Sign In to Follow Application
View All Documents & Correspondence

Indazoles Useful In Treating Cardiovascular Diseases

Abstract: This invention provides compounds of Formula (I) or (Ia):that are useful in the treatment or inhibition of LXR mediated diseases.

Get Free WhatsApp Updates!
Notices, Deadlines & Correspondence

Patent Information

Application #
Filing Date
07 February 2007
Publication Number
17/2007
Publication Type
INA
Invention Field
PHARMACEUTICALS
Status
Email
Parent Application

Applicants

WYETH
FIVE GIRALDA FARMS MADISON NEW JERSEY 07940 USA

Inventors

1. STEFFAN,ROBERT,J
263 WHEATSHEAF LANE, LANGHOME, PA 19047 USA
2. MATELAN, EDWARD, M
1914 BROOKE DRIVE, ROYERSFORD PA 19468 USA
3. BOWEN STEPHEN, M
799 ALLEGHENYVILE ROAD MOHNTON, PA 19540 USA
4. ULLRICH, JOHN W
317 MISTY AUTUMN DRIVE, EXTON, PA 19341, USA
5. WROBEL, JAY, E
15 RSETREE LANE, LAWERENCE NJ 08648, USA
6. ZAMARATSKI, EDOUARD
FREDSGATAN, 4B 65-S-753 13 UPPASALA SE
7. KRUGER, LARS
PROFESSORSSLINGAN 45, 901, S104 05 STOCKHOLM, SWEDEN
8. HEDEMYR, ANNABEL, L., OLSEN
GASTRIKCGATAN 17, IST FLOOR, S-113 62 STOCKHOLM, SWEDEN
9. CHENG, AIPING
SOLHEMSVAGEN 19A, S-141 31 HUDDINGE SWEDEN
10. HANSSON TOMAS
TRANSTIGEN 10, S-149 50 NYNASHAMN SWEDEN
11. UNWALLA, RAYMAND, J
4025 KILLINGTON COURT, EAGLEVILLE, PA 19403 USA
12. MILLER, CHRISTOPHER, P
72 MEADOWBROOK ROAD, WAYNE PA 19087 USA
13. RHONNSTAD, PATRIK,P
BORGVIKSVAGEN 3, S-73632 KUNGSOR SWEDEN

Claims

2. A compound as claimed in claim 1 wherein RI is C\* alkyl, CN, CO2R5, NR5R*. or halogen; wherein said Ci_6 alkyl is optionally substituted with from 1 to 7 substituents independently selected from the group consisting of halogen and OH; and RS and R6 are as previously defined.

3. A compound as claimed in claim 1 wherein RI is CN, halogen, or d-e alkyl substituted with from 1 to 7 fluorine atoms.

4. A compound as claimed in claim 1 wherein RI is Ci_3 perhaloalkyl.

5. A compound as claimed in claim 1 wherein RI is CF3, F or Cl.

6. A compound as claimed in claim 1 wherein RI is CF3.

7. A compound as claimed in any one of claims 1 to 6 wherein: R2 is Ca.g alkyl, C3.8 cycloalkyl, aryl, arylalkyl, heteroaryl or heterocycloalkyl; wherein said €3.8 alkyl, said €3.8 cycloalkyl and said arylalkyl are each optionally substituted with up to four substituents independently selected from the group consisting of halogen, CN and OR?; and said heteroaryl is optionally substituted with YD; wherein Y and D are as previously defined; or R2 is phenyl substituted with up to four substituents independently selected from the group consisting of Cio alkyl, C2.g alkenyl, C2.s alkynyl, Cu alkoxy, Ci-s cycloalkyl, halogen, OH, CH2OH, CN, NR7R8, N(R7)C(O)NRsR6, S(O)mR7, phenyl, NO2, C(O)R7, OC(O)R7, C(O)NR7R8) C(O)NR7D and YD, providing any OH group present is not in the para position; wherein said Ci-3 alkyl and said do alkoxy are each optionally substituted with from 1 to 7 fluorine atoms; and m. RS. Re, R7, RS, Y and D are as previously defined.

8. A compound as claimed in any one of claims 1 to 6 wherein R2 is arylalkyl, heteroaryl or heteroarylalkyl, wherein: said arylalkyl is optionally substituted with up to four substituents independently-selected from the group consisting of halogen, CN and OR7; and said heteroaryl is optionally substituted with YD; or R2 is phenyl substituted with up to four substituents independently selected from the group consisting of Q.3 alkyl, do alkoxy, halogen, CH2OH, CN, NR7Rg, N(R7)CONR5R6, S(O)mR7, NO2) and YD; wherein said Ci.3 alkyl and said C|.3 alkoxy are each optionally substituted with from 1 to 7 fluorine atoms; m, R5, R*,, R7, and RS are as previously defined; Y is a bond, CH2, CH2CH2, CM alkynylenyl, -O-, OCH2, CH2O. -N(R7)-, -N(R7)CH2-, -N(R7)CONR8-, -OCH2O- or -OC(R7)(CO2Rg)-; wherein R7 and RS are as previously defined; D is benzyl or phenyl, each of which is optionally substituted with up to five independently selected R groups; each R is independently selected from the group consisting of C|^ alkyl, CM-alkoxy, halogen, -C(=O)H, -C(O)-Ci.3 alkyl, CH2OH. CN, NO2, C2.4 alkenyl, C2.4 alkynyl, S(O)jR9, and WX; wherein said C|. e alkyl and said C|.3 alkoxy are each optionally substituted with from 1 to 7 fluorine atoms; and j, Rg and WX are as previously defined; or D is a heterocycloalkyl, heteroarylalkyl, heteroaryl, or arylalkyl group, each of which is optionally substituted with up to four independently selected Rg groups; each Ra is independently selected from the group consisting of C\j alkyl, phenyl, benzyl, Cj.\\ arylalkyl, 'Ci.3 alkoxy, halogen, C(O)H, CO(CH3)2, C(CH3)2OH, -C(O)-Ci-3 alkyl, CH2OH, CN, NO2, NH2, OH, =O, C2.6 alkenyl, C2-4 alkynyl, S(O)jR9, and WX; wherein said Ci-s alkyl, said C2-6 alkenyl, C2-4 alkynyl and said Ct.3 alkoxy are each optionally substituted with from 1 to 7 fluorine atoms; and j, RQ and WX are as previously defined.

9. A compound as claimed in any one of claims 1 to 7 wherein R2 is phenyl substituted with an ortho or meta OH.

10. A compound as claimed in any one of claims 1 to 7 wherein R2 is phenyl substituted with a meta OH.

11. A compound as claimed in any one of claims 1 to 7 wherein: R2 is phenyl substituted with up to four substituents independently selected from the group consisting of C 1.3 alkyl, C2.g .alkenyl, C2.g alkynyl, Cio alkoxy, C3.s cycloalkyl, halogen, OH, CH2OH, CN, NR7Rg-, N(R7)C(O)NR5R6, S(O)mR7. phenyl, NO2, C(O)R7, OC(O)R7, C(O)NR7R8) C(O)NR7D and YD, providing any OH group present is not in the para position; wherein said C].3 alkyl and said Q.3 alkoxy are each optionally substituted with from 1 to 7 fluorine atoms; and m. RS, Re, R7, Rg, Y and D are as previously defined.

12. A compound as claimed in any one of claims 1 to 8 wherein R2 is phenyl substituted with YD.

13. A compound as claimed in claim 12 wherein Y is a bond, CH2, CH2CH2. alkynylenyl, -O-, OCH2, CH2O, -N(R7)-, -N(R7)CH2-, -N(R7)CONR8-, -OCH2O-or -OC(R7)(C02Rg).

14. A compound as claimed in claim 12 or claim 13 wherein D is benzyl or phenyl, each of which is optionally substituted with up to five independently selected R groups; each R is independently selected from the group consisting of C|^ alkyl, Ci.3 alkoxy, halogen, -C(=O)H, -C(O)-C|.3 alkyl, Cn alkyl, C|_3 alkoxy, halogen, C(=O)H, Cw acyl, CH2OH, CN, NO2, C2^ alkenyl, C2-4 alkynyl, S(O)jR9, and WX; wherein said Ci^ alkyl and said Cio alkoxy are each optionally substituted with from 1 to 7 fluorine atoms; and j, Rg and WX are as previously defined.

15. A compound as claimed in claim 12 or claim 13 wherein D is phenyl that is optionally substituted with up to four independently selected R groups; each R is independently selected from the group consisting of Ci_6 alkyl, -C(=O)H, -C(O)- Ci-3 alkyl, Ci.3 alkoxy, halogen, CH2OH, CN, NO2, CM alkenyl, C2^ alkynyL and WX; wherein said Ci^ alkyl and said Q.3 alkoxy are each optionally substituted with from 1 to 7 fluorine atoms; and wherein WX is previously defined.

16. A compound as claimed in any one of claims 1 to 8 or 11 wherein R2 is-phenyl substituted with CM perfluoroalkyl.

17. A compound as claimed in any one of claims 1 to 8, 14 or 15 wherein R or Ra is C|.3 perfluoroalkyl or Q_3 perfluoroalkoxy.

18. A compound as claimed in any one of claims 1 to 6 wherein R2 is selected from the group consisting of 2,4-dimethoxyphenyl, phenyl, 4-methoxy-2-methylphenyl, 2-methoxyphenyl, 4-methoxyphenyl, 2-methylphenyl, 2,4-dimethylphenyl, 1,1'- biphenyl-4-yI, 4-methoxy-3,5-dimethylphenyl, 2-naphthyl, 2-vinylphenyl. 4- methoxy-3-methylphenyl, 3-methylphenyl, 2,3-dimethylphenyl, 3- (trifluoromethyl)phenyl, 4-fluorophenyl, 3-chlorophenyl, 3-methoxyphenyl, benzaldehyde-2-yI, 2-isopropylphenyl, 2-cyclohexylphenyl, 2-benzylphen\ I. 2- (l,l,2,2-tetrafluoroethoxy)phenyl, 2-chlorO'5-fluorophenyl, 9H-fluoren-2-yl. 4- benzylphenyl, bcnzaldehyde-3-yl, 3-hydroxyphenyl, butyl, isobutyl, pentyl, cyclopentyl, 2-hydroxyphenyl, l,3-dioxolan-2-yl, 4'-methoxy-l,l'-biphenyl-4-yl, l,l'-biphenyI-4-ol, cyclohexanyl, 4-methoxy-2-methylphenyl, 4-methoxy-2- methylphenyl, 4-bromophenyl, 3-bromophenyl, 3-(benzyloxy)phenyl, 2- hydroxyphenyl, N-cyclohexamino, and 4-phenoxy-phenyl.

19. A compound as claimed in any one of claims 1 to 18, wherein: R3 is phenyl optionally substituted with Ci-3 alkyl, or ZA; wherein: ZisCH2;and A is pyridyl or phenyl, wherein said phenyl is optionally substituted with up to five independently selected R|g groups; wherein each said R|g is independently selected from the group consisting of C^ alkyl, d.3 alkoxy, halogen, OH, NO2, and CN; wherein said Q 4. alkyl and said Ci_3 alkoxy are each optionally substituted with from 1 to 7 fluorine atoms.

20. A compound as claimed in any one of claims 1 to 18, wherein R3 is phenyl optionally substituted with C|.3 alkyl or ZA.

21. A compound as claimed in claim 20, wherein A is phenyl that is optionally substituted with up to five independently selected Rig groups; wherein each said RIS is independently selected from the group consisting of Q-e alkyl, Ci_3 alkoxy, halogen, OH, NO2, CN, phenyl, pyrrol-1-yl, C(O)Ri2, CO2R|2, NR)2R|3, C(O)NRi2Rj3, and S(O)nRi2; wherein said Ci_6 alkyl and said Ci.3 alkoxy are each optionally substituted with from 1 to 7 fluorine atoms; and n, R]2 and R)3 are as previously defined.

22. A compound as claimed in any one of claims 1 to 18 wherein R3 is ZA; wherein: Z is CH2; and A is phenyl, wherein said phenyl is optionally substituted with up to five independently selected Rig groups; wherein each said Rig is independently selected from the group consisting of C|-6 alkyl, Cj.3 alkoxy, halogen, OH, NO2, and CN; wherein said Ci_6 alkyl and C).3 alkoxy are each optionally substituted with from 1 -to 7 fluorine atoms.

23. A compound as claimed in any one of claims 19 to 22 wherein Rt8 is Ci-3 perfluorpalkyl.

24. A compound as claimed in any one of claims 1 to 18, wherein R3 is selected from the group consisting of 2-allyl, propyl, cyclopentyl, isobutyl, cyclohexylmethyl, 2- ethylbutyl, cyclobutyl, benzyl, 3-methoxybenzyl, 2-naphthylmethyl, 4- methylbenzyl, 2-nitrobenzyl, 2-(trifluoromethyl)benzyl, 4-bromobenzyl, 3-(difluoromethoxy)benzyl, 3-(trifluoromethoxy)benzyl, 3,5-difluorobenzyl, 3,5-dimethylbenzyl, quinolinylmethyl, 2-chloro-4-fluorobenzyl, 3-(lH-pyrrol-l-yl)benzyl, 2-bromobenzyl, 2-methylbenzyl, 5-fluoro-2-methylbenzyl, 6-chloro-2-fluoro-3-methyIbenzyl, l,l'-biphenyI-3-ylmethyl, 2-chlorobenzyi, I-naphthylmethyl, 2,5-dichlorobenzyl, (difluoromethoxy)benzyl, 3-fluorobenzyl, 4-methylbenzyl, 2,4-dimethylbenzyl, mesitylmethyl, 2, 4-dimethylbenzyl, 2-phenylethyl, 2-chloro-6-fluorobenzyI,^-chloro^^fluorobenzyl, 4-fluorobenzyl, 4-(methylsulfonyl)benzyl, and phenyl.

25. A compound as claimed in any one of claims 1 to 24 wherein R4 is H or F.

26. The compound as claimed in claim 1 wherein: RI is C|.6 alkyl, CN, COjRs, NRsRe, halogen; wherein said Ci^ alkyl is optionally substituted with from 1 to 7 substituents independently selected from the group consisting of halogen and OH; Rs and Re are as previously defined; R2 is as previously defined; RS is phenyl optionally substituted with Cu alkyl, or ZA; wherein: ZisCH2;and A is pyridyl or phenyl, wherein said phenyl is optionally substituted with up to five independently selected Rjs groups; wherein each said R)8 is independently selected from the group consisting of C|^ alkyl, C|.3 alkoxy, halogen, OH, NO2, and CN; wherein said C\* alkyl and said C|.3 alkoxy are each optionally substituted with from 1 to 7 fluorine atoms; and R4 is H or halogen.

27. A compound as claimed in claim 1 wherein: RI is Ci^ alkyl, CN, or halogen; wherein said Ci^ alkyl is optionally substituted with from 1 to 7 fluorine atoms; R2 is arylalkyl, heteroaryl or heteroarylalkyl, wherein: said arylalkyl is optionally substituted with up to four substituents independently selected from the group consisting of halogen, CN and OR?; and said heteroaryl is optionally substituted with YD; wherein R7, Y and Dare as previously defined; or R2 is phenyl substituted with up to four substituents independently selected from the group consisting of CM alkyl, €1.3 alkoxy, halogen, CH2OH, CN, NR7Rg, N(R7)CONR5R'.'.-- .'.'•"- ot) 3-{3-[(2,4-dichlorophenyl)ethynyl]phenyl}-2-(2,4,6-trifluorobenzyl)-7- (trifluoromethyl)-2H-indazole; ou) 3-{3-[2-(2,4-dichlorophenyl)ethyl]phenyI}-2-(2,4,6-trifluorobenzyl)-7- (trifluoromethyl)-2H-indazole; ov) 2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyl)-3-(3-{[2- (trifluoromethyl)phenyl]ethynyI}phenyl)-2H-indazole; ow) 2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyl)-3-(3-{2-[2- (trifluoromethyl)phenyl]ethyl}phenyl)-2H-indazole; ox) 3-[l-(2-chloro-6-fluorobenzyI)-lH-indol-5-yl]-2-(2,4,6-trifluorobenzy!)- 7-(trifluoromethyl)-2H-indazole; oy) 3-[l-(2,6-difluorobenzyl)-lH-indol-5-yl]-2-(2,4,6-trifluorobenzyl)-7- (trifluoromethyl)-2H-indazole; oz) 3-{3-[2-(2,5-dichlorophenyl)ethyl]phenyl}-2-(2,4,6-trifluorobenzyI)-7- (trifluoromethyI)-2H-indazole; pa) 3-[3-(2-phenylethyl)phenyl]-2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyl)- 2H-indazole; pb) 3-[l-(2,6-dichlorobenzyl)-lH-indol-5-yl]-2-(2,4,6-trifluorobenzyl)-7- (trifluoromethyl)-2H-indazole; pc) . 3-[l-(2-chloro-4-fluorobenzyl)-lH-indol-5-yl]-2-(2,4,6-trifluorobenzyl)- 7-(trifluoromethyl)-2H-indazole; pd) 3-(3-{[2-chloro-5-(trifluoromethyl)phenyl]ethynyl}phenyl)-2-(2,4,6- trifluorobenzyl)-7-(trifluoromethyl)-2H-indazole; pe) 3- {3-[(2-bromo-5-fluorophenyl)ethynyl]phenyl} -2-(2,4,6- trifluorobenzyl)-7-(trifluoromethyl)-2H-indazole; pO 3-(3-{2-[2-chIoro-5-(trifluoromethyl)phenyl]ethyI}phenyl)-2-(2,4,6- trifluorobenzyl)-7-(trifluoromethyl)-2H-indazole; pg) 3-{3-[2-(2-bromo-5-fluorophenyl)ethyl]phenyl}-2-(2,4,6-trifluorobenzyl)- 7-(trifluoromethyl)-2H-indazole; ph) 3-{3-[2-(3-fluorophenyl)ethyl]phenyl}-2-(2,4,6-trifluorobenzyl)-7- (trifluoromethyl)-2H-indazole; pi) 4-amino-3-({3-[2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyl)-2H-indazol- 3-yl]phenyl}ethynyl)benzonjtrile; PJ) 3-{3-[(3-chlpro-2-fluorophenyl)ethynyl]phenyl}-2-(2,4,6- trifluorobenzyl)-7-(trifluoromethyl)-2H-indazole; pk) [3-({3-[2-(2,,4,6-trifluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]phenyl}ethynyl)phenyl]methanol; pi) 4-amino-3-(2-{3-[2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyl)-2H- indazol-3-yI]phenyl}ethyl)benzonitrile; pm) 3-{3-[(2,3-dichlorophenyl)ethyny!]phenyl}-2-(2,4,6-trifluorobenzyl)-7- (trifluoromethyl)-2H-indazole; pn) 3-{l-[5-chloro-2-(trifluoromethyl)benzyl]-lH-indol-6-yl}-2-(2,4,6- tri fluorobenzy l)-7-(tri fluoromethyl)-2H-indazo le; po) 3-(l-benzyl-lH-indol-6-yl)-2-(2)4,6-trifluorobenzyl)-7-(trifluoromethyl)- 2H-indazole; pp) 3-[l-(2,6-dichlorobenzyl)-lH-indol-6-yl]-2-(2,4,6-trifluorobenzyl)-7- (trifluoromethyl)-2H-indazole; pq) 3-[l-(2-chloro-4-fluorobenzyl)-lH-indol-6-yl]-2-(2,4,6-trifluorobenzyl)- 7-(trifluoromethyl)-2H-indazole; pr) 3-[l-(2-chIorobenzyl)-lH-indol-6-yl]-2-(2,4,6-trifluorobenzyl)-7- (trifluoromethyl)-2H-indazole; ps) 3-[l-(2-chloro-6-f!uorobenzyl)-lH-indol-6-yl]-2-(2,4,6-trifluorobenzyl)- 7-(trifluoromethyl)-2H-indazole; pt) 3-[l-(2,6-difluorobenzyl)-lH-indol-6-yl]-2-(2,4,6-trifluorobenzyl)-7- (trifluoromethyl)-2H-indazole; pu) 3-[l-(2-fluorobenzyl)-lH-indol-6-yl]-2-(2,4,6-trifluorobenzyl)-7- (trifluoromethyl)-2H-indazole; pv) 3-[l-(2,4-difluorobenzyI)-lH-indol-6-yI]-2-(2,4,6-trifluorobenzyl)-7- (trifluoromethyl)-2H-indazole; pw) 3-[l-(4-chlorobenzyl)-lH-indol-6-yl]-2-(2,4,6-trifluorobenzyl)-7- (trifluoromethyl)-2H-indazole; px) 3-{3-[2-(2,3-dichlorophenyl)ethyl]phenyl}-2-(2,4,6-trifluorobenzyl)-7- (trifluoromethyi)-2H-indazole; py) 3-{3-[2-(3-chloro-2-fluorophenyl)ethyl]phenyl}-2-(2,4,6-trifluorobenz\i)- 7-(trifluoromethyl)-2H-indazole; pz) [3-(2-{3-[2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]phenyl}ethyl)phehyl]methanol; qa) 3-(4-ethynylphenyl)-2-(2>4,6-trifluorobenzyl)-7-(trifluor9methyl)-2H- indazole; qb) ethyl 3-({4-[2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]phenyl}ethynyl)benzoate; qc) 3-({4-[2-(2,4;5-trifluorobenzyl)-7-(triflubromethyl)-2H-indazol-3- yljphenyl} ethynyl)benzoic acid; qd) N-[3-({3-[2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]phenyl}ethynyl)phenyl]morphoIine-4-carboxamide; qe) tert-butyl 4-({[3-({3-[2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyl)-2H- indazol-3-yl]phenyl} ethyny I)phenyl]am ino} carbonyl)piperazine-1 - carboxylate; qf) 2-methyl-N-[3-({3-[2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyl)-2H- indazol-3-yl]phenyl}ethynyl)phenyl]piperidine-l-carboxamide; qg) 3-methyl-N-[3-({3-[2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyI)-2H- indazol-3-yl]phenyl}ethynyl)phenyl]piperidine-l-carboxamide; qh) 4-methyl-N-[3-({3-[2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyl)-2H- indazol-3-yl]phenyl}ethynyl)phenyl]piperidine-l-carboxamide; qi) 3-(hydroxymethyJ)-N-[3-({3-[2-(2,4,6-trifluorobenzyl)-7- (trifluoromethyl)-2H-indazol-3-yl]phenyl}ethynyl)phenyl]piperidine-l- carboxamide; qj) N-isopropyl-N'-[3-({3-[2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyl)-2H- indazoI-3-yl]phenyl}ethynyl)phenyl]urea; qk) N,N-dipropyl-N'-[3-({3-[2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyl)-2H- indazol-3-yl]phenyl}ethynyI)phenyl]urea; ql) N-methy!-N'-[3-({3-[2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyl)-2H- indazol-3-yl]phenyl}ethynyl)phenyl]urea; qm) N,N-dimethyl-N'-[3-({3-[2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyl)- 2H-indazol-3-yl]phenyI}ethynyl)phenyl]urea; qn) 3-(4-{[2-chloro-5-(trifluoromethyI)phenyI]ethynyl}phenyl)-2-(2,4,6- trifluorobenzyl)-7-(trifluoromethyl)-2H-indazoIe; qo) 3-{4-[(2,4-difluorophenyl)ethynyl]phenyl}-2-(2,4,6-trifluorobenzyl)-7- (trifluoromethyl)-2H-indazole; qp) 3-{4-[(3,5-dimethylphenyl)ethynyl]phenyl}-2-(2,4,6-trifluorobenzyl)-7- (trifluoromethyl)-2H-indazole; qq) 3-{4-[(3-chloro-2-fluorophenyl)ethynyl]phenyl}-2-(2,4,6- trifluorobenzyl)-7-(trifluoromethyl)-2H-indazole; qr) 3-{4-[(2,3-dichIorophenyl)ethynyl]phenyl}-2-(2,4,6-trifluorobenzyl)-7- (trifluoromethyl)-2H-indazole; qs) 3-{4-[(2,3-dimethylphenyl)ethynyl]phenyl}-2-(2,4,6-trifluorobenzyl)-7- (trifluoromethyl)-2H-indazole; qt) tert-butyl 4-[3-({4-[2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyl)-2H- indazol-3-yl]phenyl}ethynyl)benzoyl]piperazine-l-carboxylate; qu) 3-(3-bromophenyl)-2-(4-chloro-2-fluorobenzyl)-7-(trifluoromethyl)-2H- indazole; qv) l-melhyl-3-[3-({3-[2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyl)-2H- indazol-3-yl]phenyl}ethynyl)phenyl]imidazolidin-2-one; qw) methyl [3-({3-[2-(2,4,6-trifluorobenzyI)-7-(trifluoromethyl)-2H-indazol- 3-yl]phenyl}ethynyl)phenyl]carbamate; qx) N-(methylsulfonyl)-N-[3-({3-[2-(2,4,6-trifluorobenzyl)-7- (trifluoromethyl)-2H-indazol-3- yl]phenyl}ethynyl)phenyl]methanesulfonamide; qy) 3-[3-(pyridin-3-ylethynyl)phenyl]-2-(2,4,6-trifluorobenzyl)-7- (trifluoromethyl)-2H-indazole; qz) 3-[3-(pyridin-4-ylethynyl)phenyl]-2-(2,4,6-trifluorobenzyl)-7- (trifluoromethyl)-2H-indazole; ra) 6-methyl-2-({3-[2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyl)-2H-indazol- 3-yl]phenyl}ethynyl)pyridin-3-ol; rb) 3-[3-(pyridin-2-ylethynyl)phenyl]-2-(2,4,6-trifluorobenzyl)-7- (trifluoromethyl)-2H-indazole; re) 2-({3-[2-(2,4,6-trifluorobenzyI)-7-(trifluoromethyI)-2H-indazol-3- yl]phenyl}ethynyl)pyridin-3-ol; rd) 2-{[3-[l-(2,6-dichlorobenzyl)-lH-indol-6-yl]-7-(trifluoromethyl)-2H- indazol-2-yl]methyl}-3,3-difluorophenol; re) 2-{[3-[l-(2-chloro-6-fluorobenzyl)-lH-indol-6-yl]-7-(trifluoromethyl)- 2H-indazol-2-yl]methyl}-3,5-difluorophenol; rf) tert-butyl 6-methyI-5-{3-[2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyI)- 2H-indazol-3-yl]phenoxy}-lH-indole-l-carboxylate; rg) tert-butyl 6-fluoro-5-{3-[2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyl)- 2H-indazol-3-yl]phenoxy}-lH-indole-l-carboxylate; rh) 5-{3-[2-(4-chloro-2-fluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy} -3,4-dihydronaphthalen-1 (2H)-one; ri) 3-(3-bromophenyl)-2-(2-chloro-4-fluorobenzyl)-7-(trifluoromethyl)-2H- indazole; rJ) 3-{3-[4-(morpholin-4-ylsulfonyl)phenoxy]phenyl}-2-(2,4,6- trifluorobenzyI)-7-(trifluoromethyl)-2H-indazole; rk) 3-{3-[4-(pyrrolidin-l-ylsulfonyl)phenoxy]phenyl}-2-(2,4,6- trifluorobenzyl)-7-(trifluoromethyl)-2H-indazole; rl) N-propyl-4-{3-[2-(2,4,6-trifluorobenzyl)-7-(trifluororaethyl)-2H-inda/.ol- 3-yl]phenoxy} benzenesulfonamide; rm) N-ethyl-N-methyl-4-{3-[2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyl)-2H- indazol-3-yl]phenoxy}benzenesulfonamide; rn) N,N-diethyI-4-{3-[2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyl)-2H- indazol-3-yl]phenoxy}benzenesulfonamide; ro) 3-{3-[4-(piperidin-l-ylsulfonyl)phenoxy]phenyl}-2-(2,4,6- trifluorobenzyl)-7-(trifluoromethyl)-2H-indazole; rp) N,N-dimethyl-4-{3-[2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyl)-2H- indazol-3-yl]phenoxy} benzenesulfonamide; rq) 4-fluoro-2-({3-[2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyl)-2Fl-indazol- 3-yl]phenyl}ethynyl)aniline; rr) 4-chloro-2-fluoro-6-({3-[2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyl)-2H- indazol-3-yl]phenyl}ethynyl)aniline; rs) methyl [4-fluoro-2-({3-[2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyl)-2H- indazol-3-yl]phenyl}ethynyl)phenyl]carbamate; rt) 3-[3-(5-nuoro-lH-indol-2-yi)phenyl]-2-(2,4,6-trifluorobenzyl)-7- (trifluoromethyl)-2H-indazole; ru) 3-[3-(5-fluoro-l-methyl-lH-indol-2-yl)phenyl]-2-(2,4,6-trifluorobenzyD- 7-(trifluoromethyl)-2H-indazole; rv) 2-benzyl-3-(4-methoxyphenyl)-7-(trifluoromethyl)-2H-indazole; rvv) 2-benzyl-3-ethyl-7-(trifluoromethyl)-2H-indazoIe; rx) 4-[({3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]benzyl}oxy)methyl]benzoicacid; ry) N-{4-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3-yl]phenyl}-N- phenylamine; rz) [4-({3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenyl}amino)phenyl]acetic acid; sa) [4-({-4-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenyl}amino)phenyl]aceticacid; sb) 2-benzyl-3-[4-(benzyloxy)phenyl]-7-(trifluoromethyl)-2H-indazole; sc) 3-[4-({4-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenyl}amino)phenyl]propanoic acid; sd) 3-[4-({3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenyl}amino)phenyl]propanoic acid; se) 3-[3-({4-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenyl}amino)phenyl]propanoic acid; sO 3-[3-({3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenyl}amino)phenyl]propanoic acid; sg) 2-[4-({4-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenyl}amino)phenoxy]-2-methylpropanoicacid; sh) 2-[4-({3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenyl}amino)phenoxy]-2-methylpropanoicacid; si) 2-{4-[({4-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenyl}amino)methyl]phenyl}propanoic acid; sj) ethyl [4-({4-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3 yl]phenyl}amino)phenyl]acetate; sk) methyl 3-[3-({4-[2-benzyl-7-(trifluoromethyl)-2H-indazol-5- yl]phenyl}amino)phenyl]propanoate; si) methyl 3-[3-({3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenyl}amino)phenyl]propanoate; sm) methyl 2-[4-({4-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenyl}amino)phenoxy]-2-methylpropanoate; sn) methyl 2-[4-({3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-?- yI]phenyl}amino)phenoxy]-2-methylpropanoate; so) methyl 2-{4-[({4-[2-benzyI-7-(trifluoromethyl)-2H-indazol-3- yl] pheny 1} am ino)methyl] phenyl} propanoate; sp) 2-[4-({4-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}methyl)phenyl]propanoic acid; sq) methyl 2-{4-[({3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl] pheny 1} amino)methyl]phenyl} propanoate; -sr) 2-{4-[({3-[2-benzyI-7-(trifluoromethyl)-2H-indazol-3- yl]phenyl}amino)methyl]phenyl}propanoicacid; ss) methyl 3-[3-({3-[2-benzyI-7-(trtfluoromethyl)-2H-indazol-3- yl]phenyl}amino)phenyl]butanoate; st) methyl 3-[4-({3-[2-benzyl-7-(trifluorornethyl)-2H-indazol-3- yl]phenyl}amino)phenyl]butanoate; su) methyl : {4-[({3-[2-benzyl-7-(trifluoromethyI)-2H-indazol-3- yl]phenyl}amino)methyl]phenyl} acetate; sv) methyl [3-({4-[2-benzyl-7-(trifluoromethyl)-2H-indazoI-3- yl]phenyl}amino)phenyl]acetate; sw) methyl [3-({3-[2-benzyI-7-(trifluoromethyl)-2H-indazol-3- yl]phenyl}amino)phenyl]acetate; . sx) 3-[3-({3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenyl}amino)phenyl]butanoic acid; sy) 3-[4-({3-[2-benzyl-7-(trifluoromethyl)-2H-indazoI-3- yl]phenyl}amino)phenyl]butanoic acid; sz) [3-({3-[2-benzyl-7-(trifluoromethyl)-2H-indazoI-3- yl]phenyl}amino)phenyl]acetic acid; ta) [3-({4-[2-benzyl-7-(trifluoromethyI)-2H-indazol-3- yl]phenyl}amino)phenyl]acetic acid; tb) {4-[({3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenyl}amino)methyl]phenyl}acetic acid; tc) 1 -[4-({3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}methyl)phenyl]cyclopentanecarboxylic acid; td) 2-[4-({3-[2-bcnzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}methyl)phenyl]-2-methylpropanoic acid; te) {3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3-yl]phenyl}amine; if) {4-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3-yl]phenyl}amine; tg) methyl 2-[3-({4-[2-benzyl-7-(trifluoromethyI)-2H-indazol-3- yl]phenyl}amino)phenyl]propanoate; th) methyl {4-[({4-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenyl} amino)methyl]phenyl} acetate; ti) 2-[3-({4-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenyl}amino)phenyl]propanoic acid; tj) (4-[({4-[2-benzyI-7-(trifluoromethyl)-2H-indazol-3- - yl]phenyl}amino)methyl]phenyl}acetic acid; tk) methyl 2-[3-({3-[2-benzyl-7-(trifluoromethyl)-2H-indazoI-3- yl]phenyl}amino)phenyl]propanoate; tl) 2-[3-({3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenyl}amino)phenyl]propanoic acid; tm) 2-benzyl-3-(3-{[4-(l H-tetrazol-5-yl)benzyl]oxy}phenyl)-7- (trifluoromethyl)-2H-indazole; tn) ethyl hydrogen [4-({3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy)methyl)benzyl]phosphonate; to) ethyl {3-[({4-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenyl}amino)methyl]phenyl} acetate; tp) ethyl {3-[({3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenyl}amino)methyl]phenyl}acetate; tq) methyl l-{4-[({4-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenyl}amino)methyl]phenyl}cyclopropanecarboxylate; tr) methyl l-{4-[({3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- y IJphenyl Jam ino)methyl] phenyl} eye lopropanecarboxy late: ts) 4-({3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy} methyl)benzonitri le; tt) {3-[({4-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenyl}amino)methyl]phenyl}acetic acid; tu) (3-[({3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenyl}amino)methyl]phenyl}acetic acid; tv) l-{4-[({3-[2-bcnzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenyl}amino)methyl]phenyl}cyclopropanecarboxylic acid; tvv) N-{3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3-yl]phenyI}-N-(2.6- dimethylbenzyl)amine; tx) [3-({4-[2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyl)-2H-indazoI-3- yl]phenyl} amino)phenyl]acetic acid; ty) 2-[3-({4-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenyi}aminb)phenyl]-2-hydrbxypropan6ic acid; tz) N-{4-[2-berizyl-7-(trifluoromethyl)-2H-indakol-3-yl]phenyl}-N-(2,6- dimethylbenzyl)amine; ua) [3-({4-[l-rnethyl-7-(trifluoromethyl)-lH-ind"zol-3- yl]phenyl}amino)phenyl]acetic acid; ub) [3-({4-[2-methyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenyl}amino)phenyl]aceticacid; uc) {4-[({4-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenyl}amino)methyl]-3,5-dimethylphenyl}acetic acid; ud) {4-[({3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenyl}amino)methyl]-3,5-dimethylphenyl}acetic acid; ue) [3-({4-[2-(4-chloro-2-fluorobenzyl)-7-(trifluoromethyI)-2H-indazol-3- yl]phenyl}amino)phenyl]aceticacid; uO [3-({4-[2-(2,4-dimethylbenzyI)-7-(trifluoromethyl)-2H-indazol-3- yl]phenyl}amino)phenyl]aceticacid; ug) {3-[2-(4-chloro-2-fluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}(phenyl)acetic acid; uh) 2-benzyl-3^{3-[(2,5-difluorophenoxy)methyl]phenyl}-7-(trifluoromethyI)- 2H-indazole; ui) 2-(4-chloro-2-fluorobenzyl)-3-[3-(4-methoxybenzyl)phenyl]-7- (trifluoromethyl)-2H-indazole; uj) 2-(4-chloro-2-fluorobenzyl)-3-[3-(3,5-dimethoxybenzyl)phenyl]-7- (trifluoromethyl)-2H-indazole; uk) 2-(4-chloro-2-fluorobenzyl)-3-[3-(3,5-dimethylbenzyl)phenyl]-7- (trifluoromethyl)-2H-indazole; ul) 2-(4-chloro-2-nuorobenzyl)-3-{3-[(2,3- dimethylphenoxy)methyl]phenyl}-7-(trifluoromethyl)-2H-indazole; urn) 2-(4-chloro-2-fluorobenzyl)-3-(3-{[2-chIoro-5- (trifluoromethyI)phenoxy]methyI}phenyl)-7-(trifluoromethyl)-2H- indazole; un) 2-(4-chIpro-2-fluorobenzyl)-3-(3-{[2-chloro-3- (trifluoromethyl)phenoxy]methyl}phenyl)-7-(trifluoromethyI)-2H- indazole; uo) 2-(4-chloro-2-fluorobenzyI)-3-{3-[(l-naphthyloxy)methyl]phenyl}-7- (trifluororriethyl)-2H-indazole; up) 3-{3-[(2-tert-butyl-5-methylphenoxy)methyl]phenyl}-2-(4-chIoro-2- fluorobenzyl)-; uq) 7-(trifluoromethyl)-2H-indazole; ur) 2-(4-chIoro-2-fluorobenzyI)-3-{3-[(4-fluoro-2- methylphenoxy)methyl]phenyl}-7-(trifluoromethyl)-2H-indazole; us) 2-(4-chloro-2-fluorobenzyl)-3-{3-[(2,6- dimethylphenoxy)methyl]phenyl} -7-(trifluoromethyl)-2H-indazole; ut) 5-({3-[2-(4-chloro-2-fluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]benzyl}oxy)-3,4-dihydronaphthalen-l(2H)-one; uu) 2-(4-chloro-2-fluorobenzyl)-3-[3-(2-methoxybenzyl)phenyl]-7- (trifluoromethyl)-2H-indazole; uv) 2-(4-chIoro-2-fluorobenzyl)-3-[3-(3-methoxybenzyl)phenyI]-7- (trifluoromethyl)-2H-indazo!e; uw) 2-(4-chloro-2-fluorobenzyI)-3-[3-(2,3-dimethoxybenzyl)phenyl]-7- (trifluoromethyl)-2H-indazole; ux) 2-(4-chloro-2-fluorobenzyl)-3-(3-{[(3,3-dimethyl-2,3-dihydro-l- benzofuran-7-yl)oxy]methy!}phenyl)-7-(trifluoromethyl)-2H-indazole; uy) 3-{3-[(2-tert-butylphenoxy)methyl]phenyl}-2-(4-chloro-2-fluorobenzyl)- 7-(trifluoromethyl)-2H-indazole; uz) 2-(4-chloro-2-nuorobenzyl)-3-{3-[(2,3- dimethoxyphenoxy)methyl]phenyI}-7-(trifluoromethyl)-2H-indazole; va) 2-(4-chloro-2-fluorobenzyl)-3-[3-(3,4-dimethoxybenzyl)phenyl]-7- (trifluoromethyl)-2H-indazole; vb) 2-(4-chloro-2-fluorobenzyl)-3-[3-(4-chloro-2-fluorobenzyl)phenyl]-7- (trifluoromethyl)-2H-indazole; vc) 2-(4-chIoro-2-fluorobenzyI)-3-[3-(2-chloro-4-fluorobenzyl)phenyI]-7- (trifluoromethyl)-2H-indazole; vd) 2-(4-chIoro-2-fluorobenzyl)-3-{3-[2-fluoro-4- (trifluoromethyl)benzyl]phenyl}-7-(trifluoromethyl)-2H-indazole; ve) 3-{3-[2,4-bis(trifluoromethyl)benzyl]phenyl}-2-(4-chloro-2- fluorobenzyl)-7-(trifluoromethyl)-2H-indazole; vf) 2-(4-chloro-2-fluorobenzyl)-3-[3-(2,4-difluorobenzyl)phenyl]-7- (triflu6romethyl)-2H-indazble; vg) 3-{3-[2,5-bis(trifluoromethyl)benzyl]phenyl}-2-(4-chloro-2- fluorobenzyl)-7-(trifluoromethyl)-2H-indazole; vh) 2-(4-chloro-2-fluorobenzyl)-3-{3-[(2,6-dichlorophenoxy)methyI]phenyi}- 7-(trifluoromethyI)-2H-indazole; vi) 2-(4-chloro-2-fluorobenzyl)-3-{3-[(2,6- dimethoxyphenoxy)methyl]phenyl}-7-(trifluoromethyl)-2H-indazole; vj) 2-(4-chloro-2-fluorobenzyl)-3-{3-[(2,6-dibromophenoxy)methyl]phenyl}- 7-(trifluoromethyl)-2H-indazole; vk) 2-(4-chloro-2-fluorobenzyl)-3-[3-(2-fluoro-3-methylbenzyl)phenyl]-7- (trifluoromethyl)-2H-indazole; vl) 2-(4-chloro-2-fluorobenzyl)-3-[3-(6-chloro-2-fluoro-3- methylbenzyl)phenyl]-7-(trifluoromethyI)-2H-indazole; vm) 3-{3-[(2-allyI-6-methylphenoxy)methyl]phenyl}-2-(4-chloro-2- fluorobenzyl)-7-(trifluoromethyl)-2H-indazole; vn) 2-(4-chloro-2-nuorobenzyl)-3-{3-[(2,6- diisopropylphenoxy)methyl]phenyl}-7-(trifluoromethyl)-2H-indazole; vo) 3-{3-[(2-tert-butyl-6-methylphenoxy)methyl]phenyl}-2-(4-chIoro-2- fluorobenzyl)-7-(trifluoromethyl)-2H-indazoIe; vp) 3-{3-[(2-allyl-6-methoxyphenoxy)methyl]phenyl}-2-(4-chloro-2- fluorobenzyl)-7-(trifluoromethyl)-2H-indazole; vq) 2-(4-chloro-2-fluorobenzyl)-3-{3-[(2,5-dichlorophenoxy)methyl]phenyl}- 7-(trifluoromethyl)-2H-indazole; vr) 2-(4-chloro-2-fluorobenzyJ)-3-{3-[(2,6-difluorophenoxy)methyl]phenyl}- 7-(trifluoromethyl)-2H-indazole; vs) 2-(4-chloro-2-fluorobenzyl)-3-{3-[3-(difluoromethoxy)benzyl]phenyl}-7- (trifluoromethyl)-2H-indazole; vt) 2-(4-chIoro-2-fluorobenzyl)-3-[3-(2-phenylethyl)phenyl]-7- (trifluoromethyl)-2H-indazole; vu) 3-({3-[2-(4-chloro-2-fluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}methyI)-N-propylbenzamide; vv) N-benzyl-3-({3-[2-(4-chloro-2-fluorobenzyl)-7-(trifluoromethyl)-2H- indaz6l-3-yl]phenoxy} methyl)benzamide; vw) 3-({3-[2-(4-chl6rb-2-fluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}methyl)-N-cyclopropylbenzamide; vx) 2-(4-chl6rd-2-fluor6benzyl)-3-(3-{[3-(morpholin-4- ylcarbonyl)benzyI]oxy}phenyl)-7-(trifluoromethyl)-2H-indazole; vy) 1-({3-[2-(4-chloro-2-fIuorobenzyl)-7-(trifluoromethyl)-2H-indazoI-3- yl]phenoxy}methyl)-N-isoprbpylbenzamide; vz) 2-benzyl-3-[4-(benzyloxy)phenyl]-7-(trifluoromethyl)-2H-indazole; wa) 2-benzyI-3-{4-[(3-methoxybenzyI)oxy]phenyl} -7-(trifluoromethyl)-2H- indazole; wb) 2-benzyl-3-{4-[(2-chlorobenzyl)oxy]phenyl}-7-(trifluoromethyl)-2H- indazole; we) 2-benzyl-7-(trifIuoromethyl)-3-(4-{[2- (trifluoromethyl)benzyl]oxy}phenyl)-2H-indazole; wd) 2-benzyl-3-{4-[(3-methylbenzyl)oxy]phenyI}-7-(trifluoromethyl)-2H- indazole; we) 2-benzyl-3-{4-[(2-methylbenzyl)oxy]phenyl}-7-(trifluoromethyJ)-2H- indazole; wf) 2-benzyl-3-{4-[(3-chlorobenzyl)oxy]phenyl}-7-(trifluoromethyl)-2H- indazole; wg) 2-benzyl-7-(trifluoromethyl)-3-(4-{[3- (trifluoromethyl)benzyl]oxy}phenyl)-2H-indazole; wh) 2-benzyl-3-{4-[(3,5-dimethylbenzyl)oxy]phenyl}-7r(trifluoromethyl)-2H- indazole; wi) 2-benzyl-3-{4-[(2,6-dichlorobenzyI)oxy]phenyl}-7-(trifluoromethyl)-2H- indazole; wj) 2-benzyl-3-{4-[(3,5-dichlorobenzyl)oxy]phenyl}-7-(trifluoromethyl)-2H- indazole; wk) 2-benzyl-3-{3-[(3-methoxybenzyl)oxy]phenyl}-7-(trifluoromethyl)-2H- indazole; vvl) 2-benzyl-3-{3-[(2-chlorobenzyl)oxy]phenyl}-7-(trifluoromethyl)-2H- indazole; wm) 2-benzyl-7-(trifluoromethyl)-3-(3-{[2- (trifluoromethyI)benzyl]oxy}phenyl>2H-indazole; wn) 2-benzyl-3-{3-[(3-methylbenzyI)oxy]phenyl}-7-(trifluoromethyl)-2H- indazole; wo) 2-benzyl-3-{3-[(2-methylbenzyl)oxy]phenyI}-7-(trifluoromethyl)-2H- indazole; wp) 2-benzyl-7-(trifluoromethyl)-3-(3-{[3- (trifluoromethyl)benzyl]oxy}phenyl)-2H-indazole; wq) 2-benzyl-3-(3-{[3,5-bis(trifluoromethyl)benzyI]oxy}phenyl)-7- (trifluoromethyl)-2H-indazole; wr) 2-benzyl-3-{3-[(3,5-dimethylbenzyl)oxy]phenyl}-7-(trifluoromethyl)-2H- indazole; ws) 2-benzyl-3-{3-[(2,6-dichlorobenzyl)oxy]phenyl}-7-(trifluoromethyl)-2H- indazole; wt) 2-benzyl-3-{3-[(3,5-dichlorobenzyl)oxy]phenyl}-7-(trifluoromethyl)-2H- indazole; wu) l-[4-({3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy} methyl)phenyl]cyclopentanecarboxylic acid; wv) l-[4-({3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yljphenoxy} methyl)phenyl]cyclopropanecarboxylic acid; ww) 2-benzyl-3-{3-[(2,6-dimethylbenzyl)oxy]phenyl}-7-(trifluoromethyl)-2H- indazole; vvx) 2-[4-({3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}methyl)phenyl]-2-methylpropanoic acid; wy) 2-benzy!-3-{3-[(2-fluorobenzyl)oxy]phenyl}-7-(trifluoromethyl)-2H- indazole; wz) 2-benzyl-3-{3-[(2-fluoro-6-nitrobenzyl)oxy]phenyl}-7-(trifluoromethyl)- 2H-indazole; xa) 2-benzyl-3-{3-[(2-chloro-6-fluorobenzyl)oxy]phenyl}-7- (trifluoromethyl)-2H-indazole; xb) 2-benzyl-3-{3-[(2,6-difluorobenzyl)oxy]phenyl}-7-(trifluoromethyl)-2H- indazole; xc) 2-benzyl-3-{4-[(2-fluorobenzyl)oxy]phenyl}-7-(trifluoromethyl)-2H- indazole; xd) 2-benzyl-3-{4-[(2-chloro-6-fluorobenzyl)oxy]phenyl}-7- (trifluoromethyl)-2H-indazole; xe) 2-benzyl-3-{4-[(2,6-difluorobenzyl)oxy]phenyl}-7-(trifluorotnethyl)-2H- indazole; xf) 2-benzyl-3-(3-{[3-(lH-tetrazol-5-yl)benzyl]oxy}phenyl)-7- (trifluoromethyl)-2H-indazole; xr> 2-benzyl-3-(4-{[4-(lH-tetrazol-5-yl)benzyl]oxy}phenyl)-7- (trifluoromcthyl)-2H-indazole; xh) [4-({3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}methyl)benzyl]phosphonicacid; xi) [3-({3-[2-benzyl-7-(trifluoromethyI)-2H-indazol-3- yl]phenoxy} methyl)phenyl]acetic acid; xj) 3-[2-benzyI-7-(trifluorotnethyl)-2H-indazol-3-yI]phenyI acetate; xk) 2-benzyl-3-{4-[(2-fluoro-6-nitrobenzyl)oxy]phenyl}-7-(trifluoromethyl)- 2H-indazole; xl) 4-({3-[2-benzyl-7-(trifluoromethyl)-2H-indazoi-3- yl]phenoxy}methyl)phenyl acetate; xm) diethyl [4-({3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}methyl)benzyl]phosphonate; xn) diethyl [4-({4-[2-benzyI-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}methyl)benzyl]phosphonate; xo) 3-({3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}methyl)benzonitrile; xp) 4-( (4-[2-benzyl-7-(tri fluoromethyl)-2H-i ndazol-3- yl]phenoxy}meihyl)benzonitrile; xq) ethyl hydrogen [4-({4-[2-benzyI-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}methyl)benzyl]phosphonate; xr) [4-({4-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}methyl)benzyl]phosphonicacid; xs) 2-(2,4-dimethylbenzyl)-3-{3-[(2,6-dimethylbenzyl)oxy]phenyl}-7- (trifluoromethyl)-2H-indazole; xt) 3-{3-[(2,6-dimethylbenzyl)oxy]phenyl}-2-(2,4,6-trinuorobenz>l)-7- (trifluoromethyl)-2H-indazole; xu) 3-{3-[(2-fluoro-6-nitrobenzyl)oxy]phenyl}-2-(2,4,6-trifluorobenzyl)-7-(trifluorpmethyl)-2H-indazole; •'•" '•. '.. '.- ''"-•'•'- ' ' • xv) 2-benzyl-3-[4-(3-methoxyphenoxy)phenyl]-7-(trifluoromethyl)-2H- indazole; xw) 2-benzyl-3-[4-(2J3-difluorophenoxy)phenyl]-7-(trifluoromethyl)-2H- indazole; xx) 2-benzyl-3-[4-(4-chlorophenoxy)phenyl]-7-(trifluoromethyl)-2H- indazole; xy) 2-benzyl-3-[4-(2,3-dihydro-l H-inden-5-yloxy)phenyl]-7- (trifluoromethyl)-2H-indazole; xz) 2-benzyl-3-[4-(2-fluorophenoxy)phenyl]-7-(trifluoromethyl)-2H-indazole; ya) 2-benzyI-3-[4-(4-chloro-3-methylphenoxy)phenyI]-7-(trifluoromethyl)- 2H-indazole; yb) 2-benzyl-3-[4-(2-chlorophenoxy)phenyl]-7-(trifluoromethyl)-2H- indazole; yc) N-(3-{4-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3-yl]phenoxy}phenyl)- N,N-ditnethylam ine; yd) 2-benzyl-3-[4-(3 -nitrophenoxy)phenyl]-7-(tr ifluoromethy l)-2 H- i ndazo le; ye) 2-benzyl-3-{4-[(7-methoxy-2-naphthyl)oxy]phenyl}-7-(trifluoromethyI)- 2H-indazole; yf) 2-benzyl-3-[4-(4-fluorophenoxy)phenyl]-7-(trifluoromethyl)-2H-indazole; yg) 4-(4- {4-[2-benzyl-7-(trifluoromethy l)-2H-indazol-3 - yl]phenoxy}benzyl)phenol; yh) 2-benzyl-3-[4-(5,6,7,8-tetrahydronaphthalen-2-yloxy)phenyl]-7- (trifiuoromethyl)-2H-indazole; yi) 7-{4-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3-yl]phenoxy}quinoline: yj) 2-benzyl-3-[4-(2,4-dichlorophenoxy)phenyl]-7-(trifluoromethyl)-2H- indazole; yk) 2-benzyl-3-[4-(2-methoxyphenoxy)phenyl]-7-(trifluoromethyl)-2H- indazole; yl) 2-benzyl-3-[4-(3,5-difluorophenoxy)phenyl]-7-(trifluoromethyl)-2H- indazole; ym) 2-benzyl-3-[4-(2,3-dimethylphenoxy)phenyI]-7-(trifluoromethyI)-2H- indazole; yn) 2-benzyI-3-[4-(3,5-dimethyIphenoxy)phenyl]-7-(trifluoromethyl)-2H- indazole; yo) 2-(2,4-difluorobenzyl)-3-{3-[(2,6-dimethylbenzyl)oxy]phenyl}-7- (trifluoromethyl)-2H-indazole; yp) 2-(4-chloro-2-fluorobenzyl)-3-{3-[(2,6-dimethylbenzyI)oxy]phenyl}-7- (trifluoromethyl)-2H-indazole; yq) 2-(2-chloro-4-fluorobenzyl)-3-{3-[(2,6-dimethylbenzyl)oxy]phenyl}-7- (trifluoromethyl)-2H-indazole; yr) 2-benzyI-3-{3-[(3,5-dimethoxybenzyl)oxy]phenyl}-7-(trifluoromethyl)- 2H-indazo!e; ys) 2-benzyl-3-{4-[(2,6-dimethylbenzyl)oxy]phenyl}-7-(trifluoromethyl)-2H- indazole; yt) 2-(2,4-dichlorobenzyl)-3-{3-[(2,6-dimethylbenzyl)oxy]phenyl}-7- (trifluoromethyl)-2H-indazole; yu) 2-benzyl-3-[4-(4-methylphenoxy)phenyl]-7-(trifIuoromethyI)-2H- indazole; yv) 2-benzyl-3-[4-(4-nitrophenoxy)phenyI]-7-(trifluoromethyl)-2H-indazole; yw) 2-benzyl-3-{4-[(4'-nitro-l,r-biphenyl-4-yl)oxy]phenyl}-7- (trifluoromethyl)-2H-indazoIe; yx) 3- (4-[4-(4-acetylpiperazin-1 -yl)phenoxy]phenyl} -2-benzy 1-7- (trifluoromethyl)-2H-indazoIe; yy) 2-benzyl-3-{3-[(2,5-dimethylbenzyl)oxy]phenyl}-7-(trifluoromethyl)-2H- indazole; yz) 2-benzyl-3-(3-{[2-fluoro-6-(trifluoromethyl)benzyl]oxy}phenyl)-7- (trifluoromethyl)-2H-indazole; za) 2-[4-({3-[2-(2,4-dimethylbenzyl)-7-(trifluoromethyl)-2H-indazoi-3- yl]phenoxy}methyl)phenyl]-2-methylpropanoic acid; zb) 2-methyl-2-[4-({3-[2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyl)-2H- indazol-3-yl]phenoxy}methyl)phenyl]propanoicacid; zc) 2-[4-({3-[2-(2,4-dimethylbenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}methyl)phenyl]propanoic acid; zd) 2-[4-({3-[2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}methyl)phenyl]propanoic acid; ze) 2-(2,4-dimethylbenzyl)-3-{3-[(2-fluoro-6-nilrobenzyl)oxy]phenyl}-7- (trifluoromcthyl)-2H-indazole; zf) 3-({3-[2-(2,4-dimethyIbenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy} methyl)benzonitrile; zg) 3-[3-(benzyloxy)phenyl]-2-(2,4-dimethylbenzyl)-7-(trifluoromethyl)-2H- indazole; zh) 2-(4-chloro-2-fluorobenzyI)-3-{3-[(2-fluoro-6-nitrobenzyl)oxy]puenyl}- 7-(trifluoromethyI)-2H-indazole; zi) 3-({3-[2-(4-chIoro-2-fluorobenzyl)-7-(trifluoromethyI)-2H-indazol-3- yl]phenoxy}methyl)benzonitrile; zj) 2-{3-[2-(4-chIoro-2-fluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yljphenoxy} -2-(4-methylphenyl)propanoic acid; zk) 2-benzyl-3-[4-(2,4-difluorophenoxy)phenyl]-7-(trifluoromethyl)-2H- indazole; zl) 2-benzyl-3-[4-(3,4-dimethylphenoxy)phenyl]-7-(trifluoromethyl)-2H- indazole; zm) 2-benzyl-3-[4-(2-isopropylphenoxy)phenyl]-7-(trifluoromethyl)-2H- indazole; zn) 5-{4-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3-yl]phenoxy}-3.4- dihydronaphthalen-1 (2H)-one; zo) 6-{4-[2-benzyl-7-(trifluoromethyl)-2H-indazoI-3-yl]phenoxy}quino!ine; zp) 2-benzyI-3-[4-(2,6-dimethoxyphenoxy)phenyl]-7-(trifluoromethyI)-2H- indazole; zq) 2-benzyl-3-[4-(2-methylphenoxy)phenyI]-7-(trifluoromethyl)-2H- indazole; zr) 2-[4-({3-[2-(4-chloro-2-fluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}methyl)phenyl]propanoicacid; zs) 2-benzyI-3-[4-(3,4-dichlorophenoxy)phenyl]-7-(trifluoromethyl)-2H- indazole; zt) 2-benzyl-3-[4-(3,4-difluorophenoxy)phenyl]-7-(trifluoromethyl)-2H- indazole; zu) 2-benzyl-3-[4-(2,5-difluorophenoxy)phenyl]-7-(trifluoromethyl)-2H- indazole; zv) 8-{4-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3-yl]phenoxy}quinolinc: zw) 2-benzyl-3-[4-(4-ethyIphenoxy)phenyl]-7-(trifluoromethyl)-2H-indazolc; zx) 2-benzyl-3-[4-(2,6-difluorophenoxy)phenyl]-7-(trifluoromethyl)-2H- indazole; zy) 2-benzyl-3-{4-[4-(benzyloxy)phenoxy]phenyl}-7-(trifluoromethyl)-2H- indazole; zz) 2-benzyI-3-[3-(354-dichlorophenoxy)phenyl]-7-(trifluoromethyl)-2H- indazole; ggggg) methyl 3-(4-{3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy} phenyl)propanoate; hhhhh) l-(2-{3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}phenyl)ethanone; iiiii) l-(3-{3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}phenyl)ethanone; jjjjj) 2-benzyl-3-[3-(3-methylphenoxy)phenyI]-7-(trifluoromethyl)-2H- indazole; kkkkk) 2-benzyl-3-[3-(2-chIorophenoxy)phenyl]-7-(trifluoromethyI)-2H- indazole; lllll) (3-{3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy} phenyl)dimethylamine; aag) 2-benzyl-3-[3-(3-nitrophenoxy)phenyl]-7-(trifluoromethyl)-2H-indazole; aah) 2-benzyl-3-[3-(2,3-dimethylphenoxy)phenyI]-7-(trifluoroniethyl)-2H- indazole; aai) 2-benzyI-3-{3-[2-(trifluoromethoxy)phenoxy]phenyl}-7- (trifluoromethyl)-2H-indazole; aaj) 2-benzyl-3-[3-(3-methoxyphenoxy)phenyl]-7-(trifluoromethyl)-2H- indazole; aak) methyl 3-{3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}benzoate; aal) 5-{3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3-yl]phenoxy}-3,4- d i hydronaphlhalen-1 (2H)-one; aam) 7-{3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3-yl]phenoxy}quinoline; aan) 2-benzyl-3-[3-(2-isopropylphenoxy)phenyl]-7-(trifluoromethyl)-2H- indazole; aao) 8-{3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3-yl]phenoxy}quinoline: aap) 2-benzyl-3-{3-[3,5-bis(trifluoromethyl)phenoxy]phenyI}-7- (trifluoromethyl)-2H-indazoJe; aaq) 2-benzyl-3- {3-[(7-methyl-1 -naphthyl)oxy]phenyl} -7-(trifluoromethyl)- 2H-indazole; aar) 4-{3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3-yl]phenoxy}acridine; aas) 2-benzyl-3-{3-[2-(benzyloxy)phenoxy]phenyl}-7-(trifluoromethyl)-2H- indazole; aat) (2-{3-[2-benzyl-7-(trifluoromethyl)-2H-indazoi-3- yl]phenoxy}phenyl)(phenyl)methanone; aau) 2-benzyI-3-[3-(biphenyl-2-yloxy)phenyl]-7-(trifluoromethyl)-2H- indazole; aav) 2-(2-{3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3-yl]phenoxy}phenyl)- 1,3-benzothiazole; aaw) 2-benzyl-3-{3-[2-(l H-pyrrol-1 -yl)phenoxy]phenyl}-7-(trifluoromethyl)- 2H-indazole; aax) 2-benzyI-3-[3-(3,4-difluorophenoxy)phenyl]-7-(trifluoromethyl)-2H- indazole; aay) 2-benzyl-3-[3-(2,3-difluorophenoxy)phenyl]-7-(trifluoromethyl)-2H- indazole; aaz) 2-benzyI-3-[3-(2,5-difluorophenoxy)phenyl]-7-(trifluoromethyl)-2H- indazole; qqqqq) 2-benzyl-3-{3-[(7-methoxy-2-naphthyl)oxy]phenyl}-7-(trifluoromethyl)- 2H-indazole; rrrrr) 1 -(2-{3-[2-benzyI-7-(trifluoromethyl)-2H-indazoI-3-yl]phenoxy} -4- methoxyphenyl)ethanone; sssss) 6-{3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3-yl]phenoxy}quinoIine; ttttt) 2-benzyl-3-[3-(3,5-dimethylphenoxy)phenyl]-7-(trifluoromethyl)-2H- indazole; uuuuu) 2-benzyl-3-[3-(2-methoxyphenoxy)phenyl]-7-(trifluoromethyl)-2H- indazole; vvvvv) 2-benzyl-3-[3-(l-naphthyloxy)phenyI]-7-(tri£luoromethyl)-2H-indazole; wwwww) 2-benzyl-3-(3- {2-[( 1 E)-prop-1 -en-1 -yl]phenoxy } phenyl)-7- (trifluoromethyl)-2H-indazole; abh) 2-benzyl-3-[3-(3,5-difluorophenoxy)phenyl]-7.-(trifluoromethyl)-2H- indazole; abi) 2-benzyl-3-[3-(3,5-dichlorophenoxy)phenyI]-7-(trifluoromethyl)-2H- indazole; abj) 2-benzyl-3-[3-(3,5-dimethoxyphenoxy)phenyl]-7-(trifluoroniethyl)-2H- indazole; abk) 2-(4-chloro-2-fluorobcizyI)-3-{3-[2-chloro-5- ' (trifluoromethyl)benzyl]phenyl}-7-(trifluoromethyl)-2H-indazoIe; abi) 2-(4-chloro-2-fluorobenzyl)-3-{3-[4-(methylsulfonyl)benzyl]phenyI}-7- (trifluoromethyl)-2H-indazole; abm) 2-(4-chloro-2-fluorobenzyl)-3-{3-[2-methyI-5- (trifluoromethyl)benzyl]phenyl}-7-(trifluoromethyl)-2H-indazole; abn) 2-(4-chloro-2-fluorobenzyl)-3-[3-(2-chloro-5-fluorobenzyl)phenyI]-7- (trifluoromethy!)-2H-indazole; abo) 2-(4-chloro-2-fluorobenzyl)-3-{3-[5-fluoro-2- (trifluoromethyl)benzyl]phenyI}-7-(trifluoromethyl)-2H-indazole; abp) 2-(4-chloro-2-fluorobenzyl)-3-[3-(2,5-dichlorobenzyl)phenyI]-7- (trifluoromethyl)-2H-indazole; abq) 2-(4-chloro-2-fluorobenzyl)-3-{3-[5-chloro-2- (trifluoromethyl)benzyl]phenyl}-7-(trifluoromethyl)-2H-indazole; abr) 2-(4-chloro-2-fluorobenzyl)-3-{3-[3-(morpholin-4- ylcarbonyl)benzyl]phenyl}-7-(trifluoromethyl)-2H-indazole; abs) N-benzyl-3-{3-[2-(4-chloro-2-fluorobenzyl)-7-(trifluoromethyl)-2H- indazol-3-yl] benzyl} benzam ide; abt) 2-(4-chloro-2-fluorobenzyI)-3-{3-[3-(pyrrolidin-1 - ylcarbonyl)benzyl]phenyl}-7-(trifluoromethyl)-2H-indazole; abu) 2-(4-chloro-2-fluorobenzyI)-3-{3-[3-(piperidin-l- ylcarbony!)bcnzyl]phenyl}-7-(trifluoromethyl)-2H-indazole; abv) 2-(4-chIoro-2-fluorobenzy!)-3-[3-(3-chlorophenoxy)phenyl]-7- (trifluoromethyl)-2H-indazole; abw) 2-(4-chloro-2-fluorobenzyl)-3-[3-(2-fluorophenoxy)phenyl]-7- (trifluoromethyl)-2H-indazole; abx) 6-{3-[2-(4-chloro-2-fluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}-2-naphthonitrile; aby) 2-(4-chloro-2-fluorobenzyl)-3-[3-(5,6,7,8-tetrahydronaphthaIen-1 - yloxy)phenyl]-7-(trifluoromethyJ)-2H-indazole; abz) 2-(4-chl6ro;-2-fluorobenzyl)-3-[3-(2-ethoxyphenoxy)phenyl]-7- (triflupromethyl)-2H-indazole; aaaaaa) l-(2-{3-[2-(4.-chIoro-2-fluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy} phenyl)propan-l -one; bbbbbb) 3-{3-[2-(lH-benzimidazol-2-yl)phenoxy]phenyl}-2-(4-chloro-2- fluorobenzyl)-7-(trifluoromethyl)-2H-indazole; ace) 2-(4-chloro-2-fluorobenzyI)-3-[3-(2-pyrrolidin-l-ylphenoxy)phenyl]-7-(trifluoromethyl)-2H-indazole; dddddd) 3-{3-[2-(4-chloro-2-fluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- y 1] benzyl} -N,N-d iethylbenzamide; eeeeee) 3-{3-[2-(4-chloro-2-fluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]benzyl}-N-cyclopropylbenzamide; acl) 3-{3-[2-(4-chIoro-2-fluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yi]benzyl}-N-isopropylbenzamide; acg) 3-{3-[2-(4-chloro-2-fluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]benzyl}-N-propylbenzamide; ach) 3-{3-[2-(4-chloro-2-fluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]benzyl}-N-ethylbenzamide; aci) 3-{3-[2-(4-chloro-2-fluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]benzyl}-N-methylbenzamide; acj) 2-benzyl-3-[4-(benzyloxy)phenyl]-7-(trifluoromethyl)-2H-indazoIe; ack) l-[4-({3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}methyl)phenyl]cyclopentanecarboxylic acid; acl) 2-[4-({3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}methyl)phenyl]-2-methylpropanoic acid; acm) 2-[4-({3-[2-(4-chloro-2-fluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}methyl)phenyl]-2-methylpropanoic acid; acn) 2-(2,4-difluorobenzyl)-3-{4-[(2,6-dimethylbenzyl)oxy]phenyl}-7- (trifluoromethyl)-2H-indazole; aco) 2-(2,4-dichlorobenzyl)-3-{4-[(2,6-dimethylbenzyl)oxy]phenyl}-7- (trifluoromelhyl)-2H-indazole; acp) 2-(4-chloro-2-fluorobenzyl)-3-{4-[(2,6-dimethylbenzyl)oxy]phenyl}-7- (trifluorQmethyl)-2H-indazole; acq) 2-(2-chlorp-4-fluorobenzyl)-3-{4-[(2,6-dimethylbenzyl)oxy]phcnyl}-7- (triflupromethyl)-2H-indazole; acr) 2-(2,4-dimethylbenzyl)-3-{4-[(2,6-dimethylbenzyl)oxy]phenyl}-7- (trifluoromethyl)-2H-indazole; acs) 2-benzyI-3-(4-{[2-fluoro-6-(trifluoromethyl)benzyl]oxy}phenyl)-7- (trifluoromethyl)-2H-indazole; act) [4-({3-[2-benzyl-7-(trifluoromethyI)-2H-indazol-3-yl]phenoxy}methyl)- 3,5-dimethylphenyl]acetic acid; acu) [4-({4-[2-b'enzyl-7-(trifluoromethyl)-2H-indazol-3-yl]phenoxy}methyl)- 3,5-dimethylphenyl]acetic acid; acv) 2-(4-chloro-2-fluorobenzyl)-3-{3-[(2,5-dimethylbenzyl)oxy]phenyl}-7- (trifluoromethyl)-2H-indazole; acw) 2-(2,4-dimethyIbenzyl)-3-{3-[(2,5-dimethylbenzyl)oxy]phenyl}-7- (trifluoromethyl)-2H-indazole; acx) 4-({3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3-yl]phenoxy}methyi)- 3,5-dibrornobenzoic acid; acy) 4-({4-[2-benzyl-7-(trifluoromethyl)-2H-indazoI-3-yl]phenoxy}methyl)- 3,5-dibromobenzoic acid; acz) 4-({3-[2-benzyl-7-(trifluoromethyl)-2H-indazoI-3-yl]phenoxy}methyl)- 3,5-dimethyIbenzoic acid; kkkkkk) 2-benzyI-3-{4-[(2,5-dimethylbenzyl)oxy]phenyl}-7-(trifluoromethyl)-2H- indazole; llllll) 2-(2-chloro-4-fluorobenzyl)-3-{4-[(2,5-dimethylbenzyl)oxy]phenyl}-7- (trifluoromethyl)-2H-indazoIe; mmmmmm) 2-(2,4-dichlorobenzyI)-3-{4-[(2,5-dimethylbenzyl)oxy]phenyI}-7- (trifluoromethyl)-2H-indazoIe; nnnnnn) 3-{3-[(2,5-dimethylbenzyl)oxy]phenyl}-2-(2,4,6-trifluorobenzyl)-7- (trifluoromethyl)-2H-indazole; oooooo) {4-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3-yl]phenoxy}(3- methylphenyl)acetic acid; pppppp) {3-[2-benzyI-7-(trifluoromethyl)-2H-indazol-3-yl]phenoxy}(3- methylphenyl)acetic acid; adg) 2-benzyl-3-[4-(2-naphthylmethoxy)phenyl]-7-(trifluoromethyl)-2H- indazole; adh) 2-benzyl-3-[4-(l-naphthylmethoxy)phenyl]-7-(trifluoromethyl)-2H- indazole; adi) 2-benzyl-3-{4-{(3-methyl-2-naphthyl)methoxy]phenyl}-7- (trifluoromethyl)-2H-indazoIe; adj) 2-benzyl-3-[3-(2-naphthylmethoxy)phenyl]-7-(trifluoromethyl)-2H- indazole; adk) 2-benzyI-3-[3-(l-naphthylmethoxy)phenyl]-7-(trifluoromethyl)-2H- indazole; adl) 2-benzyl-3-{3-[(3-methyl-2-naphthyl)methoxy]phenyl}-7- (trifluoromethyl)-2H-indazole; adm) 2-benzyl-3 - {4-[(2-methyl-1 -naphthyl)methoxy]pheny 1} -7- (trifluoromethyl)-2H-indazole; adn) 3-[4-(9-anthrylmethoxy)phenyl]-2-benzyl-7-(trifluoromethyl)-2H- indazole; ado) 2-benzyl-3-{3-[(2-methyl-1 -naphthyl)methoxy]phenyl} -7- (trifluoromethyl)-2H-indazole; adp) 3-[3-(9-anthrylmethoxy)phenyl]-2-benzyl-7-(trifluoromethyl)-2H- indazole; : adq) 2-(4-chloro-2-fluorobenzyl)-3-{4-[(2,5-ditnethylbenzyI)oxy]phenyl}-7- (trifluoromethyl)-2H-indazole; adr) 2-(2,4-dimethylbenzyl)-3-{4-[(2,5-dimethylbenzyl)oxy]phenyl}-7- (trifluoromethyl)-2H-indazole; ads) 3-{4-[(2,5-dimethylbenzyl)oxy]phenyl}-2-(2,4,6-trifluorobenzyl)-7- (trifluoromethyl)-2H-indazole; adt) 2-(4-ch loro-2-fluorobenzyl)-3 - {3-[(2-methy 1-3 -n i trobenzy l)oxy] pheny 1} - 7-(trifluoromethyl)-2H-indazole; adu) 2-(4-chloro-2-fluorobenzyl)-3-{3-[(5-methyl-2-nitrobenzyl)oxy]phenyl}- 7-(trifluoromethyl)-2H-indazole; adv) 2-(4-chloro-2-fluorobenzyl)-3-{3-[(2-chloro-5-nitrobenzyl)oxy]phenyl}- 7-(trifluoromethyl)-2H-indazole; adw) 2-(4-chloro-2-fIuorobenzyl)-3-{3-[(2-fluoro-3- methylbenzyl)oxy] pheny 1} -7-(trifluoromethyI)-2H-indazole; adx) 2-(4-chloro-2-fluorobenzyl)-3-(3-{[5-fluoro-2- (trifluoromethyl)benzyl]oxy}phenyl)-7-(trifluoromethyI)-2H-indazoIe; ady) 2-(4-chloro-2-fluorobenzyl)-3-(3-{[2-chloro-3- (trifluoromethyl)benzyl]oxy}phenyl)-7-(trifluoromethyl)-2H-indazoIe; adz) 2-(4-chloro-2-fluorobenzyl)-3-{3-[(2-methoxy-5- nitrobenzyl)oxy]phenyl}-7-(trifluoromethyl)-2H-indazole; aea) • 2-(4-chloro-2-fluorobenzyl)-3-(3-{[2-methyl-5- (trifluoromothyl)benzyl]oxy}phenyl)-7-(trifluoromethyl)-2H-indazole; vvvvvv) 3-{3-[(2-bromo-5-methoxybenzyl)oxy]phenyl}-2-(4-chloro-2- fluorobenzyl)-7-(trifluoromethyl)-2H-indazole; wwwwww) 3-(3-{[2,5-bis(trifluoromethyl)benzyl]oxy}phenyl)-2-(4-chloro-2- fluorobenzyl)-7-(trifluoromethyI)-2H-indazole; xxxxxx) l-[3-({3-[2-(4-chIoro-2-fluorobenzyI)-7-(trifluoromethyl)-2H-indazol-3- yI]phenoxy}methyl)-4-methoxyphenyl]ethanone; yyyyyy) 2-(4-chloro-2-fluorobenzyl)-3-{3-[(2,5-difluorobenzyl)oxy]phenyI}-7- (trifluoromethyl)-2H-indazole; zzzzzz) 3-{3-[(2-bromo-5-fluorobenzyl)oxy]phenyl}-2-(4-chloro-2-fluorobenzyl)- 7-(trifluoromethyl)-2H-indazoIe; aaaaaaa) 2-(4-chloro-2-fluorobenzyI)-3-{3-[(3-chIoro-2-fluorobenzyl)oxy]phenyl}- 7-(trifluoromethyl)-2H-indazole; aeh) 2-(4-chloro-2-fluorobenzyl)-3-(3-{[2-fluoro-5- (trifluoromethyI)benzyl]oxy}phenyl)-7-(trifluoromethyl)-2H-indazole: aei) 2-(4-chloro-2-fluorobenzyl)-3-{3-[(2,3,6-trifluorobenzyl)oxy]phenyl}-7- (trifluoromethyl)-2H-indazole; aej) 2-(4-chloro-2-fluorobenzyl)-3-{3-[(2,5-dichlorobenzyl)oxy]phenyl}-7- (trifluoromethyl)-2H-indazole; aek) 2-(4-chloro-2-fluorobenzyl)-3-(3-{[2-chloro-5- (trifluoromethyI)benzyl]oxy}phenyl)-7-(trifluoromethyI)-2H-indazole; ael) 2-(4-chloro-2-fluorobenzyl)-3-(3-{[5-chloro-2- (trifluoromethyl)benzyl]oxy}phenyI)-7-(trifluoromethyl)-2H-indazole; aem) [4-({3-[2-(4-chloro-2-fluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}methyl)phenyl]acetic acid; aen) methyl [4-({3-[2-(4-chloro-2-fluorobenzyI)-7-(trifluoromethyl)-2H- indazol-3-yl]phenoxy}methyl)phenyl]acetate; aeo) 2-(4-chloro-2-fluorobenzyl)-3-{3-[(6-chloro-2-fluoro-3- methylbenzyl)oxy]phenyl}-7-(trifluoromethyl)-2H-indazoIe; aep) 3-{3-[(2-chioror3,6-difluorobenzyl)oxy]phenyl}-2-(4-chloro-2- fluorobenzyl)-7-(trifluoromethyl)-2H-indazole; aeq) 3-{3-[(3-chloro-2,6-difluorobenzyl)oxy]phenyl}-2-(4-chIoro-2- fluorobenzyl)-7-(trifluoromethyI)-2H-indazole; • aer) 2-(4-chloro-2-fluorobenzyl)-3-{3-[(5-chloro-2-fluorobenzyI)oxy]phcnyl}- 7-(trifluoromethyl)-2H-indazole; aes) 2-(4-chloro-2-fluorobenzyl)-3-{3-[(2,5-dimethoxybenzyl)oxy]phenyl}-7- (trifluoromethyl)-2H-indazole; act) 2-(4-chloro-2-fluorobenzyl)-3-{3-[(5-fluoro-2- methylbenzyl)oxy]phenyI}-7-(trifluoromethyl)-2H-indazole; aeu) 2-(4-chloro-2-fluorobenzyl)-3-{3-[(2,6-difluoro-3- methylbenzyl)oxy]phenyl}-7-(trifluoromethyl)-2H-indazole; aev) 2-(4-chloro-2-fluorobenzyl)-3-{3-[(2,6-difluorobenzyl)oxy]phenyl}-7- (trifluoromethyl)-2H-indazole; a6w) 2-(4-chIoro-2-fIuorobenzyl)-3-{3-[(2-chloro-6-fluorobenzyl)oxy]phenyI} - 7-(trifluoromethyl)-2H-indazole; aex) 2-(4-chloro-2-fluorobenzyl)-3-(3-{[2-methoxy-5- (trifluoromethoxy)benzyl]oxy}phenyl)-7-(trifluoromethyl)-2H-indazoIe: aey) 2-(4-chloro-2-fluorobenzyI)-3-{3-[(2,3-dimethoxybenzyl)oxy]phenyl}-7- (trifluoromethyl)-2H-indazole; aez) 3-[3-(benzyloxy)phenyl]-2-(4-chloro-2-fluorobenzyl)-7-(trifluoromethyl)- 2H-indazole; eeeeeee) 2-(4-chloro-2-fluorobenzyl)-3-{3-[(4-methyIbenzyl)oxy]phenyl}-7- (trifluoromethyl)-2H-indazole; fffffff) 2-(4-chloro-2-fluorobenzyl)-3-{3-[(2-chloro-5-fluorobenzyI)oxy]phenyl}- 7-(trifluoromethyl)-2H-indazole; ggggggg) 2-(2,4-dimethylbenzyl)-3-(3-{[5-fluoro-2- (trifluoromethyl)benzyl]oxy}phenyl)-7-(trifluoroniethyI)-2H-indazole; hhhhhhh) [4-({3-[2-methyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}methyl)phenyl]acetic acid; iiiiiii) 2-(4-chloro-2-fluorobenzyl)-3-{3-[(2-chIoro-6-fluoro-3- methyIbenzyl)oxy]phenyl}-7-(trifluoromethyl)-2H-indazole; jjjjjjj) [4-({3-[7-(trifluoromethyl)-lH-indazoI-3- yljphenoxy} methyl)phenyl]acetic acid; kkkkkkk) {3-[2-(4-chlQro-2-fluoroben2yl)-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}(phenyl)acetic acid; afh) 2-{3-[2-(4-chloro-2-fluorobenzyl)-7-(trifluoromethyI)-2H-indazol-3- yl]phenoxy}-2-phenylpropanoic acid; afi) {3-[2-(4-chloro-2-fluorobenzyl)-7-(trifluoromethyl)-'(-H-indazol-3- yl]phenoxy}(3-methylphenyl)acetic acid; afj) [4-({3-[2-(4-chloro-2-fluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy} methyl)-2,5-dimethylphenyl]acetic acid; afk) [4-({3-[2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}methyl)phenyl]aceticacid; afl) l-[4-({3-[2-(4-chIoro-2-fluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}methyl)phenyl]cyclopropanecarboxylic acid; afm) 3-(3-{[5-fluoro-2-(trifluoromethyl)benzyl]oxy}phenyl)-2-(2,4,6- trifluorobenzyl)-7-(trifluoromethyl)-2H-indazole; afn) [3-({3-[2-(4-chloro-2-fluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}methyI)-2,4-dimethylphenyl]acetic acid; afo) [4-({3-[2-(2,4-dimethyIbenzyI)-7-(trifluoromethyI)-2H-indazol-3- yl]phenoxy}methyl)phenyl]acetic acid; afp) 3,3'-[methylenebis(oxy-3,l-phenylene)]bis[2-(4-chloro-2-fluorobenzyl)-7- (trifluoromethyl)-2H-indazole]; afq) 2-[3-({4-[2-(2,4-dimethylbenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]phenyl}amino)phenyl]-2-methylpropanoic acid; afr) 3-(3-{[5-chloro-2-(trifluoromethyl)benzyl]oxy}phenyl)-2-(2,4,6- trifluorobenzyl)-7-(trifluoromethyI)-2H-indazole; afs) 3-(3-{[2-chloro-5-(trifluoromethyI)benzyl]oxy}phenyl)-2-(2,4,6- trifluorobenzyl)-7-(trifluoromethyl)-2H-indazole; aft) 2-(4-chloro-2-fluorobenzyl)-3-[3-(2-phenylethyl)phenyl]-7- (trifluoromethyl)-2H-indazoIe; afu) 2-(4-chloro-2-fluorobenzyl)-3-{3-[2-(2,5-dimethyIphenyl)ethyl]phenyl}- 7-(trifluoromethyI)-2H-indazole; afv) 2-(4-chloro-2-fluorobenzyl)-3-{3-[2-(2,5-dichIorophenyl)ethyl]phenyI}-7- (trifluoromethyl)-2H-indazole; afw) 2-(4-chloro-2-fluorobenzyl)-3-{3-[2-(2,5-difluorophenyl)ethyl]phenyl}-7- (trifluoromethyl)-2H-indazole; afx) 2-(4-chloro-2-fluorobenzyl)-3-{3-[2-(5-chloro-2- fluorophenyl)ethyl]phenyl} -7-(trifluoromethyl)-2H-indazole; afy) 2-(4-chloro-2-fluorobenzyl)-3-{3-[2-(2-chloro-5- fluorophenyl)ethyl]phenyl}-7-(trifluoromethyl)-2H-indazole; afz) 2-(4-chloro-2-fluorobenzyl)-3-(3-{2-[2-fluoro-5- (trifluoromethyl)phenyl]ethyl}phenyI)-7-(trifluoromethyl)-2H-indazole; ooooooo) 2-(4-chloro-2-fluorobenzyl)-3-(3-{2- [3(trifluoromethoxy)phenyl]ethyl}phenyI)-7-(trifluoromethyl)-2H- indazole; ppppppp) 2-(4-chloro-2-fluorobenzyl)-3-{3-[2-(3-methoxyphenyl)ethyl]phenyl}-7- (trifluoromelhyl)-2H-indazole; age) 2-(4-chIoro-2-fluorobenzyl)-3-(3-{2-[3- (difluoromethoxy)phenyl]ethyl}phenyl)-7-(trifluoromethyl)-2H-indazo!e; rrrrrrr) 2-(4-chloro-2-fluorobenzyl)-3-(3- {2-[2-methy 1-5 - (trifluoromethyl)phenyl]ethyl}phenyl)-7-(trifluoromethyI)-2H-indazole; sssssss) 3-(3-{2-[2,5-bis(trifluoromethyl)phenyl]ethyI}phenyl)-2-(4-chloro-2- fluorobenzyl)-7-(trifluoromethyl)-2H-indazole; ttttttt) 2-(4-chloro-2-nuorobenzyl)-3-{3-[2-(2,3- dimethoxyphcnyI)ethyl]phenyl}-7-(trifluoromethyl)-2H-indazole; uuuuuuu) 2-(4-chloro-2-fluorobenzyI)-3-(3-{2-[2-chloro-5- (trifluoromethyl)phenyl]ethyl}phenyl)-7-(trifluoromethyl)-2H-indazole; agh) 2-(4-chIoro-2-fluorobenzyl)-3-(3-{2-[5-chloro-2- (trifluoromethyl)phenyl]ethyl}phenyl)-7-(trifluoromethyl)-2H-indazole; agi) 2-(4-chloro-2-fluorobenzyl)-3-(3-{2-[5-fluoro-2- (trifluoromethyl)phenyl]ethyl}phenyl)-7-(trifluoromethyI)-2H-indazoIe; agj) 2-benzyl-3-(3-phenoxyphenyl)-7-(trifluoromethyl)-2H-indazole; agk) 2-benzyl-3-[3-(4-methoxyphenoxy)phenyl]-7-(trifluoromethyl)-2H- indazole; agl) 3-{4-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl] phenoxy} benzaldehyde; agm) 2-benzyl-3-{3-[3-(l,3-dioxolan-2-ylmethyl)phenoxy]phenyl}-7- (trifluoromethyl)-2H-indazole; agn) (3-{3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phcrioxy}phenyl)acetic acid; ago) (3-{4-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}phenyl)acetic acid; agp) 2-benzyI-3-{4-[3-(l,3-dioxolan-2-ylmethyl)phenoxy]phenyl}-7- (trifluoromethyl)-2H-indazole; agq) 2-benzyl-3-[4-(3,5-dimethyIphenoxy)phenyl]-7-(trifluoromethyl)-2H- indazole; agr) methyl 2-(4-{3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}phenyl)-2-methylpropanoate; ags) methyl 3-{4-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- y 1] phenoxy} benzoate; agt) (3-{4-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}phenyl)methanol; agu) 3-{4-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3-yl]phenoxy}-N- methoxy-N-methy Ibenzam ide; agv) 3-{4-[2-benzyl-7-(trifluoromethyl)-2H-indazoI-3-yl]phenoxy}-N,N- dimethylbenzamide; agw) 3-{4-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3-yl]phenoxy}-N- methylbenzamide; agx) 3-{4-[2-benzyl-7-(trifluoromethyI)-2H-indazol-3-yl]phenoxy}benzamide; agy) 2-(2,4-dimethylbenzyl)-3-[4-(2-methoxyphenoxy)phenyl]-7- (trifluoromethyl)-2H-indazole; agz) 3-[4-(2-methoxyphenoxy)phenyl]-2-(2,4,6-trifluorobenzyl)-7- (trifluoromethyl)-2H-indazole; aha) 2-(4-chloro-2-fluorobenzyl)-3-[4-(2-methoxyphenoxy)phenyl]-7- (trifluoromethyl)-2H-indazole; ahb) (3-{4-[2-(2,4-dimethylbenzyl)-7-(trifluoromethyl)-2H-indazol-3-; ahc) yl]phenoxy}phenyl)dimethylamine; ahd) N,N-dimethyl-3-{4-[2-(2,4,6-trinuorobenzyl)-7-(trifluoromethyI)-2H- indazol-3-yl]phenoxy}aniline; ahe) (3-{4-[2-(4-chloro-2-fluorobenzyI)-7-(trifluoromethyl)-2H-indazol-3-, yl]phenoxy}phenyl)dimethylamine; ahf) 3-{4-[2-(2,4-dimethylbenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}-N-methoxy-N-methylbenzamide; ahg) N-methoxy-N-methyl-3 - {4-[2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyI)- 2H-indazoi-3-yl]phenoxy}benzamide; ahh) 3-{4-[2-(4-chIoro-2-fluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}-N-methoxy-N-methylbenzamide; ahi) 5-{4-[2-(4-chIoro-2-fluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}-3,4-dihydronaphtha!en-l(2H)-one; ahj) 2-benzyl-3-{4-[2-(trifluoromethoxy)phenoxy]phenyI}-7- (trifluoromethy!)-2H-indazole; ahk) 2-benzyl-3-[4-(l-naphthyloxy)phenyl]-7-(trifluoromethyl)-2H-indazole; ahl) 3-{4-[2-(4-chlorO'2-fluorobenzyl)-7-(trifluoromethyl)-2H-indazo!-3- yljphenoxy} benzaldehyde; ahm) 2-(4-chloro-2-fluorobenzyI)-3-[4-(5,6,7,8-tetrahydronaphthalen-1 - yIoxy)phenyl]-7-(trifluoromethyI)-2H-indazole; ahn) 5-{4-[2-(4-chloro-2-fluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy} -1,2,3,4-tetrahydronaphthalen-1 -ol; aho) 2-{3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yljphenoxy} benzaldehyde; ahp) 3-{4-[2-(4-chloro-2-fluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}-N,N-dimethylbenzamide; ahq) 3-{4-[2-(4-chloro-2-fluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}-N,N-diethyIbenzamide; ahr) 2-(4-chloro-2-fluorobenzyl)-3-{4-[3-(pyrrolidin-l- ylcarbonyl)phenoxy]phenyl}-7-(trifluoromethyl)-2H-indazole; ahs) 2-(4-chloro-2-fluorobenzyl)-3-{4-[3-(piperidin-l- ylcarbonyl)phenoxy]phenyl}-7-(trifluoromethyl)-2H-indazole; aht) 2-(4-chloro-2-fluorobenzyI)-3-{4-[3-(morpholin-4- ylcarbony l)phenoxy]phenyl} -7-(tri fluoromethyl)-2H-indazole; ahu) 2-(3-{4-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}phenyl)propan-2-ol; ahv) l-(3-{4-[2-(4-chIoro-2-fluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}phenyl)ethanone; ahw) N,N-dimethyI-3-{4-[2-(2,4,6-trifluorobenzyI)-7-(trifluoromethyl)-2H- indazol-3-yl]phenoxy}benzamide; ahx) 3-{4-[2-(2,4-dimethylben2yl)-7-(trifluoromethyl)-2H-indazoI-3- yl]phenoxy}-N,N-dimethylbenzamide; ahy) 2-(3-{4-[2-(4-chloro-2-fluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}phenyl)propan-2-ol; ahz) 3-{3-[2-benzyl-7-(trifluoromet-hyl)-2H-indazol-3-yl]phenoxy}-N,N- dimethylbenzamide; aia) (1 S)-5- {4-[2-(4-chloro-2-fluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy} -1,2,3,4-tetrahydronaphthalen-1 -ol; aib) (lR)-5-{4-[2-(4-chloro-2-fluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yljphenoxy} -1,2,3,4-tetrahydronaphthalen-1 -ol; aic) 2-(3-{3-[2-benzyl-7-(trifluoromcthyl)-2H-indazol-3-yl]phenoxy}phenyl)- 2-methylpropanoic acid; aid) 3 - {4-[3-(piperidin-1 -y!carbonyl)phenoxy]phenyl} -2-(2,4,6- trifluorobenzyl)-7-(trifluoromethyl)-2H-indazoIe; aie) 2-(3-{4-[2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}phenyl)propan-2-ol; aif) 3-{4-[3-(morpholin-4-ylcarbonyl)phenoxy]phenyl}-2-(2,4,6- trifluorobenzyl)-7-(trifluoromethyl)-2H-indazolc; aig) 5-{3-[2-(2-chloro-4-fluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yI]phenoxy}-3,4-dihydronaphthalen-l (2H)-one; aih) 2-(2-chloro-4-fluorobenzyI)-3-(4-methoxyphenyl)-7-(trifluoromethyl)- 2H-indazole; aii) 2-(4-chloro-2-fluorobenzyl)-3-(4-methoxyphenyl)-7-(trifluoromethyl)- 2H-indazoIe; aij) 3-(4-methoxyphenyl)-2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyl)-2H- indazole; aik) 5-{3-[2-(2-chloro-4-fluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- .yl]phenoxy}quinoline; ail) 5-{3-[2-(2-chloro-4-nuorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}isoquinoline; aim) 4-{3-[2-(2-chloro-4-fluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yljphenoxy} quinazoline; ain) 6-{3-[2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy} -3,4-dihydronaphthalen-1 (2H)-one; aio) 2-(2-chlorb-4iflUOrobenzyl)-3-[3-(5,6,7,8-tetrahydronaphthalen-2- yloxy)phenyl]-7-(trifluoromethyl)-2H-indazole; aip) 2-(2-chloro-4-flaorobenzyl)-3-[3-(5,6,7,8-tetrahydronaphthalen-1 - yloxy)pheriyl]-7-(trifluoromethyl)-2H-indazole; *.iq) 2-{4-[2-(2,4,6-trifliiorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- y l]pheny 1} -1 H-indole-5 -carbonitri le; air) 3-[4-(5-fluoro-lH-indol-2-yl)phenyl]-2-(2,4,6-trifluorobenzyl)-7- (trifluoromethyI)-2H-indazole; ais) 5-{3-[2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy} -3,4-dihydronaphthalen-1 (2H)-one; ait) 6-{3-[2-(2-chloro-4-fluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy} -3 ;4-dihydronaphthaIen-1 (2H)-one; aiu) 3-[3-(5-bromo-6-methyl-lH-indol-2-yl)phenyl]-2-(2,4,6-trifluorobenzyl)- 7-(trifluoromethyl)-2H-indazole; aiv) 3-[4-(5-bromo-6-methyl-lH-indol-2-yl)phenyl]-2-(2,4,6-trifluorobenzyl)- 7-(trifluoromethyl)-2H-indazole; aiw) l-methyl-2-{4-[2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyl)-2H-indazol- 3-yl]phenyl}-lH-indoIe-5-carbonitrile; aix) 3-[4-(5-fluoro-l-methyl-lH-indol-2-yl)phenyl]-2-(2,4,6-trifluorobenzyl)- 7-(trifluoromethyl)-2H-indazole; aiy) 6-{3-[2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}-3,4-dihydronaphthalen- l(2H)-one; aiz) 2-{4-[2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]phenyl}-lH-indole-5-carbonitrile; aja) 3-[4-(5-fluoro-lH-indol-2-yl)phenyl]-2-(2,4,6-trifluorobenzyl)-7- (trifluoromethyl)-2H-indazole; ajb) 5-{3-[2-(2,4,6-trifluorobenzyl)-7-(trinuoromethyI)-2H-indazol-3- yl]phenoxy}-3,4-dihydronaphthalen-l(2H)-one; ajc) 6-{3-[2-(2-chIoro-4-fluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy} -3,4-dihydronaphthalen-1 (2H)-one; ajd) methyl (5-{3-[2-(2-chloro-4-fluorobenzyl)-7-(trifluoromethyl)-2H- indazol-3-yl]phenoxy}-l-hydroxy-l,2,3,4-tetrahydronaphthalen-l- yl)acetate; aje) ethyl [4-({3-[2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyI)-2H-indazol-3- yl]phenoxy}methyl)phenyl]acetate; ajf) (5-{3-[2-(2-chloro-4-fluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}-3,4-dihydronaphtha!en-l-yl)acetic acid; ajg) ethyl [4-({4-[2-(4-chloro-2-fluorobenzyl)-7-(trifluoromethyl)-2H-indazol- 3-yl]phenoxy}methyl)phenyI]acetate; ajh) 5-{3-[2-(4-chloro-2-fluorobenzyl)-7-(trifluoromethyl)-2H-inda7.oI-3- yljphenoxy} -1,2,3,4-tetrahydronaphthalen-1 -ol; or a pharmaceutical ly acceptable salt thereof.

