 of B- and C-
subtypes. Protein Expr Purif 19 (2000) 321-8.
[24]. W. P. Sisk, J. D. Bradley, R. J. Leipold, A. M. Stoltzfus, M. Ponce de Leon, M. Hilf,
C. Peng, G. H. Cohen, R. J. Eisenberg. High-level expression and purification of secreted

forms of herpes simplex virus type 1 glycoprotein gD synthesized by baculovirus-infected
insect cells. J Virol 68 (1994) 766-75.
[25]. M. Singh, A. B. Andersen, J. E. McCarthy, M. Rohde, H. Schutte, E. Sanders, K. N.
Timmis. The Mycobacterium tuberculosis 38-kDa antigen: overproduction in Escherichia
coli, purification and characterization. Gene 117 (1992) 53-60.
[26]. C. V. Smith, C. C. Huang, A. Miczak, D. G. Russell, J. C. Sacchettini, K. Honer zu
Bentrup. Biochemical and structural studies of malate synthase from Mycobacterium
tuberculosis. J Biol Chem 278 (2003) 1735-43.
(Table Removed)
Table 2
(Table Removed)

I/We claim,
1. An improved process for the expression, purification and enhanced recovery of recombinant proteins of Mycobacterium species comprising steps of:
a) amplifying genomic DNA coding for proteins from Mycobacterium species and cloning the amplified DNA in a plasmid vector to obtain recombinant plasmid vector,
b) transforming E. coli cells with the recombinant plasmid vector of step (a) to produce recombinant E. coli cells and growing them at a temperature in the range of about 18 to 37°C for 5 to 8 hours, adding an inducer and allowing them to grow further for 4 to 6 hours at a temperature in the range of about 18°C to 30°C to express recombinant protein,
c) harvesting the recombinant E. coli cells from step (b) and isolating the recombinant protein by conventional methods, and
d) purifying the recombinant protein obtained from step (c) at a temperature range of about 4 to 8°C by affinity chromatography followed by anion exchange chromatography and gel filtration chromatography to obtain enhanced yield of purified recombinant protein in a soluble monomeric form.

2. The process as claimed in claim 1, wherein said Mycobacterium species is selected from a group consisting of M. tuberculosis, M. bovis, M. smegmatis, and M.bovis BCG.
3. The process as claimed in claim 1, wherein in step (a), the amplification of genomic DNA is carried out using a pair of primers selected from a group consisting of SEQ ID NO:l and SEQ ID NO:2, SEQ ID NO: 3 and SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6, SEQ ID NO: 7 and SEQ ID NO: 8, SEQ ID NO: 9 and SEQ ID NO: 10, SEQ ID NO: 11 and SEQ ID NO: 12.
4. The process as claimed in claim 1, wherein in step (a), the plasmid vector is either pVNLEBAP1306 or pVNLMTB194102.
5. The process as claimed in claim 1, wherein in step (a), the recombinant plasmid vector is selected from a group consisting of pVNLMTB811101, pVNLMTB381101, pVNLESAT64102, PVNLCFP101101, pVNLMT284102 andpVNLMTB141101.

6. The process as claimed in claim 1, wherein the recombinant protein is selected from a group consisting of 38-kDa, Mtb81, ESAT-6, CFP10, MTC28, 14-kDa, TPX, TB16.3, MTB48, ICDI, ICDII, MPT32, MPT51, MPT63, MPT70, 19-kDa, SODA and Glutamine synthase.
7. The process as claimed in claim 1, wherein in step (b), the E. coli cells are selected from a group consisting of BL21 (λ.DE3), DH5alpha, TGI, Novasene (λ)E3),XL-l,andTopl0.
8. The process as claimed in claim 1, wherein in step (b), the inducer is selected from a group consisting of Isopropyl-P-D- thiogalactoside, arabinose, lactose, galactose, tryptophan and tetracycline derivatives.
9. The process as claimed in claim 1, wherein in step (b), the concentration of inducer ranges from 0.1 to 2.0mM.
10. The process as claimed in claim 1, wherein in step (b), the recombinant cells after addition of inducer are grown at a temperature of 18 to 20 C.

Documents

Application Documents

# Name Date
1 2077-del-2004-gpa.pdf 2011-08-21
2 2077-del-2004-form-5.pdf 2011-08-21
3 2077-del-2004-form-3.pdf 2011-08-21
4 2077-del-2004-form-2.pdf 2011-08-21
5 2077-del-2004-form-18.pdf 2011-08-21
6 2077-del-2004-form-1.pdf 2011-08-21
7 2077-del-2004-drawings.pdf 2011-08-21
8 2077-del-2004-description (provisional).pdf 2011-08-21
9 2077-del-2004-description (complete).pdf 2011-08-21
10 2077-del-2004-correspondence-others.pdf 2011-08-21
11 2077-del-2004-claims.pdf 2011-08-21
12 2077-del-2004-abstract.pdf 2011-08-21
13 2077-del-2004-Form-2-(06-11-2013).pdf 2013-11-06
14 2077-del-2004-Form-13-(06-11-2013).pdf 2013-11-06
15 2077-del-2004-Correspondence-Others-(06-11-2013).pdf 2013-11-06
16 2077-del-2004-Correspondence-Others-(06-03-2014).pdf 2014-03-06
17 2077-del-2004-GPA-(02-04-2014).pdf 2014-04-02
18 2077-del-2004-Correspondence-Others-(02-04-2014).pdf 2014-04-02
19 2077-del-2004-Correspondence Others-(07-04-2014).pdf 2014-04-07
20 2077-del-2004-Claims-(07-04-2014).pdf 2014-04-07
21 2077-DEL-2004-EDUCATIONAL INSTITUTION(S) [22-12-2021(online)].pdf 2021-12-22

ERegister / Renewals

3rd: 19 Feb 2015

From 25/10/2006 - To 25/10/2007

4th: 19 Feb 2015

From 25/10/2007 - To 25/10/2008

5th: 19 Feb 2015

From 25/10/2008 - To 25/10/2009

6th: 19 Feb 2015

From 25/10/2009 - To 25/10/2010

7th: 19 Feb 2015

From 25/10/2010 - To 25/10/2011

8th: 19 Feb 2015

From 25/10/2011 - To 25/10/2012

9th: 19 Feb 2015

From 25/10/2012 - To 25/10/2013

10th: 19 Feb 2015

From 25/10/2013 - To 25/10/2014

11th: 19 Feb 2015

From 25/10/2014 - To 25/10/2015

12th: 23 Oct 2015

From 25/10/2015 - To 25/10/2016

13th: 21 Oct 2016

From 25/10/2016 - To 25/10/2017

14th: 24 Oct 2017

From 25/10/2017 - To 25/10/2018