Sign In to Follow Application
View All Documents & Correspondence

In Vitro Culture Of Mesenchymal Stem Cells (Msc) And A Process For The Preparation Thereof For Therapeutic Use

Abstract: The present invention provides a method for culturing mesenchymal stem cells using cord blood serum, for therapeutic purposes in regenerative medicine; and in particular the present invention provides the use of these cells in the treatment of Parkinson"s disease, and the present invention has provided proliferation and neuronal differentiation of the MSCs in a xenofree culture system for clinical applications in a simple two step protocol, and the in vivo functional efficacy was tested in Parkinson"s animal model.

Get Free WhatsApp Updates!
Notices, Deadlines & Correspondence

Patent Information

Application #
Filing Date
27 September 2007
Publication Number
24/2010
Publication Type
INA
Invention Field
BIOTECHNOLOGY
Status
Email
Parent Application

Applicants

RELIANCE LIFE SCIENCES PRIVATE LIMITED
DHIRUBHAI AMBANI LIFE SCIENCES CENTRE, R-282, TTC AREA OF MIDC, THANE BELAPUR ROAD, RABALE, NAVI MUMBAI

Inventors

1. PRATHIBHA SHETTY
DHIRUBHAI AMBANI LIFE SCIENCES CENTRE, R-282, TTC AREA OF MIDC, THANE BELAPUR ROAD, RABALE, NAVI MUMBAI-400701
2. CHANDRA VISWANATHAN
DHIRUBHAI AMBANI LIFE SCIENCES CENTRE, R-282, TTC AREA OF MIDC, THANE BELAPUR ROAD, RABALE, NAVI MUMBAI-400701
3. ANIRBAN M. THAKUR
DHIRUBHAI AMBANI LIFE SCIENCES CENTRE, R-282, TTC AREA OF MIDC, THANE BELAPUR ROAD, RABALE, NAVI MUMBAI-400701
4. GEETA RAVINDRAN
DHIRUBHAI AMBANI LIFE SCIENCES CENTRE, R-282, TTC AREA OF MIDC, THANE BELAPUR ROAD, RABALE, NAVI MUMBAI-400701

Specification

FORM 2
THE PATENTS ACT, 1970
(39 of 1970)
PATENT OF ADDITION
(See Section 54)
In vitro culture of mesenchymal stem cells (MSC)
and a process for the preparation
thereof for therapeutic use.
RELIANCE LIFE SCIENCES PVT.LTD.
an Indian Company having its Registered office at
Dhirubhai Ambani Life Sciences Centre,
R-282, TTC Area of MIDC,
Thane Belapur Road, Rabale,
Navi Mumbai - 400 701
Maharashtra India.
The following specification particularly describes and ascertains the nature of this invention and the manner in which it is performed:


CROSS REFERENCE TO \RELATED APPLICATIONS
This application is a patent of addition to Indian Application number 532/MUM/2003 filed on 26th May 2003.
FIELD OF THE INVENTION:
The present invention provides a method for culturing mesenchymal stem cells using cord blood serum, for therapeutic purposes in regenerative medicine. The present invention in particular provides cultured mesenchymal stem cells for neural regeneration and its potential use in the therapy of Parkinson's disease, spinal cord injury in animal models and other neurodegenerative diseases.
BACKGROUND OF THE INVENTION:
Bone marrow derived Mesenchymal stem cells (MSCs) are a unique population of stem and multipotent progenitor which can be obtained in quantities appropriate for clinical applications, making them good candidates for use in tissue repair. Bone marrow derived mesenchymal stem cells (BMMSC) is a valid definitive candidate for repair of damaged tissues in degenerative disorders in general and neurological diseases in particular. Neural and embryonic stem cells are extremely versatile but still face several known challenges. In sharp contrast, MSCs have unique plasticity, accessibility and immunosuppressive properties. Translational research needs attention in areas such as up scalability, stability, free from usage of animal products and regulatory compliance, which are soon to be implemented. Techniques for isolation and expansion of mesenchymal stem cells in culture have been established.
Cell replacement therapy aims at grafting therapeutically relevant cells to impaired tissues and has been proposed as future therapies for neurodegenerative disorders. It is well known that neurological diseases like Parkinson's disease (PD), Spinal cord injury, Multiple sclerosis, Alzheimer's disease, Stroke etc. are caused mainly due to the progressive loss of functional cells as a result of either aging, injury besides other several postulated causes. Spontaneous neural tissue repair is known to take place in patients


affected by inflammatory and degenerative disorders to a smaller or greater degree. However, this process is not robust enough to promote a functional and long term remission. The list of related art and information is referred at the end to hereinafter by reference to the listing numbers.
Recent studies have shown that tissue specific stem cells possess wider transdifferentiation potential than previously thought and can encompass heterologous lineages. There are many reports confirming the neuronal potential of stem cells isolated from adult somatic tissues such as bone marrow [1]; hair follicle [2]; amniotic fluid [3]; inner ear [4]; and cornea [5]. BMMSCs (Bone marrow mesenchymal stem cells) are a favorite of stem cell researchers with respect to the transdifferentiation potential especially towards neuronal lineage. [Herman et al 2004, 28, 7, 12]. Cytokines, growth factors, neurotrophins, and retinoic acid have been used to promote neural cell induction and differentiation both in vivo and in vitro. Woodbury et al. (see Reference No. 10) have reported usage of chemicals in both rodent and human MSCs for neuronal differentiation in vitro [20, 29]. The majority of these exhibited a neuronal morphology and expressed several neuronal markers like NSE (neuron specific enolase), neurofilament-M, taua, and NeuN [10].
Amongst the various neurological disorders, PD is a chronic, progressive
neurodegenerative movement disorder. Tremors, rigidity, slow movement
(bradykinesia), poor balance, and difficulty in walking (called parkinsonian gait) are major characteristic symptoms of Parkinson's disease. Parkinson's disease results from the degeneration of dopamine-producing nerve cells in the brain, specifically in the substantia nigra and the locus coeruleus. The disease burden is reported to be huge. Approximately 5-6 million people are affected globally. The prevalence varies widely from 82 per 100,000 in Japan and 108 per 100,000 in UK, to nearly 1% (approximately 1 million) of the population in North America. In India, however the prevalence rate of Parkinson's disease is highest in the Parsi community in Western India. (363 per 100,000) followed by other parts of the country which is 14 per 100,000 in North India, 27 per 100,000 in South India, 16 per 100,000 in East India.


PD is a neurodegenerative disorder characterized by loss of midbrain dopaminergic neurons in the substantia nigra. It is well known that L-dihydroxyphenylalanine (L-DOPA) can attenuate motor dysfunctions, but long-term efficacy of this treatment gradually decreases over time with multiple side effects. Cell replacement therapy to restore the degenerated dopaminergic neurons may serve as a viable alternative to achieve significant clinical improvement. Cell-based therapies derived from fetal or embryonic origin have been tested with questionable success. Yet, technical, ethical, practical, limited availability, variable outcomes, continue to be the researcher's nightmare [6].
Under these circumstances, adult stem cells could be an ideal source for cell replacement therapy due to their self-renewal and multilineage developmental potentials. Because of their unique attributes of plasticity and accessibility, BMMSCs are a definite alternative to neural or embryonic cells in replacing autologous damaged tissues for several neurodegenerative diseases. By harnessing the neuronal potential of readily available and accessible adult bone marrow cells, substantial ethical and technical dilemmas may be circumvented. Recent studies have shown that BMMSCs improve neurological deficits when transplanted into animal models of neurological disorders. The transdifferentiation potential of MSCs into neurons in vitro has been reported earlier [10, 27, Herman et al 2004 28 , 9].
Parkinson's disease is a chronic, a progressive neurodegenerative movement disorder. Tremors, rigidity, slow movement (bradykinesia), poor balance, and difficulty walking (called parkinsonian gait) are characteristic primary symptoms of Parkinson's disease Parkinson's disease results from the degeneration of dopamine-producing nerve cells in the brain, specifically in the substantia nigra and the locus coeruleus Dopamine is a neurotransmitter that stimulates motor neurons, those nerve cells that control the muscles. When dopamine production is depleted, the motor system nerves are unable to control movement and coordination.
While the initial treatment with L-dihydroxyphenylalanine (L-DOPA) can attenuate motor dysfunctions, the long-term efficacy of the treatment gradually decreases over time