32. A compound as claimed in preceding claims is useful for treating or inhibiting atherosclerosis or atherosclerotic lesions, Alzheimer's disease or dementia, type I or type II diabetes, acute coronary syndrome or restenosis, celiac or thyroiditis: treating multiple sclerosis, rheumatoid arthritis, inflammatory bowel disease. Crone's disease, or endometriosis, a Thl-mediated disease such as multiple sclerosis, rheumatoid arthritis, autoimmune thyroid disease, inflammatory bouel disease, Crohn's disease or atherosclerosis; inhibiting cholesterol absorption: lowering LDL cholesterol levels; increasing HDL cholesterol levels: increasing reverse cholesterol transport; suppressing lymphocyte function or activation exemplified by lymphokine production, macrophage function or activation, cytokine production; and increasing ABCAl activity by 20% or more while increasing SREBP-lc activity by 25% or less, in mammal in need thereof.

33. A pharmaceutical composition comprises a compound as claimed in any one of claims 1 to 31, or a pharmaceutically acceptable salt thereof and a pharmaceutical carrier.

34. The compound as claimed in any one of claims I to 31 is also useful in the manufacture of a medicament capable of treating or inhibiting atherosclerosis or atherosclerotic lesions, lowering LDL cholesterol levels, increasing HDL. cholesterol levels, increasing reverse cholesterol transport, inhibiting cholcsteiv absorption, treating or inhibiting Alzheimer's disease or dementia, treating or inhibiting type I or type II diabetes, treating or inhibiting acute coronary syndrome or restenpsis, treating multiple sclerosis, rheumatoid arthritis, inflammatory bowel disease, Crone's disease, or endometriosis, treating or inhibiting celiac or thyroiditis, treating a Thl -mediated disease, suppressing lymphocyte function preferably lymphokine production or activation, suppressing macrophage function or activation, suppressing cytokine production, or increasing ABCA1 activity by 20% or more while increasing SREBP-lc activity by 25% or less, preferably Thl -mediated disease is multiple sclerosis, rheumatoid arthritis, autoimmune thyroid disease, inflammatory bowel disease, Crohn's disease or atherosclerosis in a mammal in need thereof. 35. The compound as claimed in claim 1 including all variables, a composition containing the said compound and use of the said compound and composition substantially such as herein described.

Specification

This invention relates Indazoles Useful In Treating Cardiovascular Diseases This invention relates to indazoles useful in treating cardiovascular diseases, to processes for preparing them, pharmaceutical compositions containing them and methods of treatment using them. BACKGROUND OF THE INVENTION This invention provides indazoles that are useful in the treatment or inhibition of LXR (Liver X receptor) mediated diseases. Atherosclerosis, a complex disease of lipid disorder and inflammation, is the leading cause of death in developed countries. A number of independent risk factors have been identified and the most notable are high levels of serum LDL cholesterol and low HDL cholesterol. Although the most effective therapies such as statins have been shown to lower LDL cholesterol significantly (20-60%), still most patients experience adverse coronary events. Also, statins have their own undesirable side effect profile (myotoxicity), which prevents many patients from taking them. Therefore, additional therapeutic strategies to not only decrease LDL cholesterol, but also to increase HDL cholesterol, are critically needed. The important reason to increase HDL cholesterol is to increase cholesterol transport from peripheral tissues to liver for metabolism and excretion. This function of transporting cholesterol from periphery to liver is called reverse cholesterol transport and HDL plays a major role in this pathway. In addition, HDL has been suggested to inhibit the oxidation of LDL cholesterol, reduce the inflammatory response of endothelial cells, inhibit the coagulation pathway and promote the availability of nitric oxide. The key transporter involved in HDL production and reverse cholesterol transport is ABCA1. Therefore, upregulation of ABCA1 results in increased reverse cholesterol transport as well as inhibition of cholesterol absorption in the gut. LXRs, originally identified from liver as orphan receptors, are members of the nuclear hormone receptor super family and are involved in the regulation of cholesterol and lipid metabolism. They are ligand-activated transcription factors and bind to DNA as obligate heterodimers with retinoid X receptors. While LXRa is restricted to certain tissues such as liver, kidney, adipose, intestine and macrophages, LXR(3 displays a ubiquitous tissue distribution pattern. Activation of LXRs by oxysterols (endogenous ligands) in macrophages results in the expression of several genes involved in lipid metabolism and reverse cholesterol transport, including ABCA1, ABCG1 and ApoE. Studies have been conducted in LXRa k/o, LXRP k/o and double k/o mice to determine the physiological role of LXRs in lipid homeostasis and atherosclerosis. The data indicate that in double k/o mice on normal chow diet, increased cholesterol accumulation was observed in macrophages (foam cells) of the spleen, lung and arterial wall. This was associated with reduced serum HDL cholesterol and increased LDL cholesterol despite normal total cholesterol levels. While LXRa k/o mice did not show significant changes in hepatic gene expression, LXRp k/o mice showed a 58% decrease in hepatic ABCA1 expression and a 208% increase in SREBPlc expression, suggesting that LXRP may be involved in the regulation of liver SREBPlc expression. Agonists of LXRa or p are very effective in upregulating ABCA1 expression (desirable effect) in macrophages. The biological activities of several agonists have been shown in two atherosclerotic mouse models (ApoE k/o and LDLR k/o). Treatment of these mice with agonists for 12 weeks resulted in significant inhibition of atherosclerotic lesions. While these two compounds had variable effects on serum cholesterol and lipoprotein levels, both compounds caused a significant increase in serum HDL cholesterol and triglyceride levels. These in vivo data agree well with the in vitro data obtained for the compounds in macrophages. In addition to the lipid and triglyceride effects described above, a very recent communication in Nature Medicine (9: 213-219, 2003) presents convincing data that activation of LXRs results in the inhibition of inflammation and proinflammatory gene expression in three different models of inflammation (LPS-induced sepsis, acute contact dermatitis of the ear and chronic atherosclerotic inflammation of the artery wall). These data suggest that LXR modulators can mediate a two-pronged effect (removal of cholesterol from the macrophages and inhibition of vascular inflammation) resulting in the inhibition of atherosclerotic lesions. DESCRIPTION OF THE INVENTION In some embodiments, the present invention provides compounds having the Formula (I) or (la): (Figure Remove) Ri is Ci.6 alkyl, CN, CO2R5, C(O)R5, CM alkenyl, C3.g cycloalkenyl, C2^ alkynyl, NR5Re, C(O)NR5R6, phenyl, thiophene, do alkoxy, halogen, or S(O)kR5; wherein: said C1-6 alkyl is optionally substituted with from 1 to 7 substituents independently selected from the group consisting of halogen and OH; k is 0, 1 or 2; each RS and each Re is independently H, Ci-e alkyl, €3.8 cycloalkyl, S(O)2-alkyl or arylalkyl; or each RS and each Re, together with the nitrogen atom to which they are attached, form independently: a) a 3 to 7 membered saturated ring that is optionally substituted with d-3 alkyl, CH2OH, or C(=O)NH2; or b) a 3 to 7 membered ring containing in its backbone one or two additional heteroatoms that is optionally substituted with up to three substituents independently selected from the group consisting of =O, d.3 alkyl, COd-e alkyl, and CO2d-6 alkyl; provided that when RI is S(O)kR5, then said R5 of said S(O)kRs is not S(O)2-alkyl; R2 is C3.g alkyl, d-g cycloalkyl, C2.g alkenyl, d-g cycloalkenyl, C2.g alkynyl, NR7Rg, aryl, arylalkyl, heteroaryl, heteroarylalkyl or heterocycloalkyl, wherein said d_g alkyl, said d.g cycloalkyl and said arylalkyl are each optionally substituted with up to four substituents independently selected from the group consisting of halogen, CN and OR?, and wherein said heteroaryl is optionally substituted with YD; or R2 is phenyl substituted with up to four substituents independently selected from the group consisting of do alkyl, C2-g alkenyl, C2.g alkynyl, do alkoxy, d.g cycloalkyl, halogen, OH, CH2OH, CN, NR7Rg, N(R7)C(O)NR5R6, S(O)mR7, phenyl, NO2, C(O)R7, OC(O)R7) C(O)NR7R8, C(O)NR7D and YD, providing any OH group present is not in the para position; wherein: said Ci-3 alkyl and said Cu alkoxy are each optionally substituted with from 1 to 7 fluorine atoms; m is 0 to 2; and R5 and Re are as previously defined; each R7 and each Rg is independently H or Ct-3 alkyl; or each R7 and each Rg, together with the N atom to which they are attached, form independently: a) a 3 to 7 membered saturated ring which is optionally substituted with CM alkyl, CO2Ri4, CH2CO2Ri4, OCH2CO2RM, CH2OCH2CO2R|4, C(O)NRi4Ris, CH2OH, or CH2CH2OH; or b) a 3 to 7 membered ring containing in its backbone one or two additional heteroatoms that is optionally substituted with CH2CO2Ri4; wherein RH and R\$ are each independently H or do alkyl; Y is a bond, CH2, CH2CH2, C2^ alkynylenyl, -O-, CH2OCH2, OCH2, CH2O, -N(R7)-, -N(COR7)-, S(0)j, -N(R7)CH2-, -N(R7)CONR8-, -N(COR7)CH2-, S(O)jCH2) -CH2N(R7)CH2-, -CH2N(COR7)CH2-, -OCH2O-, -OC(R7)(CO2R8)- or -CH2S(O)jCH2-; wherein R7 and Rg are as previously defined; and j is 0, 1 or 2; D is tetrahydronaphthalene, tetrahydronaphthalol, tetralone, naphthalene, anthracene, benzyl or phenyl, each of which is optionally substituted with up to five independently selected R groups; each R is independently selected from the group consisting of C|^ alkyl, Ci-3 alkoxy, halogen, -C(=O)H, -C(O)-C,.3 alkyl, CH2OH, CN, NH2, NO2, C2^ alkenyl, C2^, alkynyl, S(O)jR9, and WX; wherein said Ci-6 alkyl and said €1.3 alkoxy are each optionally substituted with from 1 to 7 fluorine atoms; andj is 0, 1 or 2; or D is a heterocycloalkyl, heterocycloalkylalkyl, heteroarylalkyl, heteroaryl or arylalkyl group, each of which is optionally substituted with up to four independently selected Ra groups; each Ra is independently selected from the group consisting of C|.g alkyl, phenyl, benzyl, Cs-g cycloalkyl C7.n arylalkyl, €1.3 alkoxy, halogen, -C(=O)H, -C(O)-d.3 alkyl, CH2OH, CN, NO2, NH2, OH, =O, C2.6 alkenyl, C2_4 alkynyl, S(O)jR9 and WX; wherein said Ci.8 alkyl, said C2-6 alkenyl, said C2^ alkynyl and said Ci-3 alkoxy are each optionally substituted with from 1 to 7 fluorine atoms; and j is 0, 1 or 2; W is a bond, -CH2-, -CH2CH2-, -NR7-, -Q-N(R7)-, -CHRg-, -(CHRg)2-, -CHR9-, -CR9Rio-, -CO-, -O-, -OCH2-, -OCHR9-, or -OCR9Rio-; wherein R? and Rg are as previously defined; and Q is d-6 alkylenyl; each R9 and each RIO is independently do alkyl or OH; or any Rg and RIO, together with the atom to which they are attached, can form a 3 to 7 membered saturated ring that optionally contains one O, N or S atom; X is C02RU, CORn, C(Rn)2OH, CO2R5, C(O)NR5R6, NR5R6, QNR5C02R6, OH, CH2OH, CN, SO2NR5R6, P(O)(ORS)(OR6), cycloalkylalkyl, aryl, arylalkyl, heterocycloalkyl or heteroaryl, wherein: said aryl, said arylalkyl, said heterocycloalkyl and said heteroaryl are independently each optionally substituted with up to three substituents selected from the group consisting of C].3 alkyl, Cio alkoxy,, halogen, H, OH, NO2 and benzyl that is optionally substituted with up to five halogen atoms; wherein said Cio alkyl and said Ci-3 alkoxy are each optionally substituted with from 1 to 7 fluorine atoms; Q is Ci^ alkylenyl; RH is H or Ci-6 alkyl; and RS and Re are as previously defined; is Ci-g alkyl, C2.g alkenyl, C2.g alkynyl, d-g cycloalkyl, d.g cycloalkenyl, phenyl, or ZA; wherein: said phenyl is optionally substituted with C\.j alkyl; Z is CH2, CH2CH2, or CH2O; A is biphenyl, benzyl, naphthyl, pyridyl, 8-quinolyl, C3.g cycloalkyl or phenyl; wherein said phenyl is optionally substituted with up to five independently selected Rig groups; wherein each said Rig is independently selected from the group consisting of d-6 alkyl, C(.3 alkoxy, halogen, OH, NO2) CN, phenyl, pyrrol-1-yl, C(O)Ri2, CO2Ri2, NR12R,3, C(O)NR,2R!3 and S(O)nRi2; wherein said Ci-e alkyl and said Cj.3 alkoxy are each optionally substituted with from 1 to 7 fluorine atoms; n is 0, 1 or 2; and Rj2 and Rn are each independently H or Ci.3 alkyl; R2o is H or Ci_3 alkyl; and R4 is H, halogen, methyl or methoxy; provided that when the compound has the structure (la), then R2 is phenyl or heteroaryl, each of which is substituted by YD, wherein YD is as previously defined; or a pharmaceutically acceptable salt thereof, which are useful in the treatment of LXRmediated diseases. In particular, the compounds of this invention are useful in the treatment and inhibition of atherosclerosis and atherosclerotic lesions, lowering LDL cholesterol levels, increasing HDL cholesterol levels, increasing reverse cholesterol transport, inhibiting cholesterol absorption, treatment or inhibition of Alzheimer's disease, type I diabetes, type II diabetes, multiple sclerosis, rheumatoid arthritis, acute coronary syndrome, restenosis, inflammatory bowel disease (IBD), Crohn's disease, endometriosis, celiac, and thyroiditis. The present compounds also are useful for the treatment of TH-1 mediated diseases, particularly in mammals. Accordingly, in some embodiments, the present invention provides methods of treating a Thl-mediated disease in a mammal in need thereof, which comprises providing to said mammal an effective amount of a compound as described herein. Non-limiting examples of Thl-mediated diseases to which the methods of the invention are amenable include multiple sclerosis, rheumatoid arthritis, autoimmune thyroid disease, inflammatory bowel disease, Crohn's disease and atherosclerosis. The present compounds are further useful for suppression of lymphocyte function or activation in a mammal. Thus, in a further aspect, the invention provides methods for suppressing lymphocyte function or activation in a mammal in need thereof, which comprises providing to said mammal an effective amount of a compound as described herein. In some embodiments, the lymphocyte function that is suppressed is lymphokine production. The present compounds find further use in the suppression of macrophage function or activation in a mammal. Thus, in a further aspect, the invention provides methods for suppressing macrophage function or activation in a mammal in need thereof, which comprises providing to said mammal an effective amount of a compound as described herein. In a further aspect, the present compounds find further use in suppressing cytokine production in a mammal. Accordingly, the present invention further provides methods of suppressing cytokine production in a mammal in need thereof, which comprises providing to said mammal an effective amount of a compound as described herein. Pharmaceutically acceptable salts of the compounds of Formula (I) or (la) with an acidic moiety can be formed from organic and inorganic bases. Suitable salts from bases are, for example, metal salts, such as alkali metal or alkaline earth metal salts, for example, sodium, potassium, or magnesium salts; or salts with ammonia or an organic amine, such as morpholine, thiomorpholine, piperidine, pyrrolidine, a mono-, di- or tri-lower alkylamine, for example, ethyl-tert-butyl-, diethyl-, diisopropyl-, triethyl-, tributyl-or dimethylpropylamine, or a mono-, di-, or trihydroxy lower alkylamine, for example, mono-, di- or triethanolamine. Furthermore, internal salts may be formed. Similarly, when a compound of the present invention contains a basic moiety, salts can be formed from organic and inorganic acids. For example, salts can be formed from acetic, propionic, lactic, citric, tartaric, succinic, fumaric, maleic, malonic, mandelic, malic, phthalic, hydrochloric, hydrobromic, phosphoric, nitric, sulfuric, methanesulfonic, napthalenesulfonic, benzenesulfonic, toluenesulfonic, camphorsulfonic, and similarly known pharmaceutically acceptable acids. Preferred compounds of the invention include compounds of Formula (I) or (la) described hereinbefore, wherein: RI is Ci.6 alkyl, CN, CC^Rs, NRsRe, halogen; wherein said Ci-6 alkyl is optionally substituted with from 1 to 7 substituents independently selected from the group consisting of halogen and OH; RS and Re are as previously defined; Ra is as defined above; R3 is phenyl optionally substituted with Ci.3 alkyl; or ZA; wherein: Z is CH2; A is pyridyl or phenyl, wherein said phenyl is optionally substituted with up to five independently selected RU groups, wherein: each said Rig is independently selected from the group consisting of Cue alkyl, Ci.3 alkoxy, halogen, OH, NO2, and CN, wherein said Ci_6 alkyl and said Cu alkoxy are each optionally substituted with from 1 to 7 fluorine atoms; Rao is as defined above; and R4 is H or halogen; or a pharmaceutically acceptable salt thereof. Further preferred compounds of the invention include compounds of Formula (I) or (la) described hereinbefore, wherein: RI is Ci-s alkyl, CN, or halogen; wherein said Ci-6 alkyl is substituted with from 1 to 7 fluorine atoms; R2 is arylalkyl, heteroaryl or heteroarylalkyl, wherein said arylalkyl is optionally substituted with up to four substituents independently selected from the group consisting of halogen, CN and OR?, and said heteroaryl is optionally substituted with YD; or R2 is phenyl substituted with up to four substituents independently selected from the group consisting of C\.3 alkyl, Ci_3 alkoxy, halogen, CH2OH, CN, NR7R8, N(R7)C(O)NR5R6, S(O)mR7, NO2, OC(O)R7 and YD, providing any OH group present is not in the para position; wherein said Cu alkyl and said Cio alkoxy are each optionally substituted with from 1 to 7 fluorine atoms, and m, R5, Re, R7, and Rg are as previously defined; Y is a bond, CH2, CH2CH2, C2.4 alkynylenyl, -O-, OCH2, CH2O, -NR7-, - N(R7)CH2,-, -N(R7)CONRg-, -OCH2O- or -OC(R7)CO2R8-; D is benzyl or phenyl each of which is optionally substituted with up to five independently selected R groups; each R is independently selected from the group consisting of Ci_6 alkyl, Ci.3 alkoxy, halogen, -C(=O)H, -C(O)-d.3 alkyl, CH2OH, CN, NO2, CM alkenyl, Cw alkynyl, S(O)jR9, and WX; wherein said C|. 6 alkyl and said C\-i alkoxy are each optionally substituted with from 1 to 7 fluorine atoms; and j, Rg, and WX are as previously defined; or D is a heterocycloalkyl, heterocycloalkylalkyl, heteroarylalkyl, heteroaryl, or arylalkyl group, each of which is optionally substituted with up to four independently selected Ra groups; each Ra is independently selected from the group consisting of Ci.g alkyl, phenyl, benzyl, Cs.g cycloalkyl, Cy.n arylalkyl, Cio alkoxy, halogen, -C(=O)H, -C(O)-C,.3 alkyl, CH2OH, CN, NO2, NH2, OH, =O, C2.e alkenyl, Cw alkynyl, S(O)jR9, and WX; wherein said Ci-g alkyl and said C\.j alkoxy are each optionally substituted with from 1 to 7 fluorine atoms, and j, Rg, and WX are as previously defined; RS is ZA; wherein: Z is CH2; A is phenyl, wherein said phenyl is optionally substituted with up to five independently selected R^ groups: each Rig is independently selected from the group consisting of C|^ alkyl, C 1.3 alkoxy, halogen, OH, NO2, and CN, wherein said Ci-6 alkyl and said Q-3 alkoxy are optionally substituted with from 1 to 7 fluorine atoms; R2o is as previously defined; and R4 is H; or a pharmaceutically acceptable salt thereof. In some embodiments, the ring system formed by RS, Re and the nitrogen atom to which they are attach that includes one or two additional heteroatoms, which optionally can be substituted as previously described herein, is, for example and without limitation, morpholine, pyridine, piperidine, piperidinone, piperazine, imidazolone, imidazole, and other such systems as provided as non-limiting examples in the definitions of heterocycloalkyl and heteroaryl hereinbelow. In some embodiments, the ring system formed by Ry, Rg and the nitrogen atom to which they are attach that includes one or two additional heteroatoms is, for example and without limitation, morpholine, pyridine, piperidine, piperidinone, piperazine, and other such systems as provided as non-limiting examples in the definitions of heterocycloalkyl and heteroaryl hereinbelow. Examples of RI are Q-e alkyl, CN, CO2Rs, NRsRe, or halogen; wherein said Ci^ alkyl is optionally substituted with from 1 to 7 substituents independently selected from the group consisting of halogen and OH; wherein R$ and R§ are as previously defined. Other examples of RI include CN, halogen, or Ci_e alkyl substituted with from 1 to 7 fluorine atoms, e.g., RI is CF3, F or Cl. Other examples of RI are Ci.3 perhaloalkyl or Ci_3 perhaloalkoxy. In some embodiments, RI is Ci-3 perfluoroalkyl; Ci-3 perfluoroalkoxy. In one embodiment, RI is CF3. Examples of R2 are C3.8 alkyl, C3.g cycloalkyl, aryl, arylalkyl, heteroaryl or heterocycloalkyl, wherein: said C3.g alkyl, said C3.8 cycloalkyl and said arylalkyl are each optionally substituted with up to four substituents independently selected from the group consisting of halogen, CN and OR?, wherein R7 is as previously defined; and said heteroaryl is optionally substituted with YD, wherein Y and D are as previously defined; or R2 is phenyl substituted with up to four substituents independently selected from the group consisting of CM alkyl, C2-8 alkenyl, C2-g alkynyl, Ci.3 alkoxy, C3.g cycloalkyl, halogen, OH, CH2OH, CN, NR7Rg, N(R7)C(O)NR5R6, S(O)mR7, phenyl, NO2, C(O)R7, OC(O)R7, C(O)NR7R8, C(O)NR7D and YD, providing any OH group present is not in the para position; wherein said C).3 alkyl and said Ci_3 alkoxy are each optionally substituted with from 1 to 7 fluorine atoms; and m, Rs, Re, R7, and Rg, Y and D are as previously defined. In some embodiments R2 is arylalkyl, heteroaryl or heteroarylalkyl, wherein said arylalkyl is optionally substituted with up to four substituents independently selected from the group consisting of halogen, CN and OR7; and said heteroaryl is optionally substituted with YD, wherein Y and D are as previously defined; or R2 is phenyl substituted with up to four substituents independently selected from the group consisting of Ci.3 alkyl, C[.3 alkoxy, halogen, CH2OH, CN, NR7Rg, N(R7)C(O)NR5R6, S(O)mR7, NO2, and YD, wherein said Ci.3 alkyl and said C,.3 alkoxy are each optionally substituted with from 1 to 7 fluorine atoms; m, Rs, Re, R7, and Rg are as previously defined; Y is a bond, CH2, CH2CH2, C2^ alkynylenyl, -O-, OCH2, CH2O, -N(R7)-, - N(R7)CH2-, -N(R7)CONRg-, -OCH2O- or -OC(R7)(CO2R8)-; D is benzyl or phenyl, each of which is optionally substituted with up to five independently selected R groups; each R is independently selected from the group consisting of Ci_6 alkyl, Ci-3 alkoxy, halogen, -C(=O)H, -C(O)-C,.3 alkyl, CH2OH, CN, NO2, C2.4 alkenyl, C2-4 alkynyl, S(O)jR9, and WX; wherein said C|. 6 alkyl and said Ci-3 alkoxy are each optionally substituted with from 1 to 7 fluorine atoms; and j, R9, and WX are as previously defined; or D is a heterocycloalkyl, heteroarylalkyl, heteroaryl, or arylalkyl group, each of which is optionally substituted with up to four independently selected Ra groups; each Ra is independently selected from the group consisting of C\.g alkyl, phenyl, benzyl, C7.n arylalkyl, CM alkoxy, halogen, -C(=O)H, -C(O)-do alkyl, CH2OH, CN, NO2, NH2, OH, =O, C2^ alkenyl, C2. 4 alkynyl, S(O)jR9, and WX; wherein said d.g alkyl, said C2.6 alkenyl, C2_4 alkynyl and said do alkoxy are each optionally substituted with from 1 to 7 fluorine atoms; and j, Rg, and WX are as previously defined. In other embodiments, R2 is phenyl substituted with up to four substituents independently selected from R, wherein R is do alkyl, C2.g alkenyl, C2.g alkynyl, do alkoxy, C3.g cycloalkyl, halogen, OH, CH2OH, CN, NR7Rg-, N(R7)C(O)NR5R6, S(O)mR7, phenyl, NO2, do perfluoroalkyl, C(O)R7, OC(O)R7, C(O)NR7R8, C(O)NR7D and YD, providing any OH group present is not in the para position; wherein said do a'kyl ar|d said do alkoxy are each optionally substituted with from 1 to 5 fluorine atoms; and m, RS, Re, R7, Rg, Y and D are as previously defined; or R2 is phenyl substituted with an ortho or meta OH; or R2 is phenyl substituted with a meta OH. In yet further embodiments, R2 is phenyl substituted with YD; e.g., where Y is a bond, CH2, CH2CH2) C2A alkynylenyl, -O-, OCH2, CH2O, -N(R7)-, -N(R7)CH2-, -N(R7)CONR8-, -OCH2O- or -OC(R7)(CO2Rg). In some embodiments, R2 is phenyl substituted with do perfluoroalkyl. D can be, for example, benzyl or phenyl, each of which is optionally substituted with up to five substituents independently selected from R, wherein R is d-6 alkyl, do alkoxy, halogen, -C(=O)H, -C(O)-do alkyl, CH2OH, CN, NO2, C2.4 alkenyl, C2^ alkynyl, S(O)jR9, or WX; wherein said Ci^ alkyl and said Cio alkoxy are each optionally substituted with from 1 to 7 fluorine atoms; and j, Rg and WX are as previously defined. In some embodiments D is phenyl that is optionally substituted with up to four independently selected R groups; each R is independently selected from the group consisting of d.6 alkyl, -C(=O)H, d.3 acyl, CM alkoxy, halogen, CH2OH, CN, NO2, CM alkenyl, C2.4 alkynyl, and WX; wherein said Q.6 alkyl and said CM alkoxy are each optionally substituted with from 1 to 7 fluorine atoms; and WX is as previously defined. In some embodiments D is a heterocycloalkyl or heteroaryl, each of which is optionally substituted with up to four independently selected Ra groups; each Ra group as defined previously. In yet further embodiments, R or Ra is CM perfluoroalkyl or CM perfluoroalkoxy. Examples of Ra are 2,4-dimethoxyphenyl, phenyl, 4-methoxy-2-methylphenyl, 2-methoxyphenyl, 4-methoxyphenyl, 2-methylphenyl, 2,4-dimethylphenyl, l,l'-biphenyl-4-yl, 4-methoxy-3,5-dimethylphenyl, 2-naphthyl, 2-vinylphenyl, 4-methoxy-3-methylphenyl, 3-methylphenyl, 2,3-dimethylphenyl, 3-(trifluoromethyl)phenyl, 4-fluorophenyl, 3-chlorophenyl, 3-methoxyphenyl, benzaldehyde-2-yl, 2-isopropylphenyl, 2-cyclohexylphenyl, 2-benzylphenyl, 2-(l,l,2,2-tetrafluoroethoxy)phenyl, 2-chloro-5-fluorophenyl, 9H-fluoren-2-yl, 4-benzylphenyl, benzaldehyde-3-yl, 3-hydroxyphenyl, butyl, isobutyl, pentyl, cyclopentyl, 2-hydroxyphenyl, l,3-dioxolan-2-yl, 4'-methoxy-l,l'-biphenyl-4-yl, l,l'-biphenyl-4-ol, cyclohexanyl, 4-methoxy-2-methylphenyl, 4-methoxy-2-methylphenyl, 4-bromophenyl, 3-bromophenyl, 3-(benzyloxy)phenyl, 2-hydroxyphenyl, N-cyclohexamino, and 4-phenoxy-phenyl. Examples of RS are phenyl optionally substituted with CM alkyl, or ZA, e.g., where Z is CH2; and where A is pyridyl or phenyl, wherein said phenyl is optionally substituted with up to five independently selected Rig groups, wherein each R|g is independently selected from the group consisting of Ci-e alkyl, CM alkoxy, CM perfluoroalkyl, halogen, OH, NC>2, and CN; wherein said Ci-e alkyl and said CM alkoxy are each optionally substituted with from 1 to 7 fluorine atoms. In one embodiment, Rig is CM perfluoroalkyl. In some embodiments, A is phenyl that is optionally substituted with up to five independently selected Rig groups, wherein each Rig is independently selected from the group consisting of Cj.6 alkyl, CM alkoxy, halogen, OH, NO2, CN, phenyl, pyrrol-1-yl, C(O)R)2, CO2Ri2, NR]2Ri3, C(O)NRi2Ri3, and S(O)nRi2; wherein said C^ alkyl and said CM alkoxy are each optionally substituted with from 1 to 7 fluorine atoms; and n, Ri2 and RIS are as previously defined. In other such embodiments, Rig is CM perfluoroalkyl. In some embodiments, R$ is ZA; wherein Z is CH2; and A is phenyl, wherein said phenyl is optionally substituted with up to five independently selected Rig groups, wherein each Rig is independently selected from the group consisting of Ci-e alkyl, CM alkoxy, halogen, OH, NO2, and CN; wherein said C].e alkyl and said CM alkoxy are each optionally substituted with from 1 to 7 fluorine atoms. In other such embodiments, Rig is Ci-3 perfluoroalkyl. Examples of RS are 2-allyl, propyl, cyclopentyl, isobutyl, cyclohexylmethyl, 2-ethylbutyl, cyclobutyl, benzyl, 3-methoxybenzyl, 2-naphthylmethyl, 4-methylbenzyl, 2-nitrobenzyl, 2-(trifluoromethyl)benzyl, 4-bromobenzyl, 3-(difluoromethoxy)benzyl, 3-(trifluoromethoxy)benzyl, 3,5-difluorobenzyl, 3,5-dimethylbenzyl, quinolinylmethyl, 2-chloro-4-fluorobenzyl, 3-(lH-pyrrol-l-yl)benzyl, 2-bromobenzyl, 2-methylbenzyl, 5-fluoro-2-methylbenzyl, 6-chloro-2-fluoro-3-methylbenzyl, l,r-biphenyl-3-ylmethyl, 2-chlorobenzyl, 1-naphthylmethyl, 2,5-dichlorobenzyl, (difluoromethoxy)benzyl, 3-fluorobenzyl, 4-methylbenzyl, 2,4-dimethylbenzyl, mesitylmethyl, 2, 4-dimethylbenzyl, 2-phenylethyl, 2-chloro-6-fluorobenzyl, 4-chloro-2-fluorobenzyl, 4-fluorobenzyl, 4-(methylsulfonyl)benzyl, and phenyl. Examples of R4 are H or halogen, e.g., F. In some embodiments, the compounds of Formula (I) or (la) can be used in the manufacture of a medicament for treating or inhibiting atherosclerosis or atherosclerotic lesions, lowering LDL cholesterol levels, increasing HDL cholesterol levels, increasing reverse cholesterol transport, inhibiting cholesterol absorption, treating or inhibiting Alzheimer's disease or dementia, treating or inhibiting type I or type II diabetes, treating or inhibiting acute coronary syndrome or restenosis, treating multiple sclerosis, rheumatoid arthritis, inflammatory bowel disease, Crone's disease, or endometriosis, treating or inhibiting celiac or thyroiditis, treating a Thl-mediated disease, suppressing lymphocyte function or activation, suppressing macrophage function or activation, suppressing cytokine production, or increasing ABCA1 activity by 20% or more while increasing SREBP-lc activity by 25% or less, in a mammal in need thereof. In some such embodiments, the compounds of Formula (I) or (la) can be used in the manufacture of a medicament for treating or inhibiting a Thl-mediated disease, for example, multiple sclerosis, rheumatoid arthritis, autoimmune thyroid disease, inflammatory bowel disease, Crohn's disease or atherosclerosis; or lymphocyte function, e.g., lymphokine production. As used herein, the term "alky!" includes both branched and straight-chain saturated aliphatic hydrocarbon groups (e.g., Q-Cg; Ci-Ca) having the specified number of carbon atoms, e.g., methyl (Me), ethyl (Et), propyl (Pr), isopropyl (i-Pr), isobutyl (i-Bu), secbutyl (s-Bu), tertbutyl (t-Bu), isopentyl, isohexyl and the like. The term "alky!" further includes both unsubstituted and mono-, di- and tri-substituted hydrocarbon groups, with halogen substitution particularly preferred. The term, "alkylenyl" refers to a divalent linking alkyl group. The term "cycloalkyl" is intended to have its normal meaning of a cyclic alkyl group, e.g., a mono, bi-, tri-cyclic, fus&d, bridged or spiro saturated hydrocarbon moiety, e.g., 3-10 carbon atoms. The term "cycloalkyalkyl" is intended to denote a group of formula -alkyl-cycloalkyl, for example, a cyclopentylmethyl or cyclohexylmethyl group, where alkyl and cycloalkyl are as defined herein. As used herein the term "alkoxy" has its normal meaning of a group of formula -O-alkyl, e.g., where alkyl is as defined herein. As used herein, the term "alkenyl" is intended to denote alkyl groups that contain at least one double bond, e.g., 2-8 carbon atoms such as 2-7, including for example but not limited to vinyl, allyl, 2-methyl-allyl, 4-but-3-enyl, 4-hex-5-enyl, 3-methyl-but-2-enyl and the like. The term "cycloalkenyl" is intended to denote a cyclic alkyenyl such as cyclohex-2-enyl. As used herein, the term "alkynyl" is intended to denote alkyl groups that have at least one triple carbon-carbon bond, e.g., 2-8 carbon atoms such as 2-7. Example alkynyl groups include ethynyl, propynyl, and the like. The term "alkynylenyl" refers to a divalent linking alkynyl group. As used herein, the term "halogen" has its normal meaning of group seven elements, e.g., E, Cl, Br and I. As used herein the term "aryl" is intended to mean an aromatic hydrocarbon system, e.g., of 6 to 20 ring carbon atoms, e.g., of 1, 2 or 3 rings, for example, phenyl, naphthyl, naphthalene, anthracene, phenanthrenyl, anthracenyl, pyrenyl and the like. Also included within the definition of aryl are aromatic systems containing one or more fused aromatic rings, for example, fluorenyl groups. Included in the definition of aryl are aromatic systems containing one or more fused saturated or partially saturated hydrocarbon rings, for example, 1,2,3,4-tetrahydronaphthalene and indan. As used herein, the term "arylalkyl" is intended to mean a group of formula -alkyl-aryl, wherein aryl and alkyl have the definitions herein. As used herein, the term "acyl" has its accustomed meaning as an alkanoyl group, for example a group of formula -C(O)-alkyl, e.g.,-C(O)-Ci-3 alkyl. As used herein, the term "heterocycloalkyl" is intended to mean a 5, 6, 7, 8, 9 or 10-membered non-aromatic, preferably but not necessarily, saturated, monocyclic, bicyclic or spirocyclic ring system containing up to three ring hetero atoms selected from O, N and S. Nonlimiting examples of heterocycloalkyl groups include pyrrolidine, piperidine, morpholino, imidaolidine, pyrazolidine, piperazine, pyrazoline, pyrroline, pyran, thiazbline, thiazine, and such moieties that contain spirocyclic ring sytems, for example, 1,2-dioxane groups. Heterocycloalkyl groups also can contain one or more appended alkyl groups. Also included in the definition of heterocycloalkyl are moieties that contain exocyclic heteroatoms, for example, a cycloalkyl ring having a ring carbon attached to an exocyclic O or S atom through a double bond. Further included in the definition of heterocycloalkyl are moieties having one or more aromatic rings fused (i.e., having a bond in common with) to the nonaromatic heterocyclic ring, for example, phthalimidyl, naphthalimidyl pyromellitic diimidyl, phthalanyl, 2,3-dihydrobenzofuran, and benzo derivatives of saturated heterocycles such as indoline and isoindoiine groups. The term "heteroarylalkyl" is intended to denote a group of formula -alkyl-heteroaryl. The term "heteroaryl" is intended to denote an aryl (e.g., aromatic) group that has at least one non-carbon (i.e., "hetero") ring atom, for example, one or more ring O, N or S atoms. Nonlimiting examples of heteroaryl groups include radicals derived from furan, imidazole, tetrazole, isothiazole, isoxazole, oxathiazole, oxazole, oxazoline, pyrazole, pyrrole, thiophene, oxazine, pyrazine, pyridazine, pyridine, pyrimidine, thiadizine, thiazine, benzodioxine, benzodioxole, benzofuran, benzothiophene, dibenzothiophene, chromene, cinnoline, indazole, indole, indolene, isoindolene, indolizine, isoindole, isoindoiine, isoquinoline, naphthyridine, phthalazine, purine, quinazoline, quinoline, and quinolizine. At various places in the present specification, substituents of compounds of the invention are disclosed in groups or in ranges. It is specifically intended that the invention include each and every individual subcombination of the members of such groups and ranges. For example, the term "C\* alkyl" is specifically intended to individually disclose methyl, ethyl, propyl, isopropyl, n-butyl, sec-butyl, isobutyl, etc. As used in accordance with this invention, the term "providing," with respect to providing a compound or substance covered by this invention, means either directly administering such a compound or substance, or administering a prodrug, derivative, or analog that will form the effective amount of the compound or substance within the body. This invention also covers providing the compounds of this invention to treat the disease states disclosed herein that the compounds are useful for treating. The compounds of the present invention can contain an asymmetric atom, and some of the compounds can contain one or more asymmetric atoms or centers, which thus, can give rise to optical isomers (enantiomers) and diastereomers. The present invention includes such optical isomers (enantiomers) and diastereomers (geometric isomers); as well as the racemic and resolved, enantiomerically pure R and S stereoisomers; as well as other mixtures of the R and S stereoisomers and pharmaceutically acceptable salts thereof. Optical isomers can be obtained in pure form by standard procedures known to those skilled in the art, and include, but are not limited to, diastereomeric salt formation, kinetic resolution, and asymmetric synthesis. It is also understood that this invention encompasses all possible regioisomers, and mixtures thereof, which can be obtained in pure form by standard separation procedures known to those skilled in the art, and include, but are not limited to, column chromatography, thin-layer chromatography, and high-performance liquid chromatography. The compounds of Formula (I) or (la) can be conveniently prepared by the procedures outlined in the schemes below from commercially available starting materials, compounds known in the literature, or readily prepared intermediates, by employing standard synthetic methods and procedures known to those skilled in the art. Standard synthetic methods and procedures for the preparation of organic molecules and functional group transformations and manipulations can be readily obtained from the relevant scientific literature or from standard textbooks in the field. Although not limited to any one or several sources, classic texts such as Smith, M. B. and March, J., March's Advanced Organic Chemistry: Reactions, Mechanisms, and Structure, 5th ed., John Wiley & Sons: New York, 2001; and Greene, T. W. and Wuts, P. G. M. Protective Groups in Organic Synthesis, 3rd ed., John Wiley & Sons: New York, 1999, are useful and recognized reference textbooks of organic synthesis known to those in the art. General Schemes for the Preparation of Compounds of Formula (I) or (la) A convenient synthetic route for preparation of the compounds of formula (I) or (la) is presented in Scheme 1. According to Scheme 1, a ben/oic acid derivative (III) is transformed into a Weinreb-amide (IV) through the corresponding acid chloride. This compound is reacted with substituted aryl magnesium bromides or aryl lithium compounds to afford ketones (V). Condensation of ketones (V) with hydrazine hydrate in pyridine provides substituted IH-indazoles (VI), which are subsequently alkylated giving the target 2//-indazoles (I) and l//-indazole derivatives (la). Both derivatives (I) and (la) can be further functionalized by the following schemes. (Figure Remove)Scheme 1. Reaction conditions: a) SOC12 (solv.), reflux; b) HN(OMe)Me-HCl, pyridine, DCM, rt; c) THF, 0°-rt; d) H2NNH2 H2O, DMAP, pyridine, 100°C; e) benzyl or alkyl halide derivative, with or without base such as NaH, DMF, 120°C. According to Scheme 2, certain compounds of Formula (I) prepared as shown in Scheme 1, containing OH moiety on the phenyl ring attached to the 3-position of the indazole system, are transformed into corresponding biaryl ethers of Formula (I) upon treatment with substituted aryl halides XPhR in the presence of cesium carbonate and Cul at 200° C in microwave. 3-(Hydroxyphenyl) derivatives of Formula (I) also can be benzylated under similar conditions to provide phenol-benzylated compounds of Formula (I). (Figure Remove)According to Scheme 1, certain compounds of Formula (I), prepared as shown in Scheme 1, may contain halogens on the phenyl ring attached to the 3-postion of the indazole. According to Scheme 3, treatment of such compounds with corresponding organozinc reagents in THF in the presence of a palladium catalyst provides benzyl derivatives of Formula (1). Palladium catalyzed coupling of the halo-compounds of Formula (I) with substituted arylboronic acids at standard conditions provides biaryl derivatives of Formula (I). These halo-compounds also can be reacted with amines in the presence of base and palladium catalyst in toluene to afford aniline derivatives of Formula (I). (Figure Remove) According to Scheme 4 certain compounds of Formula (I) prepared as shown in Scheme 1, containing a formyl moiety on the phenyl ring attached to the 3-postion of the indazole, can be converted to the corresponding benzyl alcohols by a standard NaBH4 reduction procedure and subsequently reacted with substituted benzyl halides in the presence of NaOH to provide dibenzyl ethers of Formula (I). (Figure Remove)According to Scheme 5, compounds of formula (VI) can be reacted with an aryl boronic acid in the presence of a copper catalyst and suitable solvent to give compounds of Formula (I) in which the RS group is aryl. Scheme 5 (Figure Remove)Certain 3-amino-compounds of Formula (I) could be prepared as shown in Scheme 6. According to Scheme 6, substituted o-amino-benzoic acids (VIII) are converted to the corresponding o-azido-derivatives (IX) via standard diazotization procedure. Treatment of these compounds with thionyl chloride provides corresponding acyl chlorides, which are reacted directly with amines to afford amides of formula (X). Amides (X) undergo intramolecular cyclization when heated with thionyl chloride at 100°C providing 3-chloroindazole derivatives of formula (XI). 3-Chloroindazoles (X\) can be reacted with amines when heated in DMSO to provide the desired 3-amino-indazoles of Formula (I). (Figure Remove) According to Scheme 7, certain compounds of Formula (I) prepared as shown in Scheme 1, containing a bromo moiety on the phenyl ring attached to the 3 position of the indazole, can be converted to the corresponding alkynes by standard Heck coupling with l-trimethylsilyl-2-tributyltinacetylene in the presence of a palladium(O) catalyst such as palladium-(0)-tetrakis-triphenylphosphine. Subsequent functionalization with aryl iodo compounds via a Sonogashira type coupling, as described by Urganoker, S. and Verkade, J. G.,JOrg Chem 2004, 69, 5752-5755, or similar procedures as known to those skilled in the art, provide aryl alkynyl analogs of Formula (I). (Figure Remove)According to Scheme 8, certain compounds of Formula (I) prepared as shown in Scheme 7, containing an alkynylaryl moiety on the phenyl ring attached to the 3 position of the indazole, can be converted to the corresponding saturated analogs by atmoshpheric hydrogenation over ethylenediamine-palladium complex as described by Sajiki et al., JOC, 1998, 63, 7990, or by other reductions known to those skilled in the art. Scheme 8 (Figure Remove)According to Scheme 9, certain compounds of formula (I) prepared as shown in Scheme 7, containing alkynylaryl moiety on the phenyl ring attached to the 3 position of the indazole, can be converted to the corresponding 2-indolyl analogs when the distal ring contains a carbamoyl moiety such as NHCOOCHs. Treatment of the carbamate with tetrabutylammonium fluoride or other suitable base known to those skilled in the art provides the corresponding 2-indolyl compounds of Formula (I), which can be further alkylated at the indole nitrogen by reaction with an alkyl or arylhalide in the presence of a suitable base such as sodium hydride. Scheme 9 (Figure Remove)PHARMACOLOGICAL TEST PRODCEDURES Ligand-binding assay for human LXR(3. Ligand-binding to the human LXRP can be demonstrated for the compounds of Formula (I) or (la) by the following procedure. Materials And Methods: Assay Buffer: lOOmM KC1, lOOmM TRIS (pH 7.4 at +4°C), 8.6%glycerol, 0.1 mM PMSF*, 2mM MTG*, 0.2% CHAPS Tracer: 3HT0901317 (* not used in wash buffer) Receptor source: E. coli extract from cells expressing biotinylated hLXRp (Extract is made in a similar buffer as above, but with 50mM TRIS.) Davl Washed streptavidin coated flash plates with wash buffer. Diluted receptor extract to give Bmax ~ 4000 cpm and added to the wells. Wrapped the plates in aluminum foil and stored them at +4°C overnight. Day 2 Made a dilution series in DMSO of the test ligands. Made a 5nM solution of the radioactive tracer in buffer. Mixed 250ul diluted tracer with 5u1 of the test ligand from each concentration of the dilution series. Washed the receptor-coated flash plates. Added 200ul per well of the ligand/radiolabel mixture to the receptor-coated flash plates. Wrapped the plates in aluminum foil and incubated at +4°C overnight. Day 3 Aspirated wells, and washed the flash plates. Sealed the plate. Measured the remaining radioactivity in the plate. The compounds of Formula (I) or (la) described herein have activity (1C50 values) in the LXRP ligand binding assay in the range between 0.001 to 20 uM. Quantitative analysis of ABCA1 gene regulation in THP-1 cells. The effect of compounds of Formula (I) or (la) on the regulation of the ABCA1 gene can be assessed using the following procedure. Materials And Methods: Cell culture. The THP-1 monocytic cell line (ATCC # TIB-202) was obtained from American Type Culture Collection (Manassas, VA) and cultured in RPMI 1640 medium (Gibco, Carlsbad, CA) containing 10% FBS, 2 mM L-glutamine, and 55 uM beta-Mercaptoethanol (BME). Cells were plated in 96-well format at a density of 7.5 X 104 in complete medium containing 50-100 ng/ml phorbal 12,13-dibutyrate (Sigma, St.Louis, MO) for three days to induce differentiation into adherent macrophages. Differentiated THP-1 cells were treated with test compounds or ligands dissolved in DMSO (Sigma. D-8779) in culture medium lacking phorbal ester. Final concentrations of DMSO did not exceed 0.3% of the media volume. Dose response effects were measured in duplicate, in the range of 0.001 to 30 micromolar concentrations and treated cells were incubated for an additional 24 hrs prior to RNA isolation. Unstimulated cells treated with vehicle were included as negative controls on each plate. An LXR agonist reference, TO901317, was dosed at 0.3 uM and served as a positive control. RNA isolation and quantitation. Total cellular RNA was isolated from treated cells cultured in 96-well plates using PrepStation 6100 (Applied Biosystems, Foster City, CA), according to the manufacturer's recommendations. RNA was resuspended in ribonuclease-free water and stored at -70°C prior to analysis. RNA concentrations were quantitated with RiboGreen assay, #R-11490 (Molecular Probes, Eugene, OR). Gene expression analysis. Gene-specific mRNA quantitation was performed by real-time PCR (RT-PCR) with the Perkin Elmer Corp. chemistry on an ABI Prism 7700 Sequence detection system (Applied Biosystems, Foster City, CA) according to the manufacturer's instructions. Samples (50-100 ng) of total RNA were assayed in duplicate or triplicate in 50 ul reactions using one-step RT-PCR and the standard curve method to estimate speeific mRNA concentrations. Sequences of gene-specific primer and probe sets were designed with Primer Express Software (Applied Biosystems, Foster City, CA). The •human ABCAl primer and probe sequences are: forward, CAACATGAATGCCATTTTCCAA. reverse, ATAATCCCCTGAACCCAAGGA, and probe, 6FAM- TAAAGCCATGCCCTCTGCAGGAACA-TAMRA. RT and PCR reactions were performed according to PE Applied Biosystem's protocol for Taqman Gold RT-PCR. Relative levels of ABCAl mRNA are normalized using GAPDH mRNA or 18S rRNA probe/primer sets purchased commercially (Applied Biosystems, Foster City, CA). Statistics: Mean, standard deviation and statistical significance of duplicate evaluations of RNA samples were assessed using ANOVA, one-way analysis of variance, using SAS analysis. Reagents: GAPDH Probe and Primers - Taqman GAPDH Control Reagents 402869 or 4310884K 18S Ribosomal RNA - Taqman 18S Control Reagents 4308329 10 Pack Taqman PCR Core Reagent Kit 402930 The compounds of Formula (I) or (la) described herein upregulate the transcription of the ABCA1 gene in THP-lcells (EC50 value) in a range between 0.001 to 15 uM with efficacy values in the range of 20 to 250% when compared to the efficacy shown by 0.3 uM of reference standard T0901317. Based on the results obtained in the standard pharmacological test procedures, the compounds of this invention are useful in treating or inhibiting LXR mediated diseases. In particular, the compounds of this invention are useful in the treatment and inhibition of atherosclerosis and atherosclerotic lesions, lowering LDL cholesterol levels, increasing HDL cholesterol levels, increasing reverse cholesterol transport, inhibiting cholesterol absorption, treatment or inhibition of Alzheimer's disease, type 1 diabetes, type II diabetes, multiple sclerosis, rheumatoid arthritis, acute coronary syndrome, restenosis, inflammatory bowel disease (IBD), Crohn's disease, endometriosis, celiac, and thyroiditis. It is understood that the effective dosage of the active compounds of this invention may vary depending upon the particular compound utilized, the mode of administration, the condition being treated and severity thereof, as well as the various physical factors related to the individual being treated. It is projected that compounds of this invention will be administered at an oral daily dosage of from about 0.05 mg to about 30 mg per kilogram of body weight, preferably administered in divided doses two to six times per day, or in a sustained release form, and may be adjusted to provide the optimal therapeutic result. The compounds of this invention, as a pharmaceutical composition, can be formulated neat or with a pharmaceutical carrier for administration, the proportion of which is determined by the solubility and chemical nature of the compound, chosen route of administration and standard pharmacological practice. The pharmaceutical carrier may be solid or liquid. A solid carrier can include one or more substances which also may act as a flavoring agent, sweetening agent, lubricant, solubilizer, suspending agent, filler, glidant, compression aid, binder, or tablet-disintegrating agent; it also can be an encapsulating material. In powders, the carrier is a finely divided solid that is in admixture with the finely divided active ingredient. Solid dosage unit forms or compositions such as tablets, troches, pills, capsules, powders, and the like, may contain a solid carrier binder such as gum tragacanth, acacia, corn starch or gelatin; excipients such as dicalcium phosphate; a disintegrating agent 27 such as corn starch, potato starch, alginic acid; a lubricant such as magnesium stearate; and a sweetening agent such as sucrose, lactose, or saccharin. When a dosage unit form is a capsule, it may contain, in addition to materials of the above type, a liquid carrier such as a fatty oil. Various other materials may be present as coatings or to modify the physical form of the dosage unit. For instance, tablets may be coated with shellac, sugar or both. Liquid carriers are used in preparing liquid dosage forms such as solutions, suspensions, dispersions, emulsions, syrups, elixirs and pressurized compositions. The active ingredient can be dissolved or suspended in a pharmaceutically acceptable liquid carrier such as water, an organic solvent, a mixture of both, or pharmaceutically acceptable oils or fats. The liquid carrier can contain other suitable pharmaceutical additives such as solubilizers, emulsifiers, buffers, preservatives, sweeteners, flavoring agents, suspending agents, thickening agents, colors, viscosity regulators, stabilizers or osmo-regulators. Suitable examples of liquid carriers for oral and parenteral administration include water (partially containing additives as above, e.g., cellulose derivatives, preferably, sodium carboxymethyl cellulose solution); alcohols, including monohydric alcohols such as ethanol and polyhydric alcohols such as glycols and their derivatives; lethicins, and oils such as fractionated coconut oil and arachis oil. For parenteral administration, the liquid carrier also can be an oily ester such as ethyl oleatc and isopropyl myristate. Sterile liquid carriers are useful in sterile liquid form compositions for parenteral administration. The liquid carrier for pressurized compositions can be a halogenated hydrocarbon or other pharmaceutically acceptable propellant. A liquid pharmaceutical composition such as a syrup or elixir may contain, in addition to one or more liquid carriers and the active ingredients, a sweetening agent such as sucrose, preservatives such as methyl and propyl parabens, a pharmacetitically acceptable dye or coloring agent, or a flavoring agent such as cherry or orange flavoring. Liquid pharmaceutical compositions that are sterile solutions or suspensions can be administered intraocularly or parenterally, for example, by intramuscular, intraperitoneal or subcutaneous injection. Sterile solutions also can be administered intravenously. The pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases, the form must be sterile and must be fluid to the extent that easy injectabiliry exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing a liquid carrier, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol and liquid polyethylene glycol), suitable mixtures thereof, and vegetable oils. The liquid carrier may be suitably mixed with a surfactant such as hydroxypropylcellulose. The compounds of the present invention also may be administered rectally or vaginally in the form of a conventional suppository. For administration by intranasal or intrabronchial inhalation or insufflation, the compounds of this invention may be formulated into an aqueous or partially aqueous solution, which can then be utilized in the form of an aerosol. The compounds of this invention may be administered topically, or also transdermally through the use of a transdermal patch containing the active compound and a carrier that is inert to the active compound, which is non toxic to the skin, and allows delivery of the agent for systemic absorption into the blood stream via the skin. The carrier may take any number of forms such as creams and ointments, pastes, gels, and occlusive devices. The creams and ointments may be viscous liquid or semisolid emulsions of either the oil-in-water or water-in-oil type. Pastes comprised of absorptive powders dispersed in petroleum or hydrophilic petroleum containing the active ingredient also may be suitable. A variety of occlusive devices may be used to release the active ingredient into the blood stream such as a semipermeabie membrane covering a reservoir containing the active ingredient with or without a carrier, or a matrix containing the active ingredient. Other occlusive devices are known in the literature. EXAMPLES The following describes the preparation of representative compounds of this invention. Compounds described as homogeneous were determined to be 98% or greater a single peak (exclusive of enantiomers) by analytical reverse phase chromatographic analysis with 254 nM UV detection. Melting points are reported as uncorrectcd in degrees centigrade. The infrared data is reported as wave numbers at maximum absorption, vnKU, in reciprocal centimeters, cm"1. Mass spectral data is reported as the mass-to-charge ratio, m/z; and for high resolution mass spectral data, the calculated and experimentally found masses, [M+H]+, for the neutral formulae M are reported. Nuclear magnetic resonance data is reported as 5 in parts per million (ppm) downfield from the standard, tetramethylsilane, along with the solvent, nucleus, and field strength parameters. The spin-spin homonuclear coupling constants are reported as J values in hertz; and the multiplicities are reported as: s, singlet; d, doublet; t, triplet; q, quartet: quintet; or br, broadened. Preparation of Compounds of Formula (I) or (la): All compound numbers in this section refer to the Schemes above. EXAMPLE 1 2-BENZYL-3-(4-METHOXYPHENYL)-7-TRIFLUOROMETHYL-2//-INDAZOLE Preparation of 2-fluoro-JV-methoxy-AT-methyl-3-trifluoromethyl-benzamide (compound of formula (IV)). • 1.04 g (5 mmol) of 2-f!uoro-3-(trifluoromethyl)benzoic acid (compound of formula (III)) 3 ml of SOCb were dissolved and the mixture was refluxed for 2 hrs. Remaining SOCb was removed in vacua and the residue (crude acid chloride derivative) was dissolved in 5 ml of CH2Cb- JV.O-Dimethyhydroxylamine hydrochloride (585 mg, 6 mmol) in 8 ml of CfyCh was added followed by 0.5 ml of pyridine. The reaction mixture was stirred for 1.5 hrs., quenched with aq. NH4C1 solution and the product was extracted twice with C^Cla, and the combined organic phases were washed with brine and dried over sodium sulfate. Evaporation of solvents in vacua gave 1.02 g of product as an oil which was pure enough to be used in the next step without further purification. (CDC13) 8 = 7.68 (t, 1 H), 7.62 (t, 1 H), 7.30 (t, 1 H), 3.52 (s, br, 3 H), 3.35 (s, br, 3 H). LCMS: M+H: 252.3. Preparation of (2-fluoro-3-trifluoromethyl-phenyl)-(4-rnethoxy-phenyl)-methanone (compound of formula (V)). 1 milliliter of a 1M THF solution of 4-methoxyphenylmagnesium bromide (1 mmol) was added to a solution of 126 mg (0.5 mmol) of 2-fluoro-./v'-methoxy-./V-methyl-3-trifluoromethyl-benzamide in 2 ml of THF at 0°C. The reaction mixture was stirred for 2 hrs. at this temperature and then quenched with saturated Nl-UCl solution and the phases were separated. The aqueous phase was extracted twice with Cl^Cfe and the combined organic phases were washed with brine and dried over Na2SC>4. The resulting ketone (135 mg) was obtained after flash chromatographic purification using 5% EtOAc in heptane as an eluent. (CDC13) 5 = 7.80 (d, 2 H), 7.77 (t, 1 H), 7.67 (t, 1 H), 7.36 (t, 1 H), 6.95 (d, 2 H), 3.86 (s, 3 H). GC, M/Z: 298.0. Preparation of 3-(4-methoxy-phenyI)-7-trifluoromethyl-l//-indazole (compound of formula (VI)). (2-Fluoro-3-trifluoromethyl-phenyl)-(4-methoxy-phenyl)-methanone (59.6 mg, 0.2 mmol) was dissolved in 1 ml of pyridine. Hydrazine hydrate (97 u,l, 2 mmol) and 4-(dimethylamino)-pyridine (24.4 mg, 0.2 mmol) were added. The reaction mixture was stirred overnight at 100°C. After cooling to room temperature, EtOAc and 1M HC1 were added. The organic phase was washed three times with brine, dried over MgSO4 and concentrated under vacuum. Purification of the crude product by flash column chromatography on silica gel (n-heptane/ethyl acetate, 85:15) afforded 56 mg of the analytically pure product. (CDC13), 8 = 9.65 (s, br, 1 H), 8.18 (d, 1 H), 7.89 (d, 2 H), 7.68 (d, 1 H), 7.21 (t, 1 H). 7.07 (d, 2 H), 3.89j[s,3H). LCMS: M+H: 293.2. Preparation of 2-benzyl-3-(4-methoxy-phenyl)-7-trifluoromethyl-2//-indazole (compound of Formula (I)). To a solution of 3-(4-methoxy-phenyl)-7-trifluoromethyl-l//-indazole (59 mg, 0.2 mmol) in 0.5 ml DMF were added 72 ul of benzyl bromide (0.6 mmol). The reaction mixture was heated overnight at 120°C. After cooling to room temperature, ethyl acetate was added and the solution was washed three times with brine. The organic layer was dried over MgSC>4 and concentrated. Column chromatography (n-heptane/ethyl acetate. 70:30 as eluent) afforded 61 mg of pure product. (CDC13) 8 = 7.61 (s, 1 H), 7.54 (d, 1 H), 7.10-7.20 (m, 5 H), 7.02-6.95 (m, 3 H), 6.93-6.87 (m, 2 H), 5.56 (s, 2 H), 3.76 (s, 3 H). LCMS: M+H: 383.2. EXAMPLE 2 4-[4-(2-BENZYL-7-TRIFLUOROMETHYL-2//-INDAZOL-3-YL)- PHENOXYMETHYL]-BENZOIC ACID Preparation of 4-(2-benzyl-7-trifluoromethyl-2//-indazol-3-yl)-phenol. 2-Benzyl-3-(4-methoxy-phenyl)-7-trifluoromethyl-2//-indazole (38 mg, 0.1 mmol) was dissolved in 2 ml of dry dichloromethane and cooled to -78°C. BFs-SMej was added (1 ml of 1M solution in CFbCli, 1 mmol) and the reaction mixture was allowed to reach room temperature overnight. The reaction mixture was quenched with MeOH followed by the addition of 2M HCI. The product was extracted with CHaCb and purified by column chromatography on silica (n-heptane/ethyl acetate, 50:50, as eluent). Yield: 32 mg. (acetone) 5 = 8.84 (s, br, 1 H), 7.80 (d, 1 H), 7.67 (d, 1 H), 7.40-7.35 (m, 2 H), 7.31-7.21 (m, 3 H), 7.17 (t, 1 H), 7.12 (d, 2 H), 7.06-7.01 (m, 2 H), 5.71 (s, 2 H). LCMS: M+H: 369.2; M-H: 367.0. Preparation of 4-[4-(2-benzyl-7-trifluoromethyl-2//-indazol-3-yI)-phenoxymethyl]-benzoic acid methyl ester. 