with multiple side effects. Cell replacement therapy to replace the degenerated dopaminergic neurons may serve as an alternative to achieve significant clinical improvement. Traditionally, cell-based therapies for the CNS have been derived from fetal or embryonic origin. Fetal cell transplantation has significant technical, ethical and practical problems partly due to limited availability and variable outcomes (G. Freed et al 2001) [6].
Stem cells could be an ideal source for cell replacement therapy due to their self renewal capacity and multilineage developmental potential. Because of their unique attributes of plasticity and accessibility, bone marrow-derived mesenchymal stem cells (MSCs) may serve as a valid alternative to neural or embryonic cells in replacing autologous damaged tissues for neurodegenerative diseases. By harnessing the neural potential of readily-available and accessible adult bone marrow, substantial ethical and technical dilemmas may be circumvented. BMMSCs offer the best hope for autologous stem cell based replacement therapies because of their potency, accessibility and immunosuppressive properties.
They are a unique population of multipotent progenitor cells which can be obtained in quantities adequate for clinical applications, thus making them good candidates for use in tissue repair. There are many reports on the successful isolation and expansion of mesenchymal stem cells in culture including our own earlier publications [21, 20, 25]. Feasibility and safety of the application of BMMSC for clinical use propagated ex vivo in FBS containing cell cultures, has been documented in a significant number of studies over the last decade. (Ringden et al, 2006) [16].
However, the use of FBS (Fetal Blood Serum) during MSC propagation carries the risk of transmission of known and unknown pathogens as well as xenoimmunization, which is an important issue to be addressed [18, 19]. Attempts have been made by several groups for replacing FBS with growth factors derived by mixing purified factors which are either isolated from FBS or a mixture of growth factors derived by recombinant methods. However, these culture media have their associated shortcomings and risks since they are


unable to support MSCs (Mesenchymal stem cells) expansion beyond 2 passages. (Meuleman et al, 2006)[14].
Use of autologous serum in the culture media is a better option for addressing this issue. Mizuno et al (2006) [15] used autologous human serum for expanding BMMSCs for 9 days, which gives limited expansion, not adequate enough for clinical use. This can still be considered a good option in certain limited clinical conditions but in a larger perspective of clinical conditions, obtaining autologous serum in adequate quantities will be a major challenge to the manufacturers. Further the various limitations of the donors such as aging, disease conditions, logistics etc poses challenges on using autologous serum as a better option.
In the previous patent application number 532/MUM/2003, the inventors had demonstrated that culturing of MSC isolated from human Bone Marrow aspirate in the presence of human umbilical cord blood serum instead of FBS promotes more effective expansion and also retains their differentiation capacity. The applicant has previously shown the superiority of using cord blood serum as a xenofree alternative to FBS. Under these circumstances, the inventors could expand MSC with no undesirable effect whatsoever on transdifferentiation and stability in cultures for more than 5 passages. The applicant therefore could generate large quantities of BMMSCs that meets the clinical requirements.
The present application provides the use of CBS (Cord Blood Serum) for expansion by approved validated protocols. CBS is processed as per available regulatory guidelines in controlled cGMP environment, using excipients that can satisfy quality parameters. The present invention also intends to provide that bone marrow derived MSC cultured under xeno free conditions continued to maintained the mesenchymal surface marker expression and displayed a typical mesenchymal phenotype CD73+ /CD105+ /CD44+ /CD29+ /SSEA4+ /CD45-/CD31-/vWF-/CD14-.
Further, the present invention could efficiently induce these cells to differentiate into dopaminergic neurons in vitro in the presence of neurotrophic factors and chemical


inducers DMSO/BHA. Thus the therapeutic potential of expanded MSCs in vivo were assessed by transplanting into the brains of Parkinson's disease models in an attempt to reestablish dopamine dependent motor behavior. The therapeutic potential of these expanded MSCs in spinal cord injury was also evaluated.
OBJECTIVE OF THE INVENTION
It is the objective of the present invention to provide process conditions for proliferation of BMMSCs using xeno free media
It is the objective of the present invention to check the differentiation capacity of the BMMSCs cultured in CBS in a regulated environment and assess their in vitro and invivo neurogenic potential.
It is the objective of the present invention to study the genotypic, phenotypic and functional properties of CBS cultured and expanded BMMSCs.
It is the object of the present invention to assess the therapeutic potential of the CBS cultured BMMSC in Parkinson's' diseases.
SUMMARY OF THE INVENTION
The present invention has shown that BMMSCs expanded in presence of medium containing CBS maintain their neural differentiation potential in vitro and also have the ability to show functional improvement after transplantation in PD rat brains, thus making it useful for infusion into humans making it important in the field of regenerative medicine.
In one aspect, the present invention has provided methods for expanding the bone marrow derived MSCs under xeno free conditions. We analyzed the proliferative potential of BMMSCs and confirmed the phenotype by flow cytometry.


In another aspect, the present invention has provided methods for characterization of the bone marrow derived cells cultured in CBS. In one preferred aspect the present invention has provided the genotypic, phenotypic and functional characterization of the cells.
In one aspect the present invention has provided methods of assessing the differentiation capacity of the xenofree cultured BMMSCs. In a preferred aspect, the Differentiation was induced by neuronal induction media supplemented with Butylated hydroxy anisole, protein kinase activator and growth factors such as NGF (Nerve growth factors) and Noggin. Differentiated cells were characterized at cellular and molecular levels
In one aspect, the present invention provides methods for demonstrating the invitro and in vivo neuronal potential.
In summary, the present invention demonstrates that BMMSCs are a good potential source for treatment of Parkinson's disease. Since these cells have been grown in CBS they overcome the hurdle of infusion into human for its clinical applications. The present invention has proved an improvement from the parent application 532/MUM/2003 by providing a better and feasible source of serum, which not only allows expansion of MSCs but also maintain and retain into differentiation potential.
Thus the present invention relates to the methods for providing MSCs free of animal components thus proving to be safe for regenerative medicine and cell therapy applications which will help in treatment of a variety of neurological disorders with great deal of clinical applications. Functionality was evaluated estimating dopamine secretion. 60HDA lesioned PD models that stereotaxically received clinical grade MSCs were assessed for 3 months.
The present invention thus has demonstrated the dopaminergic differentiation capabilities by BMMSCs cultured in CBS. This was confirmed by the expression of TH at the cellular and molecular level. The measurement of dopamine secreted in the culture supernatant confirms the functionality. In addition to TH, the differentiated cells have


shown positivity for other neuronal markers as well, such as NeuN, NF-70 and btubulin. The results using xenofree media matches well with the observations made by other investigators who worked on different cell types including that from umbilical cord blood stem cells using conventional media [[17] 23, 27, Herman et al 2004 28]. These undifferentiated BMMSCs showed a strong neuronal predisposition as revealed by gene expression studies which was also reported earlier [13].
Further, these cells were checked for its functional efficacy in animal models. The 6-OHDA lesioned PD rat model was created to assess the functional efficacy of the differentiated cells. The animals started showing significant behavioral improvement post transplantation, as evaluated by apomorphine induced rotations. One set of animals after completing 3 months were sacrificed. Their brain sections were analyzed for human cells expressing TH and human nuclei. The results also indicate that the BMMSCs cultured in CBS after injection into a damaged area of the PD rat brain had engrafted and differentiated into functional dopaminergic neurons capable of secreting dopamine and alleviating behavioral deficits. (Data not shown)
In summary, the present invention demonstrates that BMMSCs are a good potential source for treatment of PD. Since these cells have been grown in CBS, they address the issues raised by translational researchers and clinicians alike. Thus, its infusion into humans for its clinical applications can be well considered.
Thus, the present invention recommends a better and a feasible source of serum, which not only allows expansion of BMMSCs but also maintains and retains the neuronal differentiation potential which will go a long way in the field of regenerative medicine and cell therapy applications with MSCs. These cells can treat such neurodegenerative conditions, where the usual concerns of ethics, infectious disease transmissibility, and immunological reactions etc. will be adequately addressed.