4-(2-Benzyl-7-trifluoromethyl-2//-indazol-3-yl)-phenol (180 mg, 0.5 mmol) and potassium carbonate (138 mg, 1.0 mmol) were dissolved in 3 ml of dry DMF and 4-bromomethyl-benzoic acid methyl ester (230 mg, 1.0 mmol) was added. The reaction mixture was run in microwave (Emory's Optimizer, Personal Chemistry) at 200°C for 30 min. After cooling to room temperature, the reaction mixture was diluted with 1 M HCI (aq.) and the product was extracted three times with CF^Cb; and after evaporation of the solvent, it was purified with preparative HPLC using a gradient with acidic mobile phase on an ACE-C8 column to afford 140 mg of analytically pure product. LCMS: M+H: 517.4. Rf: 6.68 min (20-100% CH3CN in 10 min in 0.05% HCOOH in water on an ACE 5 C8 column). Preparation of 4-[4-(2-benzyl-7-trifluorornethyl-2//-indazol-3-yl)-phenoxymethyI]-benzoic acid. 4-[4-(2-Benzyl-7-trifluoromethyI-2//-indazol-3-yl)-phenoxymethyl]-benzoic acid methyl ester (50 mg, 0.1 mmol) was dissolved in 1 ml of methanol, and 24 mg of LiOH (10 eq) were added. The reaction mixture was stirred at 70°C overnight. After cooling to room temperature, 1M HCl-solution and dichloromethane were added, and the phases were separated. The resulting acid was obtained by standard flash chromatographic purification (43 mg). (DMSO) 8 = 7.98 (d, 2 H), 7.81 (d, 1 H), 7.73 (d, 1 H), 7.60 (d, 2 H), 7.50 (d, 2 H), 7.30-7.18 (m, 6 H), 7.00 (d, 2 H), 5.72 (s, 2 H), 5.29 (s, 2 H). LCMS: M+H: 503.3; M-H: 501.2. EXAMPLE 3 4-[4-(2-BENZYL-7-TRIFLUOROMETHYL-2fl-INDAZOL-3-YL)-PHENOXY]- BENZOICACID Preparation of 4-[4-{2-benzyl-7-trifluoromethyl-2//-indazol-3-yl)-phenoxy]-benzoic acid methyl ester. 4-(2-Benzyl-7-trifluoromethyl-2//-indazol-3-yl)-phenol (180 mg, 0.5 mmol), cesium carbonate (490 mg, 1.5 mmol), Cul (20 mg, 0.1 mmol) and 4-bromo-benzoic acid methyl ester (215 mg, 1.0 mmol) were dissolved in 3 ml of dry pyridine. The reaction mixture was run in microwave (Emory's Optimizer, Personal Chemistry) at 200°C for 30 min. After cooling to room temperature, the reaction mixture was diluted with 1 M HCI (aq.) and the product extracted three times with CFhCh. Combined organic phases were dried and evaporated, and the crude material was purified with preparative HPLC using a gradient with an acidic mobile phase on an ACE-C8 column to afford 151 mg of analytically pure product. (CDCI3) 6 = 8.07 (d, 2 H), 7.82 (d, 1 H), 7.71 (d, 1 H), 7.49 (d, 2 H), 7.24 (m, 6 H), 7.11 (d, 2 H), 7.02 (d, 2 H), 5.77 (s, 2 H). LCMS: M+H: 489.5, 2M+H: 977.9, M-H: 487.4, 2M-H: 975.5. Preparation of 4-[4-(2-benzyl-7-trifluoromethyl-2//-indazol-3-yl)-phenoxy]-benzoic acid. This compound was prepared from 4-[4-(2-benzyl-7-trifluoromethyl-2//-indazol-3-yl)-phenoxy]-benzoic acid methyl ester in a way described for the preparation of 4-|4-(2-benzyl-7-trifluoromethyl-2//-indazol-3-yl)-phenoxymethyl]-benzoic acid (Example 2). (CDC13) 5 = 8.07 (d, 2 H), 7.82 (d, 1 H), 7.71 (d, 1 H), 7.49 (d, 2 H), 7.29-7.19 (m, 6 H), 7.11 (d, 2 H), 7.02 (d, 2 H), 5.77 (s, 2 H). LCMS: M+H: 489.5, 2M+H: 977.9; M-H: 487.4, 2M-H: 975.5. EXAMPLE 4 [4-(2-BENZYL-7-TRIFLUOROMETHYL-2#-lNDAZOL-3-YL)-PHENYL]-PHENYL- AMINE 2-Benzyl-3-(4-bromo-phenyl)-7-trifluoromethyl-2#-indazole (compound of Formula (I) was prepared similar to Example 1 using 4-bromophenyl lithium instead of a Grignard reagent. This compound (43 mg, 0.1 mmol) along with aniline (11 ul, 0.12 mmol), palladium(II) acetate (0.3 mg, 0.001 mmol) and BINAP (1 mg, 0.0015 mmol) was dissolved in 0.5 ml of toluene and the reaction mixture was stirred at room temperature for 10 min. A solution of 13.5 mg of NaO'Bu (0.14 mmol) in 0.5 ml of toluene was added and the reaction mixture was stirred overnight at 80°C. Saturated NHjCI-solution and dichloromethane were added, and the phases were separated. The resulting product was obtained after flash chromatographic purification using n-heptane/ethyl acetate, 80:20, as eluent. Yield: 27 mg. (CDC13) 8 = 7.67 (d, 1 H), 7.55 (d, 1 H), 7.24 (t, 2 H), 7.20-6.99 (m, 12 H), 6.98-6.91 (m, 1 H), 5.61 (s, 2H). LCMS: M+H: 444.8; M-H: 442.7. EXAMPLE 5 3-[4-(2-BENZYL-7-TRIFLUOROMETHYL-2//-INDAZOL-3-YL)-BENZYL]-BENZOIC ACID METHYL ESTER 2-Benzyl-3-(4-bromo-phenyl)-7-trifluoromethyl-2//-indazole (43 mg, 0.1 mmol) and 4 mg of /m-[triphenylphosphine]palladium(II) chloride were dissolved in THF. After 5 minutes, 0.4 ml of a 0.5M solution of 3-(methoxycarbonyl)-benzylzinc bromide in THF (0.2 mmol) were added and the reaction mixture was stirred at room temperature overnight. 1M HCI-solution and dichloromethane were added, and the phases were separated. The resulting product was obtained after flash chromatographic purification using n-heptane/ethyl acetate, 90:10, as eluent. Yield: 47 mg. (CDC13) 5 = 7.88 (s, 1 H), 7.85 (d, 1 H), 7.61 (d, 1 H), 7.52 (d, 1 H), 7.28-7.37 (m, 2 H), 7.25-7.18 (m, 4 H), 7.16-7.11 (m, 3 H), 7.02-6.95 (m, 3 H), 5.58 (s, 2 H), 4.02 (s, 2 H), 3.83 (s, 3 H). LCMS: M+H:501.5. EXAMPLE 6 4'-(2-BENZYL-7-TRIFLUOROMETHYL-2//-INDAZOL-3-YL)-BIPHENYL-4-CARBOXYLIC ACID To a degassed solution of 2-benzyl-3-(4-bromo-phenyl)-7-trifluoromethyl-2#-indazole (22 mg, 0.05 mmol), 8 mg of boronic acid (0.05 mmol) and 21 mg of Na2CO3 (0.2 mmol) in 1 ml of MeCN/water (1:1) mixture, bis-(fr/-phenylphosphine)-palladium(II)-chloride was added. The mixture was stirred for 18 hrs. at 80°C. Saturated NHUC1-solution and dichloromethane were added, and the phases were separated. The resulting product was obtained after flash chromatographic purification using n-heptane/ethyl acetate, 50:50, as eluant. Yield: 18 mg. (acetone) 6 = 8.22 (d, 2 H), 8.01 (d, 2 H), 7.98-7.92 (m, 3 H), 7.80-7.73 (m, 3 H), 7.36-7.26 (m, 4 H), 7.23-7.18 (m, 2 H), 5.86 (s, 2 H). LCMS: M+H: 473.3; M-H: 471.5. EXAMPLE 7 4-[3-(2-BENZYL-7-TRIFLUOROMETHYL-2tf-INDAZOL-3-YL)-BENZYLOXYMETHYLJ-BENZOIC ACID Preparation of [3-(2-benzyl-7-trifluoromethyl-2//-indazol-3-yl)-phenyl]-methanol. To a solution of 116 mg (0.305 mmol) of 3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3-yl]benzaldehyde (compound of Formula (1)), prepared in a same way as Example 1, in 2 ml of methanol, 23 mg (0.71 mmol) of NaBH4 was added at 0°C. The reaction mixture was stirred at this temperature for 1 hr. Saturated NhUCl-solution and dichloromethane were added, and the phases were separated. The product was obtained after flash chromatographic purification using dichloromethane as eluant. Yield: 111 mg. (CDC13) 5 = 7.61 (m, 2 H), 7.39 (m, 2 H), 7.23 (m, 6 H), 7.02 (m, 3 H), 5.59 (s, 2 H). 4.64 (s, 2 H), 2.05 (s, br, 1 H). LCMS: M+H: 383.3. Preparation of 4-[3-(2-benzyl-7-trifluorornethyl-2//-indazol-3-yl)-benzyloxymethyl]-benzoic acid methyl ester. [3-(2-Benzyl-7-trifluoromethyl-2//-indazol-3-yl)-phenyl]-methanol (40 mg, 0.105 mmol) was dissolved in 1 ml of DMSO, and 30 mg of KOH were added. The reaction mixture was stirred at room temperature for 30 min. 4-Bromomethyl-benzoic acid methyl ester (96 mg, 0.42 mmol) was added and the reaction mixture stirred overnight at room temperature. Fifteen (15) volumes of water were added and the precipitate was collected. The product was obtained after flash chromatographic purification using dichloromethane as eluent. Yield: 33 mg. LCMS: M+H: 531.5 Rf: 6.33 min (20-100% CH3CN in 10 min in 0.05% HCOOH in water on an ACE 5 C8 column). Preparation of 4-[3-(2-benzyl-7-trifluorornethyl-2//-indazol-3-yl)-benzyloxymethyl|-benzoic acid. This compound was prepared from 4-[3-(2-benzyl-7-trifluoromethyl-2//-indazol-3-yl)- benzyloxymethyl]-benzoic acid methyl ester in the same manner described for the preparation of 4-[4-(2-benzyl-7-trifiuoromethyl-2//-indazol-3-yI)-phenoxymethyl]- benzoic acid (Example 2). (MeOD) 8 = 8.00 (d, 2 H), 7.76 (d, 1 H), 7.70 (d, 1 H), 7.58-7.53 (m, 2 H), 7.47-7.38 (m. 4 H), 7.25-7.16 (in, 4 H), 7.05-6.99 (m, 2 H), 5.71 (s, 2 H), 4.62 (s, 4 H). LCMS: M+H: 517.4; M-H: 515.3. EXAMPLE 8 2-BENZYL-3-PHENYL-7-METHYL-2//-INDAZOLE This compound was prepared similarly to that of Example I. (CDC13) 5 = 7.49-7.42 (m, 3 H), 7.15-7.08 (m, 7 H), 7.02-6.97 (m, 2 H), 6.92-6.87 (m, 1 H), 4.27 (s, 2 H), 2.78 (s, 3 H). LCMS: M+H: 299.6. EXAMPLE 9 2-BENZYL-3-(4-PHENOXYPHENYL)-7-TRIFLUOROMETHYL-2//-INDAZOLE This compound was prepared similarly to that of Example 1. (CDC13) 8 = 7.64 (d, 1 H), 7.57 (d, 1 H), 7.32 (t, 2 H), 7.18 (m, 5 H), 7.10 (t, 1 H), 7.01 (m, 7 H), 5.60 (s, 2 H). LCMS: M+H: 445.4. EXAMPLE 10 3-[4-(2-BENZYL-7-TRIFLUOROMETHYL-2//-INDAZOL-3-YL)-PHENOXY]-BENZOIC ACID This compound was prepared similarly to that of Example 3. (CDC13) 8 = 7.85 (d, 2 H), 7.81 (d, 1 H), 7.73-7.67 (m, 2 H), 7.53 (t, 1 H), 7.45 (d, 2 H), 7.36-7.31 (m, 1 H), 7.29-7.14(m, 6H), 7.02 (d',2 H), 5.75 (s, 2 H). LCMS: M+H: 489.5, 2M+H: 977.6; M-H: 487.4, 2M-H: 975.5. EXAMPLE 11 {4-[4-(2-BENZYL-7-TRIFLUOROMETHYL-2//-INDAZOL-3-YL)-PHENOXY]-PHENOXY}-ACETIC ACID This compound was prepared similarly to that of Example 3. (CDC13) 8 = 7.72 (d, 1 H), 7.65 (d, 1 H), 7.26 (m, 6 H), 7.07 (m, 7 H), 6.96 (d, 2 H), 5.69 (s, 2 H), 4.68 (s, 2 H). LCMS: M+H: 519.5, M-H: 517.4. EXAMPLE 12 {4-[4-(2-BENZYL-7-TRIFLUOROMETHYL-2//-INDAZOL-3-YL)-PHENOXYMETHYLJ-PHENOXY} -ACETIC ACID This compound was prepared similarly to that of Example 2. (CDC13) 5 = 7.63 (d, 1 H), 7.57 (d, 1 H), 7.31 (d, 2 H), 7.18 (m, 5 H), 6.99 (m, 5 H), 6.89 (d, 2 H), 5.59 (s, 2 H), 4.98 (s, 2 H), 4.60 (s, 2 H). LCMS: M+H: 533.3, M-H: 531.2. EXAMPLE 13 {3-[4-(2-BENZYL-7-TRIFLUQROMETHYL-2//-INDAZOL-3-YL)-PHENOXYMETHYLJ-PHENOXY} -ACETIC ACID This compound was prepared similarly to that of Example 2. (CDC13) 8 = 7.63 (d, 1 H), 7.57 (d, 1 H), 7.26 (t, 1 H), 7.21-7.14 (m, 5 H), 7.04-6.95 (m, 7 H), 6.80 (d, 1 H), 5.60 (s, 2 H), 5.03 (s, 2 H), 4.60 (s, 2 H). LCMS: +H: 533.3; M-H: 531.2. EXAMPLE 14 {3-[4-(2-BENZYL-7-TRIFLUOROMETHYL-2//-INDAZOL-3-YL)-PHENOXYMETHYLJ-PHENYL}-ACETIC ACID This compound was prepared similarly to that of Example 2. (MeOD) 8 = 7.84 (d, 1 H), 7.77 (d, 1 H), 7.51 (d, 2 H), 7.46-7.40 (m, 4 H), 7.35-7.30 (m. 3 H), 7.28-7.19 (m, 3 H), 7.10-7.06 (m, 2 H), 5.78 (s, 2 H), 5.24 (s, 2 H), 3.71 (s, 2 H). LCMS: M+H: 517.4; M-H: 515.3. EXAMPLE 15 3-[4-(2-BENZYL-7-TRIFLUOROMETHYL-2//-INDAZOL-3-YL)-PHENOXYMETHYLJ-BENZOIC ACID This compound was prepared similarly to that of Example 2. (MeOD) 8 = 8.04 (s, 1 H), 7.89 (d, 1 H), 7.64 (d, 1 H), 7.58 (t, 2 H), 7.40 (t, 1 H), 7.24 (d, 2 H), 7.15-7.09 (m, 3 H), 7.07-7.03 (m, 3 H), 6.91-6.86 (m, 2 H), 5.78 (s, 2 H), 5.12 (s, 2 H). LCMS: M+H: 503.3; M-H: 501.2. EXAMPLE 16 {4-[3-(2-BENZYL-7-TRIFLUOROMETHYL-2//-INDAZOL-3-YL)- BENZYLOXYMETHYL]-PHENOXY}-ACET1CAC1D This compound was prepared similarly to that of Example 7. (CDC13) 8 = 7.71 (d, 1 H), 7.65 (d, 1 H), 7.47 (d, 2 H), 7.34 (s, 1 H), 7.31-7.25 (m, 2 H). 7.24-7.20 (m, 3 H), 7.14-7.06 (m, 3 H), 6.90 (d, 2 H), 5.67 (s, 2 H), 4.65 (s, 2 H), 4.54 (s, 2 H), 4.50 (s, 2 H). LCMS: M+H: 547.4; M-H: 545.3. EXAMPLE 17 {3-[3-(2-BENZYL-7-TRIFLUOROMETHYL-2//-INDAZOL-3-YL)- BENZYLOXYMETHYL]-PHENOXY}-ACETICACID This compound was prepared similarly to that of Example 7. (CDC13) 5 = 7.71 (d, 1 H), 7.65 (d, 1 H), 7.50-7.46 (m, 2 H), 7.36 (s, 1 H), 7.31-7.27 (m, 1 H), 7.24-7.20 (m, 3 H), 7.14-7.06 (m, 3 H), 6.96 (t, 2 H), 6.84 (d, 1 H), 5.68 (s, 2 H), 4.64 (s, 2 H), 4.56 (s, 2 H), 4.54 (s, 2 H). LCMS: M+H: 547.7; M-H: 545.3. EXAMPLE 18 3-[3-(2-BENZYL-7-TRIFLUOROMETHYL-2//-INDAZOL-3-YL)-BENZYLOXYMETHYL]-BENZOIC ACID This compound was prepared similarly to that of Example 7. (MeOD) 8 = 8.01 (s, 1 H), 7.94 (d, 1 H), 7.75 (d, 1 H), 7.68 (d, 1 H), 7.56-7.50 (m, 3 H), 7.45-7.40 (m, 2 H), 7.39-7.35 (m, 1 H), 7.22-7.14 (m, 4 H), 6.99 (d, 2 H), 5.70 (s, 2 H). 4.59 (d, 4 H). LCMS: M+H: 517.4; M-H: 515.3. EXAMPLE 19 2-BENZYL-3-(4-METHOXY-2-METHYLPHENYL)-7-TRIFLUOROMETHYL-2/y- 1NDAZOLE This compound was prepared similarly to that of Example 1. (CDC13) 8 = 7.64 (d, 1 H), 7.50 (d, 1 H), 7.24-7.16 (m, 3 H), 7.10-7.00 (m, 4 H), 6.88- 6.82 (m, 2 H), 5.55 (d, 1 H), 5.47 (d, 1 H), 3.89 (s, 3 H), 1.79 (s, 3 H). LCMS: M+H: 397.2. EXAMPLE 20 2-BENZYL-3-(2-METHOXYPHENYL)-7-TRIFLUOROMETHYL-2//-INDAZOLE This compound was prepared similarly to that of Example 1. (CDC13) 8 = 7.67-7.60 (m, 2 H), 7.50 (dt, 1 H), 7.23-7.14 (m, 4 H), 7.10-6.98 (m, 5 H), 5.66 (d, 1 H), 5.56 (d, 1 H), 3.63 (s, 3 H). LCMS: M+H: 383.2. EXAMPLE 21 2-BENZYL-3-O-TOLYL-7-TRIFLUOROMETHYL-2H-INDAZOLE This compound was prepared similarly to that of Example 1. (CDC13) 8 = 7.65 (d, 1 H), 7.50 (d, 1 H), 7.44 (dt, 1 H), 7.35-7.27 (m, 2 H), 7.24-7.12 (m, 4 H), 7.07 (t, 1 H), 7.04-6.97 (m, 2 H), 5.56 (d, 1 H), 5.49 (d, 1 H), 1.81 (s, 3 H). LCMS: M+H: 367.0. EXAMPLE 22 2-BENZYL-3-(2,4-DIMETHYLPHENYL)-7-TRIFLUOROMETHYL-2//-INDAZOLE This compound was prepared similarly to that of Example 1. (CDC13) 8 = 7.65 (d, 1 H), 7.50 (d, 1 H), 7.24-6.99 (m, 9 H), 5.57 (d, I H), 5.47 (d, 1 H). 2.44 (s, 3 H), 1.80(s, 3 H). LCMS: M+H: 381.5. EXAMPLE 23 2-BENZYL-3-B1PHENYL-4-YL-7-TR1FLUOROMETHYL-2//-1NDAZOLE This compound was prepared similarly to that of Example 1. (CDC13) 8 = 7.82 (d, 1 H), 7.75 (d, 2 H), 7.72-7.66 (m, 2 H), 7.52 (t, 2 H), 7.49-7.40 (m, 3 H), 7.34-7.25 (m, 3 H), 7.20-7.12 (m, 3 H), 5.76 (s, 2 H). LCMS: M+H: 429,5. EXAMPLE 24 2-BENZYL-7-TRIFLUOROMETHYL-3-(2-VINYLPHENYL)-2#-lNDAZOLE This compound was prepared similarly to that of Example 1. (CDC13) 8 = 7.62 (d, 1 H), 7.53 (d, 1 H), 7.43-7.34 (m, 2 H), 7.20 (dt, 1 H), 7.09-7.01 (m, 3 H), 7.00-6.92 (m, 2 H), 6.88-6.82 (m, 2 H), 6.06 (dd, 1 H), 5.55 (d, 1 H), 5.50 (d, 1 H), 5.30 (d, 1 H), 4.98 (d, 1 H). LCMS: M+H: 379.4. EXAMPLE 25 2-BENZYL-7-TRIFLUOROMETHYL-3-(3-TRIFLUOROMETHYLPHENYL)-2//- INDAZOLE This compound was prepared similarly to that of Example 1. (CDC13) 8 = 7.65 (d, 1 H), 7.61-7.56 (m, 2 H), 7.53 (t, 1 H), 7.48 (s, 1 H), 7.44 (d, 1 H), 7.20-7.12 (m, 3 H), 7.05 (t, 1 H), 7.03-6.97 (m, 2 H), 5.57 (d, 2 H). LCMS: M+H: 421.4. EXAMPLE 26 2-BENZYL-3-(4-FLUOROPHENYL)-7-TRIFLUOROMETHYL-2/y-INDAZOLE This compound was prepared similarly to that of Example 1. (CDC13) 8 = 7.60-7.53 (m, 2 H), 7.24-7.19 (m, 2 H), 7.18-7.12 (m, 3 H), 7.11-7.05 (m, 2 H), 7.02 (t, 1 H), 7.00-6.95 (m, 2 H), 5.55 (s, 2 H). LCMS: M+H: 371.0. EXAMPLE 27 2-BENZYL-3-(3-CHLOROPHENYL)-7-TRlFLUOROMETHYL-2//-INDAZOLE This compound was prepared similarly to that of Example 1. (CDC13) 8 = 7.59 (d, 1 H), 7.55 (d, 1 H), 7.37-7.33 (m, 1 H), 7.30 (t, 1 H), 7.25-7.21 (m. 1 H), 7.19-7.10 (m, 4 H), 7.05-6.97 (m, 3 H), 5.56 (s, 2 H). LCMS: M+H: 387.5. EXAMPLE 28 2-BENZYL-3-(3-METHOXYPHENYL)-7-TRIFLUOROMETHYL-2//-INDAZOLE This compound was prepared similarly to that of Example 1. (CDC13) 6 = 7.76 (d, 1 H), 7.66 (d, 1 H), 7.42 (t, 1 H), 7.31-7.22 (m, 3 H), 7.16-7.10 (m, 3 H), 7.07-7.02 (m, 1 H), 7.01-6.96 (m, 1 H), 6.88-6.85 (m, 1 H), 5.72 (s, 2 H), 3.72 (s, 3 H). LCMS: M+H: 383.3. EXAMPLE 29 BENZYL-[4-(2-BENZYL-7-TRIFLUOROMETHYL-2tf-INDAZOL-3-YL)-PHENYL]- METHYLAMINE This compound was prepared similarly to that of Example 4. (CDCb) 6 = 7.67 (d, 1 H), 7.53 (d, 1 H), 7.30-7.25 (m, 2 H), 7.23-7.10 (m, 8 H), 7.05- 6.95 (m, 3 H), 6.76-6.70 (m, 2 H), 5.60 (s, 2 H), 4.53 (s, 2 H), 3.03 (s, 3 H). LCMS:M+COO~:516.5. EXAMPLE 30 2-(2-BENZYL-7-TRIFLUOROMETHYL-2//-INDAZOL-3-YL)-PHENOL This compound was prepared similarly to that of Example 1. (acetone) 8 = 8.96 (s, br, 1 H), 7.73 (d, 1 H), 7.68 (d, 1 H), 7.46-7.41 (m, 1 H), 7.28 (dd, 1 H), 7.25-7.14 (m, 5 H), 7.11-7.06 (m, 2 H), 7.03 (dt, 1 H), 5.69 (d, 2 H). LCMS: M+H: 369.2; M-H: 367.0. EXAMPLE 31 3-(4-METHOXY-2-METHYLPHENYL)-2-(4-METHYL-BENZYL)-7- TRIFLUOROMETHYL-2//-INDAZOLE This compound was prepared similarly to that of Example 1. (CDC13) 5 = 7.63 (d, 1 H), 7.49 (d, .1 H), 7.08-6.99 (m, 4 H), 6.94 (d, 2 H), 6.89-6.86 (m, 1 H), 6.86-6.82 (m, 1 H), 5.51 (d, 1 H), 5.41 (d, 1 H), 3.89 (s, 3 H), 2.28 (s, 3 H), 1.81 (s. 3H). LCMS: M+H: 411.5. EXAMPLE 32 2-(2,4-DIMETHYLBENZYL)-3-(4-METHOXY-2-METHYLPHENYL)-7- TRIFLUOROMETHYL-2//-INDAZOLE This compound was prepared similarly to that of Example 1. (CDC13) 6 = 7.63 (d, 1 H), 7.50 (d, 1 H), 7.09-7.03 (m, 2 H), 6.90-6.85 (m, 2 H), 6.84- 6.77 (m, 2 H), 6.57 (d, 1 H), 5.56 (d, 1 H), 5.43 (d, 1 H), 3.88 (s, 3 H), 2.24 (s, 3 H), 2.12 (s, 3 H), 1.85 (s, 3 H). LCMS: M+H: 425.3. EXAMPLE 33 3-(4-METHOXY-2-METHYL-PHENYL)-7-TRIFLUOROMETHYL-2-(2,4,6- TRIMETHYL-BENZYL)-2#-INDAZOLE This compound was prepared similarly to that of Example 1. (CDC13) S = 7.59 (d, 1 H), 7.47 (d, 1 H), 7.06-7.00 (m, 2 H), 6.89-6.85 (m, 1 H), 6.82- 6.78 (m, 1 H), 6.75 (s, 2 H), 5.62 (d, 1 H), 5.51 (d, 1 H), 3.89 (s, 3 H), 2.24 (s, 3 H), 2.12 (s,6H), 1.93(s,3H). LCMS: M+H: 439.7. EXAMPLE 34 2-BENZYL-3-(4-BROMOPHENYL)-7-TRlFLUOROMETHYL-2//-INDAZOLE This compound was prepared similarly to that of Example 1. (CDC13) 5 = 7.62-7.57 (m, 2 H), 7.57-7.53 (m, 2 H), 7.23-7.17 (m, 3 H), 7.16-7.12 (m, 2 H), 7.06 (t, 1 H), 7.03-6.98 (m, 2 H), 5.59 (s, 2 H). LCMS: M+H: 433.4(8lBr); 431.3(79Br). EXAMPLE 35 2-BENZYL-3-(3-BROMOPHENYL)-7-TRlFLUOROMETHYL-2//-INDAZOLE This compound was prepared similarly to that of Example 1. (CDCI3) 8 = 7.60 (d, 1 H), 7.56 (d, 1 H), 7.53-7.49 (m, 1 H), 7.40-7.36 (m, 1 H), 7.25 (t. 1 H), 7.20-7.12 (m, 4 H), 7.06-6.99 (m, 3 H), 5.56 (s, 2 H). LCMS:M+H:431.3(79Br). EXAMPLE 36 4-[4-(2-BENZYL-7-TRIFLUOROMETHYL-2#-INDAZOL-3-YL)-BENZYL]-BENZOIC ACID This compound was prepared similarly to that of Example 5. (acetone) 8 = 8.08-8.03 (m, 2 H), 7.85 (d, 1 H), 7.76-7.72 (m, 1 H), 7.56-7.47 (m, 6 H), 7.32-7.21 (m, 4 H), 7.15-7.11 (m, 2 H), 5.79 (s, 2 H), 4.23 (s, 2 H). LCMS: M+H: 487.4; M-H: 485.3. EXAMPLE 37 4-[3-(2-BENZYL-7-TRIFLUOROMETHYL-2#-INDAZOL-3-YL)-BENZYL]-BENZO1C ACID This compound was prepared similarly to that of Example 5. (acetone) 8 = 8.03-7.99 (m, 2 H), 7.83 (d, 1 H), 7.74 (d, 1 H), 7.57 (t, 1 H), 7.53-7.45 (m. 3 H), 7.40 (d, 2 H), 7.31-7.26 (m, 3 H), 7.23 (t, I H), 7.12-7.07 (m, 2 H), 5.77 (s, 2 H). 4.18(s,2H). LCMS: M+H: 487.4; M-H: 485.3. EXAMPLE 38 3-[4-(2-BENZYL-7-TRIFLUOROMETHYL-2//-INDAZOL-3-YL)-BENZYL]-BENZOIC ACID This compound was prepared similarly to that of Example 5. (acetone) S = 8.06 (s, 1 H), 7.98 (d, 1 H), 7.84 (d, 1 H), 7.73 (d, 1 H), 7.59 (d, 1 H), 7.54- 7.46 (m, 5 H), 7.31-7.25 (m, 3 H), 7.22 (t, 1 H), 7.14-7.09 (m, 2 H), 5.78 (s, 2 H), 4.21 (s, 2 H). LCMS: M+H: 487.4; M-H: 485.6. EXAMPLE 39 3-[3-(2-BENZYL-7-TRIFLUOROMETHYL-2//-INDAZOL-3-YL)-BENZYL]-BENZOIC ACID This compound was prepared similarly to that of Example 5. (acetone) 8 = 8.02 (s, 1 H), 7.96-7.92 (m, 1 H), 7.84 (d, 1 H), 7.74 (d, 1 H), 7.59-7.43 (m, 6 H), 7.32-7.26 (m, 3 H), 7.23 (t, 1 H), 7.12-7.07 (m, 2 H), 5.77 (s, 2 H), 4.20 (s, 2 H). LCMS: M+H: 487.4; M-H: 485.6. EXAMPLE 40 {4-[4-(2-BENZYL-7-TRIFLUOROMETHYL-2/f-INDAZOL-3-YL)-BENZYL]-PHENYL}-ACETIC ACID This compound was prepared similarly to that of Example 5. (acetone) 8 = 7.84 (d, 1 H), 7.74 (d, 1 H), 7.46-7.53 (m, 4 H), 7.25-7.35 (m, 7 H), 7.22 (t, 1 H), 7.10-7.15 (m, 2 H), 5.78 (s, 2 H), 4.11 (s, 2 H), 3.65 (s, 2 H). LCMS: M+H: 501.5; M-H: 499.4. EXAMPLE 41 (4-[3-(2-BENZYL-7-TRIFLUOROMETHYL-2//-INDAZOL-3-YL)-BENZYL]-PHENYL}-ACETIC ACID This compound was prepared similarly to that of Example 5. (acetone) 8 = 7.83 (d, 1 H), 7.74 (d, 1 H), 7.57-7.52 (m, 1 H), 7.50-7.47 (m, 1 H), 7.46- 7.42 (m, 2 H), 7.32-7.27 (m, 5 H), 7.25-7.21 (m, 3 H), 7.12-7.07 (m, 2 H), 5.76 (s, 2 H), 4.08 (s, 2 H), 3.63 (s, 2 H). LCMS: M+H: 501.5; M-H: 499.4. EXAMPLE 42 N-BENZYL-N-[4-(2-BENZYL-7-TRIFLUOROMETHYL-2//-INDAZOL-3-YL)- PHENYL]-AMINE This compound was prepared similarly to that of Example 4. (CDCI3) 8 = 7.63 (d, 1 H), 7.53 (d, 1 H), 7.33-7.19 (m, 5 H), 7.19-7.11 (m, 3 H), 7.07 (d. 2 H), 7.14-6.94 (m, 3 H), 6.65 (d, 2 H), 5.57 (s, 2 H), 4.30 (s, 2 H). LCMS: M+H: 458.6; M-H: 456.2. EXAMPLE 43 BENZYL-[3-(2-BENZYL-7-TRIFLUOROMETHYL-2#-INDAZOL-3-YL)-PHENYL]- AMINE This compound was prepared similarly to that of Example 4. (CDC13) 8 = 7.52 (d, 2 H), 7.29-7.10 (m, 10 H), 7.01-6.92 (m, 3 H), 6.69 (d, 1 H), 6.63 (d, 1 H), 6.48 (s, 1 H), 5.53 (s, 2 H), 4.15 (s, 2 H). LCMS: M+H: 458.6; M-H: 456.5. EXAMPLE 44 2-(2,4-DIMETHYL-BENZYL)-3-PHENYL-7-TRIFLUOROMETHYL-2#-INDAZOLE This compound was prepared similarly to that of Example 1. (CDC13) 8 = 7.65 (d, 1 H), 7.60 (d, 1 H), 7.40 (m, 3 H), 7.30 (m, 2 H), 7.05 (t, 1 H), 6.87 (s, 1 H), 6.78 (d, 1 H), 6.41 (d, 1 H), 5.57 (s, 2 H), 2.19 (s, 3 H), 2.13 (s, 3 H). LCMS: M+H: 381.5. EXAMPLE 45 3-PHENYL-7-TRIFLUOROMETHYL-2-(2,4,6-TRIMETHYL-BENZYL)-2//- INDAZOLE This compound was prepared similarly to that of Example 1. (CDC13) 8 = 7.58 (d, 1 H), 7.49 (d, 1 H), 7.42 (m, 3 H), 7.32 (m, 2 H), 6.97 (t, 1 H), 6.67 (s, 2 H), 5.58 (s, 2 H), 2.14 (s, 3 H), 2.04 (s, 6 H). LCMS: M+H: 395.2. EXAMPLE 46 METHYL 3-({3-[2-BENZYL-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YL ]PHENOXY}METHYL)BENZOATE This compound was prepared similarly to that of Example 2. (CDCb) 8 = 8.06 (s, 1 H), 7.99 (d, 1 H), 7.83-7.75 (m, 2 H), 7.58 (d, 1 H), 7.45 (t, 1 H), 7.41 (t, 1 H), 7.28-7.25 (m, 3 H), 7.15-7.12 (m, 4 H), 6.98 (d, 1 H), 6.89 (m, 1 H), 5.66 (s, 2 H), 5.00 (s, 2 H), 3.94 (s, 3 H). LCMS:M+H:517.4. EXAMPLE 47 2-BENZYL-3-[3-(BENZYLOXY)PHENYL]-7-(TRIFLUOROMETHYL)-2H- INDAZOLE This compound was prepared similarly to that of Example 2. (CDC13) 5 = 7.53-7.50 (m, 2 H), 7.28-7.19 (m, 8 H), 7.17-7.12 (m, 4 H), 7.03-6.95 (m, 4 H), 6.86 (d, 1 H), 6.75-6.83 (m, 1 H), 5.50 (s, 2 H), 4.87 (s, 2 H). LCMS: M+H: 459.5. EXAMPLE 48 [4-({3-[2-BENZYL-7-TRIFLUOROMETHYL)-2H-INDAZOL-3-YL] PHENOXY}METHYL)PHENYL] ACETIC ACID This compound was prepared similarly to that of Example 2. (CDC13) 8 = 3.67 (s, 2 H), 4.95 (s, 2 H), 5.68 (s, 2 H), 6.90 (m, 1 H), 6.97 (m, 1 H), 7.06- 7.13 (m, 4 H), 7.23-7.28 (m, 3 H), 7.29-732 (m, 2 H), 7.33-7.37 (m, 2 H), 7.40 (t, 1 H), 7.66(m, 2 H). LCMS:M-fH:517.4. EXAMPLE 49 3-({3-[2-BENZYL-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENOXY}METHYL) BENZOIC ACID This compound was prepared similarly to that of Example 2. (CDCI3) 8 = 5.00 (s, 2 H), 5.68 (s, 2 H), 6.89 (m, 1 H), 7.01 (d, 1 H), 7.08-7.13 (m, 4 H), 7.25-7.30 (m, 3 H), 7.42 (t, 1 H), 7.51 (t, 1 H), 7.62 (t, 2 H), 7.65 (d, 1 H), 8.08 (d, 1H). 8.12(s, 1H). LCMS: M+H: 503.3; M-H: 501.2. EXAMPLE 50 4-({3-[2-BENZYL-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENOXY}METHYL) BENZOIC ACID This compound was prepared similarly to that of Example 2. (CDC13) 8 = 5.02 (s, 2 H), 5.67 (s, 2 H), 6.85 (s, 1 H), 6.97 (m, 1 H), 7.05-7.15 (m, 4 H), 7.40-7.50 (m, 3 H), 7.54 (m, 1 H), 7.63 (d, 2 H),8.12 (m, 4 H). LCMS: M+H: 503.3; M-H: 501.2. EXAMPLE 51 [4-({3-[2-BENZYL-7-TRIFLUOROMETHYL)-2H-INDAZOL-3-YL] PHENOXY}METHYL)PHENYL] PROPIONIC ACID This compound was prepared similarly to that of Example 2. (CDC13) 8 = 1.53 (d, 3 H), 3.74 (q, 1 H), 4.93 (s, 2 H), 5.65 (s, 2 H), 6.89 (m, 1 H), 6.96 (dt, 1 H), 7.04-7.12 (m, 4 H), 7.22-7.26 (m, 3 H), 7.35 (m, 4 H), 7.39 (t, 1 H), 7.65 (m, 2 H). LCMS: M+H: 531.2; M-H: 529.1. EXAMPLE 52 (3-[3-{2-BENZYL-7-TRIFLUOROMETHYL-2H-INDAZOL-3-YL)- PHENOXYMETHYL])-PHENOXY}-ACETICACID This compound was prepared similarly to that of Example 2. (CD3OD) 8 = 4.50 (d, 2 H), 4.92 (d, 2 H), 5.55 (d, 2 H), 6.78 (dt, 1 H), 6.85-6.92 (m, 6 H), 7.03-7.08 (m, 2 H), 7.10-7.20 (m, 4 H), 7.32 (t, 1 H), 7.56 (d, 1 H), 7.58 (s, 1 H). LCMS: M+H: 533.3; M-H: 531.5. EXAMPLE 53 (4-[3-(2-BENZYL-7-TRIFLUOROMETHYL-2H-INDAZOL-3-YL)- PHENOXYMETHYL])-PHENOXY}-ACETICACID This compound was prepared similarly to that of Example 2. (CD3OD) 8 = 4.55 (s, 2 H), 4.86 (s, 2 H), 5.57 (s, 2 H), 6.82-6.93 (m, 6 H), 7.02-7.10 (m, 2 H), 7.11-7.17 (m, 3 H), 7.22 (d, 2 H), 7.33 (t, 1 H), 7.58 (m, 2 H). LCMS: M+H: 533.3; M-H: 531.2. EXAMPLE 54 2-BENZYL-3-PHENYL-7-TRIFLUOROMETHYL-2H-INDAZOLE This compound was prepared similarly to that of Example 1. (CD3OD) 8 = 5.62 (s, 2 H), 6.90 (m, 2 H), 7.08 (t, 1 H), 7.13 (m, 3 H), 7.3l(m, 2 H), 7.43 (m, 3 H), 7.53 (d, 1 H), 7.62 (d, 1 H). LCMS: M+H: 353.2. EXAMPLE 55 2-(3-METHOXYBENZYL)-3-PHENYL-7-TRIFLUOROMETHYL-2H-INDAZOLE This compound was prepared similarly to that of Example 1. (CD3OD) 8 = 3.51 (s, 3 H), 5.50 (s, 2 H), 6.38 (d, 1 H), 6.46 (s, 1 H), 6.62 (m, 1 H), 7.01 (m, 2 H), 7.29 (m, 2 H), 7.36 (m, 3 H), 7.55 (d, 1 H), 7.61 (d, 1 H ). LCMS: M+H: 383.2. EXAMPLE 56 2-(3-FLUOROBENZYL)-3-PHENYL-7-TRIFLUOROMETHYL-2H-INDAZOLE This compound was prepared similarly to that of Example 1. (CD3OD), 8 = 5.68 (s, 2 H), 6.79 (d, 1 H), 6.85 (d, 1 H), 6.96 (m, 1 H), 7.55 (t, 1 H), 7.23 (m, J H), 7.37 (m, 2 H), 7.49-7.55 (m, 3 H), 7.67 (d, 1 H), 7.73 (d, 1 H). LCMS: M+H: 371.0. EXAMPLE 57 2-(2-NITROBENZYL)-3-PHENYL-7-TRIFLUOROMETHYL-2H-INDAZOLE This compound was prepared similarly to that of Example 1. (CD3OD) 8 = 6.12 (s, 2 H), 6.63 (d, 1 H), 7.19 (t, 1 H), 7.35 (m, 2 H), 7.49 (m, 4 11), 7.57 (t, 1 H), 7.70 (d, 1 H), 7.80 (d, 1 H), 8.15 (d, 1 H). LCMS: M+H: 398.2; M-H: 395.8. EXAMPLE 58 2-(3,5-DIFLUOROBENZYL)-3-PHENYL-7-TRIFLUOROMETHYL-2H-INDAZOLE This compound was prepared similarly to that of Example 1. (CDC13) 8 = 5.67 (s, 2 H), 6.61 (d, 2 H), 6.68 (m, 1 H), 7.15 (t, 1 H), 7.37 (m, 2 H), 7.52 (m, 3 H), 7.68 (d, 1 H), 7.75 (d, 1 H). LCMS: M+H: 389.4; M-H: 387.4. EXAMPLE 59 8-(3-PHENYL-7-TRIFLUOROMETHYL-INDAZOL-2-YL-METHYL)-QUINOLINE This compound was prepared similarly to that of Example 1. (CDC13) 5 = 6.46 (s, 2 H), 7.02 (d, 1 H), 7.15 (t, 1 H), 7.32-7.42 (m, 7 H), 7.70 (d, 1 H). 7.75 (d, 1 H), 7.83 (d, 1 H), 8.16 (d, 1 H), 8.85 (m, 1 H). LCMS: M+H: 404.4. EXAMPLE 60 2-(4-METHYLBENZYL)-3-PHENYL-7-TRIFLUOROMETHYL-2H-INDAZOLE This compound was prepared similarly to that of Example 1. (CD3OD) 6 = 2.12.(s, 3 H), 5.53 (s, 2 H), 6.77 (d, 2 H), 6.93 (d, 2H), 7.04 (t, 1 H), 7.27 (m, 2 H), 7.42 (m, 3 H), 7.55 (d, 1 H), 7.62 (d, 1 H). LCMS: M+H: 367.2. EXAMPLE 61 2-(2-TRIFLUOROMETHYLBENZYL)-3-PHENYL-7-TRlFLUOROMETHYL-2H- INDAZOLE This compound was prepared similarly to that of Example 1. (CD3OD) 5 = 5.83 (s, 2 H), 6.50 (d, 1 H), 7.16 (t, 1 H), 7.27-7.32 (m, 2 H), 7.35-7.43 (m. 5 H), 7.62 (d, 1 H), 7.66 (d, 1 H), 7.74 (d, 1 H ). LCMS: M+H: 421.4. EXAMPLE 62 2-(4-BROMOBENZYL)-3-PHENYL-7-TRIFLUOROMETHYL-2H-INDAZOLE This compound was prepared similarly to that of Example 1. (CD3OD) 5 = 5.55 (s, 2 H), 6.81 (d, 2 H), 7.06 (t, 1 H), 7.25 (d, 2 H), 7.33 (m, 2 H), 7.42 (m, 3 H), 7.58 (d, 1 H), 7.62 (d, 1 H). LCMS: M+H:431.4. EXAMPLE 63 2-(2-DIFLUOROMETHOXYBENZYL)-3-PHENYL-7-TRIFLUOROMETHYL-2H- INDAZOLE This compound was prepared similarly to that of Example 1. (CDC13) 6 = 5.77 (s, 2 H), 6.32-6.62 (t, 1 H), 6.83 (d, 1 H), 7.10 (m, 2 H), 7.13 (t, 1 H), 7.30 (m, 1 H), 7.40 (m, 2 H), 7.50 (m, 3 H), 7.66 (d, 1 H), 7.78 (d, 1 H). LCMS: M+H:419.4. EXAMPLE 64 2-(3-DlFLUOROMETHOXYBENZYL)-3-PHENYL-7-TRIFLUOROMETHYL-2H- INDAZOLE This compound was prepared similarly to that of Example 1. (CDC13) 8 = 5.68 (s, 2 H), 6.27-6.57 (t, 1 H), 6.87 (s, 1 H), 6.95 (d, 1 H), 7.03 (d, 1 II), 7.15 (t, 1 H), 7.25 (m, 1 H), 7.37 (m, 2 H), 7.50 (m, 3 H), 7.66 (d, 1 H), 7.73 (d, 1 H). LCMS: M+H:419.4. EXAMPLE 65 2-(3-TRIFLUOROMETHOXYLBENZYL)-7-TRIFLUOROMETHYL-3-PHENYL-2H- INDAZOLE This compound was prepared similarly to that of Example 1. (CDC13) 6 = 5.65 (s, 2 H), 6.93 (s, 1 H), 7.02-7.12 (m, 3 H), 7.25 (t, 1 H), 7.33 (m, 2 H), 7.47 (m, 3 H), 7.62 (d, 1 H), 7.70 (d, 1 H). LCMS: M+H, 437.2. EXAMPLE 66 2-(3,5-DIMETHYLBENZYL)-3-PHENYL-7-TRIFLUOROMETHYL-2H-INDAZOLE This compound was prepared similarly to that of Example 1. (CDC13) 5 = 2.20 (2, 6 H), 5.65 (s, 2 H), 6.73 (s, 2 H), 6.88 (s, 1 H),), 7.13 (t, 1 H), 7.42 (m, 2 H), 7.53 (m, 3'H), 7.68 (d, 1 H), 7.78 (d, 1 H). LCMS: M+H:381.4. EXAMPLE 67 2-NAPHTHALEN-1-YLMETHYL-3-PHENYL-7-TRIFLUOROMETHYL-2H- INDAZOLE This compound was prepared similarly to that of Example 1. (CD3OD) 6 = 5.80 (s, 2 H), 7.08-7.13 (m, 2 H), 7.29 (s, 1 H), 7.32 (m, 2 H), 7.40 (m, 2 H), 7.44 (m, 3 H), 7.58 (m, 1 H), 7.62 (d, 1 H), 7.67-7.72 (m, 3 H ). LCMS: M+H: 403.4. EXAMPLE 68 2-(2-CHLORO-4-FLUOROBENZYL)-3-PHENYL-7-TRIFLUOROMETHYL-2H- INDAZOLE This compound was prepared similarly to that of Example 1. (CDCI3) 5 = 5.74 (s, 2 H), 6.77 (m, 1 H), 6.90 (td, 1 H), 7.11 (dd, 1 H), 7.17 (t, 1 H), 7.35 (m, 2 H), 7.48(m, 3 H), 7.68 (d, 1 H), 7.81 (d, 1 H). LCMS: M+H: 405.4. EXAMPLE 69 3-PHENYL-2-(3-PYRROL-l-YL-BENZYL)-7-TRlFLUOROMETHYL-2H- INDAZOLE This compound was prepared similarly to that of Example 1. (CDC13) 8 = 5.73 (s, 2 H), 6.31 (m, 2 H), 6.95-7.03 (m, 3 H), 7.14 (t, 1 H), 7.28-7.34 (m. 3 H), 7.40 (m, 2 H), 7.53 (m, 3 H), 7.67 (d, 1 H), 7.75 (d, 1 H). LCMS: M+H: 418.4. EXAMPLE 70 2-(2-BROMOBENZYL)-3-PHENYL-7-TRIFLUOROMETHYL-2H-INDAZOLE This compound was prepared similarly to that of Example 1. (CDC13) 6 = 5.75 (s, 2 H), 6.67 (d, 1 H), 7.08-7.18 (m, 3 H), 7.35 (m, 2 H), 7.48 (m, 3 H), 7.54 (d, 1 H), 7.70 (d, 1 H), 7.75 (d, 1 H). LCMS: M+H:431.3. EXAMPLE 71 2-(2-METHYLBENZYL)-3-PHENYL-7-TRIFLUOROMETHYL-2H-INDAZOLE This compound was prepared similarly to that of Example 1. (CDC13) 5 = 2.20 (s, 3 H), 5.67 (s, 2 H), 6.60 (d, 1 H), 7.07 (m, 1 H), 7.12-7.18 (m, 3 H), 7.37 (m, 2 H), 7.48-7.54 (m, 3 H), 7.69 (d, 1 H), 7.80 (d, 1 H). LCMS: M+H: 367.1. EXAMPLE 72 2-(2,5-DICHLOROBENZYL)-7-TRIFLUOROMETHYL-3-PHENYL-2H-INDAZOLE This compound was prepared similarly to that of Example 1. (CDC13) S = 5.64 (s, 2 H), 6.76 (d, 1 H), 7.18 (m, 2 H), 7.28 (m, 1 H), 7.37 (m, 2 H), 7.51 (m, 3 H), 7.71 (d, 1 H), 7.81 (d, 1 H). LCMS: M+H: 423.2. EXAMPLE 73 2-(2-METHYL-5-FLUOROBENZYL)-3-PHENYL-7-TRIFLUOROMETHYL-2H- 1NDAZOLE This compound was prepared similarly to that of Example 1. (CDC13) 8 = 2.15 (s, 3 H), 5.58 (s, 2 H), 6.27 (d, 1 H), 6.95 (t, 1 H), 7.09 (dd, I H), ),' 7.15 (t, 1 H), 7.32 (m, 2 H), 7.52 (m, 3 H), 7.67 (d, 1 H), 7.80 (d, 1 H). LCMS: M+H: 385.0. EXAMPLE 74 2-(6-CHLORO-2-FLUORO-3-METHYLBENZYL)-3-PHENYL-7-TRIFLUOROMETHYL-2H-INDAZOLE This compound was prepared similarly to that of Example 1. (CDC13) 5 = 2.17 (s, 3 H), 5.87 (s, 2 H), 7.02 (m, 2 H), 7.13 (t, 1 H), 7.48-7.55 (m, 5 H), 7.62 (d, lH),7.71(d, 1 H). LCMS: M+H:419.2. EXAMPLE 75 2-BIPHENYL-3-YLMETHYL-3-PHENYL-7-TRIFLUOROMETHYL-2H-INDAZOLE This compound was prepared similarly to that of Example 1. (CDC13) 5 = 5.58 (s, 2 H), 6.98 (d, 1 H), 7.04 (t, 1 H), 7.23 (t, 2 H), 7.30-7.38 (m, 5 H), 7.42-7.47 (m, 6 H), 7.58 (d, 1 H), 7.66 (d, 1 H). LCMS: M+H: 429.4. EXAMPLE 76 2-BENZYL-3-BUTYL-7-TRIFLUOROMETHYL-2H-INDAZOLE This compound was prepared similarly to that of Example 1. (CDC13) 6 = 0.86 (t, 3 H), 1.30 (m, 2 H), 1.51 (m, 2 H), 2.92 (t, 2 H), 5.69 (s, 2 H), 7.07 (t, 1 H), 7.13 (d, 2 H), 7.29 (m, 3 H), 7.61 (d, 1 H), 7.77 (d, 1 H). LCMS: M+H: 333.5. EXAMPLE 77 2-BENZYL-3-1SOBUTYL-7-TRIFLUOROMETHYL-2H-INDAZOLE This compound was prepared similarly to that of Example 1. (CDC13) 5 = 0.90 (d, 6 H), 1.93 (m, 1 H), 2.31 (d, 2 H), 5.73 (s, 2 H), 7.10 (t, 1 H), 7.14 (d, 2 H), 7.30 (m, 3 H), 7.62 (d, 1 H), 7.77 (d, 1 H). LCMS: M+H: 333.2. EXAMPLE 78 2-BENZYL-3-CYCLOPENTYL-7-TRIFLUOROMETHYL-2H-INDAZOLE This compound was prepared similarly to that of Example 1. (CDC13) 5 = 1.68 (m, 2 H), 1.90 (m, 6 H), 3.47 (m, 1 H), 5.75 (s, 2 H), 7.06 (t, 1 H), 7.11 (d, 2 H), 7.30 (m, 3 H), 7.61 (d, 1 H), 7.87 (d, 1 H). LCMS: M+H: 345.2. EXAMPLE 79 2-BENZYL-3-CYCLOHEXANYL-7-TRIFLUOROMETHYL-2H-INDAZOLE This compound was prepared similarly to that of Example 1. (CDC13) 8 = 1.19-1.30(m, 4 H), 1.78-1.92 (m, 6 H), 2.98 (t, 1 H), 5.75 (s, 2 H), 7.01 (t, 1 H), 7.15 (d, 2 H), 7.32 (m, 3 H), 7.55 (d, 1 H), 7.96 (d, 1 H). LCMS: M+H: 359.3. EXAMPLE 80 [3-(2-BENZYL-7-TRIFLUOROMETHYL-2#-INDAZOL-3-YL)-PHENYL]- METHANOL This compound was prepared similarly to that of Example 7. (CDC13) 5 = 7.61 (m, 2 H), 7.39 (m, 2 H), 7.23 (m, 6 H), 7.02 (m, 3 H), 5.59 (s, 2 H), 4.64 (s, 2 H), 2.05 (s, br, 1 H). LCMS: M+H: 383.3. EXAMPLE 81 [3-(2-BENZYL-7-TRIFLUOROMETHYL-2//-INDAZOL-3-YL)-PHENYL]- PHENYLAMINE This compound was prepared similarly to that of Example 4. (CDC13) 6 = 5.62 (s, 2 H), 6.82 (d, 1 H), 6.90 (t, 1 H), 6.94 (s, 1 H), 6.95-7.05 (m, 5 H), 7.09 (d, 1 H), 7.12-7.20 (m, 5 H), 7.28 (t, 1 H), 7.56 (d, 1 H), 7.66 (d, 1 H). LCMS: M+H: 444.5; M-H: 442.7. EXAMPLE 82 3-(2-BENZYL-7-TRIFLUOROMETHYL-2//-INDAZOL-3-YL)-PHENOL This compound was prepared similarly to that of Example 2. (acetone) 5 = 8.73 (s, br, 1 H), 7.86 (d, 1 H), 7.71 (d, 1 H), 7.45-7.40 (m, 1 H), 7.33-7.24 (m, 3 H), 7.22 (t, 1 H), 7.17-7.12 (m, 2 H), 7.07-7.01 (m, 3 H), 5.78 (s, 2 H). LCMS: M+H: 369.2; M-H: 367.0. EXAMPLE 83 2-(2-CHLORO-BENZYL)-3-PHENYL-7-TRIFLUOROMETHYL-2H-INDAZOLE This compound was prepared similarly to that of Example 1. (CDC13) 8 = 7.81 (d, 1 H), 7.69 (d, 1 H), 7.51-7.45 (m, 3 H), 7.38-7.33 (m, 3 H), 7.22 (t, 1 H), 7.16 (q, 2 H), 6.69 (d, 1 H), 5.80 (s, 2 H). LCMS: M+H: 387.2. EXAMPLE 84 2-NAPHTH ALEN-1-YLMETHYL-3-PHEN YL-7-TRIFLUOROMETHYL-2H- INDAZOLE This compound was prepared similarly to that of Example 1. (CDC13) 6 = 8.02-7.97 (m, 1 H), 7.89-7.83 (m, 1 H), 7.81-7.73 (m, 2 H), 7.68 (d, 1 H), 7.53-7.48 (m, 2 H), 7.42 (m, 3 H), 7.36 (d, 2 H), 7.29 (t, 1 H), 7.95 (t, 1 H), 6.69 (d, 1 H). 6.20 (s, 2 H). LCMS: M+H: 403.4. EXAMPLE 85 2-BENZYL-3-NAPHTALEN-2-YL-7-TRIFLUOROMETHYL-2H-1NDAZOLE This compound was prepared similarly to that of Example 1. (CDC13) 5 = 7.98-7.91 (m, 2 H), 7.83-7.75 (m, 3 H), 7.68 (d, 1 H), 7.62-7.55 (m, 2 H), 7.46 (d, 1 H), 7.30-7.23 (m, 3 H), 7.16-7.11 (m, 3 H), 5.73 (s, 2 H). LCMS: M+H: 403.4. EXAMPLE 86 2-BENZYL-3-(4-METHOXY-3-METHYLPHENYL)-7-TRIFLUOROMETHYL-2H- INDAZOLE This compound was prepared similarly to that of Example 1. (CDC13) 5 = 7.65 (d, 1 H), 7.56 (d, 1 H), 7.19 (m, 3 H), 7.05 (m, 5 H), 6.84 (d, 1 H), 5.59 (s,2H),3.83(s,3H),2.16(s,3H). LCMS: M+H: 397.4. EXAMPLE 87 2-BENZYL-3-METHYLPHENYL-7-TRIFLUOROMETHYL-2H-INDAZOLE This compound was prepared similarly to that of Example \. (CDC13) 8 = 7.65 (d, 1 H), 7.57 (d, 1 H), 7.27(m, 6 H), 7.05 (m, 5 H), 5.60 (s, 2 H), 2.31 (s,3H). LCMS: M+H: 367.1. EXAMPLE 88 2-BENZYL-3-(2,3-DIMETHYLPHENYL)-7-TRIFLUOROMETHYL-2H-lNDAZOLE This compound was prepared similarly to that of Example 1. (CDC13) 8 = 7.56 (d, 1 H), 7.42 (d, 1 H), 7.24 (d, 1 H), 7.11 (m, 4 H), 6.98 (t, 1 H), 6.91 (m, 3 H), 5.42 (dd, 2 H), 2.24 (s, 3 H), 1.59 (s, 3 H). LCMS: M+H: 381.5. EXAMPLE 89 2-(2-BENZYL-7-TRlFLUOROMETHYL-2H-INDAZOL-3-YL)-BENZALDEHYDE This compound was prepared similarly to that of Example 1. (CDC13) 5 = 9.34 (s, 1 H), 8.04 (d, 1 H), 7.73-7.65 (m, 3 H), 7.46 (d, 1 H), 7.31 (dd. 1 H), 7.21-7.09 (m, 4 H), 6.94 (d, 2 H), 5.59 (s, 2 H). LCMS: M+H: 381.2. EXAMPLE 90 2-BENZYL-3-(2-ISOPROPYL-PHENYL)-7-TRlFLUOROMETHYL-2H-INDAZOLE This compound was prepared similarly to that of Example 1. (CDC13) 6 = 7.55 (d, 1 H), 7.41 (t, 2 H), 7.36 (d, 1 H), 7.15 (t, 1 H), 7.12-7.07 (m, 3 H), 7.00-6.91 (m, 4 H), 5.40 (dd, 2 H), 2.41-7.31 (m, 1 H), 0.96 (d, 3 H). LCMS: M+H: 395.0. EXAMPLE 91 2-BENZYL-3-(2-CYCLOHEXYL-PHENYL)-7-TRIFLUOROMETHYL-2H- INDAZOLE This compound was prepared similarly to that of Example 1. (CDC13) 6 = 7.69 (d, 1 H), 7.56-7.49 (m, 2 H), 7.46 (d, 1 H), 7.30-7.25 (m, 1 H), 7.25- 7.20 (m, 3 H), 7.10 (t, 1 H), 7.08-7.02 (m, 3 H), 5.54 (dd, 2 H), 2.08 (m, 1 H), 1 72 (d, 1 H), 1.67-1.53 (m, 3 H), 1.42-1.27 (m, 2 H), 1.20-1.07 (m, 2 H), 0.99-0.84 (m, 2 H). LCMS: M+H: 435.5. EXAMPLE 92 2-BENZYL-3-(2-BENZYLPHENYL)-7-TRIFLUOROMETHYL-2H-INDAZOLE This compound was prepared similarly to that of Example 1. (CDC13) 8 = 7.52 (d, 1 H), 7.36-7.28 (m, 2 H), 7.20 (d, 1 H), 7.16 (t, 1 H), 7.12-7.06 (m, 3 H), 7.03-7.95 (m, 3 H), 6.94-6.87 (m, 4 H), 6.53 (d, 2 H), 5.06 (dd, 2 H) 3.37 (dd, 2 H). LCMS: M+H: 443.9. EXAMPLE 93 2-BENZYL-3-[2-(l,l,2,2-TETRAFLUOROETHOXY)-PHENYL]-7- TRIFLUOROMETHYL-2H-INDAZOLE This compound was prepared similarly to that of Example 1. (CDC13) 8 = 7.65 (d, 1 H), 7.56 (t, 2 H), 7.51 (d, 1 H), 7.34 (t, 1 H), 7.22-7.16 (m, 4 II), 7.11 (t, 1 H), 7.06-6.99 (m, 2 H), 5.58 (dd, 2 H), 5.32 (tt, 1 H). LCMS: M+H: 469.7. EXAMPLE 94 2-BENZYL-3-(2-CHLORO-5-FLUORO-PHENYL)-7-TRIFLUOROMETHYL-2H- INDAZOLE This compound was prepared similarly to that of Example 1. (CDC13) S = 7.67 (d, 1 H), 7.54 (d, 1 H), 7.39-7.35 (m, 1 H), 7.30-7.23 (m, 3 H), 7.16- 7.08 (m, 3 H), 6.90 (td, 1 H), 6.35 (dd, 1 H). 5.67 (s, 2 H). LCMS: M+H: 419.3; M-H: 417.4. EXAMPLE 95 2-BENZYL-3-(9H-FLOUREN-2-YL)-7-TRIFLUOROMETHYL-2H-INDAZOLE This compound was prepared similarly to that of Example 1. (CDC13) 8 = 7.90 (d, 1 H), 7.86 (d, 1 H), 7.78 (d, 1 H), 7.67 (d, 1 H), 7.60 (d, 1 H), 7.50 (s, 1 H), 7.44 (t, 1 H), 7.41-7.35 (m, 2 H), 7.29-7.22 (m, 3 H), 7.16-7.10 (m, 3 H), 5.73 (s, 2 H), 3.95 (s, 2H): LCMS: M+H: 441.5; M-H: 439.4. EXAMPLE 96 2-BENZYL-3-(4-BENZYLPHENYL)-7-TRIFLUOROMETHYL-2H-INDAZOLE This compound was prepared similarly to that of Example 1. (CDCI3) 8 = 7.61 (d, 1 H), 7.52 (d, 1 H), 7.25-7.06 (m, 12 H), 6.99-6.92 (m, 3 H), 5.56 (s, 2 H), 3.94 (s, 2 H). LCMS: M+H: 443.6. EXAMPLE 97 3-(2-BENZYL-7-TRIFLUOROMETHYL-2H-INDAZOL-3-YL)-BENZALDEHYDE This compound was prepared similarly to that of Example 1. (CDC13) 8 = 9.99 (s, 1 H), 7.99 (dt, 1 H), 7.83 (t, 1 H), 7.67 (q, 3 H), 7.60 (dt, 1 H), 7.26- 7.23 (m, 3 H), 7.15 (t, 1 H), 7.09-7.04 (m, 2 H), 5.68 (s, 2 H). LCMS: M+H: 381.5. EXAMPLE 98 2-BENZYL-3-(3-[l,3-DIOXOLAN-2-YL-PHENYL)-7-TRIFLUOROMETHYL INDAZOLE This compound was prepared similarly to that of Example 1. (CDC13) 5 = 7.73 (d, 1 H), 7.66 (d, 1 H), 7.60 (d, 1H), 7.51 (t, 2 H), 7.37 (d, 1 H), 7.29- 7.22 (m, 3 H), 7.15-7.10 (m, 3 H), 5.82 (s, 2 H), 5.68 (s, 2 H), 4.08-4.01 (m, 4 H). LCMS: M+H: 335.6; M-H: 333.1. EXAMPLE 99 2-BENZYL-3-(4'-METHOXY-BIPHENYL-4-YL)-7-TRIFLUOROMETHYL INDAZOLE This compound was prepared similarly to that of Example 1. (CDC13) 8 = 7.79 (d, 1 H), 7.67 (t, 3 H), 7.60 (d, 2 H), 7.42 (d, 1 H), 7.30-7.23 (m, 3 H), 7.16-7.11 (m, 3 H), 7.03 (d, 2 H), 5.73 (s, 2-H), 3.88 (s, 3 H). LCMS: M+H: 495.5. EXAMPLE 100 4'-(2-BENZYL-7-TRIFLUOROMETHYL-2H-INDAZOL-3-YL)-BIPHENYL-4-OL This compound was prepared similarly to that of Example 1. (CDC13) 5 = 7.79 (d, 1 H), 7.67 (d, 3 H), 7.55 (d, 2 H), 7.42 (d, 2 H), 7.30-7.23 (m, 3 H), 7.17-7.11 (m, 3 H), 6.95 (d, 2 H), 5.74 (s, 2 H). LCMS: M+H: 445.4; M-H: 443.6. EXAMPLE 101 2-ALLYL-3-(2,4-DIMETHOXYPHENYL)-7-(TRIFLUOROMETHYL)-2//- INDAZOLE Sodium hydride (60% in oil, 0.025 g, 1.04 mmol) was added in one portion to a solution of 3-(2,4-dimethoxyphenyl)-7-(trifluoromethyl)-l//-indazole (0.150 g, 0.49 mmol) in DMF. After the gas evolution ceased, allyl bromide (0.07 mL, 0.7 mmol) was added and the reaction mixture was stirred at ambient temperature to 50°C overnight. The cool reaction mixture was partitioned with EtOAc and 1 N HCI. The organic phase was washed with brine and dried (Na2SC>4). The resulting residue was purified by flash chromatography or by HPLC chromatography through silica gel columns, 150X12 mm (Biotage, Charlottesville, VA), at 10 mL/min with methyl-t-butyl ether/hexane (gradient elution, 1:9 to 1:1) to give the title compound (0.062 g) as a white solid. 'H NMR (DMSO-d6): 5 3.75 (s, 3H), 3.86 (s, 3H), 4.87-4.99 (m, 3H), 5.13 (d, IH), 5.90-5.99 (m, IH), 6.72 (d, IH), 6.79 (s, IH), 7.12 (t, IH), 7.31 (d, IH), 7.61-7.68 (m, 2H), MS (ESI) /H/Z 363 ([M+Hf). EXAMPLE 102 3-(2,4-DIMETHOXYPHENYL)-2-PROPYL-7-(TRlFLUOROMETHYL)-2//- INDAZOLE Prepared according to Example 101 from 3-(2,4-dimethoxyphenyl)-7-(trifluoromethyl)-l//-indazole and 1-iodopropane. 'H NMR (DMSO-de): 8 0.74 (t, 3H), 1.76-1.85 (m, 2H), 3.87 (s, 3H), 4.10-4.26 (m, 2H), 6.74 (d, IH), 6.80 (s, IH), 7.32 (d, IH), 7.59.7.66 (m, 2H), MS (ESI) ml* 365 ([M+H]+. EXAMPLE 103 7-CHLORO-2-ISOPROPYL-3-(4-METHOXY-2-METHYLPHENYL)-2//-INDAZOLE Prepared according to Example 101 from 7-chloro-3-(4-methoxy-2-methyIphenyl)-l//-indazole (0.150 g, 0.52 mmol), sodium hydride (60% in oil, 0.025 g, 1.04 mmol) and 2-iodopropane (0.07 mL, 0.7 mmol) to give the title compound (0.059 g) as a white solid. 'H NMR (DMSO-d6): 8 1.46 (s, 6H), 1.99 (s, 3H), 3.83 (s, 3H), 4.42-4.47 (m, IH), 6.94-6.98 (m, 2H), 7.04 (s, IH), 7.20 (dd, IH, J=0.61 and 8.25 Hz), 7.26 (d, IH), 7.35 (dd, IH, J=0.76 and 7.17 Hz), MS (ESI) m/z 315 ([M+Hf). EXAMPLE 104 7-CHLORO-3-(4-METHOXY-2-METHYLPHENYL)-2-PROPYL-2//-INDAZOLE Prepared according to Example 101 from 7-chloro-3-(4-methoxy-2-methylphenyl)-l//-indazole (0.150 g, 0.52 mmol), sodium hydride (60% in oil, 0.025 g, 1.04 mmol) and 1-propyl iodide (0.07 mL, 0.7 mmol) to give the title compound (0.056 g) as a white solid. 'H NMR (DMSO-d6): 8 0.71 (t, 3H), 1.79 (m, 2H), 2.00 (s, 3H), 3.83 (s, 3H), 4.04-4.09 (m, IH), 4.20-4.25 (m, IH), 6.94-6.98 (m, 2H), 7.00 (s, IH), 7.22 (d, IH), 7.27 (d. IH). 7.35 (d, 1 H), MS (ESI) m/z 3 1 5 EXAMPLE 105 2-CYCLOPENTYL-3-(2,4-DIMETHOXYPHENYL)-7-(TRIFLUOROMETHYL)-277- INDAZOLE Prepared according to Example 101 from 3-(2,4-methoxyphenyl)-7-trifluoromethyl-//- indazole (2.00 g, 6.20 mmol), sodium hydride (60% in oil, 0.297 g, 7.44 mmol) and cyclopentyl bromide (1.00 mL, 9.30 mmol) to give the title compound (0.892 g) as a white solid. 'H NMR (DMSO-de): 5 1.61 (m, 2H), 1.97 (m, 4H) 2.1 1 (m, 1H), 2.18 (m, 1H), 3.76 (s, 3H), 3.87 (s, 3H), 4.69 (m, 1H), 6.74 (dd, 1H, J= 8.4 and 2.3 Hz), 6.79 (d, 1H, J= 2.3 Hz), 7.09 (t, 1H, 7= 7.6 Hz), 7.31 (d, 1H, J= 8.4 Hz), 7.58 (d, 1H, 7=8.4 Hz), 7.63 (d, 1H, .7=7.0 Hz, MS (El) m/z 390; Anal, calcd for €21^^202: C: 64.61 H:5.42 N:7.18 Found: C:64.29 H:5.48 N:6.86. EXAMPLE 106 3-(2,4-DIMETHOXYPHENYL)-2-ISOBUTYL-7-(TRIFLUOROMETHYL)-27/- INDAZOLE Prepared according to Example 101 from 3-(2,4-methoxyphenyl)-7-trifluoromethyl-7/-indazole (2.00 g, 6.20 mmol), sodium hydride (60% in oil, 0.297 g, 7.44 mmol) and 1-iodo-2-methylpropane (1.07 mL, 9.30 mmol) to give the title compound (0.768 g) as a white solid. mp 1 1 1-1 12 °C; 'H NMR (DMSO-d6): 5 0.66 (d, 3H, J= 6.7 Hz.), 0.76 (d, 3H, J= 6.7 Hz) 2.1 9 (m, 1H), 3.75 (s,3H), 3.87 (s,3H), 3.97 (m,lH), 4.16 (m, 1H), 6.74 (dd, 1H,.7= 8.4 and 2.3 Hz), 6.79 (d, 1H, J= 2. 1- Hz), 7. 1 1 (t, 1 H, J= 7.8 Hz), 7.3 1 (d, 1 H, J= 8.4 Hz), 7.60 (d, 1H, .7=8.3 Hz), 7.65 (d, 1H, .7=7.0 Hz), MS (ESI) m/z 379 ([M+H]+);Anal. calcd for C2oH2iF3N2O2: C:63.48 H:5.59 N:7.40 Found: C:63.37 H:5.66 N:7.36. EXAMPLE 107 2-(CYCLOHEXYLMETHYL)-3-(2,4-DIMETHOXYPHENYL)-7- (TRIFLUOROMETHYL)-2//-INDAZOLE Prepared according to Example 101 from 3-(2,4-methoxyphenyl)-7-trifluoromethyl-7/-indazole (1.82 g, 5.64 mmol), sodium hydride (60% in oil, 0.451 g, 1 1.28 mmol) and (bromomethyl)cyclohexane (4.00 g, 22.5 mmol) to give the title compound (0.967 g) as a white solid. mp 156-157 °C; 'H NMR (DMSO-d6): 6 0.73 (m, 1H), 0.82 (m, 1H) 1.03 (m, 2H) 1.23 (m, 1H) 1.30 (m, 1H), 1.50 (m,4H) 1.88 (m, 1H), 3.75 (s, 3H), 3.87 (s, 3H), 3.99 (m,lH), 4.18 (m, 1H), 6.74 (dd, 1H, J= 8.4 and 2.3 Hz), 6.79 (d, 1H, J= 2.1 Hz), 7.10 (t, 1H, J= 7.8 Hz), 7.31 (d, 1H, J= 8.4 Hz), 7.59 (d, 1H, 7=8.3 Hz), 7.64 (d, 1H, J=7.0 Hz, MS (ESI) m/z 419 ([M+H]+); Anal, calcd for C23H25F3N2O2: C:66.02 H:6.02 N:6.69 Found: C:66.03 H:6.05 N:6.64. EXAMPLE 108 3-(2,4-DIMETHOXYPHENYL)-2-(2-ETHYLBUTYL)-7-(TRIFLUOROMETHYL)- 2//-INDAZOLE Prepared according to Example 101 from 3-(2,4-methoxyphenyl)-7-trifluoromethyl-//-indazole (2.00 g, 6.20 mmol), sodium hydride (60% in oil, 0.496 g, 12.4 mmol) and 1-bromo-2-ethylbutane (3.07 g, 18.6 mmol) to give the title compound (0.540 g) as a white solid. 'H NMR (DMSO-d6): 5 0.60 (t, 3H, J= 7.3 Hz), 0.67 (t, 3h, J = 7.3 Hz), 1.12 (m, 4H). 1.79 (m, 1H), 3.76 (s,3H), 3.86 (s,3H), 4.12 (dd, 1H,J= 13.6 and 7.3 Hz), 4.24 (dd, 1H, J= 13.6 and 7.0 Hz), 6.74 (dd, 1H, J= 8.4 and 2.1 Hz), 6.79 (d, 1H, J= 2.0 Hz), 7.11 (t, 1H, J= 7.8 Hz), 7.32 (d, 1H, J= 8.2 Hz), 7.60 (d, 1H, J=8.4 Hz), 7.65 (d, 1 H, 7=7.0 Hz). MS (ESI) m/z 407 ([M+H]+); Anal, calcd for C22H25F3N2O2: C:65.01 H:6.20 N:6.89 Found: C:64.90 H:6.22 N:6.73. EXAMPLE 109 2-CYCLOBUTYL-3-(2,4-DIMETHOXYPHENYL)-7-(TRIFLUOROMETHYL)-2//- INDAZOLE Prepared according to Example 101 from 3-(2,4-methoxyphenyl)-7-trifluoromethyl-//- indazole (2.38 g, 7.40 mmol), sodium hydride (60% in oil, 0.592 g, 14.8 mmol) and bromocyclobutane (3.00 g, 22.2 mmol) to give the title compound (0.896 g) as a white solid. mp 51-52 °C; 'H NMR (DMSO-d6): 6 1.80 (m, 2H), 2.25 (m, 1H), 2.39 (m. IH). 2.74 (m, 2H), 3.75 (s, 3H), 3.87 (s, 3H), 4.85 (m, 1H), 6.74 (dd, 1H, J= 8.4 and 2.1 Hz). 6.80 (d, IH, /= 2.1 Hz), 7.11 (t, IH, J= 7.6 Hz), 7.28 (d, IH, J= 8.4 Hz), 7.61 (d, IH, J=8.3 Hz), 7.66 (d, IH, .7=7.0 Hz), MS (ESI) m/z 377 ([M+H]+); Anal, calcd for C2oH,9F3N2O2: C:63.82 H:5.09 N:7.44 Found: C:64.11 H:5.14 N:7.15. EXAMPLE 110 3-(2,4-DIMETHOXYPHENYL)-2-(l-ETHYLPROPYL)-7-(TRIFLUOROMETHYL)- 2//-INDAZOLE Prepared according to Example 101 from 3-(2,4-methoxyphenyl)-7-trifluoromethyl-//-indazole (2.50 g, 7.75 mmol), sodium hydride (60% in oil, 0.62 g, 15.5 mmol) and 3-bromopentane (3.51 g, 23 mmol) to give the title compound (0.674 g) as a white solid, mp 138-139°C; JH NMR (DMSO-d6): 8 0.51 (t, 3H, J= 7.3 Hz), 0.76 (t, 3h, J= 7.3 Hz), 1.90 (m, 2H), 2.07 (m, 2H), 3.73 (s, 3H), 3.87 (s, 3H), 4.00 (m, IH), 6.74 (dd, IH, J= 8.4 and 2.3 Hz), 6.79 (d, IH, J= 2.1 Hz), 7.10 (t, IH, J= 7.8 Hz), 7.23 (d, IH, J= 8.2 Hz), 7.58 (d, IH, .7=8.4 Hz), 7.63 (d, IH, .7=7.2 Hz, MS (ESI) m/z 393 ([M+H]+); Anal, calcd for C2|H23F3N2O2: C:64.28 H:5.91 N:7.14 Found: C:64.04 H:5.77 N:6.92. EXAMPLE 111 2,3-DIPHENYL-7-(TRIFLUOROMETHYL)-2//-INDAZOLE 3-Phenyl-7-trifluoromethylindazole (0.2 g, 0.76 mmol), phenyl boronic acid (186 mg, 1.53 mmol), copper II acetate (208 mg, 1.14 mmol), and pyridine (93 uL, 1.14 mmol) in 6 mL methylene chloride were stirred at room temperature for 72 hours. The reaction mixture was filtered through Celite®, poured into NHjCl (sat. soln.) and extracted with EtOAc. The combined organic layers were dried with Na2SC>4, concentrated and the resulting residue was purified by HPLC (10-100 % CH3CN-H2O) to provide the desired compound as a white solid (40 mg). MS (ESI) m/z 339 ([M+H]+); HRMS: calcd for CjoHnFsNa, 338.1031; found (ESI), 339.1062. EXAMPLE 112 3-PHENYL-2-(2-PHENYLETHYL)-7-(TRIFLUOROMETHYL)-2//-INDAZOLE This compound was prepared similarly to that of Example 1. MS (ESI) mlz 367 ([M+H]+); Anal. Calcd for C22Hi7F3N2: C, 72.12; H, 4.68; N, 7.65. Found: C, 71.96; H, 4.42; N, 7.58. EXAMPLE 113 2-(4-FLUOROBENZYL)-3-PHENYL-7-(TRIFLUOROMETHYL)-2//-INDAZOLE This compound was prepared similarly to that of Example 1. MS (ESI) m/z 371 ([M+H]+); HRMS: calcd for C2iHi4F4N2 370.3492 found (ESI), 370.3487. EXAMPLE 114 2-(2-CHLORO-6-FLUOROBENZYL)-3-PHENYL-7-(TRIFLUOROMETHYL)-2//- INDAZOLE This compound was prepared similarly to that of Example 1. MS (ESI) m/z 405/407 ([M+H]+), MS (ESI) m/z 403/405 ([M-H]'); HRMS: calcd for C2|H,3C1F4N2, 404.7942; found (ESI), 404.7938. EXAMPLE 115 2-(4-CHLORO-2-FLUOROBENZYL)-3-PHENYL-7-(TRIFLUOROMETHYL)-2//- INDAZOLE i This compound was prepared similarly to that of Example I. MS (ESI) m/z 405/407 ([M+H]*); HRMS: calcd for C2iH,3ClF4N2, 404.0703; found (ESI), 463.0855. EXAMPLE 116 2-PHENYL-3-PIPERIDIN-1-YL-7-TRIFLUOROMETHYL-2//-INDAZOLE Preparation of 2-azido-3-trifiuoromethyl-benzoic acid (compound of formula (IX)). A mixture of 1.67 g (10 mmol) of 2-amino-3-(trifluoromethyl)-benzoic acid (compound of formula (VIII)) with 40 ml of 6WHC1 was cooled down to 5°C and a solution of 760 mg of NaNO2 (11 mmol) in 17 ml of water were added dropwise in such a way that the temperature of the reaction mixture did not exceed 7°C. The resulting solution was stirred at this temperature for 30 minutes and then added slowly to a solution of 20.5 g of NaOAc and 715 mg (11 mmol) of NaNa in 40 ml of water. The reaction mixture was stirred overnight at room temperature. The product was extracted with CF^Cb three times. The solvent was removed in vacua and the residue dried in a desiccator over P2O5 affording the required compound in quantitative yield. (DMSO-<&) 5 = 13.84 (s, br, 1H), 8.06 (dd, 1 H), 7.87 (dd, 1 H), 7.42 (t, 1 H). LCMS: M-H: 229.8. Preparation of 2-azido-Ar-phenyl-3-trifluoromethyl-benzamide (compound of formula (X)). 2-Azido-3-trifluoromethyl-benzoic acid (460 mg, 2 mmol, compound IX) was dissolved in 2 ml of SOCb and the reaction mixture was heated at 80°C for 1 hour. The remaining SOCb was evaporated in vacua and the residue was coevaporated with dry benzene. Dry CHjCb (2 ml) was added followed by a dropwise addition of 200 ul of aniline (2 mmol). The reaction mixture was stirred at room temperature for 1 hour. Saturated aq. NaHCOs was added and the product was extracted with CFbCb. The resulting amide was purified by recrystallization from methanol. The yield was 521 mg (86%). (CDC13) 5 = 8.01 (s, br, 1 H), 7.85 (d, 1 H), 7.72 (d, 1 H), 7.57-7.55 (m, 2 H), 7.34-7.30 (m, 3 H), 7.13 (t, 1 H). LCMS: M+H: 307.4. Preparation of 3-chloro-2-phenyl-7-trifluoromethyl-2//-indazole (compound of formula (XI)). 2-Azido-Af-phenyl-3-trifluoromethyl-benzamide (310 mg, 1 mmol, compound of formula (X)) was heated in 2 ml of SOCb in a sealed vial at 100°C for 4 hours. After evaporation of SOCb in vacua the residue was purified by column chromatography on silica (n-heptane/ethyl acetate, 50:50, as eluent). Yield: 212 mg (72%). (CDCI3) 5 = 7.76 (d, 1 H), 7.66-7.60 (m, 3 H), 7.51-7.42 (m, 3 H), 7.14 (t, 1 H). LCMS: M+H: 297.2; 299.2. Preparation of 2-phenyl-3-piperidin-l-yl-7-trifluoromethyl-2//-indazole (compound of Formula (I)). 3-Chloro-2-phenyl-7-trifluoromethyl-2//-indazole (21 mg, 0.07 mmol, compound of formula (XI)) was dissolved in 0.5 ml of DMSO and 100 u! of piperidine (1 mmol) were added. The reaction mixture was stirred overnight at 110°C. After cooling to room temperature, 10 volumes of water were added. The supernatant was removed and the residue was purified by column chromatography on silica (n-heptane/ethyl acetate, 50:50, as eluent) to provide the title compound as a white solid (9 mg, 37%). (CDCb) 5 = 7.92 (d, 1 H), 7.79-7.77 (m, 2 H), 7.48-7.46 (m, 1 H), 7.43-7.40 (m, 2 H), 7.34-7.30 (m, 1 H), 6.88 (t, 1 H), 3.15-3.13 (m, 4 H), 1.55-1.49 (m, 6 H). LCMS: M+H: 346.0. EXAMPLE 117 2-CYCLOPENTYL-7-FLUORO-3-(4-METHOXYPHENYL)-2//-INDAZOLE Prepared according to Example 116 from 7-fluoro-3-(4-methoxyphenyl)-l//-indazole (0.75 g, 3.1 mmol), sodium hydride (60% in oil, 0.124 g, 3.1 mmol) and cyclopentylbromide (0.36 mL, 3.3 mmol) to give the title compound (0.055 g) as a white solid. 'H NMR- (DMSO-d6, 400 MHz) d: 1.70 (m, 2H), 1.89 (m, 2H), 2.14 (m, 4H), 3.82 (s, 3H), 5.27 (m, 1H), 7.08 (d, 2H), 7.15 (m, 1H), 7.23 (m, 1H), 7.815 (d, 1H) 7.855 (d, 2H); MS(ESr,«j/z):3ll [M+Hf. EXAMPLE 118 3-(4-METHOXYPHENYL)-7-METHYL-l//-INDAZOLE A solution of (2-fluoro-3-methylphenyl)-(4-methoxy-phenyI)-methanone (3.§ g, 14.7 mmol), hydrazine hydrate (4.3 mL, 140 mmol) and DMAP (1.8 g, 14.7 mmol) in pyridine was heated at 100 C for 24-48 hrs. The cooled reaction mixture was partitioned with EtOAc and 1 N HCI. The organic phase was washed with brine and dried (NajSO^j). The resulting residue was purified by flash chromatography to give the product (1.7 g) as a yellow solid. 'H NMR (DMSO-d6): 6 2.52 (s, 3H), 3.81 (s, 3H), 7.06 (m, 3H), 7.13 (d, IH), 7.81 (d, IH), 7.89 (d, 2H), 13.132 (s, 1 H); MS (APCI) m/z 239 ([M+H]+). EXAMPLE 119 3-(4-METHOXYPHENYL)-7-TRIFLUOROMETHYL-l//-INDAZOLE Prepared as in Example 104 from (2-fluoro-3-trifluorornethylphenyl)-(4-methoxy-phenyl)-methanone (3.6 g, 14.7 mmol), hydrazine hydrate (4.3 mL, 140 mmol) and DMAP (1.8 g, 14.7 mmol) to give the product (1.7 g) as a yellow solid. 'H NMR (DMSO-d6, 300 MHz): 6 2.52 (s, 3H), 3.82 (s, 3H), 7.07 (d, 2H), 7.18 (t, IH), 7.48 (d, IH), 7.91 (d, 2H), 8.0 (d, IH), 13.132 (s, 1 H); MS (APCI) m/z 239 ([M+Hf). EXAMPLE 120 7-CHLORO-3-(4-METHOXYPHENYL)-l//-INDAZOLE Prepared as in Example 104 from (3-chloro-2-fluoro-phenyl)-(4-methoxy-phenyI)-methanone (0.84 g, 3.2 mmol), hydrazine hydrate (1.0 mL, 32 mmol) and DMAP (0.39 g, 3.2 mmol) to give the product (0.75 g) as a white solid. 'H NMR (DMSO-d6): 5 3.81 (s, 3H), 7.06 (d, 2H), 7.13 (d, IH), 7.81 (d, IH), 7.89 (d. 2H), 13.52 (s, 1 H); MS (APCI) m/z 259 ([M+H]+). EXAMPLE 121 7-FLUORO-3-(4-METHOX YPHEN YL)-1 //-INDAZOLE Prepared as in Example 104 from (2,3-difluorophenyl)-(4-methoxy-phenyl)-methanone (1.1 g, 4.4 mmol), hydrazine hydrate (1.37 mL, 44 mmol) and DMAP (0.54 g, 4.4 mmol) to give the product (0.85 g) as a white solid. 'H NMR (DMSO-d6): 6 3.82 (s, 3H), 7.06 (d, 3H), 7.1-7.25 (m, 2H), 7.83 (d, IH), 7.92 (d, 2H), 13.53 (s, 1 H); MS (APCI) m/z 243 ([M+H]+). EXAMPLE 122 7-FLUORO-3-(4-METHOXY-3-METHYLPHENYL)-l//-INDAZOLE Prepared as in Example 104 from (2,3-difiuorophenyI)-(4-methoxy-3-methyl-phenyl)- methanone (0.9 g, 3.45 mmol), hydrazine hydrate (1.06 mL, 34 mmol) and DMAP (0.42 g, 3.45 mmol) to give the product (0.80 g) as a yellow solid. 'H NMR (DMSO-d6): 5 2.247 (s, 3H), 3.845 (s, 3H), 7.07 (d, 1H), 7.13 (m, 1H), 7.22 (m, 1 H), 7.75 (m, 2H), 7.83 (d, 1H), 13.62 (broad s, 1H); MS (ESI) m/z 257 ([M+Hf). EXAMPLE 123 3-(2,4-DIMETHOXYPHENYL)-7-(TRIFLUOROMETHYL)-l//-INDAZOLE Prepared as in Example 104 from (2,4-dimethoxyphenyl)[2-fluoro-3- (trifluoromethyl)phenyl]methanone (1.50 g, 5.17 mmol), hydrazine hydrate (1.61 mL, 51.7 mmol) and DMAP (0.632 g, 5.17 mmol) to give the product (0.619 g) as a yellow solid. 'H NMR (DMSO-de): 8 3.78 (s, 3H), 3.83 (s, 3H), 6.66 (dd, 1H, J = 2.38 and 8.33Hz), 6.75 (s, 1H), 7.24 (t, 1H), 7.43 (d, 1H), 7.72 (d, 1H), 7.89 (d, 1H); MS (APGI) m/z 323 ([M+Hf); Anal, calcd for QtffoFaN^: C:59.63 H:4.07 N:8.69 Found: C:59.91 H:4.08 N:7.95. EXAMPLE 124 3-(4-METHOXY-2-METHYLPHENYL)-7-(TRIFLUOROMETHYL)-l//-INDAZOLE Prepared as in Example 104 from [2-fluoro-3-(trifluoromethyl)phenyl](4-methoxy-2-methylphenyl)methanone (1.34 g, 4.90 mmol), hydrazine hydrate (1.61 mL, 51.7 mmol) and DMAP (0.632 g, 5.17 mmol) to give the product (0.620 g) as a yellow solid. 'H NMR (DMSO-d6): 5 2.31 (s, 3H), 3.81 (s, 3H), 6.92 (d, 1H), 6.98 (s, 1H), 7.29 (t, 1H), 7.41 (d, 1H), 7.70 (d, 1H), 7.90 (d, 1H); MS (APCI) m/z 307 ([M+H]+); Anal, calcd for C,6H,3F3N2O: C:62.74 H:4.28 N:9.15 Found: C:62.35 H:4.01 N:9.34. EXAMPLE 125 3-(2,4-DlMETHOXYPHENYL)-7-FLUORO-l//-INDAZOLE Prepared as in Example 104 from (2,4-dimethoxyphenyl)[2,3-dif!uorophenyl]methanone (1.60 g, 5.8 mmol), hydrazine hydrate (1.79 mL, 5702 mmol) and DMAP (0.632 g. 57.5 mmol) to give the product (1.66 g) as a yellow solid. 'H NMR (DMSO-d6): 8 3.77 (s, 3H), 3.83 (s, 3H), 6.65 (dd, 1H, J=2.13 and 8.40Hz), 6.72 (s, 1H), 7.02-7.05 (m, 1H), 7.13-7.17 (m, 1H),7.41 (t, 1H), 13.54 (broad s, 1H) MS(ESI)m/z273([M+Hf). EXAMPLE 126 7-FLUORO-3-(4-METHOXY-2-METHYLPHENYL)-l//-lNDAZOLE Prepared as in Example 104 from [2-fluoro-3-(trifluoromethyl)phenyl](4-methoxy-2-methylphenyl)methanone (1.34 g, 4.90 mmol), hydrazine hydrate (1.61 mL, 51.7 mmol) and DMAP (0.632 g, 5.17 mmol) to give the product (0.620 g) as a yellow solid. 'H NMR (DMSO-d6): 8 2.30 (s, 3H), 3.80 (s, 3H), 6.89 (dd, 1H, J=2.44 and 8.39Hz), 6.95 (s, 1H), 7.06-7.11 (m, 1H), 7.19-7.22 (m, 1H), 7.38-7.40 (m, 2H), 13.64 (broad s. 1H), MS (ESI) m/z 257 ([M+H]+). EXAMPLE 127 7-CHLORO-3-(4-METHQXY-2-METHYLPHENYL)-lfl-INDAZOLE Prepared as in Example 104 from [2-fluoro-3-chlorophenyl](4-methoxy-2-methylphenyl)methanone (1.26 g, 4.52 mmol), hydrazine hydrate (1.61 mL, 51.7 mmol) and DMAP (0.632 g, 5.17 mmol) to give the product (0.613 g) as a yellow solid. 'H NMR (DMSO-d6): 8 2.31 (s, 3H), 3.81 (s, 3H), 6.89 (dd, IH, J=2.57 and 8.53Hz), 6.96 (s, 1H), 7.13 (t, 1H), 7.39 (d, 1H), 7.47 (d, IH), 7.54 (d, 1H), 13.62 (broad s, 1H). MS (ESI) m/z 273 ([M+H]+). EXAMPLE 128 7-CHLORO-3-(2,4-DIMETHOXYPHENYL)-l//-INDAZOLE Prepared as in Example 104 from (2,4-dimethoxyphenyl)[2-fluoro-3-chlorophenyl]methanone (1.20 g, 4.1 mmol), hydrazine hydrate (1.61 mL, 51.7 mmol) and DMAP (0.632 g, 5.17 mmol) to give the product (0.618 g) as a yellow solid. 'H NMR (DMSO-d6): 8 3.77 (s, 3H), 3.83 (s, 3H), 6.65 (dd, IH, J=2.18 and 8.33Hz). 6.73 (s, IH), 7.07 (t, IH), 7.41 (d, IH), 7.55 (d, IH), 13.52 (broad s, IH), MS (ESI) m/z 289 ([M+Hf). EXAMPLE 129 4-[2-(2,4-DIMETHYL-BENZYL)-7-TRIFLUOROMETHYL-2//-INDAZOL-3-YL]-3- METHYLPHENOL This compound was prepared similarly to that of Example 1. 'H NMR (CDCI3): 5 7.66 (d, 1 H), 7.52 (d, 1 H), 7.10 (t, 1 H), 6.96-6.68 (m, 6 H), 6.53 (d, 1 H), 5.56 (d, 1 H), 5.42 (d, 1 H), 2.20 (s, 3 H), 2.06 (s, 3 H), 1.76 (s, 3 H). LCMS:M+H:411.5. EXAMPLE 130 4-(2-BENZYL-7-TRIFLUOROMETHYL-2tf-INDAZOL-3-YL)-PHENOL This compound was prepared similarly to that of Example 2. 'H NMR (acetone-de): 8 5.71 (s, 2 H), 7.01-7.06 (m, 2 H), 7.12 (d, 2 H), 7.17 (t, 1 H), 7.21-7.31 (m, 3 H), 7.35-7,40 (m, 2 H), 7.67 (d, 1 H), 7.80 (d, 1 H), 8.84 (s, br, 1 H). LCMS: M+H: 369.2; M-H: 367.0. EXAMPLE 131 4-[2-BENZYL-7-(TRIFLUOROMETHYL)-2#-INDAZOL-3-YL]-3- METHOXYPHENOL Prepared according to Example 116 from 3-(2,4-dimethoxyphenyl)-7-(trifluoromethyl)-l//-indazole and benzyl bromide. 'H NMR (CDCb): 8 3.558 (s, 3H), 5.55 (q, 2H), 6.52 (m, 2H), 7.09 (m, 2H), 7.18 (m, 4H), 7.263 (d, 1 H), 7.56 (t, 2H) MS (ESI) m/z 399 ([M+H]+). EXAMPLE 132 4-(2-CYCLOPENTYL-7-FLUORO-2#-INDAZOL-3-YL)PHENOL A solution of 2-cyclopentyl-7-fluoro-3-(4-methoxyphenyl)-2//-indazole (0.055 g, 0.177 mmol) in CFhCb containing excess equivalents of cyclohexene (0.3 mL) at -78°C was treated with boron tribromide (0. 70 mL, 0.74 mmol, 4 eq.) and slowly allowed to warm to ambient temperature. The reaction mixture was quenched by dropwise addition of CHsOH to the cooled reaction mixture. The solvent was removed in vacua and the residue partitioned with EtOAc and 1 N HC1. The organic phase was washed with brine and dried (Na2SC>4). Removal of the solvent in vacua afforded the crude product. Pure product was obtained by crystallization or flash chromatography through water deactivated silica gel to give the product (0.03 g) as an amber solid. ]H NMR (DMSO-d6): 8 1.63 (m, 2H), 1.94 (m, 2H), 2.118 (m, 4H), 4.96 (m, 1H), 6.98 (m, 4H), 7.25 (d 1H), 7.36 (d, 2H), 9.925 (s, 1H), MS (ESI) m/z 297 ([M+H]*). EXAMPLE 133 4-(7-CHLORO-2-ISOPROPYL-2//-INDAZOL-3-YL)-3-METHYLPHENOL Prepared according to Example 128 from 7-chloro-2-isopropyl-3-(4-methoxy-2-methylphenyl)-2//-indazole (0.05 g, 0.16 mmol), boron tribromide (0.19 mL, 2.0 mmol) and 1.0 mL of cyclohexene to give the product (0.016 g) as a white solid. 'H NMR (DMSO-d6): 8 1.45 (d, 6H), 1.93 (s, 3H), 4.43-4.48 (m, 1H), 6.77 (dd, 1H. J=2.29 and 8.24 Hz), 6.83 (s, 1H), 6.96 (t, 1H), 7.12 (d, 1H), 7.20 (d, 1H), 7.34 (d, IH). 9.78 (broad s, 1 H), MS (ESI) m/z 301 ([M+H]4). EXAMPLE 134 4-(7-CHLORO-2-PROPYL-2//-INDAZOL-3-YL)-3-METHYLPHENOL Prepared according to Example 128 from 7-chloro-3-(4-methoxy-2-methylphenyl)-2-propyl-2//-indazole (0.04 g, 0.13 mmol), boron tribromide (0.20 mL, 2.10 mmol) and 1.0 mL of cyclohexene to give the product (0.023 g) as a white solid. 'H NMR (DMSO-de): S 0.71 (t,,3H), 1.76-1.81 (m, 2H), 1.93 (s, 3H), 4.03-4.08 (m, IH). 4.19-4.24 (m, IH), 6.77 (dd,l H, J=2.29 and 8.24 Hz), 6.82 (s, IH), 6.96 (t, IH), 7.12 (d. IH), 7.22 (d, IH), 7.34 (d, IH), 9.78 (broad s, IH), MS (ESI) m/z 301 ([M+H]+). EXAMPLE 135 2-(2-CHLORO-4-FLUORO-BENZYL)-3-(4-FLUORO-PHENYL)-7- TRIFLUOROMETHYL-2H-INDAZOLE Preparation of 2-fluoro-ALmethoxy-Af-methyl-3-trifluoromethyl-benzamide Ten grams (10 g 65 mmol) of 2-fluoro-3-(trifluoromethyl)benzoic acid and oxalyl chloride in 10 mL of anhydrous CH2C12 were treated with a few drops of DMF, and stirred at ambient temperature for 1 hour (gas evolution ceased). N.O-Dimethyhydroxylamine hydrochloride (16.8 g, 174 mmol) was added followed by 16 ml of pyridine. The reaction mixture was stirred overnight, then washed successively with , 2 N HC1, and brine. The resulting solution was dried over sodium sulfate. Evaporation of solvents in vacua gave 13.3 g of product as an oil, which was pure enough to be used in the next step without further purification. (CDC13) 8: 7.68 (t, 1 H), 7.62 (t, 1 H), 7.30 (t, 1 H), 3.52 (s, br, 3 H), 3.35 (s, br, 3 H). LCMS: M+H: 252.3. Preparation of(2-fluoro-3-trifluoromethyl-phenyl)-(4-fluoro-phenyl)-methanone 2M Et2O solution of 4-fluorophenylmagnesium bromide (32.5 ml; 65 mmol) was added to a solution of 12.8 g (65 mmol) of 2-fluoro-W-methoxy-A'-methyl-3-trifluorornethyl-benzamide in 150 ml of THF at 0°C. The reaction mixture was heated overnight at 50°C. The reaction mixture was partitioned with EtOAc and FfeO. The organic phases were washed with brine and dried over Na2SO4. The resulting ketone (135 mg) was obtained after flash chromatographic purification using hexane/ CFfeCfe (3:1, v/v) as an eluent. 'HNMR (DMSO-d6) 6: 7.43 (t, 2H), 7.61 (t, 1H), 7.9 (m, 3H), 8.06 (t, 1H). Preparation of 3-(4-Fluoro-phenyl)-7-trifluoromethyl-l//-indazole (2-Fluoro-3-trifluoromethyl-phenyl)-(4-fluoro-phenyl)-methanone (6.58 g, 23 mmol) was dissolved in 20 ml of pyridine. Hydrazine hydrate (7.36 mL, 230 mmol) and 4-(dimethylamino)-pyridine (2.8 g, 23 mmol) were added. The reaction mixture was stirred overnight at 110°C. After cooling to room temperature, EtOAc and 2N HCI were added. The organic phase was washed three times with brine, dried over NaSC>4 and concentrated under vacuum. Purification of the crude product by plug filtration (silica gel, CFhCh) provided 5.18 g product as a white solid. 'HNMR (DMSO-d6) 8: 7.39 (t, 3H), 7.82 (d, 1H), 8.04 (dt, 2H), 8.37 (d, 1H), 13.8 (s 1H). Preparation of 2-(2-Chloro-4-fluoro-benzyl)-3-(4-fluoro-phenyl)-7-trifluoromethyl-2H-indazole. To a solution of 3-(4-fluoro-phenyl)-7-trifluoromethyl-l//-indazole (6.43 g, 23 mmol) in 20 mL DMF was added 2-chloro-4-fluoro benzyl bromide (7.0 g, 31 mmol). The reaction mixture was heated overnight at 120°C. After cooling to room temperature, ethyl acetate was added and the solution was washed three times with brine. The organic layer was dried over NaSC>4 and concentrated. Flash chromatography (hexane/ C^Cfe, 1:1, as eluent) afforded 4.1 g of pure product. Three grams (3 g) of product were recrystallized from 10 mL of isopropanol to recover 1.98 g of crystalline product, mp 78°C. 'HNMR (DMSO-d6) 8: 5.77 (s, 2H), 6.92 (dt, 1H), 7.15 (dt, 1H), 7.24 (t, 1H), 7.43 (m, 3H), 7.63 (m, 2H), 7.76 (d, 1H), 7.83 (d, 1H). MS (ES, m/z): [423/425]V EXAMPLE 136 2-(2-FLUOROBENZYL)-3-(4-FLUOROPHENYL)-7-(TRIFLUOROMETHYL)-2H- INDAZOLE This compound was prepared similarly to that of Example 1. MS (ESI) m/z 389; mp 89-90°C. EXAMPLE 137 2-(2-CHLOROBENZYL)-3-(4-FLUOROPHENYL)-7-(TRIFLUOROMETHYL)-2H- TNDAZOLE This compound was prepared similarly to that of Example 1. MS (ESI) m/z 405. EXAMPLE 138 2-(3,4-DIFLUOROBENZYL)-3-(4-FLUOROPHENYL)-7-(TRIFLUOROMETHYL)- 2H-INDAZOLE This compound was prepared similarly to that of Example 1. MS (ESI) m/z 407. EXAMPLE 139 3-(4-FLUOROPHENYL)-2-(2,4,6-TRIFLUOROBENZYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 1. MS(ESI)m/z425;mp 125°C. EXAMPLE 140 2-(4-FLUOROBENZYL)-3-(4-FLUOROPHENYL)-7-(TRIFLUOROMETHYL)-2H- INDAZOLE This compound was prepared similarly to that of Example 1. MS (ESI) m/z 389. EXAMPLE 141 2-(4-CHLOROBENZYL)-3-(4-FLUOROPHENYL)-7-(TRIFLUOROMETHYL)-2H- INDAZOLE This compound was prepared similarly to that of Example 1. MS (ESI) m/z 405. EXAMPLE 142 2-(2,4-DIFLUOROBENZYL)-3-(4-FLUOROPHENYL)-7-(TRIFLUOROMETHYL)- 2H-INDAZOLE This compound was prepared similarly to that of Example 1. MS (ESI) m/z 407. EXAMPLE 143 2-(2,4-DIMETHYLBENZYL)-3-(4-FLUOROPHENYL)-7-(TRIFLUOROMETHYL)- 2H-INDAZOLE This compound was prepared similarly to that of Example 1. MS (ESI) m/z 399. EXAMPLE 144 METHYL 2-(2,4-DIMETHYLBENZYL)-3-(4-FLUOROPHENYL)-2H-INDAZOLE-7- CARBOXYLATE A solution of 2-(2,4-dimethylbenzyl)-3-(4-fluorophenyl)-7-(trifluoromethyl)-2H-indazole (0.43g, 1.08 mmol) in 10 mL of methylene chloride containing 0.1 mL of cyclohexene was treated with boron tribromide (0.48 mL, 4.3 mmol) at -78°C. The reaction mixture was allowed to warm to room temperature. The reaction mixture was quenched by the slow addition of methanol. The reaction mixture was partitioned with 2 N HC1 and the organic phase was washed with brine. The oranic phase was concentrated in vacua and purified by flash chromatography (silica gel 60; CH2C12 then CH2C12-EtOAc, 7:3) to give 0.43g of the title compound as a white solid. MS (ESI) m/z 389. EXAMPLE 145 2-(2,4-DIMETHYLBENZYL)-3-(4-FLUOROPHENYL)-2H-INDAZOLE-7-CARBOXYLIC ACID A solution of methyl 2-(2,4-dimethylbenzyl)-3-(4-fluorophenyl)-2H-indazole-7-carboxylate (0.195 g, 0.5 mmol) in 5 mL methanol was treated with 1 mL of IN NaOH and stirred at 50°C for 1 hour. The solution was neutralized with dilute HC1 and partitioned with ethyl acetate and H2O. The organic phase was dried (Na2SO4) and concentrated in vacua to give 0.95 mg of the title compound as a yellow solid. MS (ESI) m/z 375. EXAMPLE 146 [2-(2?4-DIMETHYLBENZYL)-3-(4-FLUOROPHENYL)-2H-INDAZOL-7- YLJMETHANOL A solution of methyl 2-(2,4-dimethylbenzyl)-3-(4-fluorophenyl)-2H-indazole-7-carboxylate (0.100 g, 0.25 mmol) and lithium aluminum (O.lg, 0.25 mmol) in 5 mL THF was stirred at ambient temperature for 1 hour. Excess hydride was decomposed by the addition of 0.1 mL H2O, 0.1 mL IN NaOH, Oi3 mL H2O and 100 mg of Na2SO4. The solids were filtered and the filtrate concentrated in vacua to give 0.09g of product as a light yellow solid. MS (ESI) m/z 361. EXAMPLE 147 ETHYLl-{4-[2-(2,4-DIMETHYLBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENYL}PIPERIDINE-4-CARBOXYLATE A solution of 2-(2,4-dimethylbenzyl)-3-(4-fluorophenyl)-7-(trifluoromethyl)-2H-indazole (0.187 g, 0.47 mmol), ethyl isonipicotate (77 uL, 0.5 mmol) and potassium t-butoxide (0.056g, 0.5 mmol) in DMA was heated at 120°C for 72 hours. The reaction mixture was partitioned with ethyl acetate and f^O. The organic phase was adsorbed on silica gel and purified by flash chromatography (Cl^Cfe) to give 0.008 g product. MS (ESI) m/z 536. EXAMPLE 148 2-BENZYL-3-(4-CHLOROPHENYL)-7-(TRIFLUOROMETHYL)-2H-rNDAZOLE This compound was prepared similarly to that of Example 1. MS (ESI) m/z 387. EXAMPLE 149 l-{4-[2-BENZYL-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3- YL]PHENYL}PIPERIDINE-4-CARBOXAMIDE A solution of 2-benzyI-3-(4-chlorophenyl)-7-(trifluoromethyl)-2H-indazole (0.1 g, 0.25 mmol), isonipecotamide (0.039 g, 0.3 mmol), tris-(dibenzylidineacetone)dipalladium(0) (14 mg), 2-dicyclohexylphosphino-2'-(N,N-dimethylamino)biphenyl (47 mg) and sodium /-butoxide (0.029g, 0.3 mmol) in 2 mL of dimethoxyethane was heated at 150°C for 5 minutes in a microwave (Emory's Optimizer, Personal Chemistry). The reaction mixture was concentrated in vacua. The residue was purified by flash chromatography (Cr^Cb-CH3OH, 19:1) to give the product (0.034 g) as an off-white solid. MS (ESI) m/z 479. EXAMPLE 150 ETHYLl-{4-[2-BENZYL-7-(TRlFLUOROMETHYL)-2H-INDAZOL-3- YL]PHENYL}PIPERIDINE-4-CARBOXYLATE This compound was prepared similarly to that of Example 149. MS (ESI) m/z 508. EXAMPLE 151 (l-{4-[2-BENZYL-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3- YL]PHENYL}PIPERIDIN-4-YL)METHANOL This compound was prepared similarly to that of Example 149. MS (ESI) m/z 466. EXAMPLE 152 3-(4-CHLOROPHENYL)-2-(2,4,6-TRIFLUOROBENZYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 1. MS (ES) m/z 441.1. EXAMPLE 153 2-(2-CHLORO-4-FLUOROBENZYL)-3-(4-CHLOROPHENYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 1. MS (ES) m/z 439.1. EXAMPLE 154 2-(4-CHLORO-2-FLUOROBENZYL)-3-(4-CHLOROPHENYL)-7- (TR1FLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 1. MS (ES) m/z 439.1. EXAMPLE 155 3-(4-CHLOROPHENYL)-2-(2,4-DIMETHYLBENZYL)-7-(TRIFLUOROMETHYL)- 2H-INDAZOLE This compound was prepared similarly to that of Example 1. MS (ES) m/z 415.2. EXAMPLE 156 2-(4-CHLORO-2-FLUOROBENZYL)-3-(4-FLUOROPHENYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 1. MS (ES)m/z 423.1. EXAMPLE 157 2-(2-CHLORO-6-FLUOROBENZYL)-3-(4-CHLOROPHENYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 1. MS (ES) m/z 439.2. EXAMPLE 158 2-(2-CHLORO-6-FLUOROBENZYL)-3-(4-FLUOROPHENYL)-7- (TR1FLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 1. ms(ES)m/z423.2. EXAMPLE 159 4-[2-(2,4-DIMETHYLBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]-3- METHYLPHENOL A solution of 2-(2,4-Dimethylbenzyl)-3-(4-methoxy-2-methylphenyI)-7-trifluorornethyI-2H-indazole (0.27 g, 0.63 mmol) and tetrabutylammonium iodide (0.7 g, 1.9 mmol) in 10 mL of CH2C12 was cooled to -78°C and treated with boron trichloride IM in CH2CI2 (1.9 mL, 1.9 mmol). The reaction mixture was allowed to warm to ambient temperature. The reaction mixture was partitioned with IN HC1 and the organic phase was concentrated in vacua. The residue was purified by flash chromatography to give 0.18 g of title compound as a white solid. MS (ES) m/z 409.2. EXAMPLE 160 (1 - {4-[2-BENZYL-7-(TRIFLUOROMETH YL)-2H-INDAZOL-3- YL]PHENYL}PIPERIDIN-3-YL)METHANOL This compound was prepared similarly to that of Example 149. MS (ES) m/z 466. EXAMPLE 161 2-(l-{4-[2-BENZYL-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENYL} PIPERIDIN-4-YL)ETHANOL This compound was prepared similarly to that of Example 149. MS (ES) m/z 480. EXAMPLE 162 2-BENZYL-3-(4-PIPERIDIN-l-YLPHENYL)-7-(TRIFLUOROMETHYL)-2H- INDAZOLE This compound was prepared similarly to that of Example 149. MS (ES) m/z 436. EXAMPLE 163 2-BENZYL-3-(4-PYRROLlDlN-l-YLPHENYL)-7-(TRIFLUOROMFTHYL)-2H- INDAZOLE This compound was prepared similarly to that of Example 149. MS (ES) m/z 422. EXAMPLE 164 l-{4-[2-BENZYL-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENYL} PYRROLIDIN-3-OL This compound was prepared similarly to that of Example 149. MS (ESI) m/z 438. EXAMPLE 165 l-BENZYL-N-{4-[2-BENZYL-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3- YL]PHENYL}PYRROLIDIN-3-AMINE This compound was prepared similarly to that of Example 149. MS (ESI) m/z 527. EXAMPLE 166 l-{4-[2-BENZYL-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENYL}PIPERIDINE-4-CARBOXYLIC ACID A solution of ethyl l-{4-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3-yl]phenyl}piperidine-4-carboxylate (0.06 g, 0.12 mmol) in 5mL of methanol containing 1 mL of 1 N NaOH was stirred overnight at ambient temperature. The reaction mixture was neutralized with dilute HC1 and partitioned with ethyl acetate and PbO. The organic phase was dried (Na2SC>4) and concentrated in vacua. The residue was triturated with petroleum ether to give the title compound as an amber solid (0.049 g). MS (ES) m/z 478.2. EXAMPLE 167 (1 - {4-[2-(2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3- YLJPHENYL} PIPERIDIN-3-YL)METHANOL This compound was prepared similarly to that of Example 149. MS (ESI) m/z 520. EXAMPLE 168 (l-{4-[2-(2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3- YL]PHENYL}PIPERIDIN-4-YL)METHANOL This compound was prepared similarly to that of Example 149. MS (ESI) m/z 520. EXAMPLE 169 ((3R)-l-{4-[2-(2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-lNDAZOL-3-YL]PHENYL}PIPERIDIN-3-YL)METHANOL The racemic compound of Example 169 was resolved by chiral HPLC to give the title compound. [a]D25 = -6.6° (c = 0.010 g/mL, CHC13); MS (ES) m/z 520.1. EXAMPLE 170 ((3S)-l-{4-[2-(2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H- INDAZOL-3-YL]PHENYL}PIPERIDIN-3-YL)METHANOL The racemic compound of Example 169 was resolved by chiral HPLC to give the title compound. MS (ES) m/z 520.1. EXAMPLE 171 ETHYL l-{4-[2-(2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H- INDAZOL-3-YL]PHENYL}PIPERIDINE-4-CARBOXYLATE This compound was prepared similarly to that of Example 149. MS (ES) m/z 562.4. EXAMPLE 172 !-{4-[2-(2,4,6-TRlFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-lNDAZOL-3- YL]PHENYL}PYRROLIDIN-3-OL This compound was prepared similarly to that of Example 149. MS (ESI) m/z 492. EXAMPLE 173 I-BENZYL-N-{4-[2-(2,4,6-TRlFLUOROBENZYL)-7-(TRlFLUOROMETHYL)-2H- !NDAZOL-3-YL]PHENYL}PYRROLIDIN-3-AMlNE This compound was prepared similarly to that of Example 149. MSm/z581. EXAMPLE 174 N-METHYL-l-{4-[2-(2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H- INDAZOL-3-YL]PHENYL}PIPERIDIN-4-AMINE This compound was prepared similarly to that of Example 149. MS(ES)m/z519.2. EXAMPLE 175 3-[4-(2-METHYLPIPERIDIN-l -YL)PHENYL]-2-(2,4,6-TRIFLUOROBENZYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 149. MS (ES) m/z 504.2. EXAMPLE 176 3-[4<3-METHYLPIPERIDIN-l-YL)PHENYL]-2-(2,4,6-TRIFLUOROBENZYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 149. MS (ES) m/z 504.2; mp 103°C. EXAMPLE 177 3-[4-(4-METHYLPlPERlDIN-l-YL)PHENYL]-2-(2,4,6-TRIFLUOROBENZYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 149. MS (ES) m/z 504.2. EXAMPLE 178 l-{4-[2-(2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3- YL]PHENYL}PIPERlDIN-3-OL This compound was prepared similarly to that of Example 149. MS m/z 506. EXAMPLE 179 (l-{4-[2-(2,4-DIMETHYLBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3- YL]PHENYL}PIPERIDIN-3-YL)METHANOL This compound was prepared similarly to that of Example 149. MS (ES) m/z 494.2. EXAMPLE 180 (l.{4-[2-(2,4-DIMETHYLBENZYL)-7-(TRIFLUOROMETHYL)-2H-rNDAZOL-3- YL]PHENYL}PIPERIDIN-4-YL)METHANOL This compound was prepared similarly to that of Example 149. MS m/z 494. EXAMPLE 181 ETHYL l-{4-[2-(2,4-DIMETHYLBENZYL)-7-(TRIFLUOROMETHYL)-2H- INDAZOL-3-YL]PHENYL}PIPERIDINE-3-CARBOXYLATE This compound was prepared similarly to that of Example 149. MS (ES) m/z 536.2. EXAMPLE 182 2-(l-{4-[2-(2,4,6-TRIFLUOROBENZYL)-7-(TRlFLUOROMETHYL)-2H-lNDAZOL- 3-YL]PHENYL}PIPERIDIN-4-YL)ETHANOL This compound was prepared similarly to that of Example 149. MS (ES) m/z 534.2. EXAMPLE 183 4-PHENYL-l-{4-[2-(2,4,6-TRJFLUOROBENZYL)-7-(TRlFLUOROMETHYL)-2H- INDAZOL-3-YL]PHENYL}PIPERlDIN-4-OL This compound was prepared similarly to that of Example 149. MS (ES) m/z 582.2. EXAMPLE 184 TERT-BUTYL [(l-{4-[2-(2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)- 2H-INDAZOL-3-YL]PHENYL}PIPERIDlN-4-YL)METHYL]CARBAMATE This compound was prepared similarly to that of Example 149. MS (ES) m/z 619.3. EXAMPLE 185 8-{4-[2-(2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3- YL]PHENYL}-l,4-DIOXA-8-AZASPIRO[4.5]DECANE This compound was prepared similarly to that of Example 149. MS (ESI) m/z 548. EXAMPLE 186 (3S)-l-BENZYL-N-{4-[2-(2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)- 2H-INDAZOL-3-YL]PHENYL}PYRROLIDIN-3-AMINE This compound was prepared similarly to that of Example 149. MS (ESI) m/z 581. EXAMPLE 187 (3R)-l-BENZYL-N-{4-[2-(2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)- 2H-INDAZOL-3-YL]PHENYL}PYRROLlDIN-3-AMINE This compound was prepared similarly to that of Example 149. MS (ES) m/z 581.0. EXAMPLE 188 METHYL ((3R)-l-{4-[2-(2,4,6-TRIFLUOROBENZYL)-7-(TRlFLUOROMETHYL)- 2H-INDAZOL-3-YL]PHENYL}PIPERIDIN-3-YL)ACETATE This compound was prepared similarly to that of Example 149. mp 103°C; MS (ES) m/z 562.0. EXAMPLE 189 l-{4-[2-(2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3- YL]PHENYL}PIPERIDIN-4-ONE A solution of 8-{4-[2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3-yl]phenyl}-l,4-dioxa-8-azaspiro[4.5]decane (0.195 g, 0.36 mmol) in 2 mL of formic acid was heated at 70°C for 2 hours. The solvent was evaporated and the residue purified by flash chromatography (CHaCb-EtOAc, 19:1) to give 0.1 g of the title compound. MS (ES) m/z 503.9. EXAMPLE 190 ((3R)-l-{4-[2-(2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YLJPHENYL}PIPERIDIN-3-YL)ACETIC ACID A solution of methyl ((3R)-l-{4-[2-(2,4,6-trifluorobenzyl)-7-(trifluoroniethyl)-2H-indazol-3-yl]phenyl}piperidin-3-yl)acetate (0.045 g, 0.08 mmol) in CH3OH-THF (1:1. v/v) containing 0.5 mL of 1 N NaOH was stirred overnight at ambient temperature. Then it was neutralized with dilute acid and partitioned with ethyl acetate and brine. The organic phase was dried (NaaSC^) and concentrated in vacuo. The crude product was crystallized from ether/petroleum ether to give 0.036 g of title compound as a pale yellow solid. MS (ESI) m/z 548; [a]D25 = -4.5° (c = 0.012 g/mL, CHC13). EXAMPLE 191 l-{4-[2-(2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3- YL]PHENYL}-N-[4-(TRIFLUOROMETHYL)BENZYL]PIPERIDIN-4-AMINE This compound was prepared similarly to that of Example 149. MS (ES) m/z 663.0. EXAMPLE 192 ETHYL l-{4-[2-(2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H- INDAZOL-3-YL]PHENYL}PIPERIDINE-2-CARBOXYLATE This compound was prepared similarly to that of Example 149. MS (ES) m/z 562.0. EXAMPLE 193 ETHYL l-{4-[2-(2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H- INDAZOL-3-YL]PHENYL}PIPERIDINE-3-CARBOXYLATE This compound was prepared similarly to that of Example 149. MS (ES) m/z 562.0. : EXAMPLE 194 TERT-BUTYL((3S)-1 -{4-[2-(2,4,6-TRIFLUOROBENZYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENYL}PYRROLIDIN-3- YL)CARBAMATE This compound was prepared similarly to that of Example 149. MS (ES) m/z 591.0. EXAMPLE 195 TERT-BUTYL((3R)-l-{4-[2-(2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENYL}PYRROLIDIN-3-YL)CARBAMATE This compound was prepared similarly to that of Example 149. MS (ES) m/z 591.0. EXAMPLE 196 (3S)-l-CYCLOHEXYL-N-{4-[2-(2,4,6-TRIFLUOROBENZYL)-7- (TRIFLUOROMETHYL)-2H-lNDAZOL-3-YL]PHENYL}PYRROLlDIN-3-AMINE This compound was prepared similarly to that of Example 149. MS(ESI)m/z573. EXAMPLE 197 (3S)-l-{4-[2-(2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H- INDAZOL-3-YL]PHENYL}PYRROLIDIN-3-AMINE A solution of tert-butyl ((3S)-l-{4-[2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3-yl]phenyl}pyrrolidin-3-yl)carbamate (0.05 g, 0.085 mmol) in 1 mL CFbCh was treated with 0.1 mL of trifluoroacetic acid and stirred at ambient temperature overnight. Then the reaction mixture was partitioned with extra CFfeCla and saturated NaHCOs. The organic phase was isolated and dried (NaiSC^). The sovent was evaporated and the residue treated with excess HC1 in diethyl ether. The solids were collected and dried to give 0.32 g of the title compound as the HCI salt. MS(ESI)m/z491. EXAMPLE 198 (3R)-l-{4-[2-(2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H- INDAZOL-3-YL]PHENYL}PYRROLIDIN-3-AMINE This compound was prepared similarly to that of Example 197. MS(ESI)m/z491. EXAMPLE 199 (3S)-l-(3-METHYLBUT-2-ENYL)-N-{4-[2-(2,4,6-TRIFLUOROBENZYL)-7- (TRIFLUOROMETHYL)-2H-lNDAZOL-3-YL]PHENYL}PYRROLIDIN-3-AMlNE This compound was prepared similarly to that of Example 149. MS m/z 559. EXAMPLE 200 (3R)-l-(3-METHYLBUT-2-ENYL)-N-{4-[2-(2,4,6-TRlFLUOROBENZYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENYL}PYRROLIDlN-3-AMlNI- This compound was prepared similarly to that of Example 149. MS m/z 559. EXAMPLE 201 (3R)-N-{4-[2-(2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H- INDAZOL-3-YL]PHENYL}-l-(3,3,3-TRIFLUOROPROPYL)PYRROLIDIN-3-AMINE This compound was prepared similarly to that of Example 149. MS (ES) m/z 585.0. EXAMPLE 202 (3R)-l-(2-METHYLPROP-2-ENYL)-N-{4-[2-(2,4,6-TRIFLUOROBENZYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENYL}PYRROLIDIN-3-AMINE This compound was prepared similarly to that of Example 149. MS (ES) m/z 545.0. EXAMPLE 203 (3R)-l-[(2E)-PENT-2-ENYL]-N-{4-[2-(2,4,6-TRIFLUOROBENZYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENYL}PYRROLIDIN-3-AMlNE This compound was prepared similarly to that of Example 149. MS (ESI) m/z 559. EXAMPLE 204 (3R)-l-HEXYL-N-{4-[2-(2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)- 2H-lNDAZOL-3-YL]PHENYL}PYRROLIDlN-3-AMINE This compound was prepared similarly to that of Example 149. MS (ESI) m/z 575. EXAMPLE 205 (3R)-l-CYCLOPENTYL-N-{4-[2-(2,4,6-TRIFLUOROBENZYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENYL}PYRROLlDIN-3-AMINE This compound was prepared similarly to that of Example 149. MS (ES)m/z 559.1. EXAMPLE 206 (3R)-l-ISOPROPYL-N-{4-[2-(2,4,6-TRIFLUOROBENZYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENYL}PYRROLIDIN-3-AMINE This compound was prepared similarly to that of Example 149. MS (ESI) m/z 533. EXAMPLE 207 (3S)-l-HEXYL-N-{4-[2-(2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)- 2H-INDAZOL-3-YL]PHENYL}PYRROLIDIN-3-AMINE This compound was prepared similarly to that of Example 149. MS (ESI) m/z 575. EXAMPLE 208 (3S)-N-{4-[2-(2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H- INDAZOL-3-YL]PHENYL}-l-(3,3,3-TRIFLUOROPROPYL)PYRROLIDIN-3-AMINE This compound was prepared similarly to that of Example 149. MS (ESI) m/z 587. EXAMPLE 209 (3S)-l-(2-METHYLPROP-2-ENYL)-N-{4-[2-(2,4,6-TRIFLUOROBENZYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENYL}PYRROLIDIN-3-AMlNE This compound was prepared similarly to that of-Example 149. MS (ESI) m/z 545. EXAMPLE 210 (3S)-l-[(2E)-PENT-2-ENYL]-N-{4-[2-(2,4,6-TRIFLUOROBENZYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENYL}PYRROLIDIN-3-AMINE This compound was prepared similarly to that of Example 149. MS (ESI) m/z 559. EXAMPLE 211 (3S)-l-CYCLOPENTYL-N-{4-[2-(2,4,6-TRIFLUOROBENZYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENYL}PYRROLIDIN-3-AMINE This compound was prepared similarly to that of Example 149. MS (ESI) m/z 559. EXAMPLE 212 (3S)-l-ISOBUTYL-N-{4-[2^2,4,6-TRIFLUOROBENZYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENYL}PYRROLIDIN-3-AMINE This compound was prepared similarly to that of Example 149. MS (ESI) m/z 547. EX AMPLE 213 METHYL ((3S)-l-{4-[2-(2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)- 2H-INDAZOL-3-YL]PHENYL}PIPERIDIN-3-YL)ACETATE This compound was prepared similarly to that of Example 149. MS (ES) m/z 562.0; mp 103°C. EXAMPLE 214 ((3S)-l-{4-[2-(2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H- INDAZOL-3-YL]PHENYL}PIPERIDIN-3-YL)ACETICACID This compound was prepared similarly to that of Example 190. MS (ES) m/z 546.0. EXAMPLE 215 3-(4-BROMOPHENYL)-2-(2-CHLORO-4-FLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 1. MSm/z483. EXAMPLE 216 METHYL ((3R)-l-{4-[2-(2-CHLORO-4-FLUOROBENZYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENYL}PIPERIDIN-3- YL)ACETATE This compound was prepared similarly to that of Example 149. MS (ES) m/z 560.0. EXAMPLE 217 ((3R)-l-{4-[2-(2-CHLORO-4-FLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H- INDAZOL-3-YL]PHENYL}PIPERIDIN-3-YL)ACETICACID This compound was prepared similarly to that of Example 190. MS (ES) m/z 543.9. EXAMPLE 218 3-(4-BROMOPHENYL)-2-(2,4-DIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)- 2H-INDAZOLE This compound was prepared similarly to that of Example 1. MS (ES) m/z 467.0. EXAMPLE 219 3-(4-BROMOPHENYL)-2-(2,6-DICHLOROBENZYL)-7-(TRIFLUOROMETHYL)- 2H-INDAZOLE This compound was prepared similarly to that of Example 1. MS (ES) m/z 498.9. EXAMPLE 220 METHYL ((3R)-l-{4-[2-(2,6-DICHLOROBENZYL)-7-(TRIFLUOROMETHYL)-2H- INDAZOL-3-YL]PHENYL}PIPERIDIN-3-YL)ACETATE This compound was prepared similarly to that of Example 149. MS (ES)m/z 576.1. EXAMPLE 221 METHYL ((3R)-l-{4-[2-(2,4-DIFLUOROBENZYL)-7-(TRJFLUOROMETHYL)-2H- INDAZOL-3-YL]PHENYL}PIPERIDIN-3-YL)ACETATE This compound was prepared similarly to that of Example 149. MS (ES) m/z 544.2. EXAMPLE 222 ((3R)-l-{4-[2-(2,4-DIFLUOROBENZYL)-7{3-[(3-CHLORO-2-FLUOROPHENYL)ETHYNYL]PHENYL}-2-(2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 228. MS (ES) m/z 559.0. EXAMPLE 252 [3-({3-[2-(2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENYL} ETHYNYL)PHENYL]METHANOL This compound was prepared similarly to that of Example 228. MS (ES) m/z 537.1. EXAMPLE 253 4-AMINO-3-(2-{3-[2-(2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H- lNDAZOL-3-YL]PHENYL}ETHYL)BENZONITRILE This compound was prepared similarly to that of Example 229. MS (ES) m/z 551.1. EXAMPLE 254 3-{3-[(2,3-DICHLOROPHENYL)ETHYNYL]PHENYL}-2-(2,4,6- TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 228. MS (ES) m/z 575.0. EXAMPLE 255 3-{3-[2-(3-CHLORO-2-FLUOROPHENYL)ETHYL]PHENYL}-2-(2,4,6- TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 229. MS (ES) m/z 563.0. EXAMPLE 256 [3-(2-{3-[2-(2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENYL} ETHYL)PHENYL]METHANOL This compound was prepared similarly to that of Example 229. MS (ES) m/z 541.1. EXAMPLE 257 3-{3-[2-(2,3-DICHLOROPHENYL)ETHYL]PHENYL}-2-(2,4,6- TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-lNDAZOLE This compound was prepared similarly to that of Example 229. MS (ES) m/z 576. EXAMPLE 258 N-[3-({3-[2-(2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-lNDAZOL-3-YL]PHENYL}ETHYNYL)PHENYL]MORPHOLINE-4-CARBOXAM1DE Preparation of N-(3-iodophenyl)morpholine-4-carboxamide. A solution of 3-iodophenylisocyanate (O.lg, 0.41 mmol) and morpholine (0.04 mL, 0.45 mmol) in 2 mL dioxane were heated at 100°C overnight. The solvent was evaporated and the resulting product was used without purification. MS(ES)m/z331.0. Preparation of N-[3-({3-[2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyl)-2h-indazol-3-yl]phenyl}ethynyl)phenyl]morpholine-4-carboxarnide The title compound was obtained by reaction of N-(3-iodophenyl)morpholine-4-carboxamide with the alkyne of Example 228. MS (ES) m/z 635.2. EXAMPLE 259 TERT-BUTYL 4-({[3-({3-[2-{2,4,6-TRIFLUOROBENZYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOL-3- YL]PHENYL}ETHYNYL)PHENYL]AM1NO} CARBONYL) PIPERAZINE-1- CARBOXYLATE This compound was prepared similarly to that of Example 258. MS (ES) m/z 734.3. EXAMPLE 260 2-METHYL-N-[3-({3-[2-(2,4,6-TRIFLUOROBENZYL)-7-(TRlFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENYL}ETHYNYL)PHENYL]PIPERIDINE-l-CARBOXAMIDE This compound was prepared similarly to that of Example 258. MS (ES) m/z 647.2. EXAMPLE 261 3-METHYL-N-[3-({3-[2-(2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENYL}ETHYNYL)PHENYL]PIPERIDINE-l-CARBOXAM1DE This compound was prepared similarly to that of Example 258. MS (ES) m/z 647.2. EXAMPLE 262 4-METHYL-N-[3-({3-[2-(2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENYL}ETHYNYL)PHENYL]PIPERIDINE-l-CARBOXAMIDE This compound was prepared similarly to that of Example 258. MS (ES) m/z 647.2. EXAMPLE 263 3-(HYDROXYMETHYL)-N-[3-({3-[2-(2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENYL}ETHYNYL)PHENYL] PIPERIDINE-1 -CARBOXAMIDE This compound was prepared similarly to that of Example 258. MS (ES) m/z 663.3. EXAMPLE 264 N-ISOPROPYL-N'-[3-({3-[2-(2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENYL} ETHYNYL)PHENYL]UREA This compound was prepared similarly to that of Example 258. MS (ES) m/z 607.2. EXAMPLE 265 N,N-DIPROPYL-N'-[3-({3-[2-(2,4,6-TRIFLUOROBENZYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENYL}ETHYNYL)PHENYL]UREA This compound was prepared similarly to that of Example 258. MS (ES) m/z 649.3. EXAMPLE 266 N-METHYL-N'-[3-({3-[2-(2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)- 2H-INDAZOL-3-YL]PHENYL}ETHYNYL)PHENYL]UREA This compound was prepared similarly to that of Example 258. MS (ESI) m/z 579. EXAMPLE 267 N,N-DIMETHYL-N'-[3-({3-[2-(2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENYL}ETHYNYL)PHENYL]UREA This compound was prepared similarly to that of Example 258. MS (ES) m/z 593.2. EXAMPLE 268 3-[3-(PYRIDIN-3-YLETHYNYL)PHENYL]-2-(2,4,6-TRIFLUOROBENZYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 228. MS (ES)m/z 508.1. EXAMPLE 269 3-[3-(PYRIDIN-4-YLETHYNYL)PHENYL]-2-(2,4,6-TRIFLUOROBENZYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 228. MS (ES)m/z 508.1. EXAMPLE 270 N-(METHYLSULFONYL)-N-[3-({3-[2-(2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENYL}ETHYNYL)PHENYL] METHANESULFONAMIDE This compound was prepared similarly to that of Example 228. MS (ES)m/z 678.1. EXAMPLE 271 METHYL [3-({3-[2-(2,4,6-TRIFLUOROBEhfZYL)-7-(TRlFLUOROMETHYL)-2H- INDAZOL-3-YL]PHENYL}ETHYNYL)PHENYL]CARBAMATE This compound was prepared similarly to that of Example 228. MS (ES)m/z 580.1. EXAMPLE 272 l-METHYL-3-[3-({3-[2-(2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)- 2H-INDAZOL-3-YL]PHENYL}ETHYNYL)PHENYL]IMIDAZOLIDlN-2-ONE This compound was prepared similarly to that of Example 228. MS (ES) m/z 605.2. EXAMPLE 273 6-METHYL-2-({3-[2-(2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H- INDAZOL-3-YL]PHENYL}ETHYNYL)PYRIDIN-3-OL This compound was prepared similarly to that of Example 228. MS(ES)m/z538.1. EXAMPLE 274 3-[3-(PYRIDIN-2-YLETHYNYL)PHENYL]-2-(2,4,6-TRIFLUOROBENZYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 228. MS (ES)m/z 508.1. EXAMPLE 275 METHYL 5-CYANO-2-{3-[2-(2,4,6-TRIFLUOROBENZYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENYL}-l H-INDOLE-1 - CARBOXYLATE This compound was prepared similarly to that of Example 228. MS(ES)m/z603.7. EXAMPLE 276 2-({3-[2-(2,4,6-TRlFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENYL} ETHYNYL)PYRIDIN-3-OL This compound was prepared similarly to that of Example 228. MS (ES)m/z 524.1. EXAMPLE 277 TERT-BUTYL 6-METHYL-5-{3-[2-(2,4,6-TRIFLUOROBENZYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENOXY} -1 H-INDOLE-1 - CARBOXYLATE This compound was prepared similarly to that of Example 3. MS (ES) m/z 652.2. EXAMPLE 278 TERT-BUTYL 6-FLUORO-5-{3-[2-(2,4,6-TRIFLUOROBENZYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENOXY}-lH-INDOLE-l- CARBOXYLATE This compound was prepared similarly to that of Example 3. MS (ES) m/z 656.2. EXAMPLE 279 4-FLUORO-2-({3-[2-(2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H- INDAZOL-3-YL]PHENYL}ETHYNYL)ANILINE This compound was prepared similarly to that of Example 228. MS (ES) m/z 538.1. EXAMPLE 280 4-CHLORO-2-FLUORO-6-({3-[2-(2,4,6-TRIFLUOROBENZYL)-7- (TRlFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENYL}ETHYNYL)ANlLINlI This compound was prepared similarly to that of Example 228. MS (ES) m/z 571.9. EXAMPLE 281 METHYL [4-FLUORO-2-({3-[2-(2,4,6-TRIFLUOROBENZYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENYL}ETHYNYL) PHENYL]CARBAMATE This compound was prepared similarly to that of Example 228. MS (ES)m/z 596.1. EXAMPLE 282 3-[3-(5-FLUORO-lH-mDOL-2-YL)PHENYL]-2-(2,4,6-TRIFLUOROBENZYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOLE A solution of methyl [4-fluoro-2-({3-[2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3-yl]phenyl}ethynyl)phenyl]carbamate (0.07 g, 0.12 mmol) and tetrabutylammonium fluoride (0.24 mL, 0.24 mmol, 1M solution in THF) in 2 mL THF was heated at 60°C for 21 hours. The reaction mixture was concentrated in vacua and the residue purified by normal phase HPLC (silica, hexane-EtOAC, 19:1) to give 0.045 g of product as a white solid. MS (ES) m/z 539.7. EXAMPLE 283 3-[3-(5-FLUORO-l-METHYL-lH-INDOL-2-YL)PHENYL]-2-(2,4,6- TRIFLUOROBENZYL)-7-(TRlFLUORQMETHYL)-2H-INDAZOLE A solution of 3-[3-(5-fluoro-lH-indol-2-yl)phenyl]-2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyl)-2H-indazole (0.03 g, 0.056 mmol) in 2 mL THF was treated with sodium hydride (0.004 g, 0.1 mmol, 60 % in oil). The reaction mixture was stirred for 20 minutes and treated with iodomethane (0.007 mL, 0.1 mmol). Stirring was continued for 1 hour. The reaction mixture was concentrated and purified by normal phase HPLC (silica, hexane-EtOAC, 19:1) to give 0.01 g of product as a white solid. MS (ES) m/z 553.6. EXAMPLE 284 l-BENZYL-7-CHLORO-3-(4-METHOXY-2-METHYLPHENYL)-lH-INDAZOLE This compound was prepared similarly to that of Example 1. MS (ESI) m/z 363. EXAMPLE 285 7-CHLORO-2-(2-FLUOROBENZYL)-3-(4-METHOXY-2-METHYLPHENYL)-2H- INDAZOLE This compound was prepared similarly to that of Example 1. MS (ESI) m/z 381. EXAMPLE 286 7-CHLORO-2-(4-FLUOROBENZYL)-3-(4-METHOXY-2-METHYLPHENYL)-2H- INDAZOLE This compound was prepared similarly to that of Example 1. MS (ESI) m/z 381. EXAMPLE 287 2-BENZYL-7-CHLORO-3-(2,4-DIMETHOXYPHENYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 1. MS (ESI) m/z 379. EXAMPLE 288 7-CHLORO-3-(2,4-DIMETHOXYPHENYL)-2-(2-FLUOROBENZYL)-2H- INDAZOLE This compound was prepared similarly to that of Example 1. MS (ESI) m/z 397. EXAMPLE 289 7-CHLORO-3-(2,4-DIMETHOXYPHENYL)-2-(4-FLUOROBENZYL)-2H- INDAZOLE This compound was prepared similarly to that of Example 1. MS (ESI) m/z 397. EXAMPLE 290 2-BENZYL-7-FLUORO-3-(4-METHOXY-2-METHYLPHENYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 1. MS (ESI) m/z 347. EXAMPLE 291 7-FLUORO-2-(2-FLUOROBENZYL)-3-(4-METHOXY-2-METHYLPHENYL)-2H- INDAZOLE This compound was prepared similarly to that of Example 1 MS (ESI) m/z 365. EXAMPLE 292 7-FLUORO-2-(4-FLUOROBENZYL)-3-(4-METHOXY-2-METHYLPHENYL)-2H- INDAZOLE This compound was prepared similarly to that of Example I. MS (ESI) m/z 365. EXAMPLE 293 2-(2-CHLORO-6-FLUOROBENZYL)-7-FLUORO-3-(4-METHOXY-2- METHYLPHENYL)-2H-INDAZOLE This compound was prepared similarly to that of Example I. MS (ESI) m/z 399. EXAMPLE 294 2-(2-CHLOROBENZYL)-7-FLUORO-3-(4-METHOXY-2-METHYLPHENYL)-2H- INDAZOLE This compound was prepared similarly to that of Example 1. MS(ESI)m/z381. EXAMPLE 295 2-(2,4-DIFLUOROBENZYL)-7-FLUORO-3-(4-METHOXY-2-METHYLPHENYL)- 2H-INDAZOLE This compound was prepared similarly to that of Example 1. MS(ESI)m/z383. EXAMPLE 296 2-BENZYL-3-(2,4-DIMETHOXYPHENYL)-7-FLUORO-2H-INDAZOLE This compound was prepared similarly to that of Example 1. MS(ESI)m/z363. EXAMPLE 297 3-(2,4-DIMETHOXYPHENYL)-7-FLUORO-2-(2-FLUOROBENZYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 1. MS(ESI)m/z381. EXAMPLE 298 3-(2,4-DIMETHOXYPHENYL)-7-FLUORO-2-(4-FLUOROBENZYL)-2H-INDAZOLE This compound was prepared similarly to that of Example I. MS(ESI)m/z381. EXAMPLE 299 2-(2-CHLORO-6-FLUOROBENZYL)-3-(2,4-DIMETHOXYPHENYL)-7-FLUORO- 2H-INDAZOLE This compound was prepared similarly to that of Example 1. MS(ESI)m/z415. EXAMPLE 300 2-(2-CHLOROBENZYL)-3-(2,4-DIMETHOXYPHENYL)-7-FLUORO-2H- INDAZOLE This compound was prepared similarly to that of Example 1. MS (ESI) m/z 397. EXAMPLE 301 2-(2,4-DIFLUOROBENZYL)-3-(2,4-DIMETHOXYPHENYL)-7-FLUORO-2H- INDAZOLE This compound was prepared similarly to that of Example 1. MS (ESI) m/z 399. EXAMPLE 302 2-(3,4-DIFLUOROBENZYL)-3-(2,4-DIMETHOXYPHENYL)-7-FLUORO-2H- 1NDAZOLE This compound was prepared similarly to that of Example I. MS (ESI) m/z 399. EXAMPLE 303 2-(4-CHLOROBENZYL)-3-(2,4-DIMETHOXYPHENYL)-7-FLUORO-2H- INDAZOLE This compound was prepared similarly to that of Example 1. MS (ESI) m/z 397. EXAMPLE 304 3-(3,4-DIFLUOROPHENYL)-2-(3-METHYLBENZYL)-7-(TRIFLUOROMETHYL)- 2H-INDAZOLE This compound was prepared similarly to that of Example 1. MS(ESI)m/z403. EXAMPLE 305 2-BENZYL-3-(3,4-DIFLUOROPHENYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 1. MS (ESI) m/z 389. EXAMPLE 306 3-(3,4-DIFLUOROPHENYL)-2-(2-FLUOROBENZYL)-7-(TRIFLUOROMETHYL)- 2H-INDAZOLE This compound was prepared similarly to that of Example 1. MS (ESI) m/z 407. EXAMPLE 307 3-(3,4-DIFLUOROPHENYL)-2-(2,4,6-TRIFLUOROBENZYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 1. MS (ESI) m/z 443. EXAMPLE 308 2-(2,4-DIFLUOROBENZYL)-3-(3,4-DIFLUOROPHENYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 1. MS (ESI) m/z 425. EXAMPLE 309 2-(3,4-DICHLOROBENZYL)-3-(3,4-DIFLUOROPHENYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 1. MS (ESI) m/z 457. EXAMPLE 310 3-(4-CHLOROPHENYL)-2-(3,4-DICHLOROBENZYL)-7-(TRIFLUOROMETHYL)- 2H-INDAZOLE This compound was prepared similarly to that of Example 1. MS (ES) m/z 455.1. EXAMPLE 311 3-(4-CHLOROPHENYL)-7-(TRIFLUOROMETHYL)-2-[4- (TRIFLUOROMETHYL)BENZYL]-2H-INDAZOLE This compound was prepared similarly to that of Example 1. MS (ES) m/z 455.1. EXAMPLE 312 3-(4-CHLOROPHENYL)-7-(TRIFLUOROMETHYL)-2-[2- (TR1FLUOROMETHYL)BENZYL]-2H-INDAZOLE This compound was prepared similarly to that of Example I. MS (ES) m/z 455.1. EXAMPLE 313 3-(4-CHLOROPHENYL)-2-(2,4-DIMETHYLBENZYL)-7-(TRIFLUOROMETHYL)- 2H-INDAZOLE This compound was prepared similarly to that of Example 1 MS(ES)m/z415.2. EXAMPLE 314 3-(4-CHLOROPHENYL)-2-(2,4-DIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)- 2H-INDAZOLE This compound was prepared similarly to that of Example 1, MS (ES)m/z 423.1. EXAMPLE 315 3-(4-CHLOROPHENYL)-2-(2-FLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H- INDAZOLE This compound was prepared similarly to that of Example 1. MS (ES)m/z 405.1. EXAMPLE 316 2-(4-CHLOROBENZYL)-3-(4-CHLOROPHENYL)-7-(TRIFLUOROMETHYL)-2H- INDAZOLE This compound was prepared similarly to that of Example 1. MS(ES)m/z421.1. EXAMPLE 317 2-(2-CHLOROBENZYL)-3-(4-CHLOROPHENYL)-7-(TRIFLUOROMETHYL)-2H- INDAZOLE This compound was prepared similarly to that of Example 1. MS(ES)m/z421.1. EXAMPLE 318 2-BENZYL-3-(2,4-DIFLUOROPHENYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 1. MS(ES)m/z389.2. EXAMPLE 319 3-(2,4-DIFLUOROPHENYL)-2-(2,4,6-TRIFLUOROBENZYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 1. MS (ES)m/z 443.1. EXAMPLE 320 3-(4-CHLOROPHENYL)-2-(3-METHOXYBENZYL)-7-(TRIFLUOROMETHYL)-2H- INDAZOLE This compound was prepared similarly to that of Example 1. MS(ESI)m/z417. EXAMPLE 321 3-(3-CHLOROPHENYL)-2-(2,4,6-TRIFLUOROBENZYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 1. MS (ES)m/z 441.1. EXAMPLE 322 2-(4-CHLORO-2-FLUOROBENZYL)-3-(3-CHLOROPHENYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example I. MS (ES)m/z 439.1. EXAMPLE 323 2-(2-CHLOROBENZYL)-3-(3-CHLOROPHENYL)-7-(TRIFLUOROMETHYL)-2H- INDAZOLE This compound was prepared similarly to that of Example 1 MS(ES)m/z421.1. EXAMPLE 324 2-(4-CHLOROBENZYL)-3-(3-CHLOROPHENYL)-7-(TRIFLUOROMETHYL)-2H- INDAZOLE This compound was prepared similarly to that of Example I. MS(ES)m/z421.1. EXAMPLE 325 3-(4-CHLOROPHENYL)-2-(3-METHYLBENZYL)-7-(TRIFLUOROMETHYL)-2H- INDAZOLE This compound was prepared similarly to that of Example 1. MS(ESI)m/z401. EXAMPLE 326 3-(4-CHLOROPHENYL)-2-(3-NITROBENZYL)-7-(TRIFLUOROMETHYL)-2H- INDAZOLE This compound was prepared similarly to that of Example I. MS (ESI) m/z 432. EXAMPLE 327 3-(4-CHLOROPHENYL)-2-(2-METHYLBENZYL)-7-(TRIFLUOROMETHYL)-2H- 1NDAZOLE This compound was prepared similarly to that of Example 1. MS (ESI) m/z 401. EXAMPLE 328 3-(4-CHLOROPHENYL)-2-(4-METHOXYBENZYL)-7-(TRIFLUOROMETHYL)-2H- INDAZOLE This compound was prepared similarly to that of Example 1. MS(ESI)m/z417. EXAMPLE 329 3-(4-CHLOROPHENYL)-2-(2,6-DICHLOROBENZYL)-7-(TRIFLUOROMETHYL)- 2H-INDAZOLE This compound was prepared similarly to that of Example 1. MS (ESI) m/z 455. EXAMPLE 330 2-(4-TERT-BUTYLBENZYL)-3-(4-CHLOROPHENYL)-7-(TRlFLUOROMETHYL)- 2H-INDAZOLE This compound was prepared similarly to that of Example . 1. MS (ESI) m/z 443. EXAMPLE 331 3-(3-CHLOROPHENYL)-2-(2-FLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H- INDAZOLE This compound was prepared similarly to that of Example 1. MS (ESI) m/z 405. EXAMPLE 332 3-(3-CHLOROPHENYL)-2-(2,4-DIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)- 2H-1NDAZOLE This compound was prepared similarly to that of Example I MS(ESI)m/z423. EXAMPLE 333 3-(3-CHLOROPHENYL)-2-(2,4-DIMETHYLBENZYL)-7-(TRIFLUOROMETHYL)- 2H-INDAZOLE This compound was prepared similarly to that of Example 1. MS(ESI)m/z415. EXAMPLE 334 3-(3-CHLOROPHENYL)-7-(TRIFLUOROMETHYL)-2-[4- (TRIFLUOROMETHYL)BENZYL]-2H-INDAZOLE This compound was prepared similarly to that of Example 1. MS(ESI)m/z455. EXAMPLE 335 3-(3-CHLOROPHENYL)-2-(3,4-DICHLOROBENZYL)-7-(TRIFLUOROMETHYL)- 2H-INDAZOLE This compound was prepared similarly to that of Example 1. MS (ESI) m/z 455. EXAMPLE 336 3-(3-CHLOROPHENYL)-2-(3,4-DIFLUOROBENZYL)-7-(TRl FLUOROM ETH Y D- 2H-INDAZOLE This compound was prepared similarly to that of Example 1. MS (ESI) m/z 423. EXAMPLE 337 3-(3-CHLOROPHENYL)-2-(3-METHOXYBENZYL)-7-(TRlFLUOROMETHYL)-2H- INDAZOLE This compound was prepared similarly to that of Example 1 MS(ESI)m/z417. EXAMPLE 338 3-(3-CHLOROPHENYL)-2-(3-METHYLBENZYL)-7-(TRIFLUOROMETHYL)-2H- INDAZOLE This compound was prepared similarly to that of Example 1. MS(ESI)m/z401. EXAMPLE 339 3-(3-CHLOROPHENYL)-2-(3-NITROBENZYL)-7-(TRIFLUOROMETHYL)-2H- INDAZOLE This compound was prepared similarly to that of Example 1. MS (ESI) m/z 432. EXAMPLE 340 3-(3-CHLOROPHENYL)-2-(2-METHYLBENZYL)-7-(TRIFLUOROMETHYL)-2H- INDAZOLE This compound was prepared similarly to that of Example 1. MS (ESI) m/z 401. EXAMPLE 341 (l-{4-[2-(2-METHYLBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YLJPHENYL} PIPERIDIN-3-YL)METHANOL This compound was prepared similarly to that of Example 149. MS (ESI) m/z 480. EXAMPLE 342 2-(2-FLUOROBENZYL)-3-[3-(4-METHYLPIPERIDIN-l-YL)PHENYL]-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 149. MS (ESI) m/z 468; EXAMPLE 343 (l-{3-[2-(3,4-DIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENYL} PIPERIDIN-3-YL)METHANOL This compound was prepared similarly to that of Example 149. MS (ESI) m/z 502. EXAMPLE 344 (l-{3-[2-(3-METHYLBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3- YL]PHENYL}PIPERlDIN-4-YL)METHANOL This compound was prepared similarly to that of Example 149. MS (ESI) m/z 480. EXAMPLE 345 (l-{4-[2-(2,4-DIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3- YL]PHENYL}PIPERIDIN-3-YL)METHANOL This compound was prepared similarly to that of Example 149. MS m/z 502. EXAMPLE 346 (1 -{4-[2-(2-METHYLBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3- YL]PHENYL}PIPERIDIN-4-YL)METHANOL This compound was prepared similarly to that of Example 149. MS (ESI) m/z 480. EXAMPLE 347 (l-{3-[2-(2,4-DIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3- YL]PHENYL}PIPERIDIN-4-YL)METHANOL This compound was prepared similarly to that of Example 149. MS (ESI) m/z 502. EXAMPLE 348 (i-{3-[2-(2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3- YL]PHENYL}PIPERIDIN-3-YL)METHANOL This compound was prepared similarly to that of Example 149. MS (ESI) m/z 520. EXAMPLE 349 (l-{3-[2-(2,4-DIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3- YL]PHENYL}PIPERIDIN-3-YL)METHANOL This compound was prepared similarly to that of Example 149. MS (ESI) m/z 502. EXAMPLE 350 (l-{3-[2-(3-METHYLBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3- YL]PHENYL}PIPERIDIN-3-YL)METHANOL This compound was prepared similarly to that of Example 149. MS (ESI) m/z 480. EXAMPLE 351 (l-{3-[2-(2,4,6-TRIFLUOROBENZYL)-7-(TR!FLUOROMETHYL)-2H-INDAZOL-3- YL]PHENYL}PIPERIDIN-4-YL)METHANOL This compound was prepared similarly to that of Example 149. MS (ESI) m/z 520. EXAMPLE 352 (l-{3-[2-(3,4-DIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YLJPHENYL} PIPERIDIN-4-YL)METHANOL This compound was prepared similarly to that of Example 149. MS (ESI) m/z 502. EXAMPLE 353 8-{4-[2-(2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENYL}-J ,4-DIOXA-8-AZASPIRO[4.5]DECANE This compound was prepared similarly to that of Example 149. MS (ESI) m/z 548. EXAMPLE 354 N-(2-PHENYLETHYL)-l-{4-[2-(2,4,6-TRIFLUOROBENZYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENYL}PIPERlDIN-4-AMINE This compound was prepared similarly to that of Example 149. MS (ESI) m/z 609. EXAMPLE 355 3.[4.(4-MORPHOLlN-4-YLPIPERIDIN-l-YL)PHENYL]-2-(2,4,6- TRIFLUOROBENZYL)-7-(TRlFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 149. MS (ES) m/z 575.0. EXAMPLE 356 7-{4-[2-(2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDA7.OL-3- YL]PHENYL}-l,4-DIOXA-7-AZASPIRO[4.5]DECANE This compound was prepared similarly to that of Example 149. MS (ES) m/z 548. EXAMPLE 357 7-{3-[2-(2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENYL}-l,4-DIOXA-7-AZASPIRO[4.5]DECANE This compound was prepared similarly to that of Example 149. MS (ES) m/z 548. EXAMPLE 358 8-{3-[2-(2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3- YL]PHENYL}-l,4-DIOXA-8-AZASPIRO[4.5]DECANE This compound was prepared similarly to that of Example 149. MS (ES) m/z 548. EXAMPLE 359 l-{3-[2-(2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YLJPHENYL} PIPERIDIN-4-ONE This compound was prepared similarly to that of Example 149. MS (ES) m/z 504.0. EXAMPLE 360 3-[3-(3-MORPHOLIN-4-YLPIPERlDIN-l-YL)PHENYL]-2-(2,4,6- TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 149. MS (ES) m/z 575.2. EXAMPLE 361 N-BUTYL-l-{4-[2-(2,4,6-TRlFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H- lNDAZOL-3-YL]PHENYL}PIPERIDIN-4-AMINE This compound was prepared similarly to that of Example 149. MS (ESI) m/z 561. EXAMPLE 362 N,N-DIPROPYL-l-{4-[2-(2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)- 2H-INDAZOL-3-YL]PHENYL}PIPERIDIN-4-AMINE This compound was prepared similarly to that of Example 149. MS (ES) m/z 589.2. EXAMPLE 363 N-PHENYL-l-{4-[2-(2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H- INDAZOL-3-YL]PHENYL}PIPERIDIN-4-AMINE This compound was prepared similarly to that of Example 149. MS (ESI) m/z 581. EXAMPLE 364 3. {4-[4-(4-METHYLPIPERAZIN-1 -YL)PIPERIDIN-1 -YLJPHENYL} -2-(2,4,6- TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-lNDAZOLE This compound was prepared similarly to that of Example 149. MS (ESI) m/z 588. EXAMPLE 365 N-(CYCLOHEXYLMETHYL)-l-{4-[2-(2,4,6-TRIFLUOROBENZYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENYL}PIPERIDIN-4-AMINE This compound was prepared similarly to that of Example 149. MS (ESI) m/z 601. EXAMPLE 366 N-PHENYL-l-{3-[2-(2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENYL}PIPERIDIN-4-AMINE This compound was prepared similarly to that of Example 149. MS(ESI)m/z581. EXAMPLE 367 N-(CYCLOHEXYLMETHYL)-l-{3-[2-(2,4,6-TRIFLUOROBENZYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENYL}PIPERIDIN-4-AMINE This compound was prepared similarly to that of Example 149. MS(ESI)m/z601. EXAMPLE 368 3_{3.[4.(4-METHYLPIPERAZIN-l-YL)PIPERIDIN-l-YL]PHENYL}-2-(2,4,6- TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 149. MS (ESI) m/z 588. EXAMPLE 369 N-BUTYL-l-{3-[2-(2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H- INDAZOL-3-YL]PHENYL}PIPERIDIN-4-AMINE This compound was prepared similarly to that of Example 149. MS (ESI) m/z 561. EXAMPLE 370 3-[3-(4-MORPHOLIN-4-YLPIPERIDIN-l-YL)PHENYL]-2-(2,4,6- TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 149. MS (ESI) m/z 575. EXAMPLE 371 N-(2-PHENYLETHYL)-l-{3-[2-(2,4,6-TRIFLUOROBENZYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENYL}PIPERIDIN-4-AMINE This compound was prepared similarly to that of Example 149. MS (ESI) m/z 609. EXAMPLE 372 N-ETHYL-N-METHYL-l-{3-[2-(2,4,6-TRIFLUOROBENZYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENYL}PIPERIDIN-4-AMINE This compound was prepared similarly to that of Example 149. MS (ESI) m/z 547. EXAMPLE 373 l-{3-[2-(2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YLJPHENYL} PIPERIDIN-4-OL This compound was prepared similarly to that of Example 149. MS (ESI) m/z 506. EXAMPLE 374 3-( 1 -BENZOTHIEN-2-YL)-2-(2,4,6-TRlFLUOROBENZYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOLE A solution of 3-bromo-5-trifluoroindazole (1.8 g, 9.3mmol) and 2,4,6-trifluorobenzyl bromide (2.1g, 9.3 mmol) in 20 mL DMF was heated at 110°C for 48 hours. The reaction mixture was partitioned with EtOAc and HjO. The organic phase was concentrated in vacua and the residue purified by flash chromatography (hexane-EtOAc: 9:1) to give the intermediate 2-(2,4,6-trifluorobenzyl-3-bromo-5-trifluoroindazole. Then a solution of 2-(2,4,6-trifluorobenzyl-3-bromo-5-trifluoroindazole (0.15 g, 0.37 mmol), 2-benzothiophene boronic acid (0.37 g, 0.21 mmol), palladium dichloro-diphenylphosphonoferrocenc (0.02 g. 0.024 mmol) and potassium phosphate (0.222 g, 1.05 mmol) in ethylene glycol dimethylether (10 mL) was heated at 84°C for 12 hours. The reaction mixture was partitioned with EtOAc and H2O. The organic phase was concentrated in vacua and the residue purified by flash chromatography (hexane-EtOAc. 10:1) to give the title compound MS (ES) m/z 463.0. EXAMPLE 375 3-(lH-INDOL-5-YL)-2-(2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)- 2H-INDAZOLE This compound was prepared similarly to that of Example 374. MS (ESI) m/z 446. EXAMPLE 376 S-DIBENZOtB.DJTHIEN^-YL^-CAe-TRIFLUOROBENZYLH- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 374. MS (ES) m/z 513.0. EXAMPLE 377 3-(2-NAPHTHYL)-2-(2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H- INDAZOLE This compound was prepared similarly to that of Example 374. MS (ES) m/z 457.1. EXAMPLE 378 3-[2-(2-FLUORO-4-METHOXYPHENYL)-lH-INDOL-6-YL]-2-(2,4,6- TRlFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 374. MS (ES) m/z 568.1. EXAMPLE 379 3-[ 1 -(2,4-DICHLOROBENZYL)-1 H-INDOL-5-YL]-2-(2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOLE A solution of 3-(lH-indol-5-yl)-2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyl)-2H-indazole (0.025 g, 0.056 mmol) and sodium hydride (60% in oil, 0.003 g, 0.07 mmol) in 1 mL DMF was stirred at ambient temperature under nitrogen for 20 minutes. 2,4-dichlorobenzyl bromide (0.081 g, 0.42 mmol) was added to the reaction mixture, which was stirred overnight and then partitioned between EtOAc and HjO. The organic phase was concentrated and purified by normal phase HPLC (silica, hexane-EtOAc, 4:1) to provide the title compound. MS (ES)m/z 604.0. EXAMPLE 380 : ; : 3-{l-[5<:HLORO-2-(TRIFLUOROMETHYL)BENZYL]-lH-INDOL-5-YL}-2-(2,4,6- TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 379. MS (ES)m/z 638.0. EXAMPLE 381 3-[l-(2-GHLOROBENZYL)-lH-INDOL-5-YL]-2-(2,4,6-TRIFLUOROBENZYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 379. MS (ES) m/z 570.0. EXAMPLE 382 3-[l-(2-FLUOROBENZYL)-lH-INDOL-5-YL]-2-(2,4,6-TRIFLUOROBENZYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 379. MS (ES) m/z 554.1. EXAMPLE 383 3-[l-(2,4-DIFLUOROBENZYL)-lH-INDOL-5-YL]-2-(2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 379. MS (ES) m/z 572. EXAMPLE 384 3-(l-BENZYL-lH-INDOL-5-YL)-2-(2,4,6-TRIFLUOROBENZYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 379. MS (ES) m/z 536.1. EXAMPLE 385 3-[l-(4-CHLOROBENZYL)-lH-INDOL-5-YL]-2-(2,4,6-TRIFLUOROBENZYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 379. MS (ES) m/z 570.0. EXAMPLE 386 3-[l-(2-CHLORO-6-FLUOROBENZYL)-lH-lNDOL-5-YL]-2-(2,4,6- TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 379. MS (ES) m/z 588.0. EXAMPLE 387 3-[l-(2,6-DICHLOROBENZYL)-lH-INDOL-5-YL]-2-(2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 379. MS (ES) m/z 604.0. EXAMPLE 388 3-[l-(2,6-DIFLUOROBENZYL)-lH-INDOL-5-YL]-2-(2,4,6-TRIFLUOROBENZYL)- 7-(TRIFLUbROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that, of Example 379. MS (ES) m/z 572.1. EXAMPLE 389 3-[l-(2-CHLORO-4-FLUOROBENZYL)-lH-INDOL-5-YL]-2-(2,4,6- TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 379. MS (ES)m/z 588.0. EXAMPLE 390 3-[l-(2-FLUOROBENZYL)-lH-INDOL-6-YL]-2-(2,4,6-TRIFLUOROBENZYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 379. MS (ES) m/z 554.0. EXAMPLE 391 3-[ 1 -(2,6-DIFLUOROBENZYL)-1 H-INDOL-6-YL]-2-(2,4,6-TRlFLUOROBENZYL)- 7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 379. MS (ES) m/z 572.1. EXAMPLE 392 3-[ 1-(2-CHLORO-4-FLUOROBENZYL)-1H-INDOL-6-YL]-2-(2;4,6- TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 379. MS (ES) m/z 588.0. EXAMPLE393 3-[ 1 -(2-CHLOROBENZYL)-! H-INDOL-6-YL]-2-(2,4,6-TRIFLUOROBENZYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 379. MS (ES) m/z 570.0. EXAMPLE 394 3-[l -(2-CHLORO-6-FLUOROBENZYL)-! H-INDOL-6-YL]-2-(2,4,6- TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 379. MS (ES) m/z 588.0. EXAMPLE 395 3-[l-(2,4-DIFLUOROBENZYL)-lH-INDOL-6-YL]-2-(2,4,6-TRIFLUOROBENZYL)- 7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 379. MS (ES) m/z 572.1. EXAMPLE 396 3-[l-(2,6-DICHLOROBENZYL)-lH-INDOL-6-YL]-2-(2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 379. MS (ES) m/z 601.9. EXAMPLE 397 3-[ 1 -(4-CHLOROBENZYL)-1 H-lNDOL-6-YL]-2-(2,4,6-TRIFLUOROBENZYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 379. MS (ES) m/z 570.0. EXAMPLE 398 3-{l-[5-CHLORO-2-(TRIFLUOROMETHYL)BENZYL]-lH-INDOL-6-YL}-2-(2,4,6- TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 379. MS (ES)m/z 638.1. EXAMPLE 399 3-(l-BENZYL-lH-INDOL-6-YL)-2-(2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROME THYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 379. MS (ES) m/z 536.1. EXAMPLE 400 3-[l-(2,4-DICHLOROBENZYL)-lH-INDOL-6-YL]-2-(2,4,6-TRIFLUOROBENZYL)- 7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 379. MS (ES) m/z 604.0. EXAMPLE 401 3-[2-(2,4,6-TRIFLUOROBENZYL)-7-(TRlFLUOROMETHYL)-2H-INDAZOL-3- YLJPHENOL This compound was prepared similarly to that of Example 379. MS (ES) m/z 423.1. EXAMPLE 402 2-{[3-[l-(2,6-DICHLOROBENZYL)-lH-INDOL-6-YL]-7-(TRIFLUOROMETHYL)- 2H-INDAZOL-2-YL]METHYL}-3,5-DIFLUOROPHENOL This compound was prepared similarly to that of Example 379. MS (ES) m/z 603.1. EXAMPLE 403 2-{[3-[l-(2-CHLORO-6-FLUOROBENZYL)-lH-INDOL-6-YL]-7- (TRIFLUOROMETHYL)-2H-INDAZOL-2-YL]METHYL}-3,5-DIFLUOROPHENOL This compound was prepared similarly to that of Example 379. MS (ES)m/z 586.1. EXAMPLE 404 N,N-DIMETHYL-4-{3-[l-(2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)- lH-INDAZOL-3-YL]PHENOXY}BENZENESULFONAMIDE A solution of 3-[2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyI)-lH-indazol-3-yl]phenol (0.09 g, 0.21 mmol, prepared similarly to that of Example 1), 4-fluoro-N,N-dimeihyl-benzenesulfonamide (0.087 g, 0.42 mmol) and potassium carbonate (0.06 g, 0.42 mmol) in 1 mL DMF was heated at 150°C for 3 hours, and then partitioned between EtOAc and I-bO. The organic phase was concentrated and purified by normal phase chromatography (silica, hexane-EtOAc, 4:1) to provide the title compound. MS (ES) m/z 605.8. EXAMPLE 405 3-{3-[4-(MORPHOLIN-4-YLSULFONYL)PHENOXY]PHENYL}-2-(2,4,6- TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 404. MS (ES) m/z 648. EXAMPLE 406 N-PROPYL-4-{3-[2-(2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H- INDAZOL-3-YL]PHENOXY}BENZENESULFONAMIDE This compound was prepared similarly to that of Example 404. MS (ESI) m/z 620. EXAMPLE 407 3_{3.[4.