Thus the main features of the invention are:
1. the present invention has successfully achieved derivation of clinical grade MSC from bone marrow under cGMP and strict regulatory conditions;
2. the present invention provides proliferation and neuronal differentiation of the MSCs in a Xenofree cell culture system for clinical applications;
3. the present invention provides a simple two (2) step protocol for neuronal differentiation;
4. the present invention provides MSCs differentiated to neurons, which are characterized at the cellular, molecular and functional level;
5. the present invention has analyzed the in vivo functional efficacy in animal models with human diseases created in a GLP accredited facility;
6. the present invention has accessed the survivability and significant functional improvement in PD animal models as early as two (2) weeks post transplantation, the transplanted cells showed the expression of Dopamine specific TH marker;
7. the results of the present invention re-emphasizes the immense potential of the BMMSC derived in a regulated environment as a replacement therapy for neurodegenerative diseases in general, using Parkinson's disease as representative disease condition; and,
8. the present invention demonstrates that autologous derived BMMSCs are the safest and can be the accepted mode of choice for various cell therapy applications to begin with.
To these ends, the present invention consists in the provision of a method of culturing mesenchymal stem cells (MSCs) for therapeutic purposes from mononuclear cell fractions of umbilical cord blood or bone marrow comprising the steps of:
a) plating a mononuclear cell suspension of about 10-10 cells/ml into tissue cultureflasks comprising a culture medium along with 1-50% cord blood serum for 24-72 hours to produce adhered cell cultures;
b) incubation of the adhered cell cultures of step a) at 37°C in 5% CO2 air incubator for at least 7 days; and


c) counting and analyzing the cultured cells for expression of markers selected from CD73+, CD45- and CD 105+ markers.
The aforesaid culture medium comprises a mixture of: Dulbecco's modified Eagle's medium (DMEM) and Ham's F-12 medium in the ratio of 1:1 supplemented with 2mM
glutamine, 3mM sodium bicarbonate and IS-FGF.
The mesenchymal stem cells are obtained from human bone marrow from human cord blood and from swine bone marrow.
The culture medium expands the mesenchymal stem cells.
The invention is also concerned with the use of the method of culturing mesenchymal stem cells as for therapeutic purposes in regenerative medicine and for cardiac disorders, bone, cartilage and neural disorders.
The invention further includes a method of culturing human mesenchymal stem cells (hMSC) for therapeutic purposes in the presence of 1-50% cord blood serum as a replacement for fetal bovine serum in a culture medium comprising Cord Blood Serum in a range of 1-50% of cord blood, and a mixture of: Dulbecco's modified Eagle's medium (DMEM) and Ham's F-12 medium in the ratio of 1:1 supplemented with 2mM glutamine,
3mM sodium bicarbonate and li-FGF.
The method of culturing animal mesenchymal stem cells in a culture medium comprises using Cord Blood serum in a range of 1-50%; and a mixture of: Dulbecco's modified Eagle's medium (DMEM) and Ham's F-12 medium in the ratio of 1:1 supplemented with
2mM glutamine, 3mM sodium bicarbonate and &-FGF.
The use of the method of culturing mesenchymal stem cells as for therapeutic purposes in regenerative medicine and for cardiac disorders, bone, cartilage and neural disorders and


provides for the use of sera separated from umbilical cord for growing the mesenchymal stem calls, in accordance with the following method, comprises plating a mononuclear cell suspension of about 106-107 cells/ml into tissue culture flasks comprising a culture medium along with 1-50% cord blood serum for 24-72 hours to produce adhered cell cultures, incubation of the adhered cell cultures of step a) at 37°C in 5% CO2 air incubator for at least 7 days, and counting and analyzing the cultured cells for expression of markers selected from CD73+, CD45- and CD 105+ markers.
The method for using the mesenchymal stem cells for therapeutic purposes in regenerative medicine and for cardiac disorders, bone, cartilage and neural disorders and provides for the use of sera separated from umbilical cord for growing the mesenchymal stem cells.
BRIEF DESCRIPTION OF DRAWINGS:
The following figures, which are in the form of photographs are part of the present specification and are incorporated to further demonstrate certain aspects of the present invention. The invention may be better understood by reference to these figures in combination with the detailed description presented herein.
Figure 1 Illustrates the growth kinetics and the viability of the BMMSC in xenofree media
Figure la Shows the growth kinetics of the BMMSCs expanded in a xenofree media.
BMMSC showed an 8-10 fold increase in the cell count after expansion in presence of
CBS for a week. The cells could be expanded for 5 passages.
Figure lb Dot plot showing the viability of the expanded BMMSCs.
The viability of the expanded cells was checked at every passage and these cells were
more than 90% viable as checked by 7-Aminoactinomycin D (7AAD) on Flow
cytometry.
Figure 2 Illustrates the Immunophenotyping of the BMMSCs expanded in xenofree media by flowcytometry.


The BMMSCs expanded in CBS media were checked for the cell surface antigen expression for various mesenchymal and haematopoetic markers. The expanded BMMSCs were negative for haematopoeitc marker and strongly expressed mesenchymal markers. The phenotype expressed by the expanded cells was CD73+/CD105+/ CD29+/CD44+/SSEA4 +/HLA ABC+/ HLA DR-/ CD45-/ CD14-/CD31-/vWF-
Figure 3 illustrates the Neuronal differentiation of BMMSCs in xenofree media.
Figure 3a The BMMSCs expanded in xenofree medium grow as monolayer, and these undifferentiated cells show a uniform fibroblast like morphology, which are spindle shaped.
Figure 3b shows upon exposure to a neuronal induction medium in a xenofree media the expanded BMMSCs show a change in morphology, which begins within four hours of induction
Figure 3c shows the condition after four hours when the cytoplasm of the BMMSCs retracts and the cells start acquiring a neuronal morphology with processes.
Figure 3d shows the condition within five hours of neuronal induction the BMMSCs start exhibiting neuronal morphology with processes.
Figure 4 illustrates the characterization of the neuronal differentiation of BMMSCs by immunoflourscence.
The Undifferentiated BMMSCs were checked for neuron specific markers such as Nestin and btubulin and the differentiated BMMSCs were checked for other neuronal markers such as Neurofilment-70 (NF-70), Neuron specific nuclear protein (NeuN), Tyrosine Hydorxylase (TH) and Glial Fibrillary Acidic Protein (GFAP).
Figure 4a shows an expression of Nestin by the undifferentiated BMMSCs. Figure 4b shows an expression of ptubulin by the undifferentiated BMMSCs. Figure 4c shows an expression of NF-70 by the differentiated BMMSCs.


Figure 4d shows an expression of NeuN by the differentiated BMMSCs.
Figure 4e shows an expression of TH by the differentiated BMMSCs.
Figure 4f shows an expression of GFAP by the differentiated BMMSCs
The undifferentiated BMMSCs showed positive staining for Nestin and (3 tubulin and
differentiated cells expressed neuronal specific markers such NF-70, NeuN, TH and
GFAP.
Figure 5 illustrates the Gene expression studies for differentiated BMMSCs to neuronal lineage by Reverse Transcriptase PCR (RT-PCR).
The undifferentiated (UD) and the differentiated cells (D) were checked for neuron
specific genes with NTERA 2D as positive control.
The RT-PCR studies showed that the undifferentiated cells expressed stem cell marker
such as Nanog and neuronal genes such as Nestin and ptubulin.
The differentiated cells expressed neuronal and dopaminergic specific genes specific
genes such as TH, Nurrl& NFM.
Figure 6 illustrates the Measurement of dopamine released into the culture supernatant:
Samples were separated on reverse phase nucleosil C I8 column and detected with an electrochemical detector. Dopamine levels were calculated using external dopamine standards injected immediately before and after each experiment Representative HPLC chromatogram of dopamine released by differentiated BMMSCs along with standard dopamine.
Figure 7 Illustrates the Behavioral analysis of the PD animals injected with BMMSCs expanded in xenofree media.
The PD animals were subjected to apomorphine. The apomorphine-induced rotations were counted per hour in the transplanted and non transplanted animals. The graph shows the comparison of the rotations in the transplanted and non-transplanted animals for 2, 4,6,8,10,12 weeks. The transplanted animals showed a significant


reduction in the rotations after 4 weeks of BMMSC transplantation. The transplanted animals continued to show the significant improvement as the weeks progressed.
Figure 8 Illustrates the Immunohistochemistry of brain sections of PD induced rats after:
(8a) Transverse section of rat brain showing the Dil labeled cells in the injection tract
3 months post transplantation; and (8b) Transverse section of rat brain shows positive staining for both TH (FITC) and
human nuclei (Alexa 568) confirming the human origin of the transplanted cells.
DETAILED DESCRIPTION OF THE INVENTION
The term "umbilical cord blood" or "cord blood" is used throughout the specification to refer to blood obtained from a neonate or fetus, most preferably a neonate and preferably refers to blood, which is obtained, from the umbilical cord or placenta of newborns. The use of cord or placental blood as a source of mononuclear cells is advantageous because it can be obtained relatively easily and without trauma to the donor. Cord blood cells can be used for auologous or allogenic transplantation when and if needed. Cord blood is preferably obtained by direct drainage from the umbilical vein.
The term "cell medium" or "cell media" is used to describe a cellular growth medium in which mononuclear cells and/or neural cells are grown. Cellular media are well known in the art and comprise at least of minimum essential medium plus optional agents such as growth factors, glucose, non-essential amino acids, insulin, transferrin and other agents well known in the art.
The term "non adherent cells" is used to describe cells remaining in suspension in the tissue culture flask at the end of the culture period. The term "adherent cells" is used to describe cells that are attached to the tissue culture plastic, and are detached from the flask by addition of enzyme free cell dissociation buffer from Gibco-BRL or by addition of trypsin-EDTA.


The term "mononuclear cells" is used to describe cells containing a single nucleus isolated from bone marrow (BM) or Umbilical Cord Blood (UCB) using a density gradient of FICOLL ™ or PERCOLL ™ Mononuclear cells are obtained from bone marrow or umbilical cord blood and are used as a source of Mesenchymal Stem Cells.
As used herein the term "confluent" indicates that the cells have formed coherent cellular monolayer on the surface so that virtually all-available surface is used leading to inhibition of cell proliferation.
In the present invention growth factors is selected from the group consisting of Epidermal growth factor (EGF), Nerve growth factor (NGF), Fibroblast Growth Factor (FGF), Transforming growth factor-B (TGF-B) either singly or in a combination thereof.
In the present invention, culture media is selected from the group consisting of Dulbecco's modified Eagle's medium, (DMEM), Hams F-12 medium, Iscoves modified Dulbeccos medium (IMDM), Roswell Park Memorial Institute medium (RPMI)
The term "Bone marrow derived mesenchymal stem cells" as used herein refers to the mesenchymal stem cells derived from the mononuclear fraction of the bone marrow and is characterized by the expression of CD markers CD73+ /CD 105+ /CD44+/ CD29+ /SSEA4+/CD45-/CD31-/vWF-/CD14-. These MSC were negative for MHC class I but expressed MHC class II.
The marrow or isolated MSC can be autologous, allogeneic or from xenogeneic sources, and can be embryonic or from post-natal sources. Bone marrow cells may be obtained from iliac crest, femora, tibiae, spine, rib or other medullary spaces. Other sources of MSC include Fat, Periosteum, Skin, and Skeletal muscle, Liver, Placenta, Blood and Umbilical Cord.
The parent application 532/MUM/2003, which is incorporated herein by reference, showed that mesenchymal stem could be cultured and expanded in medium containing CBS. The present invention has shown the neural differentiation of BMMSC expanded


in CBS and its in vivo functionality for Parkinson's disease and Spinal cord injury in
animal models.
The following steps are involved in the process for derivation of MSCs:
1. isolation of mononuclear cell fraction from the bone marrow by density gradient separation;
2. plating of the cells in culture media for expansion;
3. expansion of the adherent cell cultures till they are confluent;
4. harvesting the cells;
5. characterization of the cells; and
6. analysis of the differentiation potential into neural cells in vitro and invivo.
1. Cell isolation
The bone marrow sample is diluted appropriately with PBS. The diluted sample is subjected to density gradient separation using Percoll to obtain mononuclear cells. The mononuclear fraction is plated in cell culture cassettes in MSCGM for expansion of MSC.
2. Expansion
The mononuclear cells recovered are washed with PBS and resuspended in the medium in cell culture cassettes. After forty-eight hours the nonadherent cells are removed and plated into another cell culture cassette. The cells adhere and form colonies, which grow and become a confluent layer. Medium is changed every alternate day until the cells become confluent.
3. Harvesting
Once confluent the cells are harvested using a dissociation buffer to obtain single cells. The washes during the harvest are tested for sterility, bioburden and endotoxin. An aliquot of cells are tested for viability and biomarker expression. The expanded and harvested cells will be placed in transport media in 1,8ml cryovial and frozen in a control rate freezer to -90°C and then stored in liquid nitrogen tank.


4. Expansion and Characterization of Bone marrow derived MSC cultured in
medium containing CBS.
MSCs obtained from human bone marrow were successfully cultured and expanded in medium containing CBS under cGMP conditions. At the passage one, cultures consisted of heterogeneous cells. At passage four, MSC grew as a monolayer of adherent fibroblast like cells and showed a twenty-fold increase in expansion. Furthermore, the results from flow cytometry indicated that undifferentiated MSCs exhibited the positive labeling to mesenchymal markers with CD29, CD 105, CD44, CD73 but negative staining to hematopoeitc and endothelial markers (Fig. 2). These cells showed 90% purity in terms of MSC antigen expression and viability and expressed a phenotype of CD73+/CD105+/CD44+/CD29+/SSEA4+/CD45-/CD31-/vWF-/CD14-. These MSC were negative for MHC class I but expressed MHC class II.
5. Neuronal differentiation and characterization
Neuronal differentiation was initiated culturing the undifferentiated MSC neuronal pre induction medium containing neurotropic factors and CBS. After one week of culture in neuronal induction medium, the cytoplasm of the cells retracted towards the nucleus. Upon exposure to DMSO/BHA, most cells presented the neuronal morphology including a small cell body and long extensions. To confirm that MSCs differentiated along neuronal lineages we examined the expression of neuronal markers in the cells by immunofiourescence and RT PCR. Immunoflorescence analysis demonstrated that differentiated cells expressed neuronal specific surface markers such as NeuN, NF-70, TH, BT, Nestin and GFAP. Undifferentiated MSC were found Nestin, which was further confirmed by gene expression studies indicating a neural predisposition. RT PCR revealed the expression of characteristic neuronal markers Nestin, NF-H, p tubulin, NF-M, and dopaminergic markers TH ,Nurrl. Except for the neuronal markers we also targeted GFAP, a glial marker. GFAP. The number of GFAP positive cells was low. Undifferentiated MSC also expressed OCT4, the pluripotent stem cell marker. We further evaluated the functional properties of differentiated MSC by RP-HPLC. We found that detectable level of dopamine (1.93ug/ml) was secreted by the differentiated neurons in to the culture supernetent as compared to undifferentiated MSC (Table 2).


6. In vivo differentiation and function of MSCs post transplantation
We next examined in vivo survival, differentiation and function of the undifferentiated MSCs expanded under xeno free and cGMP conditions after transplantation into the substantia nigra of Parkinsonian rats. The Parkinson's disease rat model was created by injecting 6-hydroxydopamine (6-OHDA) into the substantia nigra. The motor abnormality in the PD rat was evaluated by examining rotational behavior in response to apomorphine injection. We selected rats that exhibited stable deterioration of motor functions and showed >10 ipsilateral circling per min for cell transplantation. About 0.2 million of MSCs /rat were transplanted into the substantia nigra of rat model of Parkinson's disease six weeks after lesioning. We observed no improvement of motor function during first two weeks post-transplantation, but after four week onwards, rats showed a significant motor improvement and reduced apomorphine-induced rotations. After 12-weeks, post-transplanted animals showed a significant reduction in apomorphine induced rotations. The histology of the grafted area showed that transplanted cells survived in the substantia nigra and differentiated into dopaminergic neurons. In order to confirm transplanted cells were of human origin, double labeling with human nuclei antibody and TH were done. At 12 weeks post transplantation, cells that were immunoreactive with anti human nuclei were found only along the needle tract and within the substantia nigra. There was no indication of cell migration to neighboring brain regions.
Previous studies from our laboratory have shown that culturing of human bone marrow derived Mesenchymal stem cells (MSC) in the presence of human umbilical cord blood serum (CBS) instead of FBS promotes more effective proliferation and also retain their differentiation capacity. In the present study, human bone marrow derived MSC showed a twenty-fold increase in expansion in the presence of CBS over a period of three weeks. These cells showed 90% purity in terms of MSC antigen expression and viability and expressed a phenotype of CD73+/CD105+/CD44+/CD29+/SSEA4+/CD45-/CD31-/vWF-/CD14-. These MSC were negative for MHC class I but expressed MHC class II. They were induced to differentiate into dopaminergic neurons in vitro by culturing in Neuronal


induction media supplemented with antioxidant DMSO, protein kinase activator Butylated hydroxy anisole, and growth factors NGF, Noggin that promotes neuronal differentiation. .Upon neuronal induction, they expressed proteins specific to neurons as evidenced by immunoreactivity to NeuN, Nestin, Neurofilament-70, p tubulin, GFAP and dopaminergic specific marker TH. These cells expressed neuronal transcripts Nestin, NFH, p tubulin Nurrl, TH, GFAP. Progression towards dopaminergic neuronal fate was also confirmed by the measurement of dopamine released by the cells into the culture supernatant by RP-HPLC. In vivo functionality was assessed by grafting these cells into the substantia nigra of rats previously made Parkinsonian by unilateral lesioning with neurotoxin 6-hydroxy dopamine. There was a significant behavioral improvement in animal models 3 months post transplantation and the injected cells also survived as revealed by immunohistochemical studies of the grafted area with TH and human nuclei.
Our results suggest that mesenchymal stem cells derived from the human bone marrow can be transdifferentiated efficiently into functional dopaminergic neurons both in vitro and in vivo, thus offer a viable option for cell-replacement therapy of incurable neurodegenerative diseases including PD.
The present results indicated that bone marrow derived MSCs expanded under xeno free conditions demonstrated the invitro and in vivo neuronal potential and significantly reduced the apomorphine-evoked rotations in parkinsonian rats. BMMSCs, showed a ten (10) fold expansion using xeno free medium, displaying typical MSC phenotype. On differentiation, they exhibited neuronal morphology, expressing cellular and molecular markers adapting a dopaminergic fate. Detectable levels of dopamine (1.93ng/ml) were observed in the culture supernatants of differentiated cells. There was a significant behavioral improvement in PD models 3 months post transplantation, substantiated by immunohistochemistry supporting in vivo survival and differentiation. Further, the present invention has obtained a pure population of BMMSCs propagated to an upscalable clinical quantity with reproducibility, in a clean room environment with our validated process and test methodologies. The present invention demonstrates that BMMSCs can be transdifferentiated efficiently into functional dopaminergic neurons


both in vitro and in vivo. This holds immense clinical potential as a replacement therapy for PD and other neurodegenerative diseases as well.
Based on the published data, the present invention has created the rodent disease models for both Parkinson's disease and Spinal cord injury that mimic the clinical symptoms of these diseases to a certain extent. The present invention has assessed these models by behavioral tests before cell transplantation. The efficacy of the bone marrow derived MSC in alleviating the symptoms of the disease was evaluated three (3) months post transplantation by behavioral and histological studies as detailed below.
In this study, the inventors have also demonstrated the dopaminergic differentiation in vitro by BMMSC cultured in CBS by showing TH positive cells by immunoflourescence and dopamine secretion by ECD. In addition to TH the differentiated cells after induction have shown positivity for NeuN, NF-70, BT. They have also shown the ability to form glial cells which is demonstrated by GFAP staining. Undifferentiated BMMSCs cultured in presence have been shown to be positive for nestion suggesting its neural predisposition. Differentiated cells have shown to expression the genes at the RNA, which was confirmed by RT-PCR studies. All these in vitro studies showed a good level of neural differentiation of BMMSC cultured in presence of CBS. Further, these cells were checked for its functional efficacy in animal models. The PD rat model was created to mimic the conditions as humans. After injecting cells in the animals started showing behavioral improvement, which was analyzed by various tests such as water, escape test, front leg placing test apomorphine injection. Appropriate control animals were used to measure the level of improvement behaviorally. The stem cell injected animals were monitored at various intervals and improvement was confirmed accordingly. One set of animals after completing 3 months were sacrificed and their brain sections were analyzed for human cells expressing Th. Also the brain section was checked for differentiated BMMSC co expressing neural markers such as TH and NeuN. Our results also indicate the BMMSCs cultured in CBS after injection into a damaged area of the PD rat brain have engrafted and differentiated into functional dopaminergic neurons which were checked by assaying the serum of the stem cell injected rats.


The following examples are included to demonstrate preferred embodiments of the invention. It should be appreciated by those skilled in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventor to function well in the practice of the invention, and thus can be considered to constitute preferred modes for its practice. However, those skilled in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.
EXAMPLE 1: Isolation and expansion of MSC in the presence of CBS
Human bone marrow from normal volunteers was obtained from the iliac crest after an informed consenting process. The marrow was processed in a clean room environment. Mononuclear cells (MNCs) were isolated as reported earlier [25]. The isolated cells were seeded in 75-cm tissue culture flasks (Nunc, USA) in MSC proliferation medium containing DMEM: F12 (1:1) (Invitrogen, Singapore) supplemented with 10% CBS and l ng/ml of basic fibroblast growth factor (Sigma, USA), incubated at 37°C with 5%C02. The cells grew as colonies, which then became confluent to form a monolayer. Upon reaching confluency, the cells were harvested using trypsin EDTA (Invitrogen, Singapore) to give a single cell suspension. The harvested cells were analyzed for cell surface markers by flow cytometry (BD Pharmingen, USA). Results
MSCs obtained from human bone marrow were successfully cultured and expanded in medium containing CBS under cGMP conditions. MSCs isolated from bone marrow grew as distinct colonies within 1 week of culture after which, the colonies started expanding and formed a monolayer of adherent fibroblast like cells. MSCs cultured in CBS showed a 8-10 fold increase in expansion. (Figure 1). Furthermore, the results from flow cytometry indicated that expanded BMMSCs exhibited the positive labeling to mesenchymal markers such as, CD73, CD 105, CD44, CD29, but negative staining to hematopoeitc and endothelial markers such as CD45, vWF. (Figure 2). These cells showed 90%) purity in terms of MSC antigen expression and viability and expressed a


phenotype of CD73+/CD105+/CD44+/CD29+/SSEA4+/CD45-/CD3l-/CD14-/vWF-. (Figure 2). These MSCs were negative for MHC class II but expressed MHC class I.
EXAMPLE 2: Identification of BMMSC phenotype
Immunophenotyping of the cultured MSCs were done using flow cytometry. The adherent cells were washed with PBS and detached by incubating with 0.05% trypsin EDTA (Invitrogen, Singapore) for 5 minutes at 37°C. The harvested cells were washed using staining buffer containing 4% FBS and 0.1% azide in PBS. After harvesting the adherent cells, a cell count was taken and approximately 50,000 cells were used for cell surface antigen expression studies. Cells were incubated with CD45 PerCP (BD Pharmingen, USA), CD73 PE (BD Pharmingen, USA), CD 105 PE (Caltag), SSEA4 PE (R&D systems, USA), HLADR PE (BD Pharmingen, USA), HLAABC PE (BD Pharmingen, USA), CD14 PE (BD Pharmingen, USA), CD31 PE (BD Pharmingen, USA), CD29 (BD Pharmingen, USA), CD44 (BD Pharmingen, USA), vWF (Santacruz, USA) using standard techniques [24].Goat anti mouse FITC was used as secondary antibody to detect the vWF primary antibody. Appropriate isotype controls were used. These cells were acquired on a FACS Calibur Flow Cytometer (BD Pharmingen, USA) equipped with a 488 nm Argon Laser. Approximately 10,000 events were acquired and analyzed using Cell Quest Software. For viability determination, cells were stained with 7-Amino Actinomycin D (7-AAD), (BD Pharmingen, USA) & acquired on the flow cytometer. Dead cells take up the fluorescent stain while live cells exclude this stain. Viability and surface antigen expression were evaluated at every passage.
EXAMPLE 3: Neural differentiation of MSC cultured in CBS
For inducing the neuronal differentiation, a modified version of Woodbury et al., protocol was followed. Briefly, after 3 days of expansion in MSC proliferation medium, the MSCs were pre induced in DMEM: F12 (1:1) medium (Invitrogen, Singapore) containing 10% CBS ,2% B27 (Sigma, USA) and supplemented with growth factors 2ng/ml basic fibroblast growth factor (Sigma, USA), l00ng/ml nerve growth factor, 50ng/ml of Noggin (Peprotech, USA). The cells were maintained in neuronal pre induction medium for a week with media changes affected every alternate day. After a


week, the cells were induced with 200mM BHA (Sigma, USA) in the same media for 4-5 hours to adapt the dopaminergic fate. Differentiated cells were characterized for the expression of neuron specific markers by immunoflourescence and RT-PCR. For characterization studies the expanded cells were plated in 8 well chamber slides (BD Falcon, USA) at a density of 3000 cells per well. The expanded BMMSCs were also seeded in 35mm petridishes at a density of 3000 cells per plate for RT-PCR and in vivo transplantation studies in animal models. Controls included cells, which were cultured in MSC proliferation medium for a week.
Results
Neuronal differentiation was initiated by culturing the undifferentiated BMMSCs in neuronal pre induction medium containing neurotropic factors and CBS. After one week of culture in neuronal induction medium, the cytoplasm of the cells retracted towards the nucleus. Upon exposure to strong neural inducers such as DMSO/BHA, most cells presented the neuronal morphology including a small cell body and long processes. To confirm that BMMSCs differentiated along neuronal lineages we examined the expression of specific markers in the cells by immunoflourescence and RT PCR. Immunoflourescence analysis demonstrated that differentiated cells expressed neuronal specific surface markers such as NeuN, NF-70, TH, (3 tubulin, Nestin and GFAP (Figure 3). Undifferentiated BMMSCs were found to express Nestin and p tubulin, which was further confirmed by gene expression studies indicating a neuronal predisposition. RT PCR revealed the expression of characteristic neuronal markers Nestin, NFH, b tubulin, NFM, and dopaminergic markers TH, Nurrl (Figure 4). We also targeted GFAP, a glial marker. The number of GFAP positive cells was low. Undifferentiated BMMSCs also expressed nanog but were negative for OCT4 (Figure 4). We further evaluated the functional properties of differentiated BMMSCs by RP-HPLC. We found that detectable level of dopamine (1.93ng/ml) was secreted by the differentiated neurons in to the culture supernatant as compared to undifferentiated BMMSCs (Table 1).
Table 1: Dopamine concentration (ng/ml) in culture supernatant by RP-HPLC


# Culture conditions Number ofsamplesanalyzed No of days in culture Area covered Concentration by the peak of dopamine (ng/ml)
1 MSC expanded in 10%CBS andDMEM/F12 3 19 969 0.03
2 MSC differentiated in neuronal induction media along with DMSO/BHA 3 7 56446 1.94
EXAMPLE 4: Immunofluorescence studies
In order to confirm that MSCs differentiated into neuronal lineage, the protein markers expressed by the differentiated cells were identified by immunoflourescence. After 4-5 hours of induction with BHA in neuronal media, the cells grown on 8 well chamber slides were washed with IX PBS and fixed with 4% paraformaldehyde at 4°C for 30 minutes. Then the cells were rinsed with PBS and stained with neuronal markers. The differentiated cells were checked for expression of the following antibodies: Glial fibrillary acidic protein (GFAP, 1:100), Nestin (1:200), Neuronal specific nuclear protein (NeuN, 1:200), Neurofilament-70 (NF-70, 1:100), b tubulin (1:100), Tyrosine hydroxylase (TH, 1:100,). All the primary antibodies were procured from Chemicon, USA. The primary antibodies were prepared in staining buffer consisting of 0.1% Triton X -100 in IX PBS. The cells were then incubated overnight at 4°C with primary antibody. After washing three times with IX PBS, cells were incubated with goat antimouse Alexa 488 (1:500, Molecular probes) as a secondary antibody for 30minutes at 37°C and counter stained with DAPI (lug/ml, Sigma). Immunopositive areas were looked for by using a fluorescence microscope (Nikon Eclipse E600)
EXAMPLE 5: Gene expression studies by RT-PCR:
The cell pellets of both induced and uninduced cells were used for total RNA extraction. Total RNA was isolated from the lxlO6 cells by Trizol method. (Invitrogen, Singapore). 5 ug of RNA was used for cDNA synthesis. The cDNA was synthesized using Superscript reverse- transcriptase II (Invitrogen, Singapore). 1 ml of cDNA was


amplified by polymerase chain reaction using ABgene 2x PCR master mix (ABgene, UK) with appropriate primers. The list of primers is as given in Table 2. Cycling parameters are as follows: Initial denaturation at 94°C for 2 minutes, denaturation at 94°C for 30seconds, annealing at 55-65°C for 30 seconds depending on the primer and elongation for 1 minute and the number of cycles varied between 25 and 40. Final elongation was carried out at 72°C for 7 minutes.
Table 2: Primer Sequences used for PCR

Gene Forward Reverse Annealing Temp Size
GAPDH TGAAGGTCGGAGTCAACGGATTTGG CATGTGGGCCATGAGGTCCACCAC 60°C 890
Nanog CCTCCTCC TGGATCTG TTATTC A CAG GTCTTCACCTGTTTG TAG CTG AG 52°C 262
OCT4 CGRGAAGCTGGAGAAGGAGAAGCTG CAAGGGCCGCAGCTTACACATGTTC 58°C 247
Nestin TTTTCCACTCCAGCCATCC CCAGAAACTCAAGCACCAC 58 °C 295
GFAP TCATCGCTCAGGAGGTCCTT CTGTTGCCAGAGATGGAGGTT 65°C 400
P Tubulin CTTACTACTGTTAGATCCCAGGAAT TGAGACGATGTCCTCCATA 56 °C 240
TH TCATCACCTGGTCACCAAGTT GGTCGCCGTGCCTGTACT 62°C 107
Nurrl CGGACAGCAGTCCTCCATTAAGGT CTGAAATCGGCAGTACTGACAGCG 68 UC 790
NF-M GAG CGC AAA GAC TAC CTG AAG A CAG CGA TTT CTA ATC CAG AGC C 63 °C 430
EXAMPLE 6: Functional: Dopamine measurement by HPLC
The functional capacity of both induced and uninduced BMMSCs were evaluated by measuring the dopamine release into the culture supernatant after one week of differentiation form-eight (48) hours after the last medium change) by Reverse phase -HPLC. Culture supernatants from undifferentiated and 1-week post differentiation were immediately stabilized after collection with 7.5% orthophosphoric acid/metabisulphite (0.22mg/ml) and stored at 80° C until analysis. The mobile phase consisted of sodium acetate (0.2M), EDTA (0.2 mM), heptane sulfonic acid (0.55%), dibutylamine (0.01%) and methanol (16%). The pH was adjusted to 3.92 with orthophosphoric acid. Samples (lOOul) were separated on reverse phase nucleosil CI8 column and detected with an electrochemical detector. The mobile phase was pumped at a flow rate of 0.5ml/min. Dopamine levels were calculated using external reference dopamine standards injected immediately before and after each experiment


EXAMPLE 7: IN VIVO studies
Creation of Parkinson's disease rat model (PD)
Rat model of PD was created according to Ravindran and Rao, 2006 [26]. Briefly adult male Sprague Dawley rats weighing about 180-250 g (n=25) were anesthetized with ketamine (50 mg/kg i.p) and Valium (30 mg/kg i.p) and fixed in a stereotaxic frame (Stoelting Co. USA). Ten microlitres of 6-hydroxydopamine (6-OHDA) (6mg /ml) was injected using motorized microinjector at the flow rate of 1 ul/minute, lowered into the substantia nigra using stereotaxic-guided coordinates [from Bregma 4.5 mm, left 2.2mm, and ventral 7.8 mm]. 4-6 weeks after 6-OHDA lesioning, animals were examined for rotational symmetry after i.p. Injection of 3mg/kg of apomorphine hydrochloride (Sigma, USA) .Rats showing > 10 rotations per minute over one hour interval were selected and randomly assigned to treatment or control groups. To prevent subjective bias, a trained examiner unaware of the experimental details performed the evaluation. All animal studies were performed as per Committee for the Purpose of Control and Supervision of Experimental Animals (CPCSEA) guidelines and were approved by our Institutional Animals Ethics Committee.
Transplantation of MSC cultured in medium containing CBS
The 6-OHDA lesioned rats, which showed significant ipsilateral turning response, were selected for the study. The rats (n=12), were used for cell transplantation. Each rat was anesthetized with ketamine (50 mg/kg i.p) and Valium (30 mg/kg i.p) and fixed in a stereotaxic frame (Stoelting Co. USA) and received an injection of 0.2-0.3 million undifferentiated BMMSCs suspended in the l0ml of medium using 28-gauge syringe at the rate of 2 ul/min into the substantia nigra. All the cells injected were labeled with cell tracker dye such as Dil (molecular probes) prior to transplantation. Sham-operated control rats (n =6) underwent the same procedure except that they received only saline. Severity of the disease and the extent of recovery were assessed in Sham-injected and cell transplanted animals by physical activity and behavioral response. Rotations were counted for one hour after subcutaneous injection of apomorphine hydrochloride (Sigma, USA). At the end of 3 months all the animals were evaluated by apomorphine induced rotations and histology studies.


Immunohistochemical analysis of PD brain injected with MSC cultures in CBS
12 weeks post transplantation; rats were anesthetized with ketamine (50 mg/kg i.p) and Valium (30 mg/kg i.p) and perfused with saline followed with 4% paraformaldehyde. The brains were equilibrated in 20% sucrose in PBS overnight at room temperature. The brains were processed to obtain thin paraffin sections approximately 4-10m for immunohistological studies. The sections were deparaffinized by xylene and ethanol treatments followed by a subsequent antigen retrival by dipping the slides in citrate buffer. The slides were heated in a microwave for 30seconds and permeabilized with 0.2% Triton X-100 in PBS. The non-specific binding slides were blocked with 1% BSA in PBS. The sections were then incubated overnight at 4°C with anti- TH and anti-human nuclei (Chemicon, USA) antibodies along with negative controls. The sections were then washed with PBS and incubated with the appropriate secondary antibody conjugate. To confirm the presence of transplanted TH positive cells, co-localization with anti-human nuclei was done. The sections were embedded in immunoflour mounting medium and observed under a fluorescence microscope (Nikon Eclipse E600) to check for immunopositive cells.
Results
We then examined in vivo survival, differentiation and function of the undifferentiated BMMSCs expanded under xeno free and cGMP conditions after transplantation into the substantia nigra of Parkinsonian rats created in a GLP accredited facility. The PD rat model was created by injecting 6-OHDA into the substantia nigra. The motor abnormality in the PD rat was evaluated by examining rotational behavior in response to apomorphine injection. We selected rats that exhibited stable deterioration of motor functions and showed >10 ipsilateral circling per minute for cell transplantation. About 0.2 -0.3 million of BMMSCs per rat were transplanted into the substantia nigra of rat model of Parkinson's disease six weeks after lesioning. We observed no improvement of motor function during first two weeks post-transplantation, but after four week onwards, rats showed a significant motor improvement and reduced apomorphine-induced rotations. After 12-weeks, post-transplanted animals showed a significant reduction in


apomorphine induced rotations (Figure 5). The histology of the grafted area showed that transplanted cells survived in the substantia nigra and differentiated into dopaminergic neurons. In order to confirm that the transplanted cells were of human origin, double labeling with human nuclei antibody and TH were done. At 12 weeks post transplantation, cells that were immunoreactive with anti human nuclei were observed along the injection tract and within the substantia nigra.
REFERENCES:
1. Long X, Olzewksi M, Huang W, et al: Neural cell differentiation in vitro from adult human bone marrow mesenchymal stem cells. Stem Cells Dev 14, 65-9 (2005).
2. Seiber-Blum M, Grim M, Hu Y.F, et al.: Pluripotent neural crest stem cells in the adult hair follicle. Dev. Dyn 231,258-269 (2004).
3 Prusa AR, Marton E, Rosner M, et al.: Neurogenic cells in human amniotic fluid. Am J Obstet Gynecol 191(1), 309-14 (2004).
4. Li H, .Liu H., Heller S: Pluripotent stem cells from the adult mouse inner ear. Nat. Med 9, 1293-1299(2003).
5. Seigel, G. M., Sun W, Salvi R, et al.: Human corneal stem cells display functional neuronal properties. Mol. Vision 30, 159-163 (2003).
6. Freed, C.R. Greene P.E., Breeze R.E., et al.: Transplantation of embryonic dopamine neurons for severe Parkinson's disease. N. Engl. J. Med 344, 710-719 (2001).
7. Kan I, Ben- Zur T, Barhum Y et al.: Dopaminergic differentiation of human mesenchymal stem cells—utilization of bioassay for tyrosine hydroxylase expression. Neurosci Lett May 23 419(1), 28-33 (2007).Epub Apr 13 (2007).
8. Hellmann MA, Panet H, Barhum Y et al.: Increased survival and migration of engrafted mesenchymal bone marrow stem cells in 6-hydroxydopamine-lesioned rodents. Neurosci Lett Mar 6;395(2),124-8 (2006). Epub Dec 15 (2005).
9. Cho KJ, Trzaska KA, Greco SJ et al.: Neurons derived from human mesenchymal stem cells show synaptic transmission and can be induced to produce the neurotransmitter substance P by interleukin-1 alpha. Stem Cells Mar 23(3), 383-91 (2005).
10. Woodbury D, Schwarz EJ, Prockop DJ et al.: Adult rat and human bone marrow stromal cells differentiate into neurons.J Neurosci Res Aug 15;61(4),364-70 (2000).


11. Wang TT, Tio M, Lee W et al.: Neural differentiation of mesenchymal-like stem cells from cord blood is mediated by PKA. Biochem Biophys Res Commun Jun 15;357(4),1021-7 (2007). Epub Apr 18 (2007).
12. Choi CB, Cho YK, Prakash KV et al.: Analysis of neuron-like differentiation of human bone marrow mesenchymal stem cells. Biochem Biophys Res Commun Nov 10;350(l),138-46 (2006). Epub Sep 14 (2006).
13. Deng J, Petersen BE, Steindler DA et al.: Mesenchymal stem cells spontaneously express neural proteins in culture and are neurogenic after transplantation. Stem Cells Apr24(4), 1054-64 (2006). Epub Dec 1(2005).
14. Meuleman N, Tondreau T, Delforge A et al.: Human marrow stem cell culture: serum free medium allows better xpansion than classical a-MEM medium. Eur J Haematol 76,309-16(2006).
15. Mizuno N, Shiba H, Ozeki Y et al.: Human autologous serum obtained using a completely closed bag system as a substitute for fetal calf serum in human mesenchymal stem cell cultures. Cell Biol Int30, 521-4 (2006).
16. Le Blanc K, Rinden O: Mesenchymal stem cells.: properties and role in clinical bone marrow transplantation. Curr.Opin.Immunol Octl8(5), 586-91 (2006). Epub Aug 1(2006).
17. Tondreau T, Lagneaux L, Dejeneffe M et al: Bone marrow-derived mesenchymal stem cells already express specific neural proteins before any differentiation. Differentiation 72(7), 319-326(2004).
18 Edwin M. H, Patricia L. G, Winston K. K et al.: Isolated allogeneic bone marrow-derived mesenchymal cells engraft and stimulate growth in children with osteogenesis imperfecta: Implications for cell therapy of bone. PNAS June 25, 99 (13), 8932-8937 (2002).
19. Carl A. G, Emigdio R, Mandolin J. W et al.: Enhanced Engraftment of Mesenchymal Stem Cells in a Cutaneous Wound Model by Culture in Allogenic Species-Specific Serum and Administration in Fibrin Constructs. Stem Cells 24 (10), 2232-2243 (2006).
20. Karen B, Susanne K, Herald K et al.: Critical Parameters for the isolation mesenchymal stem cells from umbilical cord blood. Stem Cells 22, 625-634 (2004).


21. Mark F.P, Alastair M. M, Stephen C. B et al.: Multilineage Potential of Adult Human Mesenchymal Stem Cells. Science 284 (5411), 143-147 (1999).
22. Hellmann M. A, Panet H, Barhum Y et al.: Increased survival and migration of engrafted mesenchymal bone marrow stem cells in 6-hydroxydopamine-lesioned rodents. Neuroscience letters 395 (2), 124-128 (2006).
23. Nagwa S. El-Badri, Amal H et al.: Cord Blood Mesenchymal Stem Cells: Potential Use in Neurological Disorders. Stem Cells and Development 15(4), 497-506 (2006).
24. Tanavde V, Malehorn M, Lumkul R et al.: Human stem progenitor cells from neonatal cord blood have greater haematopoeitic expansion capacity than those from mobilized adult blood. Exp Hematol 30, 816-23 (2002).
25. Shetty P, Bharucha K and Tanavde V.: Human umbilical cord blood serum can replace fetal bovine serum in the culture of mesenchymal stem cells. Cell Biology International 31,293-298. (2007).
26. Ravindran G, Rao H.: Enriched NCAM- Positive cells form functional dopaminergic neurons in rat model of Parkinson's disease. Stem Cells and Development 15(4), 572-582 (2006).
27. Sanchez- Ramos JR.: Neural cells derived from adult bone marrow and umbilical cord blood. J Neurosci Res Sep 15; 69(6), 880-93 (2002).
28. Krampera M, Marconi S, Pasini A et al.: Induction of neural-likedifferentiation in human mesenchymal stem cells derived from bone marrow, fat, spleen and thymus. Bone 40(2), 382-90 (2007).
29. Chen Y, Teng F.Y.H, Tang BL et al.: Coaxing bone marrow stromal stem cells towards neuronal differentiation: progress and uncertainties. Cellular and Molecular Life Sciences 63(14), 1649-1657 (2006).
30. NOORT W A ET AL: "Comparison of repopulating ability of hematopoietic progenitor cells isolated from human umbilical cord blood or bond marrow cells in NOD/SCID mice." BONE MARROW TRANSPLANTATION, (1998 JUL) 22 SUPPL 1 S5860, XP000929915, abstract, page S59; figure 1A
31. LUI X ET AL.: "Human mesenchymal stem cells enhance ex vivo expansion of human megakaryocyte, erythroid and myeloid progenitors from purified cord blood CD34+ cells"


32. BLOOD: Vol. 92, no. 10 part 1, 15 November 1998 (1998-11-15), page 2977 XP002114346, abstract
33. BAUM C M ET AL.: "Isolation of a candidate human hematopoietic stem-cell population." PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA, (1992 APR 10 89 (7) 2804-8, XP002144544, abstract
34. WO 95 25164 A: (THE PICOWER INSTITUTE FOR MEDICAL RESEARCH) 21 September 1995 (1995-09-21), page 26; table 1, claims 1-33
35. LEBIEN T W ET AL: "Multiparameter flow cytometric analysis of human fetal bone marrow B cells." LEUKEMIA, (1990 MAY) 4 (4) 354-8, XP000929907, page 357, right-hand column, line 11- line 14
36. WALLER E K ET AL: "The common stem cells" hypothesis reevaluated: human fetal bone marrow contains separate populations of hematopoietic and stromal progenitors." BLOOD, (1995 MAY 1) 85 (9) 2422-35, XP000929998, abstract
37. WO 99 64566 A: (OSIRIS THERAPEUTICS) 16 December 1999 (19999-12-16), page 5, line 24 - line 26; claims 1-11
38. WO 95255164 A: Publication date 21-09-1995
39. WO 9964566 A: Publication date 16-12-1999
40. BHAT, Aravind Venkatrao: U.S. 2003/0232432
41. PITTENGER, etal.: U.S. 2003/0103951
42. KIM, etal.: U.S. 2004/0151701
43. FALKENBURG, Johan: EP 1 099 754 Al
44. SANBERGetal.: U.S. 2002/0028510
45. HARIRI, Robert J.: US 2003/0180269
46. RAI, Prathibha: U.S. 2004/0203142
47. Human umbilical cord blood serum replace fetal bovine serum, P. Shetty, et al. article by Cell Biology International, xx (2006) 1-6, in India
48. Buhring et al.: Novel Markers for the prospective isolation of human MSC. Annals if NY Academy of Sciences, 2007


All of the compositions and methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this invention have been described in terms of preferred embodiments, it will be apparent to those of skill in the art that variations and modifications may be applied to the compositions and/or methods and in the steps or in the sequence of steps of the methods described herein without departing from the concept, spirit and scope of the invention. More specifically, it will be apparent to those skilled in the art that certain agents that are chemically or physiologically related may be substituted for the agents described herein while the same or similar results would be achieved. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the invention as defined by the appended claims.



CLAIMS:
A method of growing mesenchymal stem cells of bone marrow comprising steps of
a. isolation of mononuclear cell fraction of bone marrow ,
b. plating a mononuclear cell suspension of about 106-107 cells/ml into tissue culture
flasks comprising a culture medium along with 1-50% cord blood serum for 24-72
hours to produce adhered cell cultures,
c. incubation of the adhered cell cultures of step b) at 37°C in 5% CO2 air incubator for
at least 7 days; and
d. counting and analyzing the cultured cells for expression of markers selected from CD
markers.
e. analysis of neural cells derived from bone marrow MSC in vitro and in vivo.
A method as per claim 1, wherein the CD markers are selected from CD73, CD 105, CD44, CD29, SSEA4, CD45, CD31, vWF and CD14.
A method as per claim 2, wherein the mesenchymal stem cells obtained from bone marrow are positive for CD73, CD105, CD44, CD29, SSEA4 markers.
A method as per claim 2, wherein the mesenchymal stem cells obtained from bone marrow are negative for CD45, CD31, vWF and CD14 markers.
A method as per claim 1, wherein the mesenchymal stem cells obtained further expressed positive for MHC class II and are negative for MHC class I
A method as per claim 1 wherein the cells are about 90% pure in terms of MSC antigen expression and viability.
A method of differentiating the mesenchymal stem cells of claim 1 into neural cells comprising steps of: a. Culturing the Bone Marrow derived MSCs of claim 1, in neuronal preinduction medium for a week.


b. Differentiation of the above induced cells into neural cells with antioxidant and
protein kinase activator in the same preinduction media for 4-5 hours
c. Characterization of the cells for the expression of neuron specific markers by
immunoflourescence and RT-PCR.
d. In vitro- functional assay for secretion of Dopamine.
A method according to claim7, wherein the preinduction medium is DMEM: F12 (1:1) medium, comprising 10% CBS ,2% B27, supplemented with growth factors.
A method according to claim 8, wherein the growth factors are 2ng/ml basic fibroblast growth factor, l00 ng/ml nerve growth factor, and 50ng/ml of Noggin.
A method according to claim 7, wherein the antioxidant is DMSO
A method according to claim 7, wherein the protein kinase activator is BHA
A method according to claim 7, wherein the neural cells characterized by immunofluroresence were analyzed for neuronal specific markers selected from NeuN, NF-70, TH, BP, Nestin and GFAP
A method according to claim 7, wherein the neural cells characeterised by RT PCR were analysed for the expression of genes selected from Nestin, NF-H, Beta - tubulin.
A method according to claim 7, wherein the functional assay of the neural cells were analysed for secretion of about 1.93ng/ml Dopamine by RP-HPLC.
A method according to claim 1, wherein the said Mesenchymal stem cells for use in regenerative medicine in neural disorder.
A method according to claim 15, wherein the neural disorder is Parkinson's disease.


The method of culturing mesenchymal stem cells in presence of cord blood serum and its therapeutic applications according to the claims above substantially as herein described with reference to the examples and figures.




ABSTRACT
The present invention provides a method for culturing mesenchymal stem cells using cord blood serum, for therapeutic purposes in regenerative medicine; and in particular the present invention provides the use of these cells in the treatment of Parkinson's disease, and the present invention has provided proliferation and neuronal differentiation of the MSCs in a xenofree culture system for clinical applications in a simple two step protocol, and the in vivo functional efficacy was tested in Parkinson's animal model.

Documents

Application Documents

# Name Date
1 abstract1.jpg 2018-08-09
2 1912-MUM-2007_EXAMREPORT.pdf 2018-08-09
3 1912-mum-2007-form-5.pdf 2018-08-09
4 1912-mum-2007-form-3.pdf 2018-08-09
5 1912-mum-2007-form-2.pdf 2018-08-09
7 1912-mum-2007-form-1.pdf 2018-08-09
8 1912-MUM-2007-FORM 2(TITLE PAGE)-(27-9-2007).pdf 2018-08-09
9 1912-MUM-2007-FORM 18(27-9-2011).pdf 2018-08-09
10 1912-mum-2007-drawings.pdf 2018-08-09
11 1912-mum-2007-description (complete).pdf 2018-08-09
12 1912-mum-2007-correspondence-received.pdf 2018-08-09
13 1912-MUM-2007-CORRESPONDENCE(IPO)-(FER)-(13-2-2015).pdf 2018-08-09
14 1912-MUM-2007-CORRESPONDENCE(IPO)-(AB21)-(22-3-2016).pdf 2018-08-09
15 1912-MUM-2007-CORRESPONDENCE(27-9-2011).pdf 2018-08-09
16 1912-mum-2007-claims.pdf 2018-08-09
18 1912-mum-2007-abstract.pdf 2018-08-09
20 1912-MUM-2007-OTHER DOCUMENT.pdf 2022-03-23