(PYRROLIDIN-l-YLSULFONYL)PHENOXY]PHENYL}-2-(2,4,6- TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 404. MS (ES) m/z 632.2. EXAMPLE 408 3. (3-[4-(PIPERIDIN-1 -YLSULFONYL)PHENOXY]PHENYL} -1 -(2,4,6- TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-1H-INDAZOLE This compound was prepared similarly to that of Example 404. MS (ESI) m/z 646. EXAMPLE 409 N,N-DIETHYL-4-{3-[l-(2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)- lH-INDAZOL-3-YL]PHENOXY}BENZENESULFONAMIDE This compound was prepared similarly to that of Example 404. MS (ES) m/z 634.3. EXAMPLE 410 N-ETHYL-N-METHYL-4-{3-[l-(2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-1H-INDAZOL-3-YL]PHENOXY}BENZENESULFONAMIDE This compound was prepared similarly to that of Example 404. MS (ES) m/z 620.3. EXAMPLE 411 7-FLUORO-2-(4-FLUOROBENZYL)-3-(4-FLUOROPHENYL)-2H-INDAZOLE This compound was made in a similar manner as for Example 1. MS (ESI) m/z 339. EXAMPLE 412 7-FLUORO-2-(2-FLUOROBENZYL)-3-(4-FLUOROPHENYL)-2H-INDAZOLE This compound was made in a similar manner as for Example 1 MS (ESI) m/z 339. EXAMPLE 413 2-(2,4-DlFLUOROBENZYL)-7-FLUORO-3-(4-FLUOROPHENYL)-2H-INDAZOLE This compound was made in a similar manner as for Example 1. MS (ESI) m/z 357. EXAMPLE 414 2-(3,4-DIFLUOROBENZYL)-7-FLUORO-3-(4-FLUOROPHENYL)-2H-INDAZOLE This compound was made in a similar manner as for Example 1. MS (ESI) m/z 357. EXAMPLE 415 2-(4-CHLOROBENZYL)-7-FLUORO-3-(4-FLUOROPHENYL)-2H-INDAZOLE This compound was made in a similar manner as for Example 1. MS (ESI) m/z 355. EXAMPLE 416 7-CHLORO-2-(4-CHLOROBENZYL)-3-(4-FLUOROPHENYL)-2H-INDAZOLE This compound was made in a similar manner as for Example 1. MS (ESI) m/z 371. EXAMPLE 417 7-CHLORO-2-(4-FLUOROBENZYL)-3-(4-FLUOROPHENYL)-2H-INDAZOLE This compound was made in a similar manner as for Example 1. MS (ESI) m/z 355. EXAMPLE 418 7-CHLORO-2-(3,4-DIFLUOROBENZYL)-3-(4-FLUOROPHENYL)-2H-INDAZOLE This compound was made in a similar manner as for Example 1. MS (ESI) m/z 373. EXAMPLE 419 7-CHLORO-2-(2,4-DIFLUOROBENZYL)-3-(4-FLUOROPHENYL)-2H-INDAZOLE This compound was made in a similar manner as for Example 1. MS (ESI) m/z 373. EXAMPLE 420 7-CHLORO-2-(2-FLUOROBENZYL)-3-(4-FLUOROPHENYL)-2H-INDAZOLE This compound was made in a similar manner as for Example 1. MS (ESI) m/z 355. EXAMPLE 421 l-[2-(2,4-DIFLUOROBENZYL)-3-(4-FLUOROPHENYL)-2H-INDAZOL-7- YL]PIPERIDINE-4-CARBOXAMIDE This compound was made in a similar manner as for Example 149. MS (ESI) m/z 465. EXAMPLE 422 2-(2,4-DIFLUOROBENZYL)-3-(4-FLUOROPHENYL)-7-MORPHOLIN-4-YL-2H- INDAZOLE This compound was made in a similar manner as for Example 149. MS (ESI) m/z 424. EXAMPLE423 2-(2,4-DIFLUOROBENZYL)-3-(4-FLUOROPHENYL)-7-PIPERIDIN-1-YL-2H-INDAZOLE This compound was made in a similar manner as for Example 149. MS(ESI)m/z422. EXAMPLE 424 2-(2,4-DIFLUOROBENZYL)-3-(4-FLUOROPHENYL)-N,N-DIMETHYL-2H- INDAZOL-7-AMINE This compound was made in a similar manner as for Example 149. MS (ESI) m/z 382. EXAMPLE 425 2-(2,4-DIFLUOROBENZYL)-N-ETHYL-3-(4-FLUOROPHENYL)-2H-INDAZOL-7- AMINE This compound was made in a similar manner as for Example 149. MS (ESI) m/z 382. EXAMPLE 426 2-(2,4-DIFLUOROBENZYL)-3-(4-FLUOROPHENYL)-7-PYRROLIDIN-l-YL-2H- INDAZOLE This compound was made in a similar manner as for Example 149. mp 112-114°C; MS (ESI) m/z 408. EXAMPLE 427 2-(2,4-DIFLUOROBENZYL)-3-(4-FLUOROPHENYL)-2H-rNDAZOLE-7- CARBONITRILE This compound was made in a similar manner as for Example 149. MS (ESI) m/z 364. EXAMPLE 428 7-CHLORO-2-(2,4-DICHLOROBENZYL)-3-(4-FLUOROPHENYL)-2H-INDAZOLE This compound was made in a similar mariner as for Example I. MS (ES)m/z 405.1. EXAMPLE 429 7-CHLORO-2-(2-CHLORO-4-FLUOROBENZYL)-3-(4-FLUOROPHENYL)-2H- INDAZOLE This compound was made in a similar manner as for Example 1. MS (ES)m/z 389.1. EXAMPLE 430 7-CHLORO-2-(2-CHLORO-6-FLUOROBENZYL)-3-(4-FLUOROPHENYL)-2H- INDAZOLE This compound was made in a similar manner as for Example 1. MS(ES)m/z389.1. EXAMPLE 431 7-CHLORO-2-(2,6-DIFLUOROBENZYL)-3-(4-FLUOROPHENYL)-2H-INDAZOLE This compound was made in a similar manner as for Example I. MS (ES)m/z 373.1. EXAMPLE 432 7-CHLORO-3- (4-FLUOROPHENYL)-2-(2,4,6-TRIFLUOROBENZYL)-2H- 1NDAZOLE This compound was made in a similar manner as for Example 1. MS (ES)m/z 391.1. EXAMPLE 433 7-CHLORO-2-(2,4-DIMETHYLBENZYL)-3-(4-FLUOROPHENYL)-2H-INDAZOLE This compound was made in a similar manner as for Example 1. MS (ES) m/z 365.2. EXAMPLE 434 2-(2,4-DIFLUOROBENZYL)-3-PYRIDIN-2-YL-7-(TRIFLUOROMETHYL)-2H- INDAZOLE Picolinic acid (12.3 g, 100 mmol), N,N-carbonyldiimidazole (17.8 g, 110 mmol) and anhydrous CH2Cl2 (150 mL) were combined and stirred at room temperature for 60 minutes. To the reaction mixture was added a solution of jV.O-dimethylhydroxylamine hydrochloride (10.7 gr, 0.11 mole), anhydrous CH2CI2 (50 mL) and diisopropylethylamine (20mL), and stirring continued overnight. The reaction mixture was concentrated in vacua and purified by flash chromatography (silica gel 60, MeOH/ CH2Cl2, 9:1) to afford pyridine-2-carboxylic acid methoxy-methyl-amide ( a pale yellow Jiquid, 15.9 g, 95%); ESI) m/z 167. Then a solution of pyridine-2-carboxylic acid methoxy-methyl-amide (1.5 g, 9 mmoles) was allowed to react with 2-flouro-3-trifluoromethylphenylmagnesium bromide (2.72 g, 10 mmoles) in THF (30 mL) at 60°C overnight. The reaction mixture was cooled and diluted with ethyl acetate and ammonium chloride. The organic portion was washed with brine and dried over MgSCU and stripped to afford a crude product, which was purified by chromatography with CH2C12 to give (6-fluoro-5-trifluoromethyl-cyclohexa-2,4-dienyl)-pyridin-2-yl-methanone as a colorless liquid (1.6 gr., 65%). Next, a solution of (6-fluoro-5-trifluoromethyl-cyclohexa-2,4-dienyl)-pyridin-2-yl-methanone (1.5 g, 5.6 mmol), 4-dimethylaminopyridine (0.5 g) and hydrazine hydrate (5 mL) in pyridine (20 mL) was heated at 100°C overnight. The reaction mixture was cooled and diluted with brine and EtOAc. The organics were washed with water (3x 25 mL), then brine (25 mL) and dried over MgSO-i. The reaction mixture was concentrated in vacua and purified by flash chromatography (silica gel 60, EtOAc/ CH2Cl2, 19:1) to afford 3-pyridin-2-yl-7-(trifluoromethyl)-2H-indazole as a pale yellow solid (1.1 g, 76 Then a solution of 3-pyridin-2-yl-7-(trifluoromethyl)-2H-indazole (0.183 g, 0.7 mmol) and 2,4,6-trifluorobenzyl bromide (0.203 g, 0.9 mmol) in DMF (5 mL) was heated at 120°C. After 5 days, the reaction mixture was partitioned with EtOAc and water. Organics were washed with water (3x), then brine and dried over MgSC>4, then stripped and the resulting crude product was flashed by reverse phase HPLC to afford the title compound (0.033 g, 5 %). MS m/z 390. EXAMPLE 43 5 2-(2-CHLORO-4-FLUOROBENZYL)-3-(PYRIDIN-2-YLMETHYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was made in a similar manner as for Example 434. MS (ESI) m/z 420. EXAMPLE436 2-(2,4-DIFLUOROBENZYL)-3-(PYRIDIN-2-YLMETHYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was made in a similar manner as for Example 434. MS (ESI) m/z 404. EXAMPLE 437 2-(2-CHLORO-6-FLUOROBENZYL)-3-(PYRIDIN-2-YLMETHYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was made in a similar manner as for Example 434. MS (ESI) m/z 420. EXAMPLE 438 2-(2,6-DIFLUOROBENZYL)-3-(PYRIDIN-2-YLMETHYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was made in a similar manner as for Example 434. MS (ESI) m/z 404. EXAMPLE 439 3-(PYRIDIN-2-YLMETHYL)-2-(2,4,6-TRIFLUOROBENZYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was made in a similar manner as for Example 434. MS (ESI) m/z 422. EXAMPLE 440 2-(2,6-DICHLOROBENZYL)-3-(PYRIDIN-2-YLMETHYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was made in a similar manner as for Example 434. MS (ESI) m/z 436. EXAMPLE 441 2-(2,6-DIFLUOROBENZYL)-3-PYRIDIN-2-YL-7-(TRIFLUOROMETHYL)-2H- INDAZOLE This compound was made in a similar manner as for Example 434. MS (ES) m/z 390.1. EXAMPLE 442 2-(2-METHYLPHENYL)-3-PYRIDIN-2-YL-7-(TRIFLUOROMETHYL)-2H- INDAZOLE A solution of 3-pyridin-2-yl-7-(trifluoromethyl)-2H-indazole (0.2633 g, 1 mmol), 2-methylphenylboronic acid (0.271 g, 2 mmol, copper(II)acetate (0.181 g, 1 mmol) and pyridine (0.161 mL, 2 mmol) in 20 mL of methylene chloride was stirred at ambient temperature for 2 hours. The reaction mixture was concentrated in vacua and purified by flash chromatography (silica gel 60, methylene chloride-ethyl acetate, 3:1) to give the title compound (0.08 g). MS (ES) m/z 354.0. EXAMPLE 443 3-(4-BROMOPHENYL)-2-(2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)- 2H-INDAZOLE This compound was made in a similar manner as for Example I. MS m/z 485. EXAMPLE 444 {3-[2-(2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YL] PHENYLJAMINE Combined, in a large microwave vial were 3-(3-chlorophenyl)-2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyl)-2H-indazole (1.0 g, 2.3 mmol), benzophenone-diphenylimine (0.500 g, 2.8 mmol), sodium /-butoxide (0.260 mg, 2.8 mmoles), tris dibenzylideneacetone-dipalladium (0.150 g, 0.16 mmoles), dicyclohexyl-dimethylamino-biphenyl (0.25 g, 0.63 mmol) and dimethoxyethane (8 mL), which were then ran in a microwave (Emory's Optimizer, Personal Chemistry) at 150°C for 10 minutes. The reaction mixture was diluted with ethyl acetate and water; then the organics were washed with water and brine and dried over magnesium sulfate. The solvent was removed and the crude material purified by flash chromatography (silica 60, 10 % ethyl acetate/hexane) to afford N-(diphenylmethylene)-N-{3-[2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyl)-2H- indazol-3-yl]phenyl}amine as a pale yellow solid (0.82 gr, 62%). Then a solution of N-(diphenyImethylene)-N-{3-[2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyl)-2H- indazoI-3-yl]phenyl}amine (0.77 g, 1.31 mmol) in methanol (10 mL) was treated with sodium acetate (0.25 g, 3 mmol) and hydroxylamine hydrochloridc (0.15 g, 2.2 mmol), and stirred at room temperature for 2 hours. The methanol was evaporated and the residue slurried in ether, the inorganic solid filtered off, and the ether stripped to afford crude product, which was purified by flash chromatography (silica 60. 10 % hexane/ethyl acetate) to afford the title compound (0.28 g, 50 %). MS (ESI) m/z 422. EXAMPLE 445 {4-[2-(2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3- YL]PHENYL}AMINE This compound was made in a similar manner as for Example 444. MS (ES) m/z 422.0. EXAMPLE 446 N-ISOBUTYL-N'-{4-[2-(2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3 -YLJPHENYL} UREA This compound was made in a similar manner as for Example 258. MS m/z 521; MS m/z 519. EXAMPLE 447 N-(PIPERIDIN-4-YLMETHYL)-N'-{4-[2-(2,4,6-TRIFLUOROBENZYL)-7- (TRTFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENYL}UREA This compound was made in a similar manner as for Example 258. MS m/z 560. EXAMPLE 448 N-(2-METHOXYBENZYL)-N'-{4-[2-(2,4,6-TRIFLUOROBENZYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENYL}UREA This compound was made in a similar manner as for Example 258. MS m/z 585; MS m/z 583. EXAMPLE 449 N,N-DIPROPYL-N'-{4-[2-(2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)- 2H-INDAZOL-3-YL]PHENYL}UREA This compound was made in a similar manner as for Example 258. MS m/z 549; MS m/z 547. EXAMPLE 450 N-(TETRAHYDROFURAN-2-YLMETHYL)-N'-{4-[2-(2,4,6-TRIFLUOROBENZYL)- 7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENYL}UREA This compound was made in a similar manner as for Example 258. MS (ESI) m/z 549; MS (ESI) m/z 547. EXAMPLE 451 N-(4-BROMOPHENYL)-N'-{4-[2-(2,4,6-TRIFLUOROBENZYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENYL}UREA This compound was made in a similar manner as for Example 258. MS (ESI) m/z 619; MS (ESI) m/z 617. EXAMPLE 452 N-(PYRIDIN-4-YLMETHYL)-N'-{4-[2-(2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHEN YL} UREA This compound was made in a similar manner as for Example 258. MS (ESI) m/z 556; MS (ESI) m/z 554. EXAMPLE453 2-(2,4-DICHLOROBENZYL)-3-PYRIDIN-2-YL-7-(TRIFLUOROMETHYL)-2H- INDAZOLE This compound was made in a similar manner as for Example 434. MS (ES) m/z 421.9. EXAMPLE 454 2-(2,4-DIMETHYLBENZYL)-3-PYRIDIN-2-YL-7-(TRIFLUOROMETHYL)-2H- INDAZOLE This compound was made in a similar manner as for Example 434. MS (ES) m/z 382.0. EXAMPLE 455 3-PYRIDIN-2-YL-2-(2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H- INDAZOLE This compound was made in a similar manner as for Example 434. MS (ES) m/z 407.9. EXAMPLE 456 2-(2-CHLOROBENZYL)-3-PYRIDIN-2-YL-7-(TRIFLUOROMETHYL)-2H- INDAZOLE This compound was made in a similar manner as for Example 434. MS (ES) m/z 387.9. EXAMPLE 457 2-(4-CHLOROBENZYL)-3-PYRIDIN-2-YL-7-(TRIFLUOROMETHYL)-2H- INDAZOLE This compound was made in a similar manner as for Example 434. MS (ES) m/z 387.9. EX AMPLE 45 8 2-(2-CHLORO-6-FLUOROBENZYL)-3-PYRIDIN-2-YL-7-(TRIFLUOROMETHYL)- 2H-INDAZOLE This compound was made in a similar manner as for Example 434. MS (ES) m/z 405.9. EXAMPLE 459 2-(2-CHLORO-4-FLUOROBENZYL)-3-PYRIDIN-2-YL-7-(TRIFLUOROMETHYL)- 2H-INDAZOLE This compound was made in a similar manner as for Example 434. MS (ES) m/z 405.9. EXAMPLE 460 N-(2-FLUOROPHENYL)-N'-{3-[2-(2,4,6-TRIFLUOROBENZYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENYL}UREA This compound was made in a similar manner as for Example 258. MS (ES) m/z 556.8. EXAMPLE 461 N-(2-CHLOROPHENYL)-N'-{4-[2-(2,4,6-TRIFLUOROBENZYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENYL}UREA This compound was made in a similar manner as for Example 258. MS (ES) m/z 572.8. EXAMPLE 462 N-PHENYL-N'-{3-[2-(2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENYL} UREA This compound was made in a similar manner as for Example 258. MS (ES) m/z 538.8. EXAMPLE 463 N-(2-CHLOROPHENYL)-N'-{3-[2-(2,4,6-TRIFLUOROBENZYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENYL}UREA This compound was made in a similar manner as for Example 258. MS (ES) m/z 572.8. EXAMPLE 464 N-(2-FLUOROPHENYL)-N'-{4-[2-(2,4,6-TRIFLUOROBENZYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENYL}UREA This compound was made in a similar manner as for Example 258. MS (ES) m/z 556.8. EXAMPLE 465 N-PHENYL-N'-{4-[2r.(2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENYL} UREA This compound was made in a similar manner as for Example 258. MS (ES) m/z 538.8. EXAMPLE 466 3-(4-PIPERAZIN-l-YLPHENYL)-2-(2,4,6-TRIFLUOROBENZYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was made in a similar manner as for Example 149. MS (ES) m/z 491.0. EXAMPLE 467 3-[4-(4-BENZOYLPIPERAZIN-l-YL)PHENYL]-2-(2,4,6-TRIFLUOROBENZYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOLE Combined in a vial were 3-(4-piperazin-l-ylphenyl)-2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyl)-2H- indazole (0.10 g, 0.2. .mmol), benzoyl chloride (0.030 g, 0.22 mmol), and diisopropylethylamuie (0.2 mL) and THF (2 mL), which were stirred overnight at room temperature. Then the reaction mixture was diluted with ethyl acetate and water, and the organics washed with water and brine, then dried over magnesium sulfate. The crude product was purified by flash chromatography (silica 60, 5 % EtOAc/CH2Cl2) to provide the title compound (0.06 g, 50 %). MS (ESI) m/z 595. EXAMPLE 468 3-{4-[4-(2-CHLOROBENZOYL)PIPERAZIN-l-YL]PHENYL}-2-(2,4,6- TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was made in a similar manner as for Example 467. MS (ESI) m/z 629. EXAMPLE 469 3. {4-[4-(2-THIENYLCARBONYL)PIPERAZIN-1 -YLJPHENYL} -2-(2,4,6- TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was made in a similar manner as for Example 467. MS(ES)m/z601.0. EXAMPLE 470 3.{4_[4.(2-METHOXYBENZOYL)PIPERAZIN-l-YL]PHENYL}-2-(2,4,6- TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was made in a similar manner as for Example 467. MS (ES)m/z 625.1. EXAMPLE 471 3-{4-[4-(3-METHOXYBENZOYL)PIPERAZIN-l-YL]PHENYL}-2-(2,4,6- TRIFLUOROBENZYL)-7-(TRlFLUOROMETHYL)-2H-INDAZOLE This compound was made in a similar manner as for Example 467. MS (ES)m/z 625.1. EXAMPLE 472 3-{4-[4-(4-METHOXYBENZOYL)PIPERAZIN-l-YL]PHENYL}-2-(2,4,6- TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was made in a similar manner as for Example 467. MS (ES)m/z 625.1. EXAMPLE 473 3-(4-CHLOROPYRIDIN-2-YL)-7-(TRIFLUOROMETHYL)-1H-INDAZOLE This compound was made in a similar manner as for Example 434. MS (ESI) m/z 298. EXAMPLE 474 N-(2,5-DIFLUOROBENZYL)-2-[2-(2,4-DIFLUOROBENZYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PYRIDIN-4-AMINE This compound was made in a similar manner as for Example 444. MS(ESI)m/z531. EXAMPLE 475 2-[2-(2,4-DIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]-N- (2,5-DIMETHYLBENZYL)PYRIDIN-4-AMINE This compound was made in a similar manner as for Example 444. MS.(ES)rri/z52I.2. EXAMPLE 476 N-(3,5-DIFLUOROBENZYL)-2-[2-(2,4-DIFLUOROBENZYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PYRIDIN-4-AMINE This compound was made in a similar manner as for Example 444. MS (ES)m/z 529.1. EXAMPLE 477 N-(lH-INDOL-5-YLMETHYL)-3-[2-(2,4,6-TRIFLUOROBENZYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]ANILINE A solution of ({3-[2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]phenyl}amine (0.1 g, 0.24 mmol), indole 5-carboxaldehyde (0.035 g, 0.24 mmol), sodium formate (0.189 g, 3 mmol) and sodium cyanoborohydride (0.188 g, 3 mmol) in methanol (3 mL) was heated at 60°C overnight. The reaction mixture was cooled, and concentrated in vacua. The residue was partitioned with ethyl acetate and ammonium hydroxide. The organic phase was concentrated in vacua to afford crude product, which was purified by flash chromatography (silic gel 60, methylene chloride) to afford the title compound (0.031 g, 24 %). MS(ES)m/z551.2. EXAMPLE 478 N-[( 1 -METHYL-1 H-INDOL-5-YL)METHYL]-3-[2-(2,4,6-TRIFLUOROBENZYL)-7- (TRIFLUOROMETHYL)-2H-lNDAZOL-3-YL]ANILINE This compound was made in a similar manner as for Example 477. MS (ES) m/z 565.2. EXAMPLE 479 {3-[2-(2,4-DIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3- YL]PHENYL}AMINE This compound was made in a similar manner as for Example 444. MS (ES) m/z 404.1. EXAMPLE 480 {3-[2-(2,4-DIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENYL}[(1-METHYL-lH-INDOL-2-YL)METHYL]AMINE This compound was made in a similar manner as for Example 477. MS (ESI) m/z 547; MS (ESI) m/z 545. EXAMPLE 481 N-(2-FLUORO-4-METHOXYBENZYL)-3-[2-(2,4,6-TRIFLUOROBENZYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]ANILINE This compound was made in a similar manner as for Example 477. MS (ESI) m/z 560. EXAMPLE 482 N-(2,5-DIMETHYLBENZYL)-3-[2-(2,4,6-TRIFLUOROBENZYL>7- (TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]ANILINE This compound was made in a similar manner as for Example 477. MS (ES) m/z 540.2. EXAMPLE 483 N-[2-FLUORO-5-(TRIFLUOROMETHYL)BENZYL]-3-[2-(2,4,6- TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]ANILINE This compound was made in a similar manner as for Example 477. MS (ESI) m/z 598. EXAMPLE 484 N-[2-FLUORO-3-(TRIFLUOROMETHYL)BENZYL]-3-[2-(2,4,6- TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]ANILINE This compound was made in a similar manner as for Example 477. MS (ESI) m/z 598. EXAMPLE 485 N-(2,5-DIMETHYLBENZYL)-4-[2-(2,4,6-TRIFLUOROBENZYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]ANILINE This compound was made in a similar manner as for Example 477. MS (ESI) m/z 540. EXAMPLE 486 N-[2-FLUORO-5-(TRIFLUOROMETHYL)BENZYL]-4-[2-(2,4,6- TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]ANILlNE This compound was made in a similar manner as for Example 477. MS (ES) m/z 596.2. EXAMPLE 487 N-(PYRIDIN-2-YLMETHYL)-3-[2-(2,4,6-TRIFLUOROBENZYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]ANILINE This compound was made in a similar manner as for Example 477. MS (ES) m/z 513.1. EXAMPLE 488 N-(lH-INDOL-7-YLMETHYL)-3-[2-(2,4,6-TRIFLUOROBENZYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]ANILINE This compound was made in a similar manner as for Example 477. MS (ES)m/z 549.2. EXAMPLE 489 N-(PYRIDIN-3-YLMETHYL)-3-[2-(2,4,6-TRIFLUOROBENZYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]ANILINE This compound was made in a similar manner as for Example 477. MS(ES)m/z513.1. EXAMPLE 490 N-(lH-INDOL-4-YLMETHYL)-3-[2-(2,4,6-TRIFLUOROBENZYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]ANILINE This compound was made in a similar manner as for Example 477. MS (ES)m/z 551.1. EXAMPLE 491 N-(PYRIDIN-4-YLMETHYL)-3-[2-(2,4,6-TRIFLUOROBENZYL)-7- (TRIFLUOROMETHYL)-2H-lNDAZOL-3-YL]ANILINE This compound was made in a similar manner as for Example 477. MS (ES)m/z 513.1. EXAMPLE 492 N-[(5-CHLORO-2-THIENYL)METHYL]-3-[2-(2,4,6-TRIFLUOROBENZYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]ANILINE This compound was made in a similar manner as for Example 477. MS (ES)m/z 552.0. EXAMPLE 493 N-[(5-BROMO-2-THIENYL)METHYL]-3-[2-(2,4,6-TRIFLUOROBENZYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]ANILINE This compound was made in a similar manner as for Example 477. MS (ES) m/z 596.0. EXAMPLE 494 N-[(4-BROMO-2-THIENYL)METHYL]-3-[2-(2,4,6-TRIFLUOROBENZYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]ANILINE This compound was made in a similar manner as for Example 477. MS (ES) m/z 596.0. EXAMPLE 495 N-[(5-METHYL-2-THIENYL)METHYL]-3-[2-(2,4,6-TRIFLUOROBENZYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]ANILINE This compound was made in a similar manner as for Example 477. MS (ES) m/z 532.1. EXAMPLE 496 N-[(3-METHYL-2-THIENYL)METHYL]-3-[2-(2,4,6-TRIFLUOROBENZYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]ANILINE This compound was made in a similar manner as for Example 477. MS (ES) m/z 532.1. EXAMPLE 497 N-[(l-ETHYL-lH-lNDOL-5-YL)METHYL]-3-[2-(2,4,6-TRIFLUOROBENZYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]ANILINE This compound was made in a similar manner as for Example 477. MS (ES) m/z 579.1. EXAMPLE 498 N-[(l-PROPYL-JH-INDOL-5-YL)METHYL]-3-[2-(2,4,6-TRIFLUOROBENZYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]ANILINE This compound was made in a similar manner as for Example 477. MS (ES)m/z 593.1. EXAMPLE 499 N-[( 1-BUTYL-1 H-INDOL-5-YL)METHYL]-3-[2-(2,4,6-TRIFLUOROBENZYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]ANILINE This compound was made in a similar manner as for Example 477. MS (ESI) m/z 607. EXAMPLE 500 N-[(3-METHYL-1 -BENZOTHIEN-2-YL)METH YL]-3-[2-(2,4,6- TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]ANILINn This compound was made in a similar manner as for Example 477. MS (ES) m/z 582.0. EXAMPLE 501 N-[(2-METHYL-l H-IMlDAZOL-5-YL)METHYL]-3-[2-(2,4,6- TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]ANILINE This compound was made in a similar manner as for Example 477. MS (ES) m/z 514.0. EXAMPLE 502 N-(2-NAPHTHYLMETHYL)-3-[2-(2,4,6-TRIFLUOROBENZYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]ANILINE This compound was made in a similar manner as for Example 477. MS (ES) m/z 562.0. EXAMPLE 503 N-tO-SEC-BUTYL-lH-INDOL-S-YLJMETHyLj-S-p^^^-TRIFLUOROBENZYL)- 7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]ANILINE This compound was made in a similar manner as for Example 477. MS (ES)m/z 607.1. EXAMPLE 504 N-[(l-ISOPROPYL-lH-INDOL-5-YL)METHYL]-3-[2-(2,4,6-TRIFLUOROBENZYL)- 7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]ANILINE This compound was made in a similar manner as for Example 477. MS (ES) m/z 593.2. EXAMPLE 505 3-(4-ETHYNYLPHENYL)-2-(2,4,6-TRIFLUOROBENZYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was made in a similar manner as for Example 229 MS (ES) m/z 431.1. EXAMPLE 506 ETHYL 3-({4-[2-(2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H- INDAZOL-3-YL]PHENYL}ETHYNYL)BENZOATE This compound was made in a similar manner as for Example 229. MS (ES) m/z 579.1. EXAMPLE 507 3-({4-[2-(2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENYL}ETHYNYL)BENZOIC ACID This compound was made in a similar manner as for Example 229. MS (ESI) m/z 551. EXAMPLE 508 TERT-BUTYL4-[3-({4-[2-(2s4,6-TRIFLUQROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENYL} ETHYNYL)BENZOYL]PIPERAZINE-1 -CARBOXYLATE This compound was made in a similar manner as for Example 229. MS(ES)m/z719.2. EXAMPLE 509 3-(4-{[2-CHLORO-5-(TRIFLUOROMETHYL)PHENYL]ETHYNYL}PHENYL)-2- (2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was made in a similar manner as for Example 229. 'H NMR (CDC13): 5 5.70 (2H, s), 6.58-6.65 (2H, m), 7.21 (1H, t, J=2.7 Hz), 7.51-7.56(3H, m), 7.59-7.63 (2H, m), 7.68-7.70 (1H, d, J=8.5 Hz), 7.76-7.78 (2H, m), 7.88 (lH,d,J=2.1Hz). EXAMPLE 510 3-{4-[(2,4-DIFLUOROPHENYL)ETHYNYL]PHENYL}-2-(2,4,6- TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was made in a similar manner as for Example 229. 'H NMR (CDC13): 5 5.70 (2H, s), 6.58-6.63 (2H, m), 6.89-6.95 (2H, m), 7.09-7.13 (1H, m), 7.48-7.54 (3H, m), 7.58-7.62 (1H, m), 7.67-7.74 (3H, m). EXAMPLE 511 3-{4-[(3,5-DIMETHYLPHENYL)ETHYNYL]PHENYL}-2-(2,4,6- TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was made in a similar manner as for Example 229. 'H NMR (CDC13): 5 2.34 (6H, s), 5.70 (2H, s), 6.58-6.64(2H, m), 7.02 (1H, s), 7.09-7.13 (1H, m), 7.22 (2H, s), 7.47 (2H, d, J=7.9 Hz), 7.61 (1H, d, J=7.9 Hz), 7.69 (3H, m). EXAMPLE 512 3-{4-[(3-CHLORO-2-FLUOROPHENYL)ETHYNYL]PHENYL}-2-(2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was made in a similar manner as for Example 229. 'H NMR (CDC13): 8 5.70 (2H, s), 6.57-6.64(2H, m), 7.09-7.14 (2H, m), 7.40-7.49 (2H, m), 7.51 (2H, d, J=8.1 Hz), 7.62 (1H, d, J=7.0 Hz), 7.69 (1H, d, J=8.5 Hz), 7.74 (2H, dd, J=6.6Hz,J=1.6Hz). EXAMPLE 513 3-{4-[(2,3-DICHLOROPHENYL)ETHYNYL]PHENYL}-2-(2,4,6- TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was made in a similar manner as for Example 229. 'H NMR (CDC13): 8 5.70 (2H, s), 6.58-6.64(2H, m), 7.10-7.14 (1H, m), 7.21-7.25 (2H, m), 7.46-7.54 (3H, m), 7.62 (1H, d, J=7.1 Hz), 7.69 (1H, d, J=8.4 Hz), 7.76 (2H, dd, J=6.7Hz,J=1.8Hz). EXAMPLE 514 3-{4-[(2,3-DIMETHYLPHENYL)ETHYNYL]PHENYL}-2-(2,4,6- TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was made in a similar manner as for Example 229. 'H NMR (CDC13): 8 2.33 (3H, s), 2.51 (3H, s), 5.70 (2H, s), 6.58-6.65(2H, m), 7.10-7.16 (3H, m), 7.42 (1H, d, J=7.4 Hz), 7.48-7.52 (2H, m), 7.61-763 (1H, m), 7.70-7.74 (3H, m). EXAMPLE 515 5-{3-[2-(4-CHLORO-2-FLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H- INDAZOL-3-YL]PHENOXY}-3,4-DIHYDRONAPHTHALEN-l(2H)-ONE This compound was made in a similar manner as for Example 3. MS (ES)m/z 565.1. EXAMPLE 516 3-(3-BROMOPHENYL)-2-(4-CHLORO-2-FLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was made in a similar manner as for Example 1. MS (ES) m/z 482.9. EXAMPLE 517 3-(3-BROMOPHENYL)-2-(2-CHLORO-4-FLUOROBENZYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was made in a similar manner as for Example 1. MS (ES) m/z 482.9. EXAMPLE 518 2-BENZYL-3-PHENYL-2H-INDAZOLE-7-CARBOXYLIC ACID METHOXY- METHYL-AMIDE 2-Benzyl-3-phenyl-7-trifluoromethyl-2H-indazole (353 mg, 1 mmol), prepared similarly to that of Example 1, was treated with 3 ml of 70% aq H2SO4 at 90 °C for 4 hours. After cooling, 10 volumes of water were added and the product was extracted with dichloromethane. Flash column chromatography (SiC>2, dichloromethane as an eluant) afforded 2-benzyl-3-phenyl-2H-indazole-7-carboxylic acid in 60% yield. The 2-benzyl-3-phenyl-2H-indazole-7-carboxylic acid (1.64 g, 5 mmol) was dissolved in 20 ml of pyridine followed by addition of l-(-3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (1.34 g, 7 mmol) and N, O-dimethyhydroxylamine hydrochloride (585 mg, 6 mmol). The reaction mixture was stirred at room temperature overnight. Pyridine was evaporated and the residue was shaken with 0.5M aq HC1 and dichloromethane. The product was extracted with dichloromethane, and flash column chromatography (SiC>2, dichloromethane as an eluant) afforded 2-benzyl-3-phenyl-2H-indazole-7-carboxylic acid methoxy-methyl-amide in 79% yield. LCMS: M+H: 372.2. EXAMPLE 519 1-(2-BENZYL-3-PHENYL-2H-INDAZOL-7-YL)ETHANONE 2-Benzyl-3-phenyI-2H-indazole-7-carboxylic acid (0.5 mmol, 160 mg, see preparation of Example 518) was dissolved in 5ml of dry THF at 0 °C. Two milliliters (2ml) of MeLi (1.6M solution in THF) were added dropwise and the mixture was stirred overnight at room temperature. The reaction mixture was quenched with aq NH4C1 solution and the product was extracted with EtOAc, and then flash column chromatography (SiO2, dichloromethane as an eluant) afforded l-(2-benzyl-3-phenyl-2H-indazol-7-yl)ethanone in 61% yield. LCMS: M+H: 327.5. EXAMPLE 520 2-(2-BENZYL-3-PHENYL-2H-INDAZOL-7-YL)PROPAN-2-OL Ninety milligrams (90 mg; 0.24 mmol) of 2-benzyl-3-phenyl-2H-indazole-7-carboxyIic acid methyl ester, prepared from 2-benzyl-3-phenyl-2H-indazole-7-carboxylic acid (sec-preparation of Example 518), were dissolved in THF and 0.5 ml of 3M MeMgBr in THF (1.4 mmol) were added. The reaction mixture was stirred at room temperature for 2 hours. The reaction mixture was quenched with aq NH4C1 solution and product was extracted with EtOAc, and then flash column chromatography (SiOa, dichloromethane as an eluant) afforded 2-(2-benzyl-3-phenyl-2H-indazol-7-yl)propan-2-ol in 86% yield. LCMS: M+H: 343.4. EXAMPLE 521 2-BENZYL-7-ISOPROPENYL-3-PHENYL-2H-INDAZOLE Fifty milligrams (50 mg; 0.15 mmol) of 2-(2-benzyI-3-phenyl-2H-indazol-7-yl)propan-2-ol (Example 52.0) were dissolved in 2 ml of toluene followed by the addition of 11 mg of TsOH. The mixture was heated at 110°C for 1 hour. After cooling, the resulting solution was filtered through SiC>2 plug affording, after evaporation, 45 mg of pure 2-benzyl-7-isopropenyl-3-phenyl-2H-indazo!e. Yield: 94%. LCMS: M+H: 325.4. EXAMPLE 522 2-BENZYL-7-ISOPROPYL-3-PHENYL-2H-INDAZOLE Thirty milligrams (30 mg; 0.092 mmol) of 2-benzyl-7-isopropenyl-3-phenyl-2H-indazole (Example 521) were dissolved in 2 ml of dry ethanol followed by the addition of 30 mg of PtO2. The reaction mixture was stirred under Fb atmosphere at room temperature for 2 hours, then filtered and the EtOH evaporated. Flash column chromatography (SiO2, dichloromethane/heptane, 1:1, as an eluant) afforded 2-benzyl-7-isopropyl-3-phenyl-2H-indazole in 80% yield. LCMS: M+H: 327.5. EXAMPLE 523 2-BENZYL-3-{3-[(2,5-DIFLUOROPHENOXY)METHYL]PHENYL}-7- (TRIFLUOROMETHYL)-2H-INDAZOLE Thirty-eight milligrams (38 mg; 0.1 mmol) of [3-(2-benzyl-7-trifluoromethyl-2li-indazol-3-yl)-phenyl]-methanol (see preparation of Example 7) were dissolved in 1 ml of dichloromethane followed by the addition of 28 ul of Et3N (0.2 mmol). The mixture was cooled to -30°C and 12 ul of MsCl were added. Stirring continued at 0°C for 1.5 hours. To the resulting solution, 85 mg of Cs2CC>3 (0.25 mmol) were added followed by the addition of 65 mg (0.5 mmol) of 2,5-difluorophenol. Then the reaction mixture was stirred at room temperature overnight. The reaction mixture was quenched with 1M aq HC1 and product was extracted with dichloromethane. Flash column chromatography (SiC>2, dichloromethane/heptane ,1:1, as an eluant) afforded 2-benzyl-3-{3-[(2.5-difluorophenoxy)methyl]phenyl}-7-(trifluoromethyl)-2H-indazole in 41% yield. LCMS: M+H: 495.8. EXAMPLE 524 N-BENZYL-3-({3-[2-(4-CHLORO-.2-FLUOROBENZYL)-7-(TRlFLUOROMETHYU- 2H-INDAZOL-3-YL]PHENOXY}METHYL)BENZAMIDE Fifty-seven milligrams (57 mg; 0.1 mmol) of 3-[3-(2-(4-chloro-2-fluorobenzyl)-7-(trifluoromethyl)—2H-indazol-3-yl)-phenoxymethyl]-benzoic acid methyl ester (prepared similarly to that of 4-[4-(2-benzyl-7-trifluoromethyl-2H-indazol-3-yl)-phenoxymeth> I]-benzoic acid methyl ester in preparation of Example 2) were dissolved in 2 ml of dry THF followed by the addition of 110 ul of bcnzylamine (1 mmol). The reaction mixture was cooled to -30°C and 450 ul of 2M solution of butylmagnesiumbromide in ether were added dropwise. Then the reaction mixture was stirred for 30 min at -30°C and left overnight at 0°C. The reaction mixture was quenched with aq Nf-LjCl solution and product was extracted with EtOAc. Flash column chromatography (SiOj, dichloromethane as an eluant) afforded N-benzyl-3-({3-[2-(4-chloro-2-fluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3-yl]phenoxy}methyl)benzamide in 66% yield. LCMS: M+H: 644.6. EXAMPLE 525 2-BENZYL-3-[4-(BENZYLOXY)PHENYL]-7-(TRIFLUOROMETHYL)-2H- INDAZOLE 4-(2-Benzyl-7-trifluoromethyl-2H-indazole-3-yl)-phenol (10 mg, 1 eq) was treated with benzylbromide (10 uL, 3 eq) and potassium carbonate (19 mg, 5 eq) in acetone (I mL). The reaction mixture was heated at 60°C until completion of the reaction, as judged by TLC. Volatiles were removed in vacua and the residue treated with a water / dichloromethane mixture followed by extraction with dichloromethane. Purification by flash chromatography (silica, ethyl acetate / n-heptane, 1:9) gave the title compound in 89 % yield. LCMS: M+H: 459.5. EXAMPLE 526 2-[4-({4-[2-BENZYL-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3- YL]PHENOXY}METHYL)PHENYL]PROPANOICACID The title compound was prepared by treating 4-(2-benzyl-7-trifluoromethyl-2H-indazole-3-yl)-phenol (20 mg, 1 eq) with 2-(4-bromomethyl-phenyl)-propionic acid (39 mg, 3 eq) and potassium carbonate (37 mg, 5 eq) in DMF (2 mL) at 150°C overnight. After cooling, water was added and the pH adjusted to 1 (aq. HC1, 2M) followed by extraction with dichloromethane. Purification by preparative HPLC gave the desired product in 45 % yield. LCMS: M+H: 531.5. EXAMPLE 527 , l-[4-({3-[2-BENZYL-7-(TRIFLUOROMETHYL)-2H-iNDAZOL-3- YL]PHENOXY}METHYL)PHENYL]CYCLOPENTANECARBOXYLICACID This compound was prepared similarly to that of Example 525 by treating 3-(2-benzyl-7-trifluoromethyl-2H-indazoIe-3-yl)-phenol (20 mg, 1 eq) with l-(4-bromomethyl-phenyl)-cyclopentanecarboxylic acid methyl ester (48 mg, 3 eq) and potassium carbonate (37 mg, 5 eq) in acetone (1.5 mL). The latter reagent was obtained by heating 1-p-tolyl-cyclopentanecarboxylic acid in methanol and a catalytic amount of sulphuric acid. Subsequent a-bromination was accomplished by refluxing the ester (100 mg, 1 eq) with NBS (82 mg, 1 eq) and benzoyl peroxide (5 mg, 3 %) in carbon tetrachloride (2 mL) for one hour. The reaction mixture was cooled, water was added and product extracted with dichloromethane. The residue was purified by flash chromatography (ethyl acetate / n-heptane, 1:9, as an eluent). Then the resulting compound was hydrolyzed with aq LiOH (1M, 40 eq) / THF 1:1 and purified by preparative HPLC, affording the desired product in 48 % yield. LCMS:M+H:571.4. EXAMPLE 528 2-[4-({3-[2-BENZYL-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENOXY}METHYL)PHENYL]-2-METHYLPROPANOIC ACID This compound was prepared similarly to that of Example 525 by treating 3-(2-benzyl-7-trifluoromethyl-2H-indazole-3-yl)-phenol (23 mg, 1 eq) with 2-(4-bromomethyl-phenyl)-2-methyl-propionic acid methyl ester (17 mg, 1 eq) and potassium carbonate (26 mg. 3 eq) in acetone (2 mL). The latter reagent was obtained by heating p-tolyl-acetic acid in methanol and a catalytic amount of sulphuric acid. Subsequent methylation was accomplished by treating the obtained ester (50 mg, 1 eq) with sodium hydride (26 mg. 2.2 eq) and methyl iodide (41 uL, 2.2 eq) in THF (1 mL). Then a-bromination \\as accomplished by refluxing the ester (16 mg, 1 eq) with NBS (15 mg, 1 eq) and benzovl peroxide (1 mg, 3 %) in carbon tetrachloride (1.5 mL) overnight. The reaction mixture was cooled, water was added and product extracted with dichloromethane. The residue was purified by flash chromatography (ethyl acetate / n-heptane,l:9, as an eluent). Then the resulting compound was then hydrolyzed with aq LiOH (1M, 40 eq) / THF. 1:1. and purified by preparative HPLC, affording the desired product in 26 % yield. LCMS: M+H: 545.3. EXAMPLE 529 2-BENZYL-3-(3-{[4-(lH-TETRAZOL-5-YL)BENZYL]OXY}PHENYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOLE 4-({3-[2-Benzyl-7-(trifluoromethyl)-2H-indazol-3-yl]phenoxy}methyl)benzonitrile (37 mg, 1 eq) was treated with trimethylsilyl azide (21 uL, 2 eq) and di-n-butyltin oxide (5 mg, 0.3 eq) in toluene (2.5 mL) at 100°C until full conversion. After cooling, most of the solvent was removed in vacua and the residue was taken in methanol. Purification by flash chromatography, eluent 10 % methanol in dichloromethane, afforded the title compound in 87 % yield. LCMS: M+H: 527.6, M-H: 525.8. EXAMPLE 530 (4-[3-(2-BENZYL-7-TRIFLUOROMETHYL-2H-INDAZOL-3-YL)-PHENOXYMETHYL]-BENZYL}-PHOSPHONIC ACID MONOETHYL ESTER {4-[3-(2-Benzyl-7-trifluoromethyl-2H-indazoI-3-yl)-phenoxymethyl]-benzyl}-phosphonic acid diethyl ester was obtained by a similar procedure to that described for Example 525. It was dissolved (45 mg, 1 eq) in acetonitrile (2 mL) and treated with bromotrimethylsilane (48 uL, 5 eq) at room temperature for two hours. The reaction mixture was quenched with water and concentrated. Purification by preparative HP1.C provided the title compound in 35 % yield. LCMS: M+H: 581.3, M-H: 579.5. EXAMPLE 531 {3-[2-(4-CHLORO-2-FLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENOXY}(PHENYL)ACETIC ACID 3-[2-(4-Chloro-2-fluoro-benzyl)-7-trifluoromethyl-2H-indazol-3-yl]-phenol (25 mg, 1 eq) was treated with bromo-phenyl-acetic acid methyl ester (41 mg, 3 eq) and cesium carbonate (95 mg, 5 eq) in dichloromethane (2 mL) until the reaction mixture was completed as judged by TLC. Water was added followed by extraction with dichloromethane. Subsequently, the ester was hydrolyzed in aq. LiOH (1M. 15 eq) / Tl IF 1:1. Purification by flash chromatography, eluent: 2-5 % methanol in dichloromethane, afforded the title compound in 55 % yield. LCMS: M+H: 555.2, M-H: 553.4. EXAMPLE 532 2-(4-CHLORO-2-FLUOROBENZYL)-3-[3-(2-PHENYLETHYL)PHENYL]-7- (TRIFLUOROMETHYL)-2H-INDAZOLE To a suspension of benzyl-phosphonic acid diethyl ester (20 uL, 1 eq) and sodium hydride (6 mg, 1.5 eq) in DMPU (0.5 mL), 3-[2-(4-chloro-2-fluoro-benzyl)-7-trifluoromethyl-2H-indazol-3-yl]-benzaldehyde (45 mg, 1 eq) was added. The reaction mixture was stirred for 45 minutes at room temperature, quenched with water and extracted with diethyl ether. The volatiles were removed and the residue purified by flash chromatography (silica, ethyl acetate / n-heptane, 2:8). The product obtained was dissolved in ethanol (2 mL) and hydrogenated at 1 atm using 7 % platinum.oxide as a catalyst. Filtration through Celite® and flash chromatography, eluent: dichloromethane / n-hepatane, 1:1, furnished the title compound in 11 % overall yield. LCMS: M+H: 509.3. EXAMPLE 533 2-BENZYL-3-ETHYL-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 1. LCMS: M+H: 305.6. EXAMPLE 534 3-(4-BROMOPHENYL)-2-METHYL-7-(TRIFLUOROMETHYL)-2H-INDAZOL[- This compound was prepared similarly to that of Example 1. LCMS: M+H: 355.1. EXAMPLE 535 2-(4-CHLORO-2-FLUOROBENZYL)-3-{3-[(2,3-DIMETHYLPHENOXY) METHYL]PHENYL}-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 523. LCMS: M+H: 539.6. EXAMPLE 536 2-(4-CHLORO-2-FLUOROBENZYL)-3-(3-{[2-CHLORO-5-(TRIFLUOROMETHYL)PHENOXY]METHYL}PHENYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 523. LCMS: M+H: 613.1. EXAMPLE 537 2-(4-CHLORO-2-FLUOROBENZYL)-3-(3-{[2-CHLORO-3-(TRIFLUOROMETHYL)PHENOXY]METHYL}PHENYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 523. LCMS: M+H: 613.1. EXAMPLE 538 2-(4-CHLORO-2-FLUOROBENZYL)-3-{3-[(l- NAPHTHYLOXY)METHYL]PHENYL}-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 523. LCMS: M+H: 561.2. EXAMPLE 539 3-{3-[(2-TERT-BUTYL-5-METHYLPHENOXY)METHYL]PHENYL}-2-(4- CHLORO-2-FLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 523. LCMS: M+H: 581.3. EXAMPLE 540 2-(4-CHLORO-2-FLUOROBENZYL)-3-{3-[(4-FLUORO-2- METHYLPHENOXY)METHYL]PHENYL}-7-(TRIFLUOROMETHYL)-2H- INDAZOLE This compound was prepared similarly to that of Example 523. LCMS: M+II: 543.5. EXAMPLE 541 2-(4-CHLORO-2-FLUOROBENZYL)-3-{3-[(2,6- DIMETHYLPHENOXY)METHYL]PHENYL}-7-(TRIFLUOROMETHYL)-2H- INDAZOLE This compound was prepared similarly to that of Example 523. LCMS: M+H: 539.6. EXAMPLE 542 5-({3-[2-(4-CHLORO-2-FLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H- INDAZOL-3-YL]BENZYL}OXY)-3,4-DIHYDRONAPHTHALEN-l(2H)-ONE This compound was prepared similarly to that of Example 523. LCMS: M+II: 579.5. EXAMPLE 543 2-(4-CHLORO-2-FLUOROBENZYL)-3-(3-{[(3,3-DIMETHYL-2,3-DIHYDRO-l-BENZOFURAN-7-YL)OXY]METHYL}PHENYL)-7-(TRFFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 523. LCMS: M+H: 581.3. EXAMPLE 544 3-{3-[(2-TERT-BUTYLPHENOXY)METHYL]PHENYL}-2-(4-CHLORO-2- FLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 523. LCMS: M+H: 567.2. EXAMPLE 545 2-(4-CHLORO-2-FLUOROBENZYL)-3-{3-[(2,3- DIMETHOXYPHENOXY)METHYL]PHENYL}-7-(TRIFLUOROMETHYL)-2H- INDAZOLE This compound was prepared similarly to that of Example 523. LCMS: M+H: 571.1. EXAMPLE 546 2-(4-CHLORO-2-FLUOROBENZYL)-3-{3-[(2,6- DICHLOROPHENOXY)METHYL]PHENYL}-7-(TRIFLUOROMETHYL)-2H- INDAZOLE This compound was prepared similarly to that of Example 523. LCMS: M+H: 579.5. EXAMPLE 547 2-(4-CHLORO-2-FLUOROBENZYL)-3-{3-[(2,6- DIMETHOXYPHENOXY)METHYL]PHENYL}-7-(TRIFLUOROMETHYL)-2H- 1NDAZOLE This compound was prepared similarly to that of Example 523. LCMS: M+H: 571.1. EXAMPLE 548 2-(4-CHLORO-2-FLUOROBENZYL)-3-{3-[(2,6- DIBROMOPHENOXY)METHYL]PHENYL}-7-(TRIFLUOROMETHYL)-2H- INDAZOLE This compound was prepared similarly to that of Example 523. LCMS: M+H: 669.2. EXAMPLE 549 3-{3-[(2-ALLYL-6-METHYLPHENOXY)METHYL]PHENYL}-2-(4-CHLORO-2- FLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 523. LCMS: M+H: 565.7. EXAMPLE 550 2-(4-CHLORO-2-FLUOROBENZYL)-3-{3-[(2,6- DIISOPROPYLPHENOXY)METHYL]PHENYL}-7-(TRIFLUOROMETHYL)-2H- INDAZOLE This compound was prepared similarly to that of Example 523. LCMS: M+H: 595.4. EXAMPLE 551 3-{3-[(2-TERT-BUTYL-6-METHYLPHENOXY)METHYL]PHENYL}-2-(4- CHLORO-2-FLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 523. LCMS: M+H: 581.3. EXAMPLE 552 3-{3-[(2-ALLYL-6-METHOXYPHENOXY)METHYL]PHENYL}-2-(4-CHLORO-2- FLUOROBENZYL)-7-(TRlFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 523. LCMS: M+H: 581.3. EXAMPLE 553 2-(4-CHLORO-2-FLUOROBENZYL)-3-{3-[(2,5- DICHLOROPHENOXY)METHYL]PHENYL}-7-(TRIFLUOROMETHYL)-2H- INDAZOLE This compound was prepared similarly to that of Example 523. LCMS: M+H: 579.5. EXAMPLE 554 2-(4-CHLORO-2-FLUOROBENZYL)-3-{3-[(2,6- DIFLUOROPHENOXY)METHYL]PHENYL}-7-(TRIFLUOROMETHYL)-2H- INDAZOLE This compound was prepared similarly to that of Example 523. LCMS: M+H: 547.4. EXAMPLE 555 3-({3-[2-(4-CHLORO-2-FLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H- INDAZOL-3-YL]PHENOXY}METHYL)-N-PROPYLBENZAMIDE This compound was prepared similarly to that of Example 524. LCMS: M+H: 596.3. * EXAMPLE 556 3-({3-[2-(4-CHLORO-2-FLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H- INDAZOL-3-YL]PHENOXY}METHYL)-N-CYCLOPROPYLBENZAMIDE This compound was prepared similarly to that of Example 524. LCMS: M+H: 594.5. EXAMPLE 557 2-(4-CHLORO-2-FLUOROBENZYL)-3-(3-{[3-(MORPHOLIN-4-YLCARBONYL)BENZYL]OXY}PHENYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 524. LCMS: M+H: 624.5. EXAMPLE 558 3-({3-[2-(4-CHLORO-2-FLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENOXY}METHYL)-N-ISOPROPYLBENZAMIDE This compound was prepared similarly to that of Example 524. LCMS: M+H: 596.3. EXAMPLE 559 {4-[3-(2-BENZYL-7-TRIFLUOROMETHYL-2H-INDAZOL-3-YL)-PHENYLAMINO]-PHENYL}-ACETIC ACID This compound was prepared similarly to that of Example 4. LCMS: M+H: 502.4, 2M+H: 1003.7, M-H: 500.5, 2M-H: 1002.0. EXAMPLE 560 (4-[4-(2-BENZYL-7-TRIFLUOROMETHYL-2H-INDAZOL-3-YL)-PHENYLAMINO]-PHENYL}-ACETIC ACID This compound was prepared similarly to that of Example 4. LCMS: M+H: 502.4, M-H: 500.6. EXAMPLE 561 3-{4-[4-(2-BENZYL-7-TRIFLUOROMETHYL-2H-INDAZOL-3-YL)-PHENYLAMINO]-PHENYL}-PROPIONIC ACID This compound was prepared similarly to that of Example 4. LCMS: M+H: 516.8, M-H: 514.4. EXAMPLE 562 3-{4-[3-(2-BENZYL-7-TRlFLUOROMETHYL-2H-INDAZOL-3-YL)-PHENYLAMINO]-PHENYL}-PROPIONIC ACID This compound was prepared similarly to that of Example 4. LCMS: M+H: 516.8, M-H: 514.4. EXAMPLE 563 3-{3-[4-(2-BENZYL-7-TRIFLUOROMETHYL-2H-INDAZOL-3-YL)- PHENYLAMINO]-PHENYL}-PROPIONICACID This compound was prepared similarly to that of Example 4. LCMS: M+H: 516.8, M-H: 514.4. EXAMPLE 564 3-{3-[3-(2-BENZYL-7-TRIFLUOROMETHYL-2H-INDAZOL-3-YL)-PHENYLAMINO]-PHENYL}-PROPIONIC ACID This compound was prepared similarly to that of Example 4. LCMS: M+H: 516.8, M-H: 514.4. EXAMPLE 565 2-{4-[4-(2-BENZYL-7-TRIFLUOROMETHYL-2H-lNDAZOL-3-YL)- PHENYLAMINO]-PHENOXY}-2-METHYL-PROPIONICACID This compound was prepared similarly to that of Example 4. LCMS: M+H: 546.8, M-H: 544.4. EXAMPLE 566 2-{4-[3-(2-BENZYL-7-TRIFLUOROMETHYL-2H-INDAZOL-3-YL)-PHENYLAM1NOJ-PHENOXY} -2-METHYL-PROPIONIC ACID This compound was prepared similarly to that of Example 4. LCMS: M+H: 546.8, M-H: 544.4. EXAMPLE 567 2-(4-{[4-(2-BENZYL-7-TRIFLUOROMETHYL-2H-INDAZOL-3-YL)-PHENYLAMiNO]-METHYL}-PHENYL)-PROPIONIC ACID This compound was prepared similarly to that of Example 4. LCMS: M+H: 530.3, M-H: 528.5. EXAMPLE 568 {4-[4-(2-BENZYL-7-TRIFLUOROMETHYL-2H-INDAZOL-3-YL)-PHENYLAMINO]-PHENYL}-ACETIC ACID ETHYL ESTER This compound was prepared similarly to that of Example 4. LCMS: M+H: 530.3, M-H: 528.5. EXAMPLE 569 3-{3-[4-(2-BENZYL-7-TRIFLUOROMETHYL-2H-INDAZOL-3-YL)-PHENYLAMINO]-PHENYL}-PROPIONIC ACID METHYL ESTER This compound was prepared similarly to that of Example 4. LCMS: M+H: 530.3, M-H: 528.5. EXAMPLE 570 3-{3-[3-(2-BENZYL-7-TRIFLUOROMETHYL-2H-INDAZOL-3-YL)-PHENYLAMINO]-PHENYL}-PROPIONIC ACID METHYL ESTER This compound was prepared similarly to that of Example 4. LCMS: M+H: 530.3, M-H: 528.5. EXAMPLE 571 2-{4-[4-(2-BENZYL-7-TRIFLUOROMETHYL-2H-INDAZOL-3-YL)-PHENYLAMINO]-PHENOXY}-2-METHYL-PROPIONIC ACID METHYL ESTER This compound was prepared similarly to that of Example 4. LCMS: M+H: 560.3, M-H: 558.5. EXAMPLE 572 2-{4-[3-(2-BENZYL-7-TRIFLUOROMETHYL-2H-INDAZOL-3-YL)-PHENYLAMINO]-PHENOXY}-2-METHYL-PROPIONIC ACID METHYL ESTER This compound was prepared similarly to that of Example 4. LCMS: M+H: 560.3, M-H: 558.5. EXAMPLE 573 2-(4- {[4-(2-BENZYL-7-TRIFLUOROMETH YL-2H-INDAZOL-3-YL)- PHENYLAMINO]-METHYL}-PHENYL)-PROPIONIC ACID METHYL ESTER This compound was prepared similarly to that of Example 4. LCMS: M+H: 544.4, M-H: 542.6. EXAMPLE 574 2-(4-{[3-(2-BENZYL-7-TRIFLUOROMETHYL-2H-INDAZOL-3-YL)-PHENYLAMINO]-METHYL}-PHENYL)-PROPIONIC ACID METHYL ESTER This compound was prepared similarly to that of Example 4. LCMS: M+H: 544.4, M-H: 542.6. EXAMPLE 575 2-(4-{[3-(2-BENZYL-7-TRIFLUOROMETHYL-2H-INDAZOL-3-YL)- PHENYLAMINOJ-METHYL}-PHENYL)-PROPIONICACID This compound was prepared similarly to that of Example 4. LCMS: M+H: 530.3, M-H: 528.5. EXAMPLE 576 3-{3-[3-(2-BENZYL-7-TRIFLUOROMETHYL-2H-INDAZOL-3-YL)-PHENYLAMINO]-PHENYL}-BUTYRIC ACID METHYL ESTER This compound was prepared similarly to that of Example 4. LCMS: M+H: 544.4, M-H: 542.6. EXAMPLE 577 3-{4-[3-(2-BENZYL-7-TRIFLUOROMETHYL-2H-INDAZOL-3-YL)-PHENYLAMINO]-PHENYL}-BUTYRIC ACID METHYL ESTER This compound was prepared similarly to that of Example 4. LCMS: M+H: 544.4, M-H: 542.6. EXAMPLE 578 (4-{[3-(2-BENZYL-7-TRIFLUOROMETHYL-2H-INDAZOL-3-YL)-PHENYLAMINO]-METHYL}-PHENYL)-ACETIC ACID METHYL ESTER This compound was prepared similarly to that of Example 4. LCMS: M+H: 530.3, M-H: 528.5. EXAMPLE 579 {3-[4-(2-BENZYL-7-TRIFLUOROMETHYL-2H-INDAZOL-3-YL)-PHENYLAM1NOJ-PHENYL}-ACETIC ACID METHYL ESTER This compound was prepared similarly to that of Example 4. LCMS: M+H: 516.5, M-H: 514.4. EXAMPLE 580 {3-[3-(2-BENZYL-7-TRIFLUOROMETHYL-2H-INDAZOL-3-YL)-PHENYLAMINOJ-PHENYL}-ACETIC ACID METHYL ESTER This compound was prepared similarly to that of Example 4. LCMS: M+H: 516.5, M-H: 514.4. EXAMPLE 581 3-{3-[3-(2-BENZYL-7-TRIFLUOROMETHYL-2H-INDAZOL-3-YL)- PHENYLAMINO]-PHENYL}-BUTYRICACID This compound was prepared similarly to that of Example 4. LCMS: M+H: 530.3, M-H: 528.5. EXAMPLE 582 3-{4-[3-(2-BENZYL-7-TRIFLUOROMETHYL-2H-INDAZOL-3-YL)- PHENYLAMINO]-PHENYL}-BUTYRICACID This compound was prepared similarly to that of Example 4. LCMS: M+H: 530.3, M-H: 528.5. EXAMPLE 583 {3-[3-(2-BENZYL-7-TRIFLUOROMETHYL-2H-INDAZOL-3-YL)-PHENYLAMINOJ-PHENYL}-ACETIC ACID This compound was prepared similarly to that of Example 4. LCMS: M+H: 502.4, M-H: 500.6. EXAMPLE 584 {3-[4-(2-BENZYL-7-TRIFLUOROMETHYL-2H-INDAZOL-3-YL)-PHENYLAMINO]-PHENYL}-ACETIC ACID This compound was prepared similarly to that of Example 4. LCMS: M+H: 502.4, M-H: 500.6. EXAMPLE 585 (4-{[3-(2-BENZYL-7-TRIFLUOROMETHYL-2H-INDAZOL-3-YL)-PHENYLAMINO]-METHYL} -PHENYL)-ACETIC ACID This compound was prepared similarly to that of Example 4. LCMS: M+H: 516.5, M-H: 514.4. EXAMPLE 586 3-(2-BENZYL-7-TRIFLUOROMETHYL-2H-INDAZOL-3-YL)-PHENYLAMINB This compound was prepared similarly to that of Example 4. LCMS: M+H: 368.3, M-H: 366.6. EXAMPLE 587 4-(2-BENZYL-7-TRIFLUOROMETHYL-2H-INDAZOL-3-YL)-PHENYLAMINE This compound was prepared similarly to that of Example 4. LCMS: M+H: 368.3, M-H: 366.1. EXAMPLE 588 (3-{[4-(2-BENZYL-7-TRIFLUOROMETHYL-2H-INDAZOL-3-YL)-PHENYLAMINO]-METHYL}-PHENYL)-ACETIC ACID ETHYL ESTER This compound was prepared similarly to that of Example 4. LCMS: M+H: 544.4, M-H: 542.6. EXAMPLE 589 (3-{[3-(2-BENZYL-7-TRIFLUOROMETHYL-2H-INDAZOL-3-YL)-PHENYLAMINO]-METHYL}-PHENYL)-ACETIC ACID ETHYL ESTER This compound was prepared similarly to that of Example 4. LCMS: M+H: 544.4, M-H: 542.6. EXAMPLE 590 l-(4-{[4-(2-BENZYL-7-TRIFLUOROMETHYL-2H-INDAZOL-3-YL)-PHENYLAMINOJ-METHYL} -PHENYL)-CYCLOPROPANEC ARBOX Y LIC AC ID ETHYL ESTER This compound was prepared similarly to that of Example 4. LCMS: M+H: 566.1, M-H: 554.3. EXAMPLE 591 l-(4-{[3-(2-BENZYL-7-TRIFLUOROMETHYL-2H-INDAZOL-3-YL)-PHENYLAM1NO]-METHYL}-PHENYL)-CYCLOPROPANECARBOXYLIC ACID METHYL ESTER This compound was prepared similarly to that of Example 4. LCMS: M+H: 566.1, M-H: 554.3. EXAMPLE 592 (3-{[4-(2-BENZYL-7-TRIFLUOROMETHYL-2H-INDAZOL-3-YL)-PHENYLAMINO]-METHYL}-PHENYL)-ACETIC ACID This compound was prepared similarly to that of Example 4. LCMS: M+H: 516.8, M-H: 514.4. EXAMPLE 593 (3-{[3-(2-BENZYL-7-TRIFLUOROMETHYL-2H-INDAZOL-3-YL)-PHENYLAMINO]-METHYL}-PHENYL)-ACETIC ACID This compound was prepared similarly to that of Example 4. LCMS: M+H: 516.5, M-H: 514.4. EXAMPLE 594 l-(4-{[3-(2-BENZYL-7-TRIFLUOROMETHYL-2H-INDAZOL-3-YL)-PHENYLAMINO]-METHYL}-PHENYL)-CYCLOPROPANECARBOXYLIC ACID This compound was prepared similarly to that of Example 4. LCMS: M+H: 542.6, M-H: 540.5. EXAMPLE 595 2-{3-[4-(2-BENZYL-7-TRIFLUOROMETHYL-2H-INDAZOL-3-YL)-PHENYLAM1NO]-PHENYL}-PROPIONIC ACID METHYL ESTER This compound was prepared similarly to that of Example 4. LCMS: M+H: 530.3, M-H: 528.5. EXAMPLE 596 (4- {[4-(2-B ENZYL-7-TRIFLUOROMETH YL-2 H-INDAZOL-3 -YL)- PHENYLAMINO]-METHYL}-PHENYL)-ACETIC ACID METHYL ESTER This compound was prepared similarly to that of Example 4. LCMS: M+H: 530.3, M-H: 528.5. EXAMPLE 597 2-{3-[4-(2-BENZYL-7-TRIFLUOROMETHYL-2H-INDAZOL-3-YL)-PHENYLAMINO]-PHENYL}-PROPIONIC ACID This compound was prepared similarly to that of Example 4. LCMS: M+H: 516.5, M-H: 514.4. EXAMPLE 598 (4-{[4-(2-BENZYL-7-TRIFLUOROMETHYL-2H-INDAZOL-3-YL)- PHENYLAMINO]-METHYL}-PHENYL)-ACETICACID This compound was prepared similarly to that of Example 4. LCMS: M+H: 516.5, M-H: 514.4. EXAMPLE 599 2-{3-[3-(2-BENZYL-7-TRIFLUOROMETHYL-2H-INDAZOL-3-YL)-PHENYLAMINO]-PHENYL}-PROPIONIC ACID METHYL ESTER This compound was prepared similarly to that of Example 4. LCMS: M+H: 530.3, M-H: 528.5. EXAMPLE 600 2-{3-[3-(2-BENZYL-7-TRlFLUOROMETHYL-2H-INDAZOL-3-YL)- PHENYLAMINO]-PHENYL}-PROPION1CACID This compound was prepared similarly to that of Example 4. LCMS: M+H: 516.5, M-H: 514.4. EXAMPLE 601 [3-(2-BENZYL-7-TRIFLUOROMETHYL-2H-INDAZOL-3-YL)-PHENYL]-(2,6- DIMETHYL-BENZYL)-AMINE This compound was prepared similarly to that of Example 4. LCMS: M+H: 486.5, M-H: 484.7. EXAMPLE 602 (3-{4-[2-(2,4,6-TRIFLUORO-BENZYL)-7-TRIFLUOROMETHYL-2H-INDAZOL-3-YL]-PHENYLAMINO}-PHENYL)-ACETIC ACID This compound was prepared similarly to that of Example 4. LCMS: M+H: 556.1, M-H: 554.3. EXAMPLE 603 2-{3-[4-(2-BENZYL-7-TRIFLUOROMETHYL-2H-INDAZOL-3-YL)- PHENYLAMINO]-PHENYL}-2-HYDROXY-PROPIONICACID This compound was prepared similarly to that of Example 4. LCMS: M+H: 532.4, M-H: 530.3. EXAMPLE 604 [4-(2-BENZYL-7-TRIFLUOROMETHYL-2H-INDAZOL-3-YL)-PHENYL]-(2,6- DIMETHYL-BENZYL)-AM1NE This compound was prepared similarly to that of Example 4. LCMS: M+H: 486.5, M-H: 484.7. EXAMPLE 605 {3-[4-( 1 -METHYL-7-TRIFLUOROMETH YL-1H-INDAZOL-3 -YL)- PHENYLAMINOJ-PHENYL}-ACETIC ACID This compound was prepared similarly to that of Example 4. LCMS: M+H: 426.2, M-H: 424.4. EXAMPLE 606 {3-[4-(2-METHYL-7-TRIFLUOROMETHYL-2H-INDAZOL-3-YL)-PHENYLAMINO]-PHENYL}-ACETIC ACID This compound was prepared similarly to that of Example 4. LCMS: M+H: 426.2, M-H: 424.4. EXAMPLE 607 (4-{[4-(2-BENZYL-7-TRIFLUOROMETHYL-2H-INDAZOL-3-YL)-PHENYLAMINO]-METHYL}-3,5-DIMETHYL-PHENYL)-ACETICACID This compound was prepared similarly to that of Example 4. LCMS: M+H: 544.4, M-H: 542.6. EXAMPLE 608 (4-{[4-(2-BENZYL-7-TRIFLUOROMETHYL-2H-INDAZOL-3-YL)-PHENYLAMINO]-METHYL}-3,5-DIMETHYL-PHENYL)-ACETIC ACID This compound was prepared similarly to that of Example 4. LCMS: M+H: 544.4, M-H: 542.6. EXAMPLE 609 (3-{4-[2-(4-CHLORO-2-FLUORO-BENZYL)-7-TRIFLUOROMETHYL-2H- INDAZOL-3-YL]-PHENYLAMINO}-PHENYL)-ACETICACID This compound was prepared similarly to that of Example 4. LCMS: M+H: 554.3, M-H: 552.5. EXAMPLE 610 (3-{4-[2-(2,4-DIMETHYL-BENZYL)-7-TRlFLUOROMETHYL-2H-INDAZOL-3- YL]-PHENYLAMINO}-PHENYL)-ACETICACID This compound was prepared similarly to that of Example 4. LCMS: M+H: 530.3, M-H: 528.2. EXAMPLE 611 2-(4-CHLORO-2-FLUORO-BENZYL)-3-[3-(4-METHOXY-BENZYL)-PHENYLJ-7- TRIFLUOROMETHYL-2H-INDAZOLE This compound was prepared similarly to that of Example 5. LCMS: M+H: 525.5. EXAMPLE 612 2-(4-CHLORO-2-FLUORO-BENZYL)-3-[3-(3,5-DIMETHOXY-BENZYL)-PHENYL]-7- TRIFLUOROMETHYL-2H-INDAZOLE This compound was prepared similarly to that of Example 5. LCMS: M+H: 555.2. EXAMPLE 613 2-(4-CHLORO-2-FLUORO-BENZYL)-3-[3-(3,5-DIMETHYL-BENZYL)-PHENYLl-7- TRIFLUOROMETHYL-2H-INDAZOLE This compound was prepared similarly to that of Example 5. LCMS: M+H: 523.9. EXAMPLE 614 2-(4-CHLORO-2-FLUORO-BENZYL)-3-[3-(2-METHOXY-BENZYL)-PHENYL]-7- TRIFLUOROMETHYL-2H-INDAZOLE This compound was prepared similarly to that of Example 5. LCMS: M+H: 525.5. EXAMPLE 615 2-(4-CHLORO-2-FLUORO-BENZYL)-3-[3-(3-METHOXY-BENZYL)-PHENYL]-7- TRIFLUOROMETHYL-2H-INDAZOLE This compound was prepared similarly to that of Example 5. LCMS: M+H: 525.5. EXAMPLE 616 2-(4-CHLORO-2-FLUORO-BENZYL)-3-[3-(2,3-DIMETHOXY-BENZYL)-PHENYL]- 7-TRIFLUOROMETHYL-2H-1NDAZOLE This compound was prepared similarly to that of Example 5. LCMS: M+H: 555.2. EXAMPLE 617 2-(4-CHLORO-2-FLUORO-BENZYL)-3-[3-(3,4-DIMETHOXY-BENZYL)-PHENYL]-7- TRIFLUOROMETHYL-2H-INDAZOLE This compound was prepared similarly to that of Example 5. LCMS: M+H: 555.2. EX AMPLE 618 2-(4-CHLORO-2-FLUORO-BENZYL)-3-[3-(4-CHLORO-2-FLUORO-BENZYL)- PHENYL]-7-TRIFLUOROMETHYL-2H-INDAZOLE This compound was prepared similarly to that of Example 5. LCMS: M+H: 547.4. EXAMPLE 619 2-(4-CHLORO-2-FLUORO-BENZYL)-3-[3-(2-CHLORO-4-FLUORO-BENZYL)- PHENYL]-7-TRIFLUOROMETHYL-2H-INDAZOLE This compound was prepared similarly to that of Example 5. LCMS: M+H: 549.5. EXAMPLE 620 2-(4-CHLORO-2-FLUORO-BENZYL)-3-[3-(2-FLUORO-4-TRIFLUOROMETHYL BENZYL)-PHENYL]-7-TRIFLUOROMETHYL-2H-INDAZOLE This compound was prepared similarly to that of Example 5. LCMS: M+H: 581.3. EXAMPLE 621 3-[3-(2,4-BIS-TRIFLUOROMETHYL-BENZYL)-PHENYL]-2-(4-CHLORQ-2- FLUORO-BENZYL)-7-TRIFLUOROMETHYL-2H-INDAZOLE This compound was prepared similarly to that of Example 5. LCMS: M+H: 631.7. EXAMPLE 622 2-(4-CHLORO-2-FLUORO-BENZYL)-3-[3-(2,4-DIFLUORO-BENZYL)-PHENYL]-7- TRIFLUOROMETHYL-2H-INDAZOLE This compound was prepared similarly to that of Example 5. LCMS:M+H:531.2. EXAMPLE 623 3-[3-(2,5-BIS-TRIFLUOROMETHYL-BENZYL)-PHENYL]-2-(4-CHLORO-2- FLUORO-BENZYL)-7-TRIFLUOROMETHYL-2H-INDAZOLE This compound was prepared similarly to that of Example 5. LCMS: M+H: 631.7. EXAMPLE 624 2-(4-CHLORO-2-FLUORO-BENZYL)-3-[3-(2-FLUORO-3-METHYL-BENZYL)- PHENYLJ-7-TRIFLUOROMETHYL-2H-INDAZOLE This compound was prepared similarly to that of Example 5. LCMS: M+H: 527.3. EXAMPLE 625 2-(4-CHLORO-2-FLUORO-BENZYL)-3-[3-(6-CHLORO-2-FLUORO-3-METHYL- BENZYL)-PHENYL]-7-TRIFLUOROMETHYL-2M-INDAZOLE This compound was prepared similarly to that of Example 5. LCMS: M+H: 562.1. ; EXAMPLE 626 2-(4-CHLORO-2-FLUORO-BENZYL)-3-[3-(3-DIFLUOROMETHOXY-BENZYL)- PHENYLJ-7-TRIFLUOROMETHYL-2H-INDAZOLE This compound was prepared similarly to that of Example 5. LCMS: M+H: 561.2. EXAMPLE 627 2-(4-CHLORO-2-FLUORO-BENZYL)-3-[3-(2-CHLORO-5-TRIFLUOROMETHYL- BENZYL)-PHENYL]-7-TRIFLUOROMETHYL-2H-INDAZOLE This compound was prepared similarly to that of Example 5. LCMS: M+H: 597.2. EXAMPLE 628 2-(4-CHLORO-2-FLUORO-BENZYL)-3-[3-(4-METHANESULFONYL-BENZYL)- PHENYL]-7-TRIFLUOROMETHYL-2H-INDAZOLE This compound was prepared similarly to that of Example 5. LCMS: M+H: 573.5. EXAMPLE 629 2-(4-CHLORO-2-FLUORO-BENZYL)-3-[3-(2-METHYL-5-TRIFLUOROMETHYL- BENZYL)-PHENYL]-7-TRIFLUOROMETHYL-2H-INDAZOLE This compound was prepared similarly to that of Example 5. LCMS: M+H: 577.7. EXAMPLE 630 2-(4-CHLORO-2-FLUORO-BENZYL)-3-[3-(2-CHLORO-5-FLUORO-BENZYL)- PHENYL]-7-TRIFLUOROMETHYL-2H-lNDAZOLE This compound was prepared similarly to that of Example 5. LCMS: M+H: 547.4. EXAMPLE 631 2-(4-CHLORO-2-FLUORO-BENZYL)-3-[3-(5-FLUORO-2-TRIFLUOROMETHYL- BENZYL)-PHENYL]-7-TRIFLUOROMETHYL-2H-INDAZOLE This compound was prepared similarly to that of Example 5. LCMS: M+H: 581.3. EXAMPLE 632 2-(4-CHLORO-2-FLUORO-BENZYL)-3-[3-(2,5-DICHLORO-BENZYL)-PHENYL]-7- TRIFLUOROMETHYL-2H-INDAZOLE This compound was prepared similarly to that of Example 5. LCMS: M+H: 565.4. EXAMPLE 633 2-(4-CHLORO-2-FLUORO-BENZYL)-3-[3-(5-CHLORO-2-TRIFLUOROMETHYL- BENZYL)-PHENYL]-7-TRIFLUOROMETHYL-2H-INDAZOLE This compound was prepared similarly to that of Example 5. LCMS: M+H: 597.2. EXAMPLE 634 (3-{3-[2-(4-CHLORO-2-FLUORO-BENZYL)-7-TRIFLUOROMETHYL-2H-INDAZOL-3-YL]-BENZYL}-PHENYL)-MORPHOLIN-4-YL-METHANONE This compound was prepared similarly to that of Example 5. LCMS: M+H: 608.6. EXAMPLE 635 N-BENZYL-3-{3-[2-(4-CHLORO-2-FLUORO-BENZYL)-7-TRIFLUOROMETHYL- 2H-INDAZOL-3-YL]-BENZYL}-BENZAMIDE This compound was prepared similarly to that of Example 5. LCMS: M+H: 628.7. EXAMPLE 636 (3-{3-[2-(4-CHLORO-2-FLUORO-BENZYL)-7-TRIFLUOROMETHYL-2H-INDAZOL-3-YLJ-BENZYL} -PHEN YL)-PYRROLIDIN-1 -YL-METH ANON E This compound was prepared similarly to that of Example 5. LCMS: M+H: 592.7. EXAMPLE 637 (3-{3-[2-(4-CHLORO-2-FLUORO-BENZYL)-7-TRIFLUOROMETHYL-2H-INDAZOL-3-YL]-BENZYL}-PHENYL)-PIPER!DIN-1-YL-METHANONE This compound was prepared similarly to that of Example 5. LCMS: M+H: 606.5. EXAMPLE 638 3-{3-[2-(4-CHLORO-2-FLUORO-BENZYL)-7-TRIFLUOROMETHYL-2H- INDAZOL-3-YL]-BENZYL}-N,N-DIETHYL-BENZAMIDE This compound was prepared similarly to that of Example 5. LCMS: M+H: 594.5. EXAMPLE 639 3-{3-[2-(4-CHLORO-2-FLUORO-BENZYL)-7-TRIFLUOROMETHYL-2H- INDAZOL-3-YL]-BENZYL}-N-CYCLOPROPYL-BENZAMIDE This compound was prepared similarly to that of Example 5. LCMS: M+H: 578.6. EXAMPLE 640 3-{3-[2-(4-CHLORO-2-FLUORO-BENZYL)-7-TRIFLUOROMETHYL-2H- INDAZOL-3-YL]-BENZYL}-N-ISOPROPYL-BENZAMIDE This compound was prepared similarly to that of Example 5. LCMS: M+H: 580.4. EXAMPLE 641 3-{3-[2-(4-CHLORO-2-FLUORO-BENZYL)-7-TRlFLUOROMETHYL-2H- INDAZOL-3-YL]-BENZYL}-N-PROPYL-BENZAMlDE This compound was prepared similarly to that of Example 5. LCMS: M+H: 580.4. EXAMPLE 642 3-{3-[2-(4-CHLORO-2-FLUORO-BENZYL)-7-TRIFLUOROMETHYL-2H-INDAZOL-3- YL]-BENZYL}-N-ETHYL-BENZAMIDE This compound was prepared similarly to that of Example 5. LCMS: M+H: 566.6. EXAMPLE 643 3.{3.[2-(4-CHLORO-2-FLUORO-BENZYL)-7-TRIFLUOROMETHYL-2H- INDAZOL-3-YL]-BENZYL}-N-METHYL-BENZAMIDE This compound was prepared similarly to that of Example 5. LCMS: M+H: 552.5. EXAMPLE 644 2-BENZYL-3-[4-(3-METHOXYPHENOXY)PHENYL]-7-(TRIFLUOROMETHYL)- 2H-INDAZOLE This compound was prepared similarly to that of Example 3. LCMS: M+H: 475.4. EXAMPLE 645 2-BENZYL-3-[4-(2,3-DIFLUOROPHENOXY)PHENYL]-7-(TRIFLUOROMETHYL)- 2H-INDAZOLE This compound was prepared similarly to that of Example 3. LCMS: M+H: 481.4. EXAMPLE 646 2-BENZYL-3-[4-(4-CHLOROPHENOXY)PHENYL]-7-(TRIFLUOROMETHYL)-2H- INDAZOLE This compound was prepared similarly to that of Example 3. LCMS: M+H: 479.0. EXAMPLE 647 2-BENZYL-3-[4-(2,3-DIHYDRO-1H-INDEN-5-YLOXY)PHENYL]-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 3. LCMS: M+H: 485.6. EXAMPLE 648 2-BENZYL-3-[4-(2-FLUOROPHENOXY)PHENYL]-7-(TRIFLUOROMETHYL)-2H- INDAZOLE This compound was prepared similarly to that of Example 3. LCMS: M+H: 463.4. EXAMPLE 649 2-BENZYL-3-[4-(4-CHLORO-3-METHYLPHENOXY)PHENYL]-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 3. LCMS: M+H: 493.4. EXAMPLE 650 2-BENZYL-3-[4-(2-CHLOROPHENQXY)PHENYL]-7-(TRIFLUOROMETHYL)-2H- INDAZOLE This compound was prepared similarly to that of Example 3. LCMS: M+H: 479.0. EXAMPLE 651 3-{4-[2-BENZYL-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENOXY}-N.N- DIMETHYLANILINE This compound was prepared similarly to that of Example 3. LCMS: M+H: 488.3. EXAMPLE 652 2-BENZYL-3-[4-(3-NITROPHENOXY)PHENYL]-7-(TRIFLUOROMETHYL)-2H- INDAZOLE This compound was prepared similarly to that of Example 3. LCMS: M+H: 490.4. EXAMPLE 653 2-BENZYL-3-{4-[(7-METHOXY-2-NAPHTHYL)OXY]PHENYL}-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 3. LCMS: M+H: 525.8. EXAMPLE 654 2-BENZYL-3-[4-(4-FLUOROPHENOXY)PHENYL]-7-(TRIFLUOROMETHYL)-2H- INDAZOLE This compound was prepared similarly to that of Example 3. LCMS: M+H: 463.4. EXAMPLE 655 4-(4-{4-[2-BENZYL-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3- YL]PHENOXY}BENZYL)PHENOL This compound was prepared similarly to that of Example 3. LCMS: M+H: 551.0. EXAMPLE 656 2-BENZYL-3-[4-(5,6,7,8-TETRAHYDRONAPHTHALEN-2-YLOXY)PHENYL]-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 3. LCMS: M+H: 499.0. EXAMPLE 657 7-{4-[2-BENZYL-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3- YL]PHENOXY}QUINOLINE This compound was prepared similarly to that of Example 3. LCMS: M+H: 496.7. EXAMPLE 65 8 2-BENZYL-H4<2,4-DICHLOROPHENOXY)PHENYL]-7-(TRIFLUOROMETHYL)- 2H-INDAZOLE : This compound was prepared similarly to that of Example 3. LCMS: M+H: 513.0. EXAMPLE 659 2-BENZYL-3-[4-(2-METHOXYPHENOXY)PHENYL]-7-(TRIFLUOROMETHYL)- 2H-INDAZOLE This compound was prepared similarly to that of Example 3. LCMS: M+H: 475.4. EXAMPLE 660 2-BENZYL-3-[4-(3,5-DIFLUOROPHENOXY)PHENYL]-7-(TRIFLUOROMETHYL)- 2H-INDAZOLE This compound was prepared similarly to that of Example 3. LCMS: M+H: 481.0. EXAMPLE 661 2-BENZYL-3-[4-(2,3-DIMETHYLPHENOXY)PHENYL]-7-(TRIFLUOROMETHYD- 2H-INDAZOLE This compound was prepared similarly to that of Example 3. LCMS: M+H: 473.3. EXAMPLE 662 2-BENZYL-3-[4-(3,5-DIMETHYLPHENOXY)PHENYL]-7-(TRIFLUOROMETHYL)- 2H-INDAZOLE This compound was prepared similarly to that of Example 3. LCMS: M+H: 473. EXAMPLE 663 2-BENZYL-3-[4-(4-METHYLPHENOXY)PHENYL]-7-(TRIFLUOROMETHYL)-2H- INDAZOLE This compound was prepared similarly to that of Example 3. LCMS: M+H: 459. EXAMPLE 664 2-BENZYL-3-[4-(4-NITROPHENOXY)PHENYL]-7-(TRIFLUOROMETHYL)-2H- 1NDAZOLE This compound was prepared similarly to that of Example 3. LCMS: M+H: 490. EXAMPLE 665 2-BENZYL-3-{4-[(4'-NITROBIPHENYL-4-YL)OXY]PHENYL}-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 3. LCMS: M+H: 566. EXAMPLE 666 3-{4-[4-(4-ACETYLPIPERAZIN-l-YL)PHENOXY]PHENYL}-2-BENZYL-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 3. LCMS: M+H: 571. EXAMPLE 667 2-BENZYL-3-[4-(2,4-DIFLUOROPHENOXY)PHENYL]-7-(TRIFLUOROMETHYD- 2H-INDAZOLE This compound was prepared similarly to that of Example 3. LCMS:M+H: 481.0. EXAMPLE 668 2-BENZYL-3-[4-(3,4-DIMETHYLPHENOXY)PHENYL]-7-(TRIFLUOROMETHYL)- 2H-INDAZOLE This compound was prepared similarly to that of Example 3. LCMS: M+H: 473. EXAMPLE 669 2-BENZYL-3-[4-(2-ISOPROPYLPHENOXY)PHENYL]-7-(TRIFLUOROMETHYL)- 2H-INDAZOLE This compound was prepared similarly to that of Example 3. LCMS: M+H: 487. EXAMPLE 670 5-{4-[2-BENZYL-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENOXY}-3.4-DIHYDRONAPHTHALEN-1 (2H)-ONE This compound was prepared similarly to that of Example 3. LCMS: M+H: 513. EXAMPLE 671 6-{4-[2-BENZYL-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YL] PHENOX Y! QUINOLINE This compound was prepared similarly to that of Example 3. LCMS: M+H: 496. EXAMPLE 672 2-BENZYL-3-[4-(2,6-DIMETHOXYPHENOXY)PHENYL]-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 3. LCMS: M+H: 505. EXAMPLE 673 2-BENZYL-3-[4-(2-METHYLPHENOXY)PHENYL]-7-(TRIFLUOROMETHYL)-2H- INDAZOLE This compound was prepared similarly to that of Example 3. LCMS: M+H: 459. EXAMPLE 674 2-BENZYL-3-[4-(3,4-DICHLOROPHENOXY)PHENYL]-7-(TRIFLUOROMETHYL)- 2H-INDAZOLE This compound was prepared similarly to that of Example 3. LCMS: M+H: 513. EXAMPLE 675 2-BENZYL-3-[4-(3,4-DIFLUOROPHENOXY)PHENYL]-7-(TRIFLUOROMETHYL)- 2H-INDAZOLE This compound was prepared similarly to that of Example 3. LCMS: M+H: 481. EXAMPLE 676 2-BENZYL-3-[4-(2,5-DIFLUOROPHENOXY)PHENYL]-7-(TRIFLUOROMETHYL)- 2H-INDAZOLE This compound was prepared similarly to that of Example 3. LCMS: M+H: 481. EXAMPLE 677 8-{4-[2-BENZYL-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENOXY}QUINOLINE This compound was prepared similarly to that of Example 3. LCMS: M+H: 496. EXAMPLE 678 2-BENZYL-3-[4-(4-ETHYLPHENOXY)PHENYL]-7-(TRIFLUOROMETHYL)-2H- INDAZOLE This compound was prepared similarly to that of Example 3. LCMS: M+H: 473. EXAMPLE 679 2-BENZYL-3-[4-(2,6-DIFLUOROPHENOXY)PHENYL]-7-(TRIFLUOROMETHYL)- 2H-INDAZQLE This compound was prepared similarly to that of Example 3. LCMS: M+H: 481. EXAMPLE 680 2-BENZYL-3-{4-[4-(BENZYLOXY)PHENOXY]PHENYL}-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 3. LCMS: M+H: 551. EXAMPLE 681 METHYL 3-{3-[2-BENZYL-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3- YL]PHENOXY}BENZOATE This compound was prepared similarly to that of Example 3. LCMS: M+H: 503.7. EXAMPLE 682 2-BENZYL-3-[3-(3-METHOXYPHENOXY)PHENYL]-7-(TRIFLUOROMETHYL)- 2H-INDAZOLE This compound was prepared similarly to that of Example 3. LCMS: M+H: 475.7. EXAMPLE 683 2-BENZYL-3-[3-(3,4-DICHLOROPHENOXY)PHENYL]-7-(TRIFLu6ROMETHYL)- 2H-INDAZOLE This compound was prepared similarly to that of Example 3. LCMS: M+H: 513.7. EXAMPLE 684 METHYL 3-(4-{3-[2-BENZYL-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3- YL]PHENOXY} PHENYL)PROPANOATE This compound was prepared similarly to that of Example 3. LCMS: M+H: 531.7. EXAMPLE 685 l-(2-{3-[2-BENZYL-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENOXY} PHENYL)ETHANONE This compound was prepared similarly to that of Example 3. LCMS: M+H: 487.7. EXAMPLE 686 l-(3-{3-[2-BENZYL-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YLJPHENOX Y} PHENYL)ETHANONE This compound was prepared similarly to that of Example 3. LCMS: M+H: 487.7. EXAMPLE 687 2-BENZYL-3-[3-(3-METHYLPHENOXY)PHENYL]-7-(TRIFLUOROMETHYL)-2H- INDAZOLE This compound was prepared similarly to that of Example 3. LCMS: M+H: 459.7. EXAMPLE 688 2-BENZYL-3-[3-(2-CHLOROPHENOXY)PHENYL]-7-(TRIFLUOROMETHYL)-2H- INDAZOLE This compound was prepared similarly to that of Example 3. LCMS: M+H: 479.6. EXAMPLE 689 3-{3-[2-BENZYL-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENOXY}-N,N- DIMETHYLANILINE This compound was prepared similarly to that of Example 3. LCMS: M+H: 488.7. EXAMPLE 690 2-BENZYL-3-[3-(3-NITROPHENOXY)PHENYL]-7-(TRIFLUOROMETHYL)-2H- INDAZOLE This compound was prepared similarly to that of Example 3. LCMS: M+H: 490.7. EXAMPLE 691 2-BENZYL-3-[3-(2,3-DIMETHYLPHENOXY)PHENYL]-7-(TRIFLUOROMETHYL)- 2H-INDAZOLE This compound was prepared similarly to that of Example 3. LCMS: M+H: 473.8. EXAMPLE 692 2-BENZYL-3-{3-[2-(TRIFLUOROMETHOXY)PHENOXY]PHENYL}-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 3. LCMS: M+H: 529.7. EXAMPLE 693 2-BENZYL-3-[3-(2-TERT-BUTYLPHENOXY)PHENYL]-7-(TRIFLUOROMETHYL)- 2H-INDAZOLE This compound was prepared similarly to that of Example 3. LCMS: M+H: 501.8. EXAMPLE 694 2-BENZYL-3-[3-(2-ISOPROPYLPHENOXY)PHENYL]-7-(TRIFLUOROMETHYL)- 2H-INDAZOLE This compound was prepared similarly to that of Example 3. LCMS: M+H: 487.8. EXAMPLE 695 5-{3-[2-BENZYL-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENOXY}-3,4-DIHYDRONAPHTHALEN-1 (2H)-ONE This compound was prepared similarly to that of Example 3. LCMS: M+H: 513.7. EXAMPLE 696 7-{3-[2-BENZYL-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3- YL]PHENOXY}QUINOLINE This compound was prepared similarly to that of Example 3. LCMS: M+H: 496.7. EXAMPLE 697 8-{3-[2-BENZYL-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENOXY}QUINOLINE This compound was prepared similarly to that of Example 3. LCMS: M+H: 496.7. EXAMPLE 698 2-BENZYL-3-{3-[3,5-BIS(TRIFLUOROMETHYL)PHENOXY]PHENYL}-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 3. LCMS: M+H: 581.6. EXAMPLE 699 2-BENZYL-3-{3-[(7-METHYL-l-NAPHTHYL)OXY]PHENYL}-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 3. LCMS: M+H: 509.7. EXAMPLE 700 4-{3-[2-BENZYL-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3- YL]PHENOXY}ACRIDINE This compound was prepared similarly to that of Example 3. LCMS: M+H: 546.8. EXAMPLE 701 2-BENZYL-3-{3-[2-(BENZYLOXY)PHENOXY]PHENYL}-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 3. LCMS: M+H: 551.7. EXAMPLE 702 (2-{3-[2-BENZYL-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENOXY}PHENYL)(PHENYL)METHANONE This compound was prepared similarly to that of Example 3. LCMS: M+H: 549.7. EXAMPLE 703 2-BENZYL-3-[3-(BIPHENYL-2-YLOXY)PHENYL]-7-(TRIFLUOROMETHYL)-2H- INDAZOLE This compound was prepared similarly to that of Example 3. LCMS: M+H: 521.8. EXAMPLE 704 2-(2-{3-[2-BENZYL-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3- YL]PHENOXY}PHENYL)-1,3-BENZOTHIAZOLE This compound was prepared similarly to that of Example 3. LCMS: M+H: 578.6. EXAMPLE 705 2-BENZYL-3-{3-[2-(lH-PYRROL-l-YL)PHENOXY]PHENYL}-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 3. LCMS: M+H: 510.7. EXAMPLE 706 2-BENZYL-3-[3-(3,4-DIELUOROPHENOXY)PHENYL]-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 3. LCMS: M+H: 482.2. EXAMPLE 707 2-BENZYL-3-[3-(2,3-DIFLUOROPHENOXY)PHENYL]-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 3. LCMS: M+H: 482.2. EXAMPLE 708 2-BENZYL-3-[3-(2,5-DIFLUOROPHENOXY)PHENYL]-7-(TRIFLUOROMETHYL)- 2H-INDAZOLE This compound was prepared similarly to that of Example 3. LCMS: M+H: 482.2. EXAMPLE 709 2-BENZYL-3-{3-[(7-METHOXY-2-NAPHTHYL)OXY]PHENYL}-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 3. LGMS: M+H: 526.3. EXAMPLE 710 l-(2-{3-[2-BENZYL-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENOXY}-4- METHOXYPHENYL)ETHANONE This compound was prepared similarly to that of Example 3. LCMS: M+H: 518.2. EXAMPLE 711 6-{3-[2-BENZYL-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YLJPH ENOX Y} QUINOLINE This compound was prepared similarly to that of Example 3. LCMS: M+H: 497.2. EXAMPLE 712 2-BENZYL-3-[3-(3,5-DIMETHYLPHENOXY)PHENYL]-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 3. LCMS: M+H: 474.2. EXAMPLE 713 2-BENZYL-3-[3-(2-METHQXYPHENOXY)PHENYL]-7-(TRIFLUOROMETHYL)- 2H-INDAZOLE This compound was prepared similarly to that of Example 3. LCMS: M+H: 476.2. EXAMPLE 714 2-BENZYL-3-[3-( 1 -NAPHTHYLOXY)PHENYL]-7-(TRIFLUOROMETHYL)-2H- INDAZOLE This compound was prepared similarly to that of Example 3. LCMS: M+H: 496.2. EXAMPLE 715 2-BENZYL-3-(3-{2-[(lE)-PROP-l-EN-l-YL]PHENOXY}PHENYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 3. LCMS: M+H: 486.2. EXAMPLE 716 2-BENZYL-3-[3-(2-CYCLOPENTYLPHENOXY)PHENYL]-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 3. LCMS: M+H: 514.3. EXAMPLE 717 2-BENZYL-3-[3-(3,5-DIFLUOROPHENOXY)PHENYL]-7-(TRIFLUOROMETHYL)-2H- INDAZOLE This compound was prepared similarly to that of Example 3. LCMS: M+H: 482.2. EXAMPLE 718 2-BENZYL-3-[3-(3,5-DIGHLOROPHENOXY)PHENYL]-7-(TRIFLUOROMETHYL)- 2H-INDAZOLE This compound was prepared similarly to that of Example 3. LCMS: M+H: 515.1. EXAMPLE 719 2-BENZYL-3-[3-(3,5-DIMETHOXYPHENOXY)PHENYL]-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 3. LCMS: M+H: 506.2. EXAMPLE 720 2-(4-CHLORO-2-FLUOROBENZYL)-3-[3-(3-CHLOROPHENOXY)PHENYL]-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 3. LCMS: M+H: 533.2. EXAMPLE 721 2-(4-CHLORO-2-FLUOROBENZYL)-3-[3-(2-FLUOROPHENOXY)PHENYL]-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 3. LCMS: M+H: 517.3. EXAMPLE 722 6-{3-[2-(4-CHLORO-2-FLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENOXY}-2-NAPHTHONITRILE This compound was prepared similarly to that of Example 3. LCMS: M+H: 574.2. EXAMPLE 723 2-(4-CIILORO-2-FLUOROBENZYL)-3-[3-(5,6,7,8-TETRAHYDRONAPHTHAL£N- l-YLOXY)PHENYL]-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 3. LCMS: M+H: 553.2. EXAMPLE 724 2-(4-CHLORO-2-FLUOROBENZYL)-3-[3-(2-ETHOXYPHENOXY)PHENYL]-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 3. LCMS: M+H: 543.2. EXAMPLE 725 l-(2-{3-[2-(4-CHLORO-2-FLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H- INDAZOL-3-YL]PHENOXY}PHENYL)PROPAN-l-ONE This compound was prepared similarly to that of Example 3. LCMS: M+H: 555.2. EXAMPLE 726 3-{3-[2-(lH-BENZIMIDAZOL-2-YL)PHENOXY]PHENYL}-2-(4-CHLORO-2- FLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 3. LCMS: M+H: 615.2. EXAMPLE 727 2-(4-CHLORO-2-FLUOROBENZYL)-3-[3-(2-PYRROLIDIN-1-YLPHENOXY)PHENYL]-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 3. LCMS: M+H: 568.2. EXAMPLE 728 2-BENZYL-3-{4-[(3-METHOXYBENZYL)OXY]PHENYL}-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 489.5. EXAMPLE 729 2-BENZYL-3-{4-[(2-CHLOROBENZYL)OXY]PHENYL}-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 493.4. EXAMPLE 730 2-BENZYL-7-(TRIFLUOROMETHYL)-3-(4-{[2- (TRIFLUOROMETHYL)BENZYL]OXY}PHENYL)-2H-1NDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 527.6. EXAMPLE 731 2-BENZYL-3-{4-[(3-METHYLBENZYL)OXY]PHENYL}-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 473.6. EXAMPLE 732 2-BENZYL-3-{4-[(2-METHYLBENZYL)OXY]PHENYL}-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 473.3. EXAMPLE 733 2-BENZYL-3-{4-[(3-CHLOROBENZYL)OXY]PHENYL}-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 493.4. EXAMPLE 734 2-BENZYL-7-(TRIFLUOROMETHYL)-3-(4-{[3- (TRIFLUOROMETHYL)BENZYL]OXY}PHENYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 527.6. EXAMPLE 735 2-BENZYL-3-(4-{[3,5-BIS(TRIFLUOROMETHYL)BENZYL]OXY}PHENYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 595.4. EXAMPLE 736 2-BENZYL-3-{4-[(3,5-DIMETHYLBENZYL)OXY]PHENYL}-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 487.4. EXAMPLE 737 2-BENZYL-3-{4-[(2,6-DICHLOROBENZYL)OXY]PHENYL}-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 527.6. EXAMPLE 738 2-BENZYL-3-{4-[(3,5-DIGHLOROBENZYL)OXY]PHENYL}-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 527.3. EXAMPLE 739 2-BENZYL-3-{3-[(3-METHOXYBENZYL)OXY]PHENYL}-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 489.5. EXAMPLE 740 2-BENZYL-3-{3-[(2-CHLOROBENZYL)OXY]PHENYL}-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 493.4. EXAMPLE 741 2-BENZYL-7-(TRIFLUOROMETHYL)-3-(3-{[2- (TRIFLUOROMETHYL)BENZYL]OXY}PHENYL)-2H-1NDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 527.6. EXAMPLE 742 2-BENZYL-3-{3-[(3-METHYLBENZYL)OXY]PHENYL}-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 473.3. EXAMPLE 743 2-BENZYL-3-{3-[(2-METHYLBENZYL)OXY]PHENYL}-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 473.3. EXAMPLE 744 2-BENZYL-7-(TRIFLUOROMETHYL)-3-(3-{[3- (TRIFLUOROMETHYL)BENZYL]OXY}PHENYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 527.6. EXAMPLE 745 2-BENZYL-3-(3-{[3,5-BIS(TRIFLUOROMETHYL)BENZYL]OXY}PHENYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 595.4. EXAMPLE 746 2-BENZYL-3-{3-[(3,5-DIMETHYLBENZYL)OXY]PHENYL}-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 487.4. EXAMPLE 747 2-BENZYL-3-{3-[(2,6-DICHLOROBENZYL)OXY]PHENYL}-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 527.3. EXAMPLE 748 2-BENZYL-3-{3-[(3,5-DICHLOROBENZYL)OXY]PHENYL}-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 527.3. EXAMPLE 749 l-[4-({3-[2-BENZYL-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENOXY}METHYL)PHENYL]CYCLOPROPANECARBOXYLIC ACID This compound was prepared similarly to that of Example 527. LCMS: M+H: 543.5, M-H: 541.4. EXAMPLE 750 2-BENZYL-3-{3-[(2,6-DlMETHYLBENZYL)OXY]PHENYL}-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 487.4. EXAMPLE 751 2-BENZYL-3-{3-[(2-FLUOROBENZYL)OXY]PHENYL}-7, (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 477.2. EXAMPLE 752 2-BENZYL-3-{3-[(2-FLUORO-6-NITROBENZYL)OXY]PHENYL}-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 522.8. EXAMPLE 753 2-BENZYL-3-{3-[(2-CHLORO-6-FLUOROBENZYL)OXY]PHENYL}-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 511.7. EXAMPLE 754 2-BENZYL-3-{3-[(2,6-DIFLUOROBENZYL)OXY]PHENYL}-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 495.8. EXAMPLE 755 2-BENZYL-3-{4-[(2-FLUOROBENZYL)OXY]PHENYL} -7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 477.2. EXAMPLE 756 2-BENZYL-3-{4-[(2-CHLORO-6-FLUOROBENZYL)OXY]PHENYL}-7- (TRIFLUOROMETHYL)-2H-1NDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 511.7. EXAMPLE 757 2-BENZYL-3-{4-[(2,6-DIFLUOROBENZYL)OXY]PHENYL}-7-(TRIFLUOROMETHYL)- 2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 495.8. EXAMPLE 758 [3-({3-[2-BENZYL-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENOXY}METHYL)PHENYL]ACETIC ACID This compound was prepared similarly to that of Example 527. LCMS: M+H: 517.4, M-H: 515.6. EXAMPLE 759 3-[2-BENZYL-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENYL ACETATE This compound was prepared similarly to that of Example 525. LCMS: M+H: 411.2. EXAMPLE 760 2-BENZYL-3-{4-[(2-FLUORO-6-NITROBENZYL)OXY]PHENYL}-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 522.8. EXAMPLE 761 4-({3-[2-BENZYL-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENOXY}METHYL)PHENYL ACETATE This compound was prepared similarly to that of Example 525. LCMS: M+H: 517.4. EXAMPLE 762. DIETHYL[4-({3-[2-BENZYL-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3- YL]PHENOXY}METHYL)BENZYL]PHOSPHONATE This compound was prepared similarly to that of Example 525. LCMS: M+H: 609.5. EXAMPLE 763 DIETHYL [4-({4-[2-BENZYL-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3- YL]PHENOXY}METHYL)BENZYL]PHOSPHONATE This compound was prepared similarly to that of Example 525. LCMS: M+H: 609.5. EXAMPLE 764 4-({3-[2-BENZYL-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENOXY} METHYL)BENZONITRILE This compound was prepared similarly to that of Example 525. LCMS: M+H: 484.4. EXAMPLE 765 3-({3-[2-BENZYL-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3- YL]PHENOXY}METHYL)BENZONITR1LE This compound was prepared similarly to that of Example 525. LCMS: M+H: 484.4. EXAMPLE 766 4-({4-[2-BENZYL-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3- YL]PHENOXY}METHYL)BENZONITRILE This compound was prepared similarly to that of Example 525. LCMS: M+H: 484.4. EXAMPLE 767 2-BENZYL-3-(3-{[3-(lH-TETRAZOL-5-YL)BENZYL]OXY}PHENYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 529. LCMS: M+H: 527.6, M-H: 525.8. EXAMPLE 768 2-BENZYL-3-(4-{[4-(lH-TETRAZOL-5-YL)BENZYL]OXY}PHENYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 529. LCMS: M+H: 527.6, M-H: 525.8. EXAMPLE 769 [4-({3-[2-BENZYL-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3- YL]PHENOXY}METHYL)BENZYL]PHOSPHONICACID This compound was prepared similarly to that of Example 530. LCMS: M+H: 553.4, M-H: 551.9. EXAMPLE 770 (4-[4-(2-BENZYL-7-TRIFLUOROMETHYL-2H-INDAZOL-3-YL)-PHENOXYMETHYL]-BENZYL}-PHOSPHONIC ACID MONOETHYL ESTER This compound was prepared similarly to that of Example 530. LCMS: M+H: 581.3, M-H: 579.5. EXAMPLE 771 [4-({4-[2-BENZYL-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3- YL]PHENOXY}METHYL)BENZYL]PHOSPHONICACID This compound was prepared similarly to that of Example 530. LCMS: M+H: 553.4, M-H: 551.6. EXAMPLE 772 2-(2,4-DIMETHYLBENZYL)-3-{3-[(2,6-DIMETHYLBENZYL)OXY]PHENYL}-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 515.6. EXAMPLE 773 3-{3-[(2,6-DIMETHYLBENZYL)OXY]PHENYL}-2-(2,4,6-TRIFLUOROBENZYL)-7- (TRIFMJOROMETHYL)-2H-1NDAZOLE This compound was prepared similarly to that of Example 525. LCMS:M+H:541.4. EXAMPLE 774 3-{3-[(2-FLUORO-6-NITROBENZYL)OXY]PHENYL}-2-(2,4,6- TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 576.5. EXAMPLE 775 2-(2,4-DIFLUOROBENZYL)-3-{3-[(2,6-DIMETHYLBENZYL)OXY]PHENYL}-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 523.7. EXAMPLE 776 2-(4-CHLORO-2-FLUOROBENZYL)-3-{3-[(2,6- DIMETHYLBENZYL)OXY]PHENYL} -7-(TRIFLUOROMETHYL)-2H-INDAZOL E This compound was prepared similarly to that of Example 525. LCMS: M+H: 539.6. EXAMPLE 777 2-(2-CHLORO-4-FLUOROBENZYL)-3-{3-[(2,6-DIMETHYLBENZYL)OXY]PHENYL}-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 539.6. EXAMPLE 778 2-BENZYL-3-{3-[(3,5-DIMETHOXYBENZYL)OXY]PHENYL}-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 519.5. EXAMPLE 779 2-BENZYL-3-{4-[(2,6-DIMETHYLBENZYL)OXY]PHENYL}-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 487.4. EXAMPLE 780 2-(2,4-DICHLOROBENZYL)-3-{3-[(2,6-DIMETHYLBENZYL)OXY]PHENYL}-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 555.2. EXAMPLE 781 2-BENZYL-3-{3-[(2,5-DIMETHYLBENZYL)OXY]PHENYL}-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 487.4. EXAMPLE 782 2-BENZYL-3-(3-{[2-FLUORO-6-TRIFLUOROMETHYL)BENZYL]OXY}PHENYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 545.3. EXAMPLE 783 2-[4-({3-[2-(2,4-DIMETHYLBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3- YL]PHENOXY}METHYL)PHENYL]-2-METHYLPROPANOICACID This compound was prepared similarly to that of Example 528. LCMS: M+H: 573.8, M-H: 571.4. EXAMPLE 784 2-METHYL-2-[4-({3-[2-(2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)- 2H-INDAZOL-3-YL]PHENOXY}METHYL)PHENYL]PROPANOICACID This compound was prepared similarly to that of Example 528. LCMS: M+H: 599.6, M-H: 597.5. EXAMPLE 785 2-[4-({3-[2-(2,4-DIMETHYLBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3- YL]PHENOXY}METHYL)PHENYL]PROPANOICACID This compound was prepared similarly to that of Example 528. LCMS: M+H: 559.4, M-H: 557.6. EXAMPLE 786 2-[4-({3-[2-(2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENOXY}METHYL)PHENYL]PROPANOIC ACID This compound was prepared similarly to that of Example 528. LCMS: M+H: 585.2, M-H: 583.4. EXAMPLE 787 2-(2,4-DIMETHYLBENZYL)-3-{3-[(2-FLUORO-6-NITROBENZYL)OXY]PHENYL}-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 550.7, M-H: 548.6. EXAMPLE 788 3-({3-[2-(2,4-DIMETHYLBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENOXY} METHYL)BENZONITRILE This compound was prepared similarly to that of Example 525. LCMS: M+H: 512.6. EXAMPLE 789 3-[3-(BENZYLOXY)PHENYL]-2-(2,4-DIMETHYLBENZYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 487.4. EXAMPLE 790 2-(4-CHLORO-2-FLUOROBENZYL)-3-{3-[(2-FLUORO-6- NITROBENZYL)OXY]PHENYL}-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 574.4, M-H: 572.3. EXAMPLE 791 3-({3-[2-(4-CHLORO-2-FLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H- INDAZOL-3-YL]PHENOXY}METHYL)BENZONlTRILE This compound was prepared similarly to that of Example 525. LCMS: M+H: 536.3. EXAMPLE 792 2-{3-[2-(4-CHLORO-2-FLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3- YL]PHENOXY}-2-(4-METHYLPHENYL)PROPANOICACID This compound was prepared similarly to that of Example 528. LCMS: M+H: 583.4, M-H: 581.3. EXAMPLE 793 2-[4-({3-[2-(4-CHLORO-2-FLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H- INDAZOL-3-YL]PHENOXY}METHYL)PHENYL]PROPANOICACID This compound was prepared similarly to that of Example 528. LCMS: M+H: 583.1, M-H: 581.3. EXAMPLE 794 2-[4-({3-[2-(4-CHLORO-2-FLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H- INDAZOL-3rYL]PHENOXY}METHYL)PHENYL]-2-METHYLPROPANOICAClD This compound was prepared similarly to that of Example 528. LCMS: M+H: 597.5, M-H: 595.4. EXAMPLE 795 2-(2,4-DIFLUOROBENZYL)-3-{4-[(2,6-DIMETHYLBENZYL)OXY]PHENYL}-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 523.7. EXAMPLE 796 2-(2,4-DICHLOROBENZYL)-3-{4-[(2,6-DIMETHYLBENZYL)OXY]PHENYL}-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 555.2. EXAMPLE 797 2-(4-CHLORO-2-FLUOROBENZYL)-3-{4-[(2,6-DIMETHYLBENZYL)OXY]PHENYL}-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 539.6. EXAMPLE 798 2-(2-CHLORO-4-FLUOROBENZYL)-3-{4-[(2,6- DIMETHYLBENZYL)OXY]PHENYL}-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 539.6. EXAMPLE 799 2-(2,4-DIMETHYLBENZYL)-3-{4-[(2,6-DIMETHYLBENZYL)OXY]PHENYL}-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 515.6. EXAMPLE 800 2-BENZYL-3-(4-{[2-FLUORO-6- (TRIFLUOROMETHYL)BENZYL]OXY}PHENYL)-7-(TRIFLUOROMETHYL)-2H- INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 545.3. EXAMPLE 801 [4-({3-[2-BENZYL-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3- YL]PHENOXY}METHYL)-3,5-DIMETHYLPHENYL]ACETICACID This compound was prepared similarly to that of Example 2. LCMS: M+H: 545.3. EXAMPLE 802 [4-({4-[2-BENZYL-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENOXY}METHYL)-3,5-DIMETHYLPHENYL]ACETIC ACID This compound was prepared similarly to that of Example 801. LCMS: M+H: 545.3. EXAMPLE 803 2-(4-CHLORO-2-FLUOROBENZYL)-3-{3-[(2,5- DIMETIIYLBENZYL)OXY]PHENYL}-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 539.6. EXAMPLE 804 2-(2,4-DlMETHYLBENZYL)-3-{3-[(2,5-DIMETHYLBENZYL)OXY]PHENYL}-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 515.6. EXAMPLE 805 4-({3-[2-BENZYL-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3- YL]PHENOXY}METHYL)-3,5-DIBROMOBENZOICACID This compound was prepared similarly to that of Example 801. LCMS: M+H: 661.0, M-H: 659.0. EXAMPLE 806 4-({4-[2-BENZYL-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENOXY}METHYL)-3,5-DIBROMOBENZOIC ACID This compound was prepared similarly to that of Example 801. LCMS: M+H: 661.0, M-H: 659.1. EXAMPLE 807 4-({3-[2-BENZYL-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3- YL]PHENOXY}METHYL)-3,5-DIMETHYLBENZOICACID This compound was prepared similarly to that of Example 801. LCMS: M+H: 531.2, M-H: 529.3. EXAMPLE 808 2-BENZYL-3-{4-[(2,5-DIMETHYLBENZYL)OXY]PHENYL}-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 487.4. EXAMPLE 809 2-(2-CHLORO-4-FLUOROBENZYL)-3-{4-[(2,5- DIMETHYLBENZYL)OXY]PHENYL}-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 539.6. EXAMPLE 810 2-(2,4-DICHLOROBENZYL)-3-{4-[(2,5-DIMETHYLBENZYL)OXY]PHENYL}-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 555.2. EXAMPLE 811 3-{3-[(2,5-DIMETHYLBENZYL)OXY]PHENYL}-2-(2,4,6-TRIFLUOROBENZYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 541.4. EXAMPLE 812 {4-[2-BENZYL-7-(TRIFLUORQMETHYL)-2H-INDAZOL-3-YL]PHENOXY}(3-METHYLPHENYL)ACETIC ACID This compound was prepared similarly to that of Example 527. LCMS:M+H:517.4. EXAMPLE 813 {3-[2-BENZYL-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENOXY}(3-METHYLPHENYL)ACETIC ACID This compound was prepared similarly to that of Example 527. LCMS: M+H: 517.4, M-H: 515.3. EXAMPLE 814 2-BENZYL-3-[4-(2-NAPHTHYLMETHOXY)PHENYL]-7-(TRIFLUOROMETHYL)- 2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 509.6. EXAMPLE 815 2-BENZYL-3-[4-(l-NAPHTHYLMETHOXY)PHENYL]-7-(TRIFLUOROMETHYL)- 2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 509.3. EXAMPLE 816 2-BENZYL-3-{4-[(3-METHYL-2-NAPHTHYL)METHOXY]PHENYL}-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 523.7. EXAMPLE 817 2-BENZYL-3-[3-(2-NAPHTHYLMETHOXY)PHENYL]-7-(TRIFLUOROMETHYL)- 2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 509.3. EXAMPLE 818 2-BENZYL-3-[3-(l-NAPHTHYLMETHOXY)PHENYL]-7-(TRIFLUOROMETHYL)- 2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 509.6. EXAMPLE 819 2-BENZYL-3-{3-[(3-METHYL-2-NAPHTHYL)METHOXY]PHENYL}-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 523.7. EXAMPLE 820 2-BENZYL-3-{4-[(2-METHYL-l-NAPHTHYL)METHOXY]PHENYL}-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 523.7. EXAMPLE 821 3-[4-(9-ANTHRYLMETHOXY)PHENYL]-2-BENZYL-7-(TRIFLUOROMETHYL)- 2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 559.4. EXAMPLE 822 2-BENZYL-3-{3-[(2-METHYL-l-NAPHTHYL)METHOXY]PHENYL}-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 523.7. EXAMPLE 823 3-[3-(9-ANTHRYLMETHOXY)PHENYL]-2-BENZYL-7-(TRIFLUOROMETHYL)- 2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 559.4. EXAMPLE 824 2-(4-CHLORO-2-FLUOROBENZYL)-3-{4-[(2,5- DIMETHYLBENZYL)OXY]PHENYL}-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 525. LGMS: M+H: 539.6. EXAMPLE 825 2-(2,4-DIMETHYLBENZYL)-3-{4-[(2,5-DIMETHYLBENZYL)OXY]PHENYL}-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 515.6. EXAMPLE 826 3-{4-[(2,5-DIMETHYLBENZYL)OXY]PHENYL}-2-(2,4,6-TRIFLUOROBENZYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 541.4. EXAMPLE 827 2-(4-CHLORO-2-FLUOROBENZYL)-3-{3-[(2-METHYL-3- NITROBENZYL)OXY]PHENYL}-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 570.5. EXAMPLE 828 2-(4-CHLORO-2-FLUOROBENZYL)-3-{3-[(5-METHYL-2- NITROBENZYL)OXY]PHENYL}-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 570.5. EXAMPLE 829 2-(4-CHLORO-2-FLUOROBENZYL)-3-{3-[(2-CHLORO-5- NITROBENZYL)OXY]PHENYL}-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 590.3. EXAMPLE 830 2-(4-CHLORO-2-FLUOROBENZYL)-3-{3-[(2-FLUORO-3- METHYLBENZYL)OXY]PHENYL}-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 543.5. EXAMPLE 831 2-(4-CHLORO-2-FLUOROBENZYL)-3-(3-{[5-FLUORO-2- (TRIFLUOROMETHYL)BENZYL]OXY}PHENYL)-7-(TRIFLUOROMETHYL)-2H- INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 597.2. EXAMPLE 832 2-(4-CHLORO-2-FLUOROBENZYL)-3-(3-{[2-CHLORO-3- (TRIFLUOROMETHYL)BENZYL]OXY}PHENYL)-7-(TRIFLUOROMETHYL)-2H- INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 613.1. EXAMPLE 833 2-(4-CHLORO-2-FLUOROBENZYL)-3-{3-[(2-METHOXY-5- NITROBENZYL)OXY]PHENYL}-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 586.1. EXAMPLE 834 2-(4-CHLORO-2-FLUOROBENZYL)-3-(3-{[2-METHYL-5- (TRIFLUOROMETHYL)BENZYL]OXY}PHENYL)-7-(TRIFLUOROMETHYL)-2H- INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 593.6. EXAMPLE 835 3-{3-[(2-BROMO-5-METHOXYBENZYL)OXY]PHENYL}-2-(4-CHLORO-2- FLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 621.5. EXAMPLE 836 3-(3-{[2,5-BIS(TRIFLUOROMETHYL)BENZYL]OXY}PHENYL)-2-(4-CHLORO-2- FLUOROBENZYL)-7-(TRJFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 647.6. EXAMPLE 837 l-[3-({3-[2-(4-CHLORO-2-FLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H- INDAZOL-3-YL]PHENOXY}METHYL)-4-METHOXYPHENYL]ETHANONE This compound was prepared similarly to that of Example 525. LCMS: M+H: 584.3. EXAMPLE 838 2-(4-CHLORO-2-FLUOROBENZYL)-3-{3-[(2,5- DIFLUOROBENZYL)OXY]PHENYL}-7-(TRlFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 547.7. EXAMPLE 839 3-{3-[(2-BROMO-5-FLUOROBENZYL)OXY]PHENYL}-2-(4-CHLORO-2- FLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 607.1. EXAMPLE 840 2-(4-CHLORO-2-FLUOROBENZYL)-3-{3-[(3-CHLORO-2- FLUOROBENZYL)OXY}PHENYL}-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 563.3. EXAMPLE 841 2-(4-CHLORO-2-FLUOROBENZYL)-3-(3-{[2-FLUORO-5- (TRIFLUOROMETHYL)BENZYL]OXY}PHENYL)-7-(TRIFLUOROMETHYL)-2*H- INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 597.2. EXAMPLE 842 ' 2-(4-CHLORO-2-FLUOROBEN'ZYL)-3-{3-[(2,3,6- TRIFLUOROBENZYL)OXY]PHENYL}-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 565.4. EXAMPLE 843 2-(4-CHLORO-2-FLUOROBENZYL)-3-{3-[(2,5- DICHLOROBENZYL)OXY]PHENYL}-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 579.3. EXAMPLE 844 2-(4-CHLORO-2-FLUOROBENZYL)-3-(3-{[2-CHLORO-5- (TRIFLUOROMETHYL)BENZYL]OXY}PHENYL)-7-(TRIFLUOROMETHYL)-2H- INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 613.1. EXAMPLE 845 2-(4-CHLORO-2-FLUOROBENZYL)-3-(3-{[5-CHLORO-2- (TRIFLUOROMETHYL)BENZYL]OXY}PHENYL)-7-(TRIFLUOROMETHYL)-2H- INDAZOLE This compound was prepared similarly to that of Example 525. LCMS:M+H: 612.8. EXAMPLE 846 [4-({3-[2-(4-CHLORO-2-FLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENOXY}METHYL)PHENYL]ACETICACID This compound was prepared similarly to that of Example 525. LCMS: M+H: 569.6. EXAMPLE 847 METHYL [4-({3-[2-(4-CHLORO-2-FLUOROBENZYL)-7-(TRIFLUOROMETHYL)- 2H-INDAZOL-3-YL]PHENOXY}METHYL)PHENYL]ACETATE This compound was prepared similarly to that of Example 525. LCMS; M+H: 583.4. EXAMPLE 848 2-(4-CHLORO-2-FLUOROBENZYL)-3-{3-[(6-CHLORO-2-FLUORO-3- METHYLBENZYL)OXY]PHENYL}-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 577.7. EXAMPLE 849 3-{3-[(2-CHLORO-3,6-DIFLUOROBENZYL)OXY]PHENYL}-2-(4-CHLORO-2- FLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 581.3. EXAMPLE 850 3-{3-[(3-CHLORO-2,6-DIFLUOROBENZYL)OXY]PHENYL}-2-(4-CHLORO-2- FLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 581.3. EXAMPLE 851 2-(4-CHLORO-2-FLUOROBENZYL)-3-{3-[(5-CHLORO-2- FLUOROBENZYL)OXY]PHENYL}-7-(TRlFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 563.6. EXAMPLE 852 2-(4-CHLORO-2-FLUOROBENZYL)-3-{3-[(2,5- DIMETHOXYBENZYL)OXY]PHENYL}-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 571.4. EXAMPLE 853 2-(4-CHLORO-2-FLUOROBENZYL)-3-{3-[(5-FLUORO-2- METHYLBENZYL)OXY]PHENYL}-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 543.5. EXAMPLE 854 2-(4-CHLORO-2-FLUOROBENZYL)-3-{3-[(2,6-DIFLUORO-3- METHYLBENZYL)OXY]PHENYL}-7-(TRIFLUOROMETHYL)-2H-lNDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 561.2. EXAMPLE 855 2-(4-CHLORO-2-FLUOROBENZYL)-3-{3-[(2,6-DIFLUOROBENZYL)OXY]PHENYL}-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 547.7. EXAMPLE 856 2-(4-CHLORO-2-FLUOROBENZYL)-3-{3-[(2-CHLORO-6- FLUOROBENZYL)OXY]PHENYL}-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 563.3. EXAMPLE 857 2-(4-CHLORO-2-FLUOROBENZYL)-3-(3-{[2-METHOXY-5- (TRIFLUOROMETHOXY)BENZYL]OXY}PHENYL)-7-(TRIFLUOROMETHYL)- 2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 625.4. EXAMPLE 858 2-(4-CHLORO-2-FLUOROBENZYL)-3-{3-[(2,3- DIMETHOXYBENZYL)OXY]PHENYL}-7-(TRIFLUOROMETHYL)-2H-INDAZOLH This compound was prepared similarly to that of Example 525. LCMS: M+H: 571.4. EXAMPLE 859 3-[3-(BENZYLOXY)PHENYL]-2-(4-CHLORO-2-FLUOROBENZYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 511.7. EXAMPLE 860 2-(4-CHLORO-2-FLUOROBENZYL)-3-{3-[(4-METHYLBENZYL)OXY]PHENYL}- 7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 525.8. EXAMPLE 861 2-(4-CHLORO-2-FLUOROBENZYL)-3-{3-[(2-CHLORO-5- FLUOROBENZYL)OXY]PHENYL}-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 563.6. EXAMPLE 862 2-(2,4-DIMETHYLBENZYL)-3-(3-{[5-FLUORO-2- (TRIFLUOROMETHYL)BENZYL]OXY}PHENYL)-7-(TRIFLUOROMETHYL)-2H- INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 573.8. EXAMPLE 863 [4-({3-[2-METHYL-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENOXY}METHYL)PHENYL]ACETICACID This compound was prepared similarly to that of Example 531. LCMS: M+H: 441.5, M-H: 439.7. EXAMPLE 864 2-(4-CHLORO-2-FLUOROBENZYL)-3-{3-[(2-CHLORO-6-FLUORO-3- METHYLBENZYL)OXY]PHENYL}-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 577.7. EXAMPLE 865 [4-({3-[7-(TRIFLUOROMETHYL)-lH-INDAZOL-3-YL]PHENOXY}METHYL)PHENYL]ACETICACID This compound was prepared similarly to that of Example 531. LCMS: M+H: 427.4, M-H: 425.9. EXAMPLE 866 2-{3-[2-(4-CHLORO-2-FLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENOXY}-2-PHENYLPROPANOIC ACID This compound was prepared similarly to that of Example 531. LCMS: M+H: 569.6, M-H: 567.5. EXAMPLE 867 {3-[2-(4-CIILORO-2-FLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOL- 3-YL]PHENOXY}(3-METHYLPHENYL)ACETICACID This compound was prepared similarly to that of Example 531. LCMS: M+H: 569.6, M-H: 567.5. EXAMPLE 868 [4-({3-[2-(4-CHLORO-2-FLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H- INDAZOL-3-YL]PHENOXY}METHYL)-2,5-DIMETHYLPHENYL]ACETICACID This compound was prepared similarly to that of Example 531. LCMS: M+H: 597.5. EXAMPLE 869 [4-({3-[2-(2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENOXY}METHYL)PHENYL]ACETIC ACID This compound was prepared similarly to that of Example 531. LCMS: M+H: 571.4, M-H: 569.3. EXAMPLE 870 l-[4-({3-[2-(4-CHLORO-2-FLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENOXY}METHYL)PHENYL]CYCLOPROPANECARBOXYLFC ACID This compound was prepared similarly to that of Example 527. LCMS: M+H: 595.4, M-H: 593.6. EXAMPLE 871 3-(3-{[5-FLUORO-2-(TRIFLUOROMETHYL)BENZYL]OXY}PHENYL)-2-(2,4?6- TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 599.3. EXAMPLE 872 [3-({3-[2-(4-CHLORO-2^FLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENOXY}METHYL)-2,4-DIMETHYLPHENYL]ACETIC ACID This compound was prepared similarly to that of Example 531. LCMS: M+H: 597.5. EXAMPLE 873 [4-({3-[2-(2,4-DIMETHYLBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENOXY}METHYL)PHENYL]ACETICACID This compound was prepared similarly to that of Example 531. LCMS: M+H: 545.6, M-H: 543.5. « EXAMPLE 874 2-[3-({4-[2-(2,4-DIMETHYLBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3- YL]PHENYL}AMINO)PHENYL]-2-METHYLPROPANOICACID This compound was prepared similarly to that of Example 4. LCMS: M+H: 558.5. EXAMPLE 875 3-(3-{[5-CHLORO-2-(TRIFLUOROMETHYL)BENZYL]OXY}PHENYL)-2-(2,4,6- TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 615.5. EXAMPLE 876 3-(3-{[2-CHLORO-5-(TRIFLUOROMETHYL)BENZYL]OXY}PHENYL)-2-(2,4,6- TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 525. LCMS: M+H: 615.5. EXAMPLE 877 2-(4-CHLORO-2-FLUOROBENZYL)-3-{3-[2-(2,5- DIMETHYLPHENYL)ETHYL]PHENYL}-7-(TRIFLUOROMETHYL)-2H- INDAZOLE This compound was prepared similarly to that of Example 532. LCMS: M+H: 537.5. EXAMPLE 878 2-(4-CHLORO-2-FLUOROBENZYL)-3-{3-[2-(2,5- DICHLOROPHENYL)ETHYL]PHENYL}-7-(TRIFLUOROMETHYL)-2H- INDAZOLE This compound was prepared similarly to that of Example 532. LCMS: M+H: 577.7. EXAMPLE 879 2-(4-CHLORO-2-FLUO^lOBENZYL)-3-{3-[2-(2,5-DIFLUOROPHENYL) ETHYL]PHENYL}-7-(tRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 532. LCMS: M+H:.545.3. I . • I EXAMPLE 880 2-(4-CHLORO-2-FLUO}lOBENZYL)-3-{3-[2-(5-CHLORO-2- FLUOROPHENYL)ETriYL]PHENYL}-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 532. LCMS:M+H:561.2. EXAMPLE 881 2-(4-CHLORO-2-FLUOkOBENZYL)-3-{3-[2-(2-CHLORO-5- FLUORQPHENYL)ETHyL]PHENYL}-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 532. LCMS:M+H:561.2. i EXAMPLE 882 2-(4-CHLORO-2-FLUORpBENZYL)-3-(3-{2-[2-FLUORO-5- (TRIFLUOROMETHYL)fHENYL]ETHYL}PIIENYL)-7-(TRIFLUOROMETHYL)- 2H-INDAZOLE I ! i This compound was prepared similarly to that of Example 532. LCMS: M+H: 595.4. EXAMPLE 883 2-(4-CHLORO-2-FLUOR(bBENZYL)-3-(3-{2-[3- (TRIFLUOROMETHOX\t)PHENYL]ETHYL}PHENYL)-7-(TRIFLUOROMETHYL)- 2H-INDAZOLE This compound was preparpd similarly to that of Example 532. LCMS: M+H: 593.6. EXAMPLE 884 2-(4-CHLORO-2-FLUOROBENZYL)-3-{3-[2-(3- METHOXYPHENYL)ETHYL]PHENYL}-7-(TRIFLUOROMETHYL)-2H- INDAZOLE This compound was prepared similarly to that of Example 532. LCMS: M+H: 539.6. EXAMPLE 885 2-(4-CHLORO-2-FLUOROBENZYL)-3-(3-{2-[3- (DIFLUOROMETHOXY)PHENYL]ETHYL}PHENYL)-7-(TRIFLUOROMETHYL)- 2H-INDAZOLE This compound was prepared similarly to that of Example 532. LCMS: M+H: 575.6. EXAMPLE 886 2-(4-CHLORO-2-FLUOROBENZYL)-3-(3-{2-[2-METHYL-5- (TRIFLUOROMETHYL)PHENYL]ETHYL}PHENYL)-7-(TRIFLUOROMETHYL)- 2H-INDAZOLE This compound was prepared similarly to that of Example 532. LCMS: M+H: 591.5. EXAMPLE 887 3-(3-{2-[2,5-BIS(TRIFLUOROMETHYL)PHENYL]ETHYL}PHENYL)-2-(4- CHLORO-2-FLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 532. LCMS: M+H: 645.5. EXAMPLE 888 2-(4-CHLORO-2-FLUOROBENZYL)-3-{3-[2-(2,3- DIMETHOXYPHENYL)ETHYL]PHENYL}-7-(TRIFLUOROMETHYL)-2H- INDAZOLE This compound was prepared similarly to that of Example 532. LCMS: M+H: 569.6. EXAMPLE 889 2-(4-CHLORO-2-FLUOROBENZYL)-3-(3-{2-[2-CHLORO-5- (TRIFLUOROMETHYL)PHENYL]ETHYL}PHENYL)-7-(TRIFLUOROMETHYL)- 2H-INDAZOLE This compound was prepared similarly to that of Example 532. LCMS:M+H:611.3. EXAMPLE 890 2-(4-CHLORO-2-FLUOROBENZYL)-3-(3-{2-[5-CHLORO-2- (TRIFLUOROMETHYL)PHENYL]ETHYL}PHENYL)-7-(TRIFLUOROMETHYL)- 2H-INDAZOLE This compound was prepared similarly to that of Example 532. LCMS:M+H:611.3. EXAMPLE 891 2-(4-CHLORO-2-FLUOROBENZYL)-3-(3-{2-[5-FLUORO-2- (TRIFLUOROMETHYL)PHENYL]ETHYL}PHENYL)-7-(TRIFLUOROMETHYL)- 2H-INDAZOLE This compound was prepared similarly to that of Example 532. LCMS: M+H: 595.4. EXAMPLE 892 (3-{3-[2-BENZYL-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENOXY}PHENYL)ACETIC ACID Fifty milligrams (50 mg 0.094 mmol) of 2-benzyl-3-[4-(3-[l,3]dioxoIan-2-yl-methyl-phenoxy)-phenyl]-7-trifluoro-methyl-2H-indazole (this compound was prepared similarly to that of Example 3) in 600 uL acetone, was treated with 5 eq. of Jones reagent (3.6M CrOs in aq. HaSO,}) at 0°C, while stirring for 2 hours at room temperature. The reaction mixture was quenched with ice / NaHSOs and extracted three times with CfyCh. The combined organic phases were dried, evaporated and the crude material was dissolved in 0.5 mL me'hanol. Twenty milligrams -(20 mg) of LiOH were added and the reaction mixture was stirred at 70°C for 2 hours. The reaction mixture was concentrated, diluted with NaCl ( aq. sat.), acidified with 2 M HCl(aq) and extracted three times with CFfcCfe. The crude material was purified by HPLC using a gradient with acidic mobile phase on an ACE-C8 column to afford analytically pure product. LCMS: M+H: 503.3, M-H: 501.5. EXAMPLE 893 2-{3-[2-BENZYL-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3- YL]PHENOXY}BENZALDEHYDE The preparation of this compound is was similar to that described for Example 3. 2-Benzyl-3-(3-bromo-phenyl)-7-trifluoromethyl-2H-indazole (60 mg, 0.139 mmol), cesium carbonate (272 mg, 0.835 mmol), Cul (80 mg, 0.417 mmol) and 2-hydroxy-benzaldehyde (51 mg, 0.417 mmol) were dissolved in 6 ml of dry pyridine. The reaction and work-up were carried out as described for Example 3. LCMS: M+H: 473.3, M+COCT: 517.4. EXAMPLE 894 2-(3-{3-[2-BENZYL-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3- YL]PHENOXY}PHENYL)-2-METHYLPROPANOICACID Preparation of 2-(3-{3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3-yl]phenoxy}phenyl)-2-methylpropanoic acid methyl ester. 3-(2-Benzyl-7-trifluoromethyl-2H-indazol-3-yI)-phenol (96 mg, 0.26 mmol), 2-methyl-2-[3-(4,4,5,5-tetramethyl-[l,3,2]dioxaborolan-2-yl)-phenyl]-propionic acid methyl ester (80 mg, 0.26 mmol), Cu(OAc)2 (47 mg, 0.26 mmol) and pyridine (42 uL, 0.52 mmol) were dissolved in 3 ml anhydrous CfyCh and stirred at room temperature with crushed molsieves (4A) overnight. The reaction mixture was diluted with 1 M HC1 (aq.) and the product was extracted three times with C^Cfe. The combined organic phases were dried, evaporated and the crude material was purified by preparative HPLC using a gradient with an acidic mobile phase on an ACE-C8 column to afford 8.4 mg of analytically pure product. LCMS: M+H: 546.5. Preparation of 2-(3-{3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3-yl]phenoxy}phenyl)-2-methylpropanoic acid. This compound was obtained from 2-(3-{3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3-yl]phenoxy}phenyl)-2-methylpropanoic acid methyl ester in a similar manner as described for the preparation of Example 2. LCMS: M+H: 531.5, M-H: 529.1. EXAMPLE 895 3-{4-[2-BENZYL-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3- YL]PHENOXY}BENZALDEHYDE Preparation of 2-Benzyl-3-[4-(3-[l ,3]dioxolan-2-ylmethyl-phenoxy)-phenyl]-7-trifluoromethyl-2H-indazole. This compound was prepared similarly to that of Example 3. LCMS: M+H: 531.5. Preparation of 3-{4-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3-yl]phenoxy}benzaldehyde. 2-benzyl-3-[4-(3-[l,3]dioxolan-2-ylmethyl-phenoxy)-phenyl]-7-trifluoromethyl-2H-indazole (14 mg, 0.0264 mmol) was treated with 6.6 mg PPTS ih 1.5 ml acetone under reflux for 2 hrs. The reaction mixture was extracted with NaHCOs and CH2Cb. The combined organic phases were dried, evaporated and the crude material was purified on a chromatotron using a gradient changing from 1:99 (EtOAc/heptane) to 3:7 (EtOAc/heptane) to afford 5 mg of analytically pure product. LCMS: M+H: 487.0, M-H': 485.6. EXAMPLE 896 (3-{4-[2-BENZYL-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YLJPHENOXY} PHENYL)METHANOL This compound was prepared from methyl 3-{4-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3-yl]phenoxy}benzoate (Example 912; 30 mg, 0.060 mmol), which was dissolved in 1.5 ml diethylether and treated with LiAlHU. The reaction mixture was stirred at room temperature overnight. The reaction mixture was quenched with water and stirred for 15 minutes. The slurry was filtered and the product extracted with Et2O / NH4C1 (aq, sat). After evaporation of the solvents, the crude material was purified by HPLC using a gradient with an acidic mobile phase on an ACE-C8 column to afford 19.6 mg of analytically pure product. LCMS: M+H: 475.4, M+COO': 519.5. EXAMPLE 897 3-{4-[2-BENZYL-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENOXY}-N- METHOXY-N-METHYLBENZAMIDE Preparation of 3-{4-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3-yl]phenoxy}benzoic acid. This compound was prepared similarly to that of Example 3. Preparation of 3-{4-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3-yl]phenoxy} -N-methoxy-N-methylbenzamide. A reaction mixture of 3-{4-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3-yl]phenoxy}benzoic acid .(115.8 mg, 0.237 mmol), (3-dimethylamino-propyl)-ethyl-carbodiimide hydrochloride (86 mg, 0.356 mmol), <9,./V-dimethyI-hydroxylamine hydrochloride ( 69 mg, 0.711 mmol) and 0.3 mL of triethylamine dissolved in 2 mL CHjCb was stirred at room temperature overnight. The reaction mixture was quenched with 1M HC1( aq) and the crude material was extracted with CH^Cli. The-crude material was purified with flash chromatography using EtOAc/heptane, 3:7, as eluent to afford 17 mg of analytically pure product. LCMS: M+H: 532.2. EXAMPLE 898 3-{4-[2-BENZYL-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENOXY}-N,N- DIMETHYLBENZAMIDE This compound was prepared from Example 912. Methyl 3-{4-[2-benzyI-7-(trifluoromethyl)-2H-indazol-3-yl]phenoxy}benzoate (49 mg, 0.0971 mmol) was dissolved in a 2M solution of dimethylamine in methanol (1.5 mL), 0.5 mg of sodium cyanide was added and the reaction mixture was stirred at 60°C overnight. The solvent was evaporated, the residue dissolved in CHzClj and washed with brine. The combined organic phases were dried, evaporated and the crude material was purified by HPLC using a gradient with an acidic mobile phase on an ACE-C8 column to afford 9 mg of analytically pure product. LCMS: M+H: 516.0. EXAMPLE 899 3-{4-[2-BENZYL-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YLJPHENOX Y) BENZAMIDE 3-{4-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3-yI]phenoxy}benzoic acid ( 39 mg, 0.08 mmol) in 0.8 mL dioxane was added to NbCl5 (64 mg, 0.238 mmol), followed by 0.95 mL NHa (0.5M in dioxane). The temperature was slowly raised to 50°C and stirred for 2 days. The solvents were evaporated and the residue dissolved in CP^Cb, followed by filtration of the precipitate. The residue was dissolved in CH2C12 and washed with brine. The combined organic phases were dried, evaporated and the crude material was purified by HPLC using a gradient with an acidic mobile phase on an ACE-C8 column to afford analytically pure product. LCMS: M+H: 488.3, M-H: 486.5. EXAMPLE 900 5-{4-[2-(4-CHLORO-2-FLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENOXY}-l,2,3,4-TETRAHYDRONAPHTHALEN-l-OL 5-{4-[2-(4-chlbro-2-fluorobenzyl)-7-(trifluoromethyl)-2H-indazoI-3-yl]phenoxy}-3,4-dihydronaphthalen-l(2H)-one (14 mg, 0.025 mmol) dissolved in 1.5 mL THF was added to a slurry of LiAlfy in THF and stirred at room temperature for 2 hours. The reaction mixture was quenched with fyO and stirred for 15 min. Filtration of the mixture was followed by extraction with C^Cfe. The combined organic phases were dried, evaporated and the crude material was purified by HPLC using a gradient with an acidic mobile phase on an ACE-C8 column to afford 1.2 mg analytically pure product. LCMS: M+H: 567.5, M+COCT: 611.3. EXAMPLE 901 3_{4.[2-(4-CHLORO-2-FLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H- INDAZOL-3-YL]PHENOXY}-N,N-DIMETHYLBENZAMIDE 4-[2-(4-Chloro-2-fluoro-benzyl)-7-trifluoromethyl-2H-indazoI-3-yl]-phenol (50 mg, 0.12 mmol), 3-(N,N-dimethyl-benzamide)-phenylboronic acid (0.24 mmol), Cu(OAc)2 (22mg, 0.12 mmol) and pyridine (2eq) were dissolved in 2ml of anhydrous CFhCli. Molsieves (4 A) were added and the reaction mixture was stirred for 3 days. The reaction mixture was extracted with NH4CL(aq) and Cl^Cfe. The combined organic phases were dried, evaporated and the crude material was purified by HPLC using a gradient with a neutral mobile phase on an ACE-C8 column to afford 17 mg analytically pure product. LCMS: M+H: 568.8, M+COCT: 571.2. EXAMPLE 902 2-(3-{4-[2-BENZYL-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3- YL]PHENOXY}PHENYL)PROPAN-2-OL Methyl 3-{4-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3-yl]phenoxy}benzoate (10 mg, 0.02 mmol) was treated with MeMgBr ( 3M in Et2O, 0.13 mL) in 2 ml of THF. The reaction mixture was stirred for 2 hours at room temperature before extraction with CHzCb /NKjCI. Purification by flash chromatography using CH2Cb / heptane, 1:1, as eluent afforded 2 mg of analytical pure product. LCMS: M+H: 503.3; M+COCT: 547.4. EXAMPLE 903 5.{4-[2-(4-CHLORO-2-FLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H- INDAZOL-3-YL]PHENOXY}-l,2,3,4-TETRAHYDRONAPHTHALEN-l-OL 5.{4-[2-(4-chloro-2-fluorobenzyl)-7-(trifluoromethyl)-2II-indazol-3-yI]phenoxy}-3,4-dihydronaphthalen-l(2H)-one (330 mg, 0.58 mmol) dissolved in 10 mL of EtOH was added to a slurry of NaBH» in EtOH and stirred at room temperature overnight. The reaction mixture was quenched with FbO and stirred for 15 min. Filtration of the mixture was followed by extraction with CHiCfe. The combined organic phases were dried, evaporated and the crude material was purified by HPLC using a gradient with an acidic mobile phase on an ACE-C8 column to afford a racemic mixture. Separation of the two enatiomers afforded the analytically pure products of this Example 903 and Example 936. LCMS: M+H: 567.5, M+Ac": 625.4. EXAMPLE 904 2-BENZYL-3-(3-PHENOXYPHENYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 3. LCMS: M+H: 445.4, M+Ac-; 503.3. EXAMPLE 905 2-BENZYL-3-[3-(4-METHOXYPHENOXY)PHENYL]-7-(TRIFLUOROMETHYL)- 2H-INDAZOLE This compound was prepared similarly to that of Example 3. LCMS: M+H: 475.4, M+Ac': 533.3. EXAMPLE 906 2-BENZYL-3-{3-[3-(l,3-DIOXOLAN-2-YLMETHYL)PHENOXY]PHENYL}-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 3. LCMS:M+H:531.1. EXAMPLE 907 METHYL 2-(4-{3-[2-BENZYL-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3- YL]PHENOXY}PHENYL)-2-METHYLPROPANOATE This compound was prepared similarly to that of Example 3. LCMS: M+II: 545.3, M+COCT: 589.7. EXAMPLE 908 3-{3-[2-BENZYL-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENOXY}-N,N- DIMETHYLBENZAMIDE This compound was prepared similarly to that of Example 894. LCMS: M+H: 545.6, M+COCT: 589.4. EXAMPLE 909 (3-{4-[2-BENZYL-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENOXY}PHENYL)ACETIC ACID This compound was prepared similarly to that of Example 892. LCMS: M+H: 503.3, M+-H: 501.2. EXAMPLE 910 2-BENZYL-3-{4-[3-(l,3-DIOXOLAN-2-YLMETHYL)PHENOXY]PHENYL}-7- (TR1FLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 3. LCMS: M+H: 531.2, M+COO": 575.6. EXAMPLE 911 2-BENZYL-3-[4-(3,5-DIMETHYLPHENOXY)PHENYL]-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 3. LCMS: M+H: 473.3. EXAMPLE 912 METHYL 3-{4-[2-BENZYL-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YL] PHENOXY}BENZOATE This compound was prepared similarly to that of Example 3. LCMS: M+H: 503.3, M+COCT: 547.7. EXAMPLE 913 3.{4_[2-BENZYL-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENOXY}-N- METHYLBENZAMIDE This compound was prepared from similarly to that of Example 898. LCMS: M+H: 502.0, M+Ac': 560.0. EXAMPLE 914 2-(2,4-DIMETHYLBENZYL)-3-[4-(2-METHOXYPHENOXY)PHENYL]-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 893. LCMS: M+H: 503.3. EXAMPLE 915 3-[4-(2-METHOXYPHENOXY)PHENYL]-2-(2,4,6-TRIFLUOROBENZYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 893. LCMS: M+H: 529.1, M+COCT: 573.2. EXAMPLE 916 2-(4-CHLORO-2-FLUOROBENZYL)-3-[4-(2-METHOXYPHENOXY)PHENYL]-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 893. LCMS: M+H: 527.3, M+COO': 571.1. EXAMPLE 917 3-{4-[2-(2,4-DIMETHYLBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YLJPHENOXY} -N,N-DIMETHYLANILINE This compound was prepared similarly to that of Example 3. LCMS: M+H: 516.8, M+COCT: 559.7. EXAMPLE 918 N,N-DIMETHYL-3-{4-[2-(2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)- 2H-INDAZOL-3-YL]PHENOXY}ANILINE This compound was prepared similarly to that of Example 3. LCMS: M+H: 542.6. EXAMPLE 919 3-{4-[2-(4-CHLORO-2-FLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H- INDAZOL-3-YL]PHENOXY}-N,N-DIMETHYLANILINE This compound was prepared similarly to that of Example 3. LCMS: M+H: 540.5, M+CQCT: 584.6. EXAMPLE 920 3-{4-[2-(2,4-DIMETHYLBENZYL)-7-(TRlFLUOROMETHYL)-2H-INDAZOL-3- YL]PHENOXY}-N-METHOXY-N-METHYLBENZAMIDE This compound was prepared similarly to that of Example 3. LCMS: M+H: 560.3. EXAMPLE 921 N-METHOXY-N-METHYL-3-{4-[2-(2,4,6-TRIFLUOROBENZYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENOXY}BENZAMIDE This compound was prepared similarly to that of Example 3. LCMS:M+H: 586.1. EXAMPLE 922 3-{4-[2-(4-CHLORO-2-FLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H- INDAZOL-3-YL]PHENOXY}-N-METHOXY-N-METHYLBENZAMIDE This compound was prepared similarly to that of Example 3. LCMS: M+H: 584.3. EXAMPLE 923 5-{4-[2-(4-CHLORO-2-FLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENOXY}-3,4-DIHYDRONAPHTHALEN-1 (2H)-ONE This compound was prepared similarly to that of Example 893. LCMS: M+H 565.2. EXAMPLE 924 2-BENZYL-3-{4-[2-(TRIFLUOROMETHOXY)PHENOXY]PHENYL}-7- (TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 893. LCMS: M+H: 529.3. EXAMPLE 925 2-BENZYL-3-[4-(l-NAPHTHYLOXY)PHENYL]-7-(TRIFLUOROMETHYL)-2H- INDAZOLE This compound was prepared similarly to that of Example 893. LCMS: M+H: 495.4. EXAMPLE 926 3-{4-[2-(4-GHLORO-2-FLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENOXY}BENZALDEHYDE This compound was prepared similarly to that of Example 893. LCMS: M+H 525.8. EXAMPLE 927 2-(4-CHLORO-2-FLUOROBENZYL)-3-[4-(5,6,7,8-TETRAHYDRONAPHTHALEN- l-YLOXY)PHENYL]-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 893. LCMS: M+H 551.6. EXAMPLE 928 3-{4-[2-(4-CHLORO-2-FLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H- INDAZOL-3-YL]PHENOXY}-N,N-DIETHYLBENZAMIDE This compound was prepared similarly to that of Example 901. LCMS: M+H: 596.3. EXAMPLE 929 2-(4-CHLORO-2-FLUOROBENZYL)-3-{4-[3-(PYRROLlDIN-l- YLCARBONYL)PHENOXY]PHENYL}-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 901. LCMS: M+H: 594.3. EXAMPLE 930 2-(4-CHLORO-2-FLUOROBENZYL)-3-{4-[3-(PIPERIDIN-l- YLCARBONYL)PHENOXY]PHENYL}-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 901. LCMS: M+H: 608.3. EXAMPLE 931 2-(4-CHLORO-2-FLUOROBENZYL)-3-{4-[3-(MORPHOLIN-4- YLCARBONYL)PHENOXY]PHENYL}-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 901. LCMS: M+H: 610.26. EXAMPLE 932 l-(3-{4-[2-(4-CHLORO-2-FLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H- INDAZOL-3-YL]PHENOXY}PHENYL)ETHANONE This compound was prepared similarly to that of Example 893. LCMS: M+H: 539.6, M+COO': 583.1. EXAMPLE 933 N,N-DIMETHYL-3-{4-[2-(2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)- 2H-INDAZOL-3-YL]PHENOXY}BENZAMIDE This compound was prepared similarly to that of Example 901. LCMS; M+H: 570.5, M+COCT: 614.6. EXAMPLE 934 3-{4-[2-(2,4-DIMETHYLBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3- YL]PHENOXY}-N,N-D1METHYLBENZAM1DE This compound was prepared similarly to that of Example 901. LCMS: M+H: 544.4, M+Acf: 602.6. EXAMPLE 935 2-(3-{4-[2-(4-CHLORO-2-FLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H- INDAZOL-3-YL]PHENOXY}PHENYL)PROPAN-2-OL This compound was prepared similarly to that of Example 902. LCMS: M+H: 555.2, M+COCT: 559.6. EXAMPLE 936 5-{4-[2-(4-CHLORO-2-FLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3- YL]PHENOXYH,2,3,4-TETRAHYDRONAPHTHALEN-1-OL This compound was prepared similarly to that of Example 903, and is the other enantiomer of Example 903. LCMS: M+H: 567.5, M+COO': 625.4. EXAMPLE 937 3-{4-[3-(PIPERIDIN-1 -YLCARBONYL)PHENOXY]PHENYL} -2-(2,4,6- TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 901. LCMS: M+H: 610.4, M+COO": 654.5. EXAMPLE 938 2-(3-{4-[2-(2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOL- 3-YL]PHENOXY}PHENYL)PROPAN-2-OL This compound was prepared similarly to that of Example 901. LCMS: M+H: 557.3, M+Ac-: 615.5. EXAMPLE 939 3-{4-[3-(MORPHOLIN-4-YLCARBONYL)PHENOXY]PHENYL}-2-(2,4,6- TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOLE This compound was prepared similarly to that of Example 901. LCMS: M+H: 612.5. By procedures similar to those in the preceding examples, the following examples (Examples 940 to 967) were prepared. EXAMPLE 940 5-{3-[2-(2-CHLORO-4-FLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H- INDAZOL-3-YL]PHENOXY}-3,4-DIHYDRONAPHTHALEN-l(2H)-ONE MS (ES) m/z 564.6; HPLC purity 99.6% at210-370 nm, 12.0 min.; Xterra RP18, 3.5u, 150 x 4.6 mm column, 1.2 mL/min, 85/15-5/95 (Ammon. Form. Buff. Ph=3.5/ACN+MeOH) for 10 min, hold 4 min. EXAMPLE 941 2-(2-CHLORO-4-FLUOROBENZYL)-3-(4-METHOXYPHENYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOLE MS (ES) m/z 434.7. EXAMPLE 942 2-(4-CHLORO-2-FLUOROBENZYL)-3-(4-METHOXYPHENYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOLE MS (ES) m/z 434.8. EXAMPLE 943 3-(4-METHOXYPHENYL)-2-(2,4,6-TRIFLUOROBENZYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOLE MS (ES) m/z 437.0. EXAMPLE 944 5-{3-[2-(2-CHLORO-4-FLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H- INDAZOL-3-YL]PHENOXY}QUINOLINE MS (ES) m/z 547.6. HPLC purity 100% at 210-370 nm, 11.8 min.; Xterra RP18, 3.5u, 150 x 4.6 mm column. 1.2 mL/min, 85/15-5/95 (Ammon. Form. Buff. Ph=3.5/ACN+MeOH) for 10 min., hold 4 min. EXAMPLE 945 5-{3-[2-(2-CHLORO-4-FLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENOXY}ISOQUINOLINE MS (ES) m/z 547.7. HPLC purity 97.4% at 210-370 nm, 11.8 min.; Xterra RP18, 3.5u, 150 x 4.6 mm column, 1.2 mL/min, 85/15-5/95 (Ammon. Form. Buff. Ph=3.5/ACN+MeOH) for 10 min., hold 4 min. EXAMPLE 946 4-{3-[2-(2-CHLORO-4-FLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H- INDAZOL-3-YL]PHENOXY}QUINAZOLINE MS (ES) m/z 548.6. HPLC purity 98.5% at 210-370 nm, 11.1 min.; Xterra RP18, 3.5u, 150 x 4.6 mm column, 1.2 mL/min, 85/15-5/95 (Ammon. Form. Buff. Ph=3.5/ACN+MeOH) for 10 min., hold 4 min. EXAMPLE 947 6-{3-[2-(2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3- YL]PHENOXY}-3,4-DIHYDRONAPHTHALEN-l(2H)-ONE MS (ES) m/z 566.8. HPLC purity 98.4% at 210-370 nm, 11.7 min.; Xterra RP18, 3.5u, 150 x 4.6 mm column, 1.2 mL/min, 85/15-5/95 (Ammon. Form. Buff. Ph=3.5/ACN+MeOH) for 10 min., hold 4 min. EXAMPLE 948 2-(2-CHLORO-4-FLUOROBENZYL)-3-[3-(5,6,7,8-TETRAHYDRONAPHTHALEN- 2-YLOXY)PHENYL]-7-(TRIFLUOROMETHYL)-2H-INDAZOLE MS (ES) m/z 550.7. HPLC purity 95.1% at 210-370 nm, 12.9 min.; Xterra RP18, 3.5u, 150 x 4.6 mm column, 1.2 mL/min, 85/15-5/95 (Ammon. Form. Buff. Ph=3.5/ACN-i-MeOH) for 10 min., hold 4 min. EXAMPLE 949 2-(2-CHLORO-4-FLUOROBENZYL)-3-[3-(5,6,7,8-TETRAHYDRONAPHTHALEN-l-YLOXY)PHENYL]-7-(TRIFLUOROMETHYL)-2H-INDAZOLE MS (ES) m/z 550.7. HPLC purity 100% at 210-370 nm, 12.8 min.; Xterra RP18, 3.5u, 150 x 4.6 mm column, 1.2 mL/min, 85/15-5/95 (Ammon. Form. Buff. Ph=3.5/ACN+MeOH) for 10 min., hold 4 min. EXAMPLE 950 2-{4-[2-(2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENYL}-1H-INDOLE-5-CARBONITRILE MS (ES) m/z 546.7. EXAMPLE 951 3-[4-(5-FLUORO-lH-INDOL-2-YL)PHENYL]-2-(2,4,6-TRIFLUOROBENZYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOLE MS (ES) m/z 539.7. EXAMPLE 952 5-{3-[2-(2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3- YL]PHENOXY}-3,4-DIHYDRONAPHTHALEN-l(2H)-ONE MS (ES) m/z 566.8. HPLC purity 100% at 210-370 nm, 11.7 min.; Xterra RP18, 3.5u, 150 x 4.6 mm column, 1.2 mL/min, 85/15-5/95 (Ammon. Form. Buff. Ph=3.5/ACN+MeOH) for lOmin, hold 4min. EXAMPLE 953 6-{3-[2-(2-CHLORO-4-FLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENOXY}-3,4-DIHYDRONAPHTHALEN-l (2H)-ONE MS (ES) m/z 564.7. HPLC purity 99.3% at 210-370 nm, 12.0 min.; Xterra RP18,3.5u, 150 \ 4.6 mm column, 1.2 mL/min, 85/15-5/95 (Ammon. Form. Buff. Ph=3.5/ACN+MeOH) for lOmin, hold 4min. EXAMPLE 954 3-[3-(5-BROMO-6-METHYL-lH-INDOL-2-YL)PHENYL]-2-(2,4,6- TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOLE MS(ES)m/z613.6. EXAMPLE 955 3-[4-(5-BROMO-6-METHYL-lH-INDOL-2-YL)PHENYL]-2-(2,4,6- TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOLE MS (ESI, [M-H]-)m/z711.7. EXAMPLE 956 l-METHYL-2-{4-[2-(2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YLJPHENYL} -1H-INDOLE-5-CARBONITRILE HRMS: calcd for C31H18F6N4 + H+, 561.15084; found (ESI, [M+H]+), 561.1509. EXAMPLE 957 3-[4-(5-FLUORO-l-METHYL-lH-INDOL-2-YL)PHENYL]-2-(2,4,6- TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOLE HRMS: calcd for C30H18F7N3 + H+, 554.14617; found (ESI, [M+H]+), 554.1463. EXAMPLE 95 8 6-{3-[2-(2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3- YL]PHENOXY}-3,4-DIHYDRONAPHTHALEN-l(2H)-ONE MS (ES) m/z 566.8. EXAMPLE 959 2-{4-[2-(2,4)6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3- YL]PHENYL}-lH-INDOLE-5-CARBONITRILE MS (ES) m/z 546.7. EXAMPLE 960 3-[4-(5-FLUORO-lH-INDOL-2-YL)PHENYL]-2-(2,4,6-TRIFLUOROBENZYL)-7- (TRIFLUOROMETHYL)-2H-INDAZOLE MS (ES) m/z 539.7. EXAMPLE 961 5-{3-[2-(2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YLJPHENOXY} -3,4-DIHYDRONAPHTHALEN-1 (2H)-ONE MS (ES) m/z 566.8. EXAMPLE 962 6-{3-[2-(2-CHLORO-4-FLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H- INDAZOL-3-YL]PHENOXY}-3,4-DIHYDRONAPHTHALEN-l(2H)-ONE MS (ES) m/z 564.7. EXAMPLE 963 METHYL (5-{3-[2-(2-CHLORO-4-FLUOROBENZYL)-7-(TRIFLUOROMETHYL)- 2H-INDAZOL-3-YL]PHENOXY}-l-HYDROXY-l ,2,3,4- TETRAHYDRONAPHTHALEN-1-YL)ACETATE MS (ESI) m/z 639. EXAMPLE 964 ETHYL [4-({3-[2-(2,4,6-TRIFLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOL- 3-YL]PHENOXY)METHYL)PHENYL]ACETATE MS (ES) m/z 598.8. EXAMPLE 965 (5-{3-[2-(2-GHLORO-4-FLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENOXY}-3,4-DIHYDRONAPHTHALEN-l-YL)ACETIC ACID MS (ES) m/z 606.8. EXAMPLE 966 ETHYL [4-({4-[2-(4-CHLORO-2-FLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H- INDAZOL-3-YL]PHENOXY}METHYL)PHENYL]ACETATE MS (ES) m/z 596.8. EXAMPLE 967 5-{3-[2-(4-GHLORO-2-FLUOROBENZYL)-7-(TRIFLUOROMETHYL)-2H-INDAZOL-3-YL]PHENOXY}-l ,2,3,4-TETRAHYDRONAPHTHALEN-1 -OL MS (ES) m/z 566.8. As those skilled in the art will appreciate, numerous changes and modifications may be made to the preferred embodiments of the invention without departing from the spirit of the invention. It is intended that all such variations fall within the scope of the invention. It is intended that each of the patents, applications, and printed publications including books mentioned in this patent document be hereby incorporated by reference in their entirety. This application claims priority benefit of U.S. Provisional Applications Serial Nos. 60/598,573, filed August 3, 2004, and 60/669,737, filed April 8, 2005, each of which is hereby incorporated herein by reference in its entirety. WE CLAIM: Indazoles having the general Formula (I) or (la): (Figure Remove) wherein: RI is Cue alkyl, CN, CO2R5, C(O)RS, CM alkenyl, C3.g cycloalkenyl, C2^ alkynyl, NR5R6, C(O)NRsRe, phenyl, thiophene, Ci-3 alkoxy, halogen, or S(O)kRs; wherein: said Ci-e alkyl is optionally substituted with from 1 to 7 substituents independently selected from the group consisting of halogen and OH; k is 0, 1 or 2; each RS and each Re is independently H, Q-e alkyl, Cs-g cycloalkyl, S(O)2-alkyl or arylalkyl; or each RS and each Re, together with the nitrogen atom to which they are attached, form independently: c) a 3 to 7 membered saturated ring that is optionally substituted with C,.3 alkyl, CH2OH, or C(=O)NH2; or d) a 3 to 7 membered ring containing in its backbone one or.two additional heteroatoms that is optionally substituted with up to three substituents independently selected from the group consisting of =O, CM alkyl, COQ-e alkyl, and CO2C^ alkyl; provided that when RI is S(O)kR5,then said R5 of said S(O)kRs is not S(O)2-aIkyl; R2 is C3.g alkyl, C3.g cycloalkyl, C2.g alkenyl, C3.g cycloalkenyl, C2.g alkynyl, NR7R8, aryl, arylalkyl, heteroaryl, heteroarylalkyl or heterocycloalkyl, wherein said C3.g alkyl, said C3.g cycloalkyl and said arylalkyl are each optionally substituted with up to four substituents independently selected from the group consisting of halogen, CN and OR?, and wherein said heteroaryl is optionally substituted with YD; or R2 is phenyl substituted with up to four substituents independently selected from the group consisting of Ci-s. alkyl, C2.g alkenyl, C2-s alkynyl, C\.i alkoxy, €3.8 cycloalkyl, halogen, OH, CH2OH, CN, NR7R8, N(R7)C(O)NR5R6, S(O)mR7, phenyl, NO2, C(O)R7, OC(O)RV, C(O)NR7R8, C(O)NR7D and YD, providing any OH group present is not in the para position; wherein: said C].3 alkyl and said Ci-3 alkoxy are each optionally substituted with from 1 to 7 fluorine atoms; m is 0 to 2; and Rs and Re are as previously defined; each R7 and each Rg is independently H or C\.3 alkyl; or each R7 and each Rg, together with the N atom to which they are attached, form independently: a) a 3 to 7 membered saturated ring which is optionally substituted with Ci.3 alkyl, CO2R|4, CH2CO2RM, OCH2CO2RM, CH2OCH2CO2R|4, C(O)NR,4Ri5, CH2OH, or CH2CH2OH; or b) a 3 to 7 membered ring containing in its backbone one or two additional heteroatoms that is optionally substituted with CH2CO2Ru; wherein RM and Risare each independently H or Cio alkyl; Y is a bond, CH2, CH2CH2, C2^ alkynylenyl, -O-, CH2OCH2, OCH2> CH2O, -N(R7)-, -N(COR7)-, S(O)J5 -N(R7)CH2-, -N(R7)CONRg-, -N(COR7)CH2-, S(0)jCH2,~ -CH2N(R7)CH2-, -CH2N(COR7)CH2-, -OCH2O-, -OC(R7)(CO2R8)- or -CH2S(O)jCH2-; wherein R7 and Rg are as previously defined; and j is 0, 1 or 2; D is tetrahydronaphthalene, tetrahydronaphthalol, tetralone, naphthalene, anthracene, benzyl or phenyl, each of which is optionally substituted with up to five independently selected R groups; each R is independently selected from the group consisting of Ci^ alkyl, C].3 alkoxy, halogen, -C(=O)H, -C(O)-C,.3 alkyl, CH2OH, CN, NH2, NO2, C2.4 alkenyl, C2-4 alkynyl. S(O),R9, and WX; wherein said Ci-6 alkyl and said C|.3 alkoxy are each optionally substituted with from 1 to 7 fluorine atoms; andj is 0, 1 or 2; or D is a heterocycloalkyl, heterocycloalkylalkyl, heteroarylalkyl, heteroaryl or arylalkyl group, each of which is optionally substituted with up to four independently selected R» groups; each Rg is independently selected from the group consisting of Cj.g alkyl, phenyl, benzyl, C3.g cycloalkyl C7.n arylalkyl, C|.3 alkoxy, halogen, -C(=O)H, -C(O)-CU3 alkyl, CH2OH, CN, NO2, NH2, OH, =O, C2.6 alkenyl, CM alkynyl, S(O)jR9 and WX; wherein said Ci.g alkyl, said C2^ alkenyl, said C2.4 alkynyl and said Ci-3 alkoxy are each optionally substituted with from 1 to 7 fluorine atoms; and j is 0, 1 or 2; W is a bond, -CH2-, -CH2CH2-, -NR7-, -Q-N(R7)-, -CHRg-, -(CHR8)2-, -CHR9-, -CR9Rio-, -CO-, -O-, -OCH2-, -OCHR9-, or -OCR9R|0-; wherein R? and Rg are as previously defined; and Q is Ci-6 alkylenyl; each Rg and each RIO is independently Ci_3 alkyl or OH; or any R9 and RIO, together with the atom to which they are attached, can form a 3 to 7 membered saturated ring that optionally contains one O, N or S atom; X is C02R,,, COR,,, C(R,,)2OH, CO2RS, C(O)NR5R6, NR5R6, QNR5C02R6, OH, CH2OH, CN, SO2NR5R6, P(O)(OR5)(OR6), cycloalkylalkyl, aryl, arylalkyl, heterocycloalkyl or heteroaryl, wherein: said aryl, said arylalkyl, said heterocycloalkyl and said heteroaryl are independently each optionally substituted with up to three substituents selected from the group consisting of Ci-3 alkyl, Ci-3 alkoxy,, halogen, H, OH, NO2and benzyl that is optionally substituted with up to five halogen atoms; wherein said Ci-3 alkyl and said Ci-3 alkoxy are each optionally substituted with from 1 to 7 fluorine atoms; Q is Ci-6 alkylenyl; RI i is H or Ci-e alkyl; and Rs and Re are as previously defined; R3 is C]-8 alkyl, C2.g alkenyl, C2.g alkynyl, Cs-g cycloalkyl, C3.g cycloalkenyl, phenyl, or ZA; wherein: said phenyl is optionally substituted with €1.3 alkyl; ZisCH2,CH2CH2,orCH2O; A is biphenyl, benzyl, naphthyl, pyridyl, 8-quinoIyl, C3.g cycloalkyl or phenyl; wherein said phenyl is optionally substituted with up to five independently selected Rig groups; wherein each said Rig is independently selected from the group consisting of CM alkyl, Ct-3 alkoxy, halogen, OH, NO2, CN, phenyh pyrrol-1-yl, C(O)R)2, CO2R)2, NRi2R13: C(O)NRi2R,3 and S(O)nRi2; wherein said Q-e alkyl and said Ci.3 alkoxy are each optionally substituted with from 1 to 7 fluorine atoms; n is 0, 1 or 2; and R]2 and Ri3 are each independently H or Ci.3 alkyl; R2o is H or C].3 alkyl; and R4 is H, halogen, methyl or methoxy; provided that when the compound has the structure (la), then R2 is phenyl or heteroaryl. each of which is substituted by YD, wherein YD is as previously defined; or a pharmaceutical ly acceptable salt thereof. 2. A compound as claimed in claim 1 wherein RI is C\* alkyl, CN, CO2R5, NR5R*. or halogen; wherein said Ci_6 alkyl is optionally substituted with from 1 to 7 substituents independently selected from the group consisting of halogen and OH; and RS and R6 are as previously defined. 3. A compound as claimed in claim 1 wherein RI is CN, halogen, or d-e alkyl substituted with from 1 to 7 fluorine atoms. 4. A compound as claimed in claim 1 wherein RI is Ci_3 perhaloalkyl. 5. A compound as claimed in claim 1 wherein RI is CF3, F or Cl. 6. A compound as claimed in claim 1 wherein RI is CF3. 7. A compound as claimed in any one of claims 1 to 6 wherein: R2 is Ca.g alkyl, C3.8 cycloalkyl, aryl, arylalkyl, heteroaryl or heterocycloalkyl; wherein said €3.8 alkyl, said €3.8 cycloalkyl and said arylalkyl are each optionally substituted with up to four substituents independently selected from the group consisting of halogen, CN and OR?; and said heteroaryl is optionally substituted with YD; wherein Y and D are as previously defined; or R2 is phenyl substituted with up to four substituents independently selected from the group consisting of Cio alkyl, C2.g alkenyl, C2.s alkynyl, Cu alkoxy, Ci-s cycloalkyl, halogen, OH, CH2OH, CN, NR7R8, N(R7)C(O)NRsR6, S(O)mR7, phenyl, NO2, C(O)R7, OC(O)R7, C(O)NR7R8) C(O)NR7D and YD, providing any OH group present is not in the para position; wherein said Ci-3 alkyl and said do alkoxy are each optionally substituted with from 1 to 7 fluorine atoms; and m. RS. Re, R7, RS, Y and D are as previously defined. 8. A compound as claimed in any one of claims 1 to 6 wherein R2 is arylalkyl, heteroaryl or heteroarylalkyl, wherein: said arylalkyl is optionally substituted with up to four substituents independently-selected from the group consisting of halogen, CN and OR7; and said heteroaryl is optionally substituted with YD; or R2 is phenyl substituted with up to four substituents independently selected from the group consisting of Q.3 alkyl, do alkoxy, halogen, CH2OH, CN, NR7Rg, N(R7)CONR5R6, S(O)mR7, NO2) and YD; wherein said Ci.3 alkyl and said C|.3 alkoxy are each optionally substituted with from 1 to 7 fluorine atoms; m, R5, R*,, R7, and RS are as previously defined; Y is a bond, CH2, CH2CH2, CM alkynylenyl, -O-, OCH2, CH2O. -N(R7)-, -N(R7)CH2-, -N(R7)CONR8-, -OCH2O- or -OC(R7)(CO2Rg)-; wherein R7 and RS are as previously defined; D is benzyl or phenyl, each of which is optionally substituted with up to five independently selected R groups; each R is independently selected from the group consisting of C|^ alkyl, CM-alkoxy, halogen, -C(=O)H, -C(O)-Ci.3 alkyl, CH2OH. CN, NO2, C2.4 alkenyl, C2.4 alkynyl, S(O)jR9, and WX; wherein said C|. e alkyl and said C|.3 alkoxy are each optionally substituted with from 1 to 7 fluorine atoms; and j, Rg and WX are as previously defined; or D is a heterocycloalkyl, heteroarylalkyl, heteroaryl, or arylalkyl group, each of which is optionally substituted with up to four independently selected Rg groups; each Ra is independently selected from the group consisting of C\j alkyl, phenyl, benzyl, Cj.\\ arylalkyl, 'Ci.3 alkoxy, halogen, C(O)H, CO(CH3)2, C(CH3)2OH, -C(O)-Ci-3 alkyl, CH2OH, CN, NO2, NH2, OH, =O, C2.6 alkenyl, C2-4 alkynyl, S(O)jR9, and WX; wherein said Ci-s alkyl, said C2-6 alkenyl, C2-4 alkynyl and said Ct.3 alkoxy are each optionally substituted with from 1 to 7 fluorine atoms; and j, RQ and WX are as previously defined. 9. A compound as claimed in any one of claims 1 to 7 wherein R2 is phenyl substituted with an ortho or meta OH. 10. A compound as claimed in any one of claims 1 to 7 wherein R2 is phenyl substituted with a meta OH. 11. A compound as claimed in any one of claims 1 to 7 wherein: R2 is phenyl substituted with up to four substituents independently selected from the group consisting of C 1.3 alkyl, C2.g .alkenyl, C2.g alkynyl, Cio alkoxy, C3.s cycloalkyl, halogen, OH, CH2OH, CN, NR7Rg-, N(R7)C(O)NR5R6, S(O)mR7. phenyl, NO2, C(O)R7, OC(O)R7, C(O)NR7R8) C(O)NR7D and YD, providing any OH group present is not in the para position; wherein said C].3 alkyl and said Q.3 alkoxy are each optionally substituted with from 1 to 7 fluorine atoms; and m. RS, Re, R7, Rg, Y and D are as previously defined. 12. A compound as claimed in any one of claims 1 to 8 wherein R2 is phenyl substituted with YD. 13. A compound as claimed in claim 12 wherein Y is a bond, CH2, CH2CH2. alkynylenyl, -O-, OCH2, CH2O, -N(R7)-, -N(R7)CH2-, -N(R7)CONR8-, -OCH2O-or -OC(R7)(C02Rg). 14. A compound as claimed in claim 12 or claim 13 wherein D is benzyl or phenyl, each of which is optionally substituted with up to five independently selected R groups; each R is independently selected from the group consisting of C|^ alkyl, Ci.3 alkoxy, halogen, -C(=O)H, -C(O)-C|.3 alkyl, Cn alkyl, C|_3 alkoxy, halogen, C(=O)H, Cw acyl, CH2OH, CN, NO2, C2^ alkenyl, C2-4 alkynyl, S(O)jR9, and WX; wherein said Ci^ alkyl and said Cio alkoxy are each optionally substituted with from 1 to 7 fluorine atoms; and j, Rg and WX are as previously defined. 15. A compound as claimed in claim 12 or claim 13 wherein D is phenyl that is optionally substituted with up to four independently selected R groups; each R is independently selected from the group consisting of Ci_6 alkyl, -C(=O)H, -C(O)- Ci-3 alkyl, Ci.3 alkoxy, halogen, CH2OH, CN, NO2, CM alkenyl, C2^ alkynyL and WX; wherein said Ci^ alkyl and said Q.3 alkoxy are each optionally substituted with from 1 to 7 fluorine atoms; and wherein WX is previously defined. 16. A compound as claimed in any one of claims 1 to 8 or 11 wherein R2 is-phenyl substituted with CM perfluoroalkyl. 17. A compound as claimed in any one of claims 1 to 8, 14 or 15 wherein R or Ra is C|.3 perfluoroalkyl or Q_3 perfluoroalkoxy. 18. A compound as claimed in any one of claims 1 to 6 wherein R2 is selected from the group consisting of 2,4-dimethoxyphenyl, phenyl, 4-methoxy-2-methylphenyl, 2-methoxyphenyl, 4-methoxyphenyl, 2-methylphenyl, 2,4-dimethylphenyl, 1,1'- biphenyl-4-yI, 4-methoxy-3,5-dimethylphenyl, 2-naphthyl, 2-vinylphenyl. 4- methoxy-3-methylphenyl, 3-methylphenyl, 2,3-dimethylphenyl, 3- (trifluoromethyl)phenyl, 4-fluorophenyl, 3-chlorophenyl, 3-methoxyphenyl, benzaldehyde-2-yI, 2-isopropylphenyl, 2-cyclohexylphenyl, 2-benzylphen\ I. 2- (l,l,2,2-tetrafluoroethoxy)phenyl, 2-chlorO'5-fluorophenyl, 9H-fluoren-2-yl. 4- benzylphenyl, bcnzaldehyde-3-yl, 3-hydroxyphenyl, butyl, isobutyl, pentyl, cyclopentyl, 2-hydroxyphenyl, l,3-dioxolan-2-yl, 4'-methoxy-l,l'-biphenyl-4-yl, l,l'-biphenyI-4-ol, cyclohexanyl, 4-methoxy-2-methylphenyl, 4-methoxy-2- methylphenyl, 4-bromophenyl, 3-bromophenyl, 3-(benzyloxy)phenyl, 2- hydroxyphenyl, N-cyclohexamino, and 4-phenoxy-phenyl. 19. A compound as claimed in any one of claims 1 to 18, wherein: R3 is phenyl optionally substituted with Ci-3 alkyl, or ZA; wherein: ZisCH2;and A is pyridyl or phenyl, wherein said phenyl is optionally substituted with up to five independently selected R|g groups; wherein each said R|g is independently selected from the group consisting of C^ alkyl, d.3 alkoxy, halogen, OH, NO2, and CN; wherein said Q 4. alkyl and said Ci_3 alkoxy are each optionally substituted with from 1 to 7 fluorine atoms. 20. A compound as claimed in any one of claims 1 to 18, wherein R3 is phenyl optionally substituted with C|.3 alkyl or ZA. 21. A compound as claimed in claim 20, wherein A is phenyl that is optionally substituted with up to five independently selected Rig groups; wherein each said RIS is independently selected from the group consisting of Q-e alkyl, Ci_3 alkoxy, halogen, OH, NO2, CN, phenyl, pyrrol-1-yl, C(O)Ri2, CO2R|2, NR)2R|3, C(O)NRi2Rj3, and S(O)nRi2; wherein said Ci_6 alkyl and said Ci.3 alkoxy are each optionally substituted with from 1 to 7 fluorine atoms; and n, R]2 and R)3 are as previously defined. 22. A compound as claimed in any one of claims 1 to 18 wherein R3 is ZA; wherein: Z is CH2; and A is phenyl, wherein said phenyl is optionally substituted with up to five independently selected Rig groups; wherein each said Rig is independently selected from the group consisting of C|-6 alkyl, Cj.3 alkoxy, halogen, OH, NO2, and CN; wherein said Ci_6 alkyl and C).3 alkoxy are each optionally substituted with from 1 -to 7 fluorine atoms. 23. A compound as claimed in any one of claims 19 to 22 wherein Rt8 is Ci-3 perfluorpalkyl. 24. A compound as claimed in any one of claims 1 to 18, wherein R3 is selected from the group consisting of 2-allyl, propyl, cyclopentyl, isobutyl, cyclohexylmethyl, 2- ethylbutyl, cyclobutyl, benzyl, 3-methoxybenzyl, 2-naphthylmethyl, 4- methylbenzyl, 2-nitrobenzyl, 2-(trifluoromethyl)benzyl, 4-bromobenzyl, 3-(difluoromethoxy)benzyl, 3-(trifluoromethoxy)benzyl, 3,5-difluorobenzyl, 3,5-dimethylbenzyl, quinolinylmethyl, 2-chloro-4-fluorobenzyl, 3-(lH-pyrrol-l-yl)benzyl, 2-bromobenzyl, 2-methylbenzyl, 5-fluoro-2-methylbenzyl, 6-chloro-2-fluoro-3-methyIbenzyl, l,l'-biphenyI-3-ylmethyl, 2-chlorobenzyi, I-naphthylmethyl, 2,5-dichlorobenzyl, (difluoromethoxy)benzyl, 3-fluorobenzyl, 4-methylbenzyl, 2,4-dimethylbenzyl, mesitylmethyl, 2, 4-dimethylbenzyl, 2-phenylethyl, 2-chloro-6-fluorobenzyI,^-chloro^^fluorobenzyl, 4-fluorobenzyl, 4-(methylsulfonyl)benzyl, and phenyl. 25. A compound as claimed in any one of claims 1 to 24 wherein R4 is H or F. 26. The compound as claimed in claim 1 wherein: RI is C|.6 alkyl, CN, COjRs, NRsRe, halogen; wherein said Ci^ alkyl is optionally substituted with from 1 to 7 substituents independently selected from the group consisting of halogen and OH; Rs and Re are as previously defined; R2 is as previously defined; RS is phenyl optionally substituted with Cu alkyl, or ZA; wherein: ZisCH2;and A is pyridyl or phenyl, wherein said phenyl is optionally substituted with up to five independently selected Rjs groups; wherein each said R)8 is independently selected from the group consisting of C|^ alkyl, C|.3 alkoxy, halogen, OH, NO2, and CN; wherein said C\* alkyl and said C|.3 alkoxy are each optionally substituted with from 1 to 7 fluorine atoms; and R4 is H or halogen. 27. A compound as claimed in claim 1 wherein: RI is Ci^ alkyl, CN, or halogen; wherein said Ci^ alkyl is optionally substituted with from 1 to 7 fluorine atoms; R2 is arylalkyl, heteroaryl or heteroarylalkyl, wherein: said arylalkyl is optionally substituted with up to four substituents independently selected from the group consisting of halogen, CN and OR?; and said heteroaryl is optionally substituted with YD; wherein R7, Y and Dare as previously defined; or R2 is phenyl substituted with up to four substituents independently selected from the group consisting of CM alkyl, €1.3 alkoxy, halogen, CH2OH, CN, NR7Rg, N(R7)CONR5R'.'.-- .'.'•"- ot) 3-{3-[(2,4-dichlorophenyl)ethynyl]phenyl}-2-(2,4,6-trifluorobenzyl)-7- (trifluoromethyl)-2H-indazole; ou) 3-{3-[2-(2,4-dichlorophenyl)ethyl]phenyI}-2-(2,4,6-trifluorobenzyl)-7- (trifluoromethyl)-2H-indazole; ov) 2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyl)-3-(3-{[2- (trifluoromethyl)phenyl]ethynyI}phenyl)-2H-indazole; ow) 2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyl)-3-(3-{2-[2- (trifluoromethyl)phenyl]ethyl}phenyl)-2H-indazole; ox) 3-[l-(2-chloro-6-fluorobenzyI)-lH-indol-5-yl]-2-(2,4,6-trifluorobenzy!)- 7-(trifluoromethyl)-2H-indazole; oy) 3-[l-(2,6-difluorobenzyl)-lH-indol-5-yl]-2-(2,4,6-trifluorobenzyl)-7- (trifluoromethyl)-2H-indazole; oz) 3-{3-[2-(2,5-dichlorophenyl)ethyl]phenyl}-2-(2,4,6-trifluorobenzyI)-7- (trifluoromethyI)-2H-indazole; pa) 3-[3-(2-phenylethyl)phenyl]-2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyl)- 2H-indazole; pb) 3-[l-(2,6-dichlorobenzyl)-lH-indol-5-yl]-2-(2,4,6-trifluorobenzyl)-7- (trifluoromethyl)-2H-indazole; pc) . 3-[l-(2-chloro-4-fluorobenzyl)-lH-indol-5-yl]-2-(2,4,6-trifluorobenzyl)- 7-(trifluoromethyl)-2H-indazole; pd) 3-(3-{[2-chloro-5-(trifluoromethyl)phenyl]ethynyl}phenyl)-2-(2,4,6- trifluorobenzyl)-7-(trifluoromethyl)-2H-indazole; pe) 3- {3-[(2-bromo-5-fluorophenyl)ethynyl]phenyl} -2-(2,4,6- trifluorobenzyl)-7-(trifluoromethyl)-2H-indazole; pO 3-(3-{2-[2-chIoro-5-(trifluoromethyl)phenyl]ethyI}phenyl)-2-(2,4,6- trifluorobenzyl)-7-(trifluoromethyl)-2H-indazole; pg) 3-{3-[2-(2-bromo-5-fluorophenyl)ethyl]phenyl}-2-(2,4,6-trifluorobenzyl)- 7-(trifluoromethyl)-2H-indazole; ph) 3-{3-[2-(3-fluorophenyl)ethyl]phenyl}-2-(2,4,6-trifluorobenzyl)-7- (trifluoromethyl)-2H-indazole; pi) 4-amino-3-({3-[2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyl)-2H-indazol- 3-yl]phenyl}ethynyl)benzonjtrile; PJ) 3-{3-[(3-chlpro-2-fluorophenyl)ethynyl]phenyl}-2-(2,4,6- trifluorobenzyl)-7-(trifluoromethyl)-2H-indazole; pk) [3-({3-[2-(2,,4,6-trifluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]phenyl}ethynyl)phenyl]methanol; pi) 4-amino-3-(2-{3-[2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyl)-2H- indazol-3-yI]phenyl}ethyl)benzonitrile; pm) 3-{3-[(2,3-dichlorophenyl)ethyny!]phenyl}-2-(2,4,6-trifluorobenzyl)-7- (trifluoromethyl)-2H-indazole; pn) 3-{l-[5-chloro-2-(trifluoromethyl)benzyl]-lH-indol-6-yl}-2-(2,4,6- tri fluorobenzy l)-7-(tri fluoromethyl)-2H-indazo le; po) 3-(l-benzyl-lH-indol-6-yl)-2-(2)4,6-trifluorobenzyl)-7-(trifluoromethyl)- 2H-indazole; pp) 3-[l-(2,6-dichlorobenzyl)-lH-indol-6-yl]-2-(2,4,6-trifluorobenzyl)-7- (trifluoromethyl)-2H-indazole; pq) 3-[l-(2-chloro-4-fluorobenzyl)-lH-indol-6-yl]-2-(2,4,6-trifluorobenzyl)- 7-(trifluoromethyl)-2H-indazole; pr) 3-[l-(2-chIorobenzyl)-lH-indol-6-yl]-2-(2,4,6-trifluorobenzyl)-7- (trifluoromethyl)-2H-indazole; ps) 3-[l-(2-chloro-6-f!uorobenzyl)-lH-indol-6-yl]-2-(2,4,6-trifluorobenzyl)- 7-(trifluoromethyl)-2H-indazole; pt) 3-[l-(2,6-difluorobenzyl)-lH-indol-6-yl]-2-(2,4,6-trifluorobenzyl)-7- (trifluoromethyl)-2H-indazole; pu) 3-[l-(2-fluorobenzyl)-lH-indol-6-yl]-2-(2,4,6-trifluorobenzyl)-7- (trifluoromethyl)-2H-indazole; pv) 3-[l-(2,4-difluorobenzyI)-lH-indol-6-yI]-2-(2,4,6-trifluorobenzyl)-7- (trifluoromethyl)-2H-indazole; pw) 3-[l-(4-chlorobenzyl)-lH-indol-6-yl]-2-(2,4,6-trifluorobenzyl)-7- (trifluoromethyl)-2H-indazole; px) 3-{3-[2-(2,3-dichlorophenyl)ethyl]phenyl}-2-(2,4,6-trifluorobenzyl)-7- (trifluoromethyi)-2H-indazole; py) 3-{3-[2-(3-chloro-2-fluorophenyl)ethyl]phenyl}-2-(2,4,6-trifluorobenz\i)- 7-(trifluoromethyl)-2H-indazole; pz) [3-(2-{3-[2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]phenyl}ethyl)phehyl]methanol; qa) 3-(4-ethynylphenyl)-2-(2>4,6-trifluorobenzyl)-7-(trifluor9methyl)-2H- indazole; qb) ethyl 3-({4-[2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]phenyl}ethynyl)benzoate; qc) 3-({4-[2-(2,4;5-trifluorobenzyl)-7-(triflubromethyl)-2H-indazol-3- yljphenyl} ethynyl)benzoic acid; qd) N-[3-({3-[2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]phenyl}ethynyl)phenyl]morphoIine-4-carboxamide; qe) tert-butyl 4-({[3-({3-[2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyl)-2H- indazol-3-yl]phenyl} ethyny I)phenyl]am ino} carbonyl)piperazine-1 - carboxylate; qf) 2-methyl-N-[3-({3-[2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyl)-2H- indazol-3-yl]phenyl}ethynyl)phenyl]piperidine-l-carboxamide; qg) 3-methyl-N-[3-({3-[2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyI)-2H- indazol-3-yl]phenyl}ethynyl)phenyl]piperidine-l-carboxamide; qh) 4-methyl-N-[3-({3-[2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyl)-2H- indazol-3-yl]phenyl}ethynyl)phenyl]piperidine-l-carboxamide; qi) 3-(hydroxymethyJ)-N-[3-({3-[2-(2,4,6-trifluorobenzyl)-7- (trifluoromethyl)-2H-indazol-3-yl]phenyl}ethynyl)phenyl]piperidine-l- carboxamide; qj) N-isopropyl-N'-[3-({3-[2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyl)-2H- indazoI-3-yl]phenyl}ethynyl)phenyl]urea; qk) N,N-dipropyl-N'-[3-({3-[2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyl)-2H- indazol-3-yl]phenyl}ethynyI)phenyl]urea; ql) N-methy!-N'-[3-({3-[2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyl)-2H- indazol-3-yl]phenyl}ethynyl)phenyl]urea; qm) N,N-dimethyl-N'-[3-({3-[2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyl)- 2H-indazol-3-yl]phenyI}ethynyl)phenyl]urea; qn) 3-(4-{[2-chloro-5-(trifluoromethyI)phenyI]ethynyl}phenyl)-2-(2,4,6- trifluorobenzyl)-7-(trifluoromethyl)-2H-indazoIe; qo) 3-{4-[(2,4-difluorophenyl)ethynyl]phenyl}-2-(2,4,6-trifluorobenzyl)-7- (trifluoromethyl)-2H-indazole; qp) 3-{4-[(3,5-dimethylphenyl)ethynyl]phenyl}-2-(2,4,6-trifluorobenzyl)-7- (trifluoromethyl)-2H-indazole; qq) 3-{4-[(3-chloro-2-fluorophenyl)ethynyl]phenyl}-2-(2,4,6- trifluorobenzyl)-7-(trifluoromethyl)-2H-indazole; qr) 3-{4-[(2,3-dichIorophenyl)ethynyl]phenyl}-2-(2,4,6-trifluorobenzyl)-7- (trifluoromethyl)-2H-indazole; qs) 3-{4-[(2,3-dimethylphenyl)ethynyl]phenyl}-2-(2,4,6-trifluorobenzyl)-7- (trifluoromethyl)-2H-indazole; qt) tert-butyl 4-[3-({4-[2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyl)-2H- indazol-3-yl]phenyl}ethynyl)benzoyl]piperazine-l-carboxylate; qu) 3-(3-bromophenyl)-2-(4-chloro-2-fluorobenzyl)-7-(trifluoromethyl)-2H- indazole; qv) l-melhyl-3-[3-({3-[2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyl)-2H- indazol-3-yl]phenyl}ethynyl)phenyl]imidazolidin-2-one; qw) methyl [3-({3-[2-(2,4,6-trifluorobenzyI)-7-(trifluoromethyl)-2H-indazol- 3-yl]phenyl}ethynyl)phenyl]carbamate; qx) N-(methylsulfonyl)-N-[3-({3-[2-(2,4,6-trifluorobenzyl)-7- (trifluoromethyl)-2H-indazol-3- yl]phenyl}ethynyl)phenyl]methanesulfonamide; qy) 3-[3-(pyridin-3-ylethynyl)phenyl]-2-(2,4,6-trifluorobenzyl)-7- (trifluoromethyl)-2H-indazole; qz) 3-[3-(pyridin-4-ylethynyl)phenyl]-2-(2,4,6-trifluorobenzyl)-7- (trifluoromethyl)-2H-indazole; ra) 6-methyl-2-({3-[2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyl)-2H-indazol- 3-yl]phenyl}ethynyl)pyridin-3-ol; rb) 3-[3-(pyridin-2-ylethynyl)phenyl]-2-(2,4,6-trifluorobenzyl)-7- (trifluoromethyl)-2H-indazole; re) 2-({3-[2-(2,4,6-trifluorobenzyI)-7-(trifluoromethyI)-2H-indazol-3- yl]phenyl}ethynyl)pyridin-3-ol; rd) 2-{[3-[l-(2,6-dichlorobenzyl)-lH-indol-6-yl]-7-(trifluoromethyl)-2H- indazol-2-yl]methyl}-3,3-difluorophenol; re) 2-{[3-[l-(2-chloro-6-fluorobenzyl)-lH-indol-6-yl]-7-(trifluoromethyl)- 2H-indazol-2-yl]methyl}-3,5-difluorophenol; rf) tert-butyl 6-methyI-5-{3-[2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyI)- 2H-indazol-3-yl]phenoxy}-lH-indole-l-carboxylate; rg) tert-butyl 6-fluoro-5-{3-[2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyl)- 2H-indazol-3-yl]phenoxy}-lH-indole-l-carboxylate; rh) 5-{3-[2-(4-chloro-2-fluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy} -3,4-dihydronaphthalen-1 (2H)-one; ri) 3-(3-bromophenyl)-2-(2-chloro-4-fluorobenzyl)-7-(trifluoromethyl)-2H- indazole; rJ) 3-{3-[4-(morpholin-4-ylsulfonyl)phenoxy]phenyl}-2-(2,4,6- trifluorobenzyI)-7-(trifluoromethyl)-2H-indazole; rk) 3-{3-[4-(pyrrolidin-l-ylsulfonyl)phenoxy]phenyl}-2-(2,4,6- trifluorobenzyl)-7-(trifluoromethyl)-2H-indazole; rl) N-propyl-4-{3-[2-(2,4,6-trifluorobenzyl)-7-(trifluororaethyl)-2H-inda/.ol- 3-yl]phenoxy} benzenesulfonamide; rm) N-ethyl-N-methyl-4-{3-[2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyl)-2H- indazol-3-yl]phenoxy}benzenesulfonamide; rn) N,N-diethyI-4-{3-[2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyl)-2H- indazol-3-yl]phenoxy}benzenesulfonamide; ro) 3-{3-[4-(piperidin-l-ylsulfonyl)phenoxy]phenyl}-2-(2,4,6- trifluorobenzyl)-7-(trifluoromethyl)-2H-indazole; rp) N,N-dimethyl-4-{3-[2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyl)-2H- indazol-3-yl]phenoxy} benzenesulfonamide; rq) 4-fluoro-2-({3-[2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyl)-2Fl-indazol- 3-yl]phenyl}ethynyl)aniline; rr) 4-chloro-2-fluoro-6-({3-[2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyl)-2H- indazol-3-yl]phenyl}ethynyl)aniline; rs) methyl [4-fluoro-2-({3-[2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyl)-2H- indazol-3-yl]phenyl}ethynyl)phenyl]carbamate; rt) 3-[3-(5-nuoro-lH-indol-2-yi)phenyl]-2-(2,4,6-trifluorobenzyl)-7- (trifluoromethyl)-2H-indazole; ru) 3-[3-(5-fluoro-l-methyl-lH-indol-2-yl)phenyl]-2-(2,4,6-trifluorobenzyD- 7-(trifluoromethyl)-2H-indazole; rv) 2-benzyl-3-(4-methoxyphenyl)-7-(trifluoromethyl)-2H-indazole; rvv) 2-benzyl-3-ethyl-7-(trifluoromethyl)-2H-indazoIe; rx) 4-[({3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]benzyl}oxy)methyl]benzoicacid; ry) N-{4-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3-yl]phenyl}-N- phenylamine; rz) [4-({3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenyl}amino)phenyl]acetic acid; sa) [4-({-4-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenyl}amino)phenyl]aceticacid; sb) 2-benzyl-3-[4-(benzyloxy)phenyl]-7-(trifluoromethyl)-2H-indazole; sc) 3-[4-({4-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenyl}amino)phenyl]propanoic acid; sd) 3-[4-({3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenyl}amino)phenyl]propanoic acid; se) 3-[3-({4-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenyl}amino)phenyl]propanoic acid; sO 3-[3-({3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenyl}amino)phenyl]propanoic acid; sg) 2-[4-({4-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenyl}amino)phenoxy]-2-methylpropanoicacid; sh) 2-[4-({3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenyl}amino)phenoxy]-2-methylpropanoicacid; si) 2-{4-[({4-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenyl}amino)methyl]phenyl}propanoic acid; sj) ethyl [4-({4-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3 yl]phenyl}amino)phenyl]acetate; sk) methyl 3-[3-({4-[2-benzyl-7-(trifluoromethyl)-2H-indazol-5- yl]phenyl}amino)phenyl]propanoate; si) methyl 3-[3-({3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenyl}amino)phenyl]propanoate; sm) methyl 2-[4-({4-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenyl}amino)phenoxy]-2-methylpropanoate; sn) methyl 2-[4-({3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-?- yI]phenyl}amino)phenoxy]-2-methylpropanoate; so) methyl 2-{4-[({4-[2-benzyI-7-(trifluoromethyl)-2H-indazol-3- yl] pheny 1} am ino)methyl] phenyl} propanoate; sp) 2-[4-({4-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}methyl)phenyl]propanoic acid; sq) methyl 2-{4-[({3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl] pheny 1} amino)methyl]phenyl} propanoate; -sr) 2-{4-[({3-[2-benzyI-7-(trifluoromethyl)-2H-indazol-3- yl]phenyl}amino)methyl]phenyl}propanoicacid; ss) methyl 3-[3-({3-[2-benzyI-7-(trtfluoromethyl)-2H-indazol-3- yl]phenyl}amino)phenyl]butanoate; st) methyl 3-[4-({3-[2-benzyl-7-(trifluorornethyl)-2H-indazol-3- yl]phenyl}amino)phenyl]butanoate; su) methyl : {4-[({3-[2-benzyl-7-(trifluoromethyI)-2H-indazol-3- yl]phenyl}amino)methyl]phenyl} acetate; sv) methyl [3-({4-[2-benzyl-7-(trifluoromethyl)-2H-indazoI-3- yl]phenyl}amino)phenyl]acetate; sw) methyl [3-({3-[2-benzyI-7-(trifluoromethyl)-2H-indazol-3- yl]phenyl}amino)phenyl]acetate; . sx) 3-[3-({3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenyl}amino)phenyl]butanoic acid; sy) 3-[4-({3-[2-benzyl-7-(trifluoromethyl)-2H-indazoI-3- yl]phenyl}amino)phenyl]butanoic acid; sz) [3-({3-[2-benzyl-7-(trifluoromethyl)-2H-indazoI-3- yl]phenyl}amino)phenyl]acetic acid; ta) [3-({4-[2-benzyl-7-(trifluoromethyI)-2H-indazol-3- yl]phenyl}amino)phenyl]acetic acid; tb) {4-[({3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenyl}amino)methyl]phenyl}acetic acid; tc) 1 -[4-({3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}methyl)phenyl]cyclopentanecarboxylic acid; td) 2-[4-({3-[2-bcnzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}methyl)phenyl]-2-methylpropanoic acid; te) {3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3-yl]phenyl}amine; if) {4-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3-yl]phenyl}amine; tg) methyl 2-[3-({4-[2-benzyl-7-(trifluoromethyI)-2H-indazol-3- yl]phenyl}amino)phenyl]propanoate; th) methyl {4-[({4-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenyl} amino)methyl]phenyl} acetate; ti) 2-[3-({4-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenyl}amino)phenyl]propanoic acid; tj) (4-[({4-[2-benzyI-7-(trifluoromethyl)-2H-indazol-3- - yl]phenyl}amino)methyl]phenyl}acetic acid; tk) methyl 2-[3-({3-[2-benzyl-7-(trifluoromethyl)-2H-indazoI-3- yl]phenyl}amino)phenyl]propanoate; tl) 2-[3-({3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenyl}amino)phenyl]propanoic acid; tm) 2-benzyl-3-(3-{[4-(l H-tetrazol-5-yl)benzyl]oxy}phenyl)-7- (trifluoromethyl)-2H-indazole; tn) ethyl hydrogen [4-({3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy)methyl)benzyl]phosphonate; to) ethyl {3-[({4-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenyl}amino)methyl]phenyl} acetate; tp) ethyl {3-[({3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenyl}amino)methyl]phenyl}acetate; tq) methyl l-{4-[({4-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenyl}amino)methyl]phenyl}cyclopropanecarboxylate; tr) methyl l-{4-[({3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- y IJphenyl Jam ino)methyl] phenyl} eye lopropanecarboxy late: ts) 4-({3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy} methyl)benzonitri le; tt) {3-[({4-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenyl}amino)methyl]phenyl}acetic acid; tu) (3-[({3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenyl}amino)methyl]phenyl}acetic acid; tv) l-{4-[({3-[2-bcnzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenyl}amino)methyl]phenyl}cyclopropanecarboxylic acid; tvv) N-{3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3-yl]phenyI}-N-(2.6- dimethylbenzyl)amine; tx) [3-({4-[2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyl)-2H-indazoI-3- yl]phenyl} amino)phenyl]acetic acid; ty) 2-[3-({4-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenyi}aminb)phenyl]-2-hydrbxypropan6ic acid; tz) N-{4-[2-berizyl-7-(trifluoromethyl)-2H-indakol-3-yl]phenyl}-N-(2,6- dimethylbenzyl)amine; ua) [3-({4-[l-rnethyl-7-(trifluoromethyl)-lH-ind"zol-3- yl]phenyl}amino)phenyl]acetic acid; ub) [3-({4-[2-methyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenyl}amino)phenyl]aceticacid; uc) {4-[({4-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenyl}amino)methyl]-3,5-dimethylphenyl}acetic acid; ud) {4-[({3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenyl}amino)methyl]-3,5-dimethylphenyl}acetic acid; ue) [3-({4-[2-(4-chloro-2-fluorobenzyl)-7-(trifluoromethyI)-2H-indazol-3- yl]phenyl}amino)phenyl]aceticacid; uO [3-({4-[2-(2,4-dimethylbenzyI)-7-(trifluoromethyl)-2H-indazol-3- yl]phenyl}amino)phenyl]aceticacid; ug) {3-[2-(4-chloro-2-fluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}(phenyl)acetic acid; uh) 2-benzyl-3^{3-[(2,5-difluorophenoxy)methyl]phenyl}-7-(trifluoromethyI)- 2H-indazole; ui) 2-(4-chloro-2-fluorobenzyl)-3-[3-(4-methoxybenzyl)phenyl]-7- (trifluoromethyl)-2H-indazole; uj) 2-(4-chloro-2-fluorobenzyl)-3-[3-(3,5-dimethoxybenzyl)phenyl]-7- (trifluoromethyl)-2H-indazole; uk) 2-(4-chloro-2-fluorobenzyl)-3-[3-(3,5-dimethylbenzyl)phenyl]-7- (trifluoromethyl)-2H-indazole; ul) 2-(4-chloro-2-nuorobenzyl)-3-{3-[(2,3- dimethylphenoxy)methyl]phenyl}-7-(trifluoromethyl)-2H-indazole; urn) 2-(4-chloro-2-fluorobenzyl)-3-(3-{[2-chIoro-5- (trifluoromethyI)phenoxy]methyI}phenyl)-7-(trifluoromethyl)-2H- indazole; un) 2-(4-chIpro-2-fluorobenzyl)-3-(3-{[2-chloro-3- (trifluoromethyl)phenoxy]methyl}phenyl)-7-(trifluoromethyI)-2H- indazole; uo) 2-(4-chloro-2-fluorobenzyI)-3-{3-[(l-naphthyloxy)methyl]phenyl}-7- (trifluororriethyl)-2H-indazole; up) 3-{3-[(2-tert-butyl-5-methylphenoxy)methyl]phenyl}-2-(4-chIoro-2- fluorobenzyl)-; uq) 7-(trifluoromethyl)-2H-indazole; ur) 2-(4-chIoro-2-fluorobenzyI)-3-{3-[(4-fluoro-2- methylphenoxy)methyl]phenyl}-7-(trifluoromethyl)-2H-indazole; us) 2-(4-chloro-2-fluorobenzyl)-3-{3-[(2,6- dimethylphenoxy)methyl]phenyl} -7-(trifluoromethyl)-2H-indazole; ut) 5-({3-[2-(4-chloro-2-fluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]benzyl}oxy)-3,4-dihydronaphthalen-l(2H)-one; uu) 2-(4-chloro-2-fluorobenzyl)-3-[3-(2-methoxybenzyl)phenyl]-7- (trifluoromethyl)-2H-indazole; uv) 2-(4-chIoro-2-fluorobenzyl)-3-[3-(3-methoxybenzyl)phenyI]-7- (trifluoromethyl)-2H-indazo!e; uw) 2-(4-chloro-2-fluorobenzyI)-3-[3-(2,3-dimethoxybenzyl)phenyl]-7- (trifluoromethyl)-2H-indazole; ux) 2-(4-chloro-2-fluorobenzyl)-3-(3-{[(3,3-dimethyl-2,3-dihydro-l- benzofuran-7-yl)oxy]methy!}phenyl)-7-(trifluoromethyl)-2H-indazole; uy) 3-{3-[(2-tert-butylphenoxy)methyl]phenyl}-2-(4-chloro-2-fluorobenzyl)- 7-(trifluoromethyl)-2H-indazole; uz) 2-(4-chloro-2-nuorobenzyl)-3-{3-[(2,3- dimethoxyphenoxy)methyl]phenyI}-7-(trifluoromethyl)-2H-indazole; va) 2-(4-chloro-2-fluorobenzyl)-3-[3-(3,4-dimethoxybenzyl)phenyl]-7- (trifluoromethyl)-2H-indazole; vb) 2-(4-chloro-2-fluorobenzyl)-3-[3-(4-chloro-2-fluorobenzyl)phenyl]-7- (trifluoromethyl)-2H-indazole; vc) 2-(4-chIoro-2-fluorobenzyI)-3-[3-(2-chloro-4-fluorobenzyl)phenyI]-7- (trifluoromethyl)-2H-indazole; vd) 2-(4-chIoro-2-fluorobenzyl)-3-{3-[2-fluoro-4- (trifluoromethyl)benzyl]phenyl}-7-(trifluoromethyl)-2H-indazole; ve) 3-{3-[2,4-bis(trifluoromethyl)benzyl]phenyl}-2-(4-chloro-2- fluorobenzyl)-7-(trifluoromethyl)-2H-indazole; vf) 2-(4-chloro-2-fluorobenzyl)-3-[3-(2,4-difluorobenzyl)phenyl]-7- (triflu6romethyl)-2H-indazble; vg) 3-{3-[2,5-bis(trifluoromethyl)benzyl]phenyl}-2-(4-chloro-2- fluorobenzyl)-7-(trifluoromethyl)-2H-indazole; vh) 2-(4-chloro-2-fluorobenzyl)-3-{3-[(2,6-dichlorophenoxy)methyI]phenyi}- 7-(trifluoromethyI)-2H-indazole; vi) 2-(4-chloro-2-fluorobenzyl)-3-{3-[(2,6- dimethoxyphenoxy)methyl]phenyl}-7-(trifluoromethyl)-2H-indazole; vj) 2-(4-chloro-2-fluorobenzyl)-3-{3-[(2,6-dibromophenoxy)methyl]phenyl}- 7-(trifluoromethyl)-2H-indazole; vk) 2-(4-chloro-2-fluorobenzyl)-3-[3-(2-fluoro-3-methylbenzyl)phenyl]-7- (trifluoromethyl)-2H-indazole; vl) 2-(4-chloro-2-fluorobenzyl)-3-[3-(6-chloro-2-fluoro-3- methylbenzyl)phenyl]-7-(trifluoromethyI)-2H-indazole; vm) 3-{3-[(2-allyI-6-methylphenoxy)methyl]phenyl}-2-(4-chloro-2- fluorobenzyl)-7-(trifluoromethyl)-2H-indazole; vn) 2-(4-chloro-2-nuorobenzyl)-3-{3-[(2,6- diisopropylphenoxy)methyl]phenyl}-7-(trifluoromethyl)-2H-indazole; vo) 3-{3-[(2-tert-butyl-6-methylphenoxy)methyl]phenyl}-2-(4-chIoro-2- fluorobenzyl)-7-(trifluoromethyl)-2H-indazoIe; vp) 3-{3-[(2-allyl-6-methoxyphenoxy)methyl]phenyl}-2-(4-chloro-2- fluorobenzyl)-7-(trifluoromethyl)-2H-indazole; vq) 2-(4-chloro-2-fluorobenzyl)-3-{3-[(2,5-dichlorophenoxy)methyl]phenyl}- 7-(trifluoromethyl)-2H-indazole; vr) 2-(4-chloro-2-fluorobenzyJ)-3-{3-[(2,6-difluorophenoxy)methyl]phenyl}- 7-(trifluoromethyl)-2H-indazole; vs) 2-(4-chloro-2-fluorobenzyl)-3-{3-[3-(difluoromethoxy)benzyl]phenyl}-7- (trifluoromethyl)-2H-indazole; vt) 2-(4-chIoro-2-fluorobenzyl)-3-[3-(2-phenylethyl)phenyl]-7- (trifluoromethyl)-2H-indazole; vu) 3-({3-[2-(4-chloro-2-fluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}methyI)-N-propylbenzamide; vv) N-benzyl-3-({3-[2-(4-chloro-2-fluorobenzyl)-7-(trifluoromethyl)-2H- indaz6l-3-yl]phenoxy} methyl)benzamide; vw) 3-({3-[2-(4-chl6rb-2-fluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}methyl)-N-cyclopropylbenzamide; vx) 2-(4-chl6rd-2-fluor6benzyl)-3-(3-{[3-(morpholin-4- ylcarbonyl)benzyI]oxy}phenyl)-7-(trifluoromethyl)-2H-indazole; vy) 1-({3-[2-(4-chloro-2-fIuorobenzyl)-7-(trifluoromethyl)-2H-indazoI-3- yl]phenoxy}methyl)-N-isoprbpylbenzamide; vz) 2-benzyl-3-[4-(benzyloxy)phenyl]-7-(trifluoromethyl)-2H-indazole; wa) 2-benzyI-3-{4-[(3-methoxybenzyI)oxy]phenyl} -7-(trifluoromethyl)-2H- indazole; wb) 2-benzyl-3-{4-[(2-chlorobenzyl)oxy]phenyl}-7-(trifluoromethyl)-2H- indazole; we) 2-benzyl-7-(trifIuoromethyl)-3-(4-{[2- (trifluoromethyl)benzyl]oxy}phenyl)-2H-indazole; wd) 2-benzyl-3-{4-[(3-methylbenzyl)oxy]phenyI}-7-(trifluoromethyl)-2H- indazole; we) 2-benzyl-3-{4-[(2-methylbenzyl)oxy]phenyl}-7-(trifluoromethyJ)-2H- indazole; wf) 2-benzyl-3-{4-[(3-chlorobenzyl)oxy]phenyl}-7-(trifluoromethyl)-2H- indazole; wg) 2-benzyl-7-(trifluoromethyl)-3-(4-{[3- (trifluoromethyl)benzyl]oxy}phenyl)-2H-indazole; wh) 2-benzyl-3-{4-[(3,5-dimethylbenzyl)oxy]phenyl}-7r(trifluoromethyl)-2H- indazole; wi) 2-benzyl-3-{4-[(2,6-dichlorobenzyI)oxy]phenyl}-7-(trifluoromethyl)-2H- indazole; wj) 2-benzyl-3-{4-[(3,5-dichlorobenzyl)oxy]phenyl}-7-(trifluoromethyl)-2H- indazole; wk) 2-benzyl-3-{3-[(3-methoxybenzyl)oxy]phenyl}-7-(trifluoromethyl)-2H- indazole; vvl) 2-benzyl-3-{3-[(2-chlorobenzyl)oxy]phenyl}-7-(trifluoromethyl)-2H- indazole; wm) 2-benzyl-7-(trifluoromethyl)-3-(3-{[2- (trifluoromethyI)benzyl]oxy}phenyl>2H-indazole; wn) 2-benzyl-3-{3-[(3-methylbenzyI)oxy]phenyl}-7-(trifluoromethyl)-2H- indazole; wo) 2-benzyl-3-{3-[(2-methylbenzyl)oxy]phenyI}-7-(trifluoromethyl)-2H- indazole; wp) 2-benzyl-7-(trifluoromethyl)-3-(3-{[3- (trifluoromethyl)benzyl]oxy}phenyl)-2H-indazole; wq) 2-benzyl-3-(3-{[3,5-bis(trifluoromethyl)benzyI]oxy}phenyl)-7- (trifluoromethyl)-2H-indazole; wr) 2-benzyl-3-{3-[(3,5-dimethylbenzyl)oxy]phenyl}-7-(trifluoromethyl)-2H- indazole; ws) 2-benzyl-3-{3-[(2,6-dichlorobenzyl)oxy]phenyl}-7-(trifluoromethyl)-2H- indazole; wt) 2-benzyl-3-{3-[(3,5-dichlorobenzyl)oxy]phenyl}-7-(trifluoromethyl)-2H- indazole; wu) l-[4-({3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy} methyl)phenyl]cyclopentanecarboxylic acid; wv) l-[4-({3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yljphenoxy} methyl)phenyl]cyclopropanecarboxylic acid; ww) 2-benzyl-3-{3-[(2,6-dimethylbenzyl)oxy]phenyl}-7-(trifluoromethyl)-2H- indazole; vvx) 2-[4-({3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}methyl)phenyl]-2-methylpropanoic acid; wy) 2-benzy!-3-{3-[(2-fluorobenzyl)oxy]phenyl}-7-(trifluoromethyl)-2H- indazole; wz) 2-benzyl-3-{3-[(2-fluoro-6-nitrobenzyl)oxy]phenyl}-7-(trifluoromethyl)- 2H-indazole; xa) 2-benzyl-3-{3-[(2-chloro-6-fluorobenzyl)oxy]phenyl}-7- (trifluoromethyl)-2H-indazole; xb) 2-benzyl-3-{3-[(2,6-difluorobenzyl)oxy]phenyl}-7-(trifluoromethyl)-2H- indazole; xc) 2-benzyl-3-{4-[(2-fluorobenzyl)oxy]phenyl}-7-(trifluoromethyl)-2H- indazole; xd) 2-benzyl-3-{4-[(2-chloro-6-fluorobenzyl)oxy]phenyl}-7- (trifluoromethyl)-2H-indazole; xe) 2-benzyl-3-{4-[(2,6-difluorobenzyl)oxy]phenyl}-7-(trifluorotnethyl)-2H- indazole; xf) 2-benzyl-3-(3-{[3-(lH-tetrazol-5-yl)benzyl]oxy}phenyl)-7- (trifluoromethyl)-2H-indazole; xr> 2-benzyl-3-(4-{[4-(lH-tetrazol-5-yl)benzyl]oxy}phenyl)-7- (trifluoromcthyl)-2H-indazole; xh) [4-({3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}methyl)benzyl]phosphonicacid; xi) [3-({3-[2-benzyl-7-(trifluoromethyI)-2H-indazol-3- yl]phenoxy} methyl)phenyl]acetic acid; xj) 3-[2-benzyI-7-(trifluorotnethyl)-2H-indazol-3-yI]phenyI acetate; xk) 2-benzyl-3-{4-[(2-fluoro-6-nitrobenzyl)oxy]phenyl}-7-(trifluoromethyl)- 2H-indazole; xl) 4-({3-[2-benzyl-7-(trifluoromethyl)-2H-indazoi-3- yl]phenoxy}methyl)phenyl acetate; xm) diethyl [4-({3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}methyl)benzyl]phosphonate; xn) diethyl [4-({4-[2-benzyI-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}methyl)benzyl]phosphonate; xo) 3-({3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}methyl)benzonitrile; xp) 4-( (4-[2-benzyl-7-(tri fluoromethyl)-2H-i ndazol-3- yl]phenoxy}meihyl)benzonitrile; xq) ethyl hydrogen [4-({4-[2-benzyI-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}methyl)benzyl]phosphonate; xr) [4-({4-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}methyl)benzyl]phosphonicacid; xs) 2-(2,4-dimethylbenzyl)-3-{3-[(2,6-dimethylbenzyl)oxy]phenyl}-7- (trifluoromethyl)-2H-indazole; xt) 3-{3-[(2,6-dimethylbenzyl)oxy]phenyl}-2-(2,4,6-trinuorobenz>l)-7- (trifluoromethyl)-2H-indazole; xu) 3-{3-[(2-fluoro-6-nitrobenzyl)oxy]phenyl}-2-(2,4,6-trifluorobenzyl)-7-(trifluorpmethyl)-2H-indazole; •'•" '•. '.. '.- ''"-•'•'- ' ' • xv) 2-benzyl-3-[4-(3-methoxyphenoxy)phenyl]-7-(trifluoromethyl)-2H- indazole; xw) 2-benzyl-3-[4-(2J3-difluorophenoxy)phenyl]-7-(trifluoromethyl)-2H- indazole; xx) 2-benzyl-3-[4-(4-chlorophenoxy)phenyl]-7-(trifluoromethyl)-2H- indazole; xy) 2-benzyl-3-[4-(2,3-dihydro-l H-inden-5-yloxy)phenyl]-7- (trifluoromethyl)-2H-indazole; xz) 2-benzyl-3-[4-(2-fluorophenoxy)phenyl]-7-(trifluoromethyl)-2H-indazole; ya) 2-benzyI-3-[4-(4-chloro-3-methylphenoxy)phenyI]-7-(trifluoromethyl)- 2H-indazole; yb) 2-benzyl-3-[4-(2-chlorophenoxy)phenyl]-7-(trifluoromethyl)-2H- indazole; yc) N-(3-{4-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3-yl]phenoxy}phenyl)- N,N-ditnethylam ine; yd) 2-benzyl-3-[4-(3 -nitrophenoxy)phenyl]-7-(tr ifluoromethy l)-2 H- i ndazo le; ye) 2-benzyl-3-{4-[(7-methoxy-2-naphthyl)oxy]phenyl}-7-(trifluoromethyI)- 2H-indazole; yf) 2-benzyl-3-[4-(4-fluorophenoxy)phenyl]-7-(trifluoromethyl)-2H-indazole; yg) 4-(4- {4-[2-benzyl-7-(trifluoromethy l)-2H-indazol-3 - yl]phenoxy}benzyl)phenol; yh) 2-benzyl-3-[4-(5,6,7,8-tetrahydronaphthalen-2-yloxy)phenyl]-7- (trifiuoromethyl)-2H-indazole; yi) 7-{4-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3-yl]phenoxy}quinoline: yj) 2-benzyl-3-[4-(2,4-dichlorophenoxy)phenyl]-7-(trifluoromethyl)-2H- indazole; yk) 2-benzyl-3-[4-(2-methoxyphenoxy)phenyl]-7-(trifluoromethyl)-2H- indazole; yl) 2-benzyl-3-[4-(3,5-difluorophenoxy)phenyl]-7-(trifluoromethyl)-2H- indazole; ym) 2-benzyl-3-[4-(2,3-dimethylphenoxy)phenyI]-7-(trifluoromethyI)-2H- indazole; yn) 2-benzyI-3-[4-(3,5-dimethyIphenoxy)phenyl]-7-(trifluoromethyl)-2H- indazole; yo) 2-(2,4-difluorobenzyl)-3-{3-[(2,6-dimethylbenzyl)oxy]phenyl}-7- (trifluoromethyl)-2H-indazole; yp) 2-(4-chloro-2-fluorobenzyl)-3-{3-[(2,6-dimethylbenzyI)oxy]phenyl}-7- (trifluoromethyl)-2H-indazole; yq) 2-(2-chloro-4-fluorobenzyl)-3-{3-[(2,6-dimethylbenzyl)oxy]phenyl}-7- (trifluoromethyl)-2H-indazole; yr) 2-benzyI-3-{3-[(3,5-dimethoxybenzyl)oxy]phenyl}-7-(trifluoromethyl)- 2H-indazo!e; ys) 2-benzyl-3-{4-[(2,6-dimethylbenzyl)oxy]phenyl}-7-(trifluoromethyl)-2H- indazole; yt) 2-(2,4-dichlorobenzyl)-3-{3-[(2,6-dimethylbenzyl)oxy]phenyl}-7- (trifluoromethyl)-2H-indazole; yu) 2-benzyl-3-[4-(4-methylphenoxy)phenyl]-7-(trifIuoromethyI)-2H- indazole; yv) 2-benzyl-3-[4-(4-nitrophenoxy)phenyI]-7-(trifluoromethyl)-2H-indazole; yw) 2-benzyl-3-{4-[(4'-nitro-l,r-biphenyl-4-yl)oxy]phenyl}-7- (trifluoromethyl)-2H-indazoIe; yx) 3- (4-[4-(4-acetylpiperazin-1 -yl)phenoxy]phenyl} -2-benzy 1-7- (trifluoromethyl)-2H-indazoIe; yy) 2-benzyl-3-{3-[(2,5-dimethylbenzyl)oxy]phenyl}-7-(trifluoromethyl)-2H- indazole; yz) 2-benzyl-3-(3-{[2-fluoro-6-(trifluoromethyl)benzyl]oxy}phenyl)-7- (trifluoromethyl)-2H-indazole; za) 2-[4-({3-[2-(2,4-dimethylbenzyl)-7-(trifluoromethyl)-2H-indazoi-3- yl]phenoxy}methyl)phenyl]-2-methylpropanoic acid; zb) 2-methyl-2-[4-({3-[2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyl)-2H- indazol-3-yl]phenoxy}methyl)phenyl]propanoicacid; zc) 2-[4-({3-[2-(2,4-dimethylbenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}methyl)phenyl]propanoic acid; zd) 2-[4-({3-[2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}methyl)phenyl]propanoic acid; ze) 2-(2,4-dimethylbenzyl)-3-{3-[(2-fluoro-6-nilrobenzyl)oxy]phenyl}-7- (trifluoromcthyl)-2H-indazole; zf) 3-({3-[2-(2,4-dimethyIbenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy} methyl)benzonitrile; zg) 3-[3-(benzyloxy)phenyl]-2-(2,4-dimethylbenzyl)-7-(trifluoromethyl)-2H- indazole; zh) 2-(4-chloro-2-fluorobenzyI)-3-{3-[(2-fluoro-6-nitrobenzyl)oxy]puenyl}- 7-(trifluoromethyI)-2H-indazole; zi) 3-({3-[2-(4-chIoro-2-fluorobenzyl)-7-(trifluoromethyI)-2H-indazol-3- yl]phenoxy}methyl)benzonitrile; zj) 2-{3-[2-(4-chIoro-2-fluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yljphenoxy} -2-(4-methylphenyl)propanoic acid; zk) 2-benzyl-3-[4-(2,4-difluorophenoxy)phenyl]-7-(trifluoromethyl)-2H- indazole; zl) 2-benzyl-3-[4-(3,4-dimethylphenoxy)phenyl]-7-(trifluoromethyl)-2H- indazole; zm) 2-benzyl-3-[4-(2-isopropylphenoxy)phenyl]-7-(trifluoromethyl)-2H- indazole; zn) 5-{4-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3-yl]phenoxy}-3.4- dihydronaphthalen-1 (2H)-one; zo) 6-{4-[2-benzyl-7-(trifluoromethyl)-2H-indazoI-3-yl]phenoxy}quino!ine; zp) 2-benzyI-3-[4-(2,6-dimethoxyphenoxy)phenyl]-7-(trifluoromethyI)-2H- indazole; zq) 2-benzyl-3-[4-(2-methylphenoxy)phenyI]-7-(trifluoromethyl)-2H- indazole; zr) 2-[4-({3-[2-(4-chloro-2-fluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}methyl)phenyl]propanoicacid; zs) 2-benzyI-3-[4-(3,4-dichlorophenoxy)phenyl]-7-(trifluoromethyl)-2H- indazole; zt) 2-benzyl-3-[4-(3,4-difluorophenoxy)phenyl]-7-(trifluoromethyl)-2H- indazole; zu) 2-benzyl-3-[4-(2,5-difluorophenoxy)phenyl]-7-(trifluoromethyl)-2H- indazole; zv) 8-{4-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3-yl]phenoxy}quinolinc: zw) 2-benzyl-3-[4-(4-ethyIphenoxy)phenyl]-7-(trifluoromethyl)-2H-indazolc; zx) 2-benzyl-3-[4-(2,6-difluorophenoxy)phenyl]-7-(trifluoromethyl)-2H- indazole; zy) 2-benzyl-3-{4-[4-(benzyloxy)phenoxy]phenyl}-7-(trifluoromethyl)-2H- indazole; zz) 2-benzyI-3-[3-(354-dichlorophenoxy)phenyl]-7-(trifluoromethyl)-2H- indazole; ggggg) methyl 3-(4-{3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy} phenyl)propanoate; hhhhh) l-(2-{3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}phenyl)ethanone; iiiii) l-(3-{3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}phenyl)ethanone; jjjjj) 2-benzyl-3-[3-(3-methylphenoxy)phenyI]-7-(trifluoromethyl)-2H- indazole; kkkkk) 2-benzyl-3-[3-(2-chIorophenoxy)phenyl]-7-(trifluoromethyI)-2H- indazole; lllll) (3-{3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy} phenyl)dimethylamine; aag) 2-benzyl-3-[3-(3-nitrophenoxy)phenyl]-7-(trifluoromethyl)-2H-indazole; aah) 2-benzyl-3-[3-(2,3-dimethylphenoxy)phenyI]-7-(trifluoroniethyl)-2H- indazole; aai) 2-benzyI-3-{3-[2-(trifluoromethoxy)phenoxy]phenyl}-7- (trifluoromethyl)-2H-indazole; aaj) 2-benzyl-3-[3-(3-methoxyphenoxy)phenyl]-7-(trifluoromethyl)-2H- indazole; aak) methyl 3-{3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}benzoate; aal) 5-{3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3-yl]phenoxy}-3,4- d i hydronaphlhalen-1 (2H)-one; aam) 7-{3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3-yl]phenoxy}quinoline; aan) 2-benzyl-3-[3-(2-isopropylphenoxy)phenyl]-7-(trifluoromethyl)-2H- indazole; aao) 8-{3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3-yl]phenoxy}quinoline: aap) 2-benzyl-3-{3-[3,5-bis(trifluoromethyl)phenoxy]phenyI}-7- (trifluoromethyl)-2H-indazoJe; aaq) 2-benzyl-3- {3-[(7-methyl-1 -naphthyl)oxy]phenyl} -7-(trifluoromethyl)- 2H-indazole; aar) 4-{3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3-yl]phenoxy}acridine; aas) 2-benzyl-3-{3-[2-(benzyloxy)phenoxy]phenyl}-7-(trifluoromethyl)-2H- indazole; aat) (2-{3-[2-benzyl-7-(trifluoromethyl)-2H-indazoi-3- yl]phenoxy}phenyl)(phenyl)methanone; aau) 2-benzyI-3-[3-(biphenyl-2-yloxy)phenyl]-7-(trifluoromethyl)-2H- indazole; aav) 2-(2-{3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3-yl]phenoxy}phenyl)- 1,3-benzothiazole; aaw) 2-benzyl-3-{3-[2-(l H-pyrrol-1 -yl)phenoxy]phenyl}-7-(trifluoromethyl)- 2H-indazole; aax) 2-benzyI-3-[3-(3,4-difluorophenoxy)phenyl]-7-(trifluoromethyl)-2H- indazole; aay) 2-benzyl-3-[3-(2,3-difluorophenoxy)phenyl]-7-(trifluoromethyl)-2H- indazole; aaz) 2-benzyI-3-[3-(2,5-difluorophenoxy)phenyl]-7-(trifluoromethyl)-2H- indazole; qqqqq) 2-benzyl-3-{3-[(7-methoxy-2-naphthyl)oxy]phenyl}-7-(trifluoromethyl)- 2H-indazole; rrrrr) 1 -(2-{3-[2-benzyI-7-(trifluoromethyl)-2H-indazoI-3-yl]phenoxy} -4- methoxyphenyl)ethanone; sssss) 6-{3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3-yl]phenoxy}quinoIine; ttttt) 2-benzyl-3-[3-(3,5-dimethylphenoxy)phenyl]-7-(trifluoromethyl)-2H- indazole; uuuuu) 2-benzyl-3-[3-(2-methoxyphenoxy)phenyl]-7-(trifluoromethyl)-2H- indazole; vvvvv) 2-benzyl-3-[3-(l-naphthyloxy)phenyI]-7-(tri£luoromethyl)-2H-indazole; wwwww) 2-benzyl-3-(3- {2-[( 1 E)-prop-1 -en-1 -yl]phenoxy } phenyl)-7- (trifluoromethyl)-2H-indazole; abh) 2-benzyl-3-[3-(3,5-difluorophenoxy)phenyl]-7.-(trifluoromethyl)-2H- indazole; abi) 2-benzyl-3-[3-(3,5-dichlorophenoxy)phenyI]-7-(trifluoromethyl)-2H- indazole; abj) 2-benzyl-3-[3-(3,5-dimethoxyphenoxy)phenyl]-7-(trifluoroniethyl)-2H- indazole; abk) 2-(4-chloro-2-fluorobcizyI)-3-{3-[2-chloro-5- ' (trifluoromethyl)benzyl]phenyl}-7-(trifluoromethyl)-2H-indazoIe; abi) 2-(4-chloro-2-fluorobenzyl)-3-{3-[4-(methylsulfonyl)benzyl]phenyI}-7- (trifluoromethyl)-2H-indazole; abm) 2-(4-chloro-2-fluorobenzyl)-3-{3-[2-methyI-5- (trifluoromethyl)benzyl]phenyl}-7-(trifluoromethyl)-2H-indazole; abn) 2-(4-chloro-2-fluorobenzyl)-3-[3-(2-chloro-5-fluorobenzyl)phenyI]-7- (trifluoromethy!)-2H-indazole; abo) 2-(4-chloro-2-fluorobenzyl)-3-{3-[5-fluoro-2- (trifluoromethyl)benzyl]phenyI}-7-(trifluoromethyl)-2H-indazole; abp) 2-(4-chloro-2-fluorobenzyl)-3-[3-(2,5-dichlorobenzyl)phenyI]-7- (trifluoromethyl)-2H-indazole; abq) 2-(4-chloro-2-fluorobenzyl)-3-{3-[5-chloro-2- (trifluoromethyl)benzyl]phenyl}-7-(trifluoromethyl)-2H-indazole; abr) 2-(4-chloro-2-fluorobenzyl)-3-{3-[3-(morpholin-4- ylcarbonyl)benzyl]phenyl}-7-(trifluoromethyl)-2H-indazole; abs) N-benzyl-3-{3-[2-(4-chloro-2-fluorobenzyl)-7-(trifluoromethyl)-2H- indazol-3-yl] benzyl} benzam ide; abt) 2-(4-chloro-2-fluorobenzyI)-3-{3-[3-(pyrrolidin-1 - ylcarbonyl)benzyl]phenyl}-7-(trifluoromethyl)-2H-indazole; abu) 2-(4-chloro-2-fluorobenzyI)-3-{3-[3-(piperidin-l- ylcarbony!)bcnzyl]phenyl}-7-(trifluoromethyl)-2H-indazole; abv) 2-(4-chIoro-2-fluorobenzy!)-3-[3-(3-chlorophenoxy)phenyl]-7- (trifluoromethyl)-2H-indazole; abw) 2-(4-chloro-2-fluorobenzyl)-3-[3-(2-fluorophenoxy)phenyl]-7- (trifluoromethyl)-2H-indazole; abx) 6-{3-[2-(4-chloro-2-fluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}-2-naphthonitrile; aby) 2-(4-chloro-2-fluorobenzyl)-3-[3-(5,6,7,8-tetrahydronaphthaIen-1 - yloxy)phenyl]-7-(trifluoromethyJ)-2H-indazole; abz) 2-(4-chl6ro;-2-fluorobenzyl)-3-[3-(2-ethoxyphenoxy)phenyl]-7- (triflupromethyl)-2H-indazole; aaaaaa) l-(2-{3-[2-(4.-chIoro-2-fluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy} phenyl)propan-l -one; bbbbbb) 3-{3-[2-(lH-benzimidazol-2-yl)phenoxy]phenyl}-2-(4-chloro-2- fluorobenzyl)-7-(trifluoromethyl)-2H-indazole; ace) 2-(4-chloro-2-fluorobenzyI)-3-[3-(2-pyrrolidin-l-ylphenoxy)phenyl]-7-(trifluoromethyl)-2H-indazole; dddddd) 3-{3-[2-(4-chloro-2-fluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- y 1] benzyl} -N,N-d iethylbenzamide; eeeeee) 3-{3-[2-(4-chloro-2-fluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]benzyl}-N-cyclopropylbenzamide; acl) 3-{3-[2-(4-chIoro-2-fluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yi]benzyl}-N-isopropylbenzamide; acg) 3-{3-[2-(4-chloro-2-fluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]benzyl}-N-propylbenzamide; ach) 3-{3-[2-(4-chloro-2-fluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]benzyl}-N-ethylbenzamide; aci) 3-{3-[2-(4-chloro-2-fluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]benzyl}-N-methylbenzamide; acj) 2-benzyl-3-[4-(benzyloxy)phenyl]-7-(trifluoromethyl)-2H-indazoIe; ack) l-[4-({3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}methyl)phenyl]cyclopentanecarboxylic acid; acl) 2-[4-({3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}methyl)phenyl]-2-methylpropanoic acid; acm) 2-[4-({3-[2-(4-chloro-2-fluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}methyl)phenyl]-2-methylpropanoic acid; acn) 2-(2,4-difluorobenzyl)-3-{4-[(2,6-dimethylbenzyl)oxy]phenyl}-7- (trifluoromethyl)-2H-indazole; aco) 2-(2,4-dichlorobenzyl)-3-{4-[(2,6-dimethylbenzyl)oxy]phenyl}-7- (trifluoromelhyl)-2H-indazole; acp) 2-(4-chloro-2-fluorobenzyl)-3-{4-[(2,6-dimethylbenzyl)oxy]phenyl}-7- (trifluorQmethyl)-2H-indazole; acq) 2-(2-chlorp-4-fluorobenzyl)-3-{4-[(2,6-dimethylbenzyl)oxy]phcnyl}-7- (triflupromethyl)-2H-indazole; acr) 2-(2,4-dimethylbenzyl)-3-{4-[(2,6-dimethylbenzyl)oxy]phenyl}-7- (trifluoromethyl)-2H-indazole; acs) 2-benzyI-3-(4-{[2-fluoro-6-(trifluoromethyl)benzyl]oxy}phenyl)-7- (trifluoromethyl)-2H-indazole; act) [4-({3-[2-benzyl-7-(trifluoromethyI)-2H-indazol-3-yl]phenoxy}methyl)- 3,5-dimethylphenyl]acetic acid; acu) [4-({4-[2-b'enzyl-7-(trifluoromethyl)-2H-indazol-3-yl]phenoxy}methyl)- 3,5-dimethylphenyl]acetic acid; acv) 2-(4-chloro-2-fluorobenzyl)-3-{3-[(2,5-dimethylbenzyl)oxy]phenyl}-7- (trifluoromethyl)-2H-indazole; acw) 2-(2,4-dimethyIbenzyl)-3-{3-[(2,5-dimethylbenzyl)oxy]phenyl}-7- (trifluoromethyl)-2H-indazole; acx) 4-({3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3-yl]phenoxy}methyi)- 3,5-dibrornobenzoic acid; acy) 4-({4-[2-benzyl-7-(trifluoromethyl)-2H-indazoI-3-yl]phenoxy}methyl)- 3,5-dibromobenzoic acid; acz) 4-({3-[2-benzyl-7-(trifluoromethyl)-2H-indazoI-3-yl]phenoxy}methyl)- 3,5-dimethyIbenzoic acid; kkkkkk) 2-benzyI-3-{4-[(2,5-dimethylbenzyl)oxy]phenyl}-7-(trifluoromethyl)-2H- indazole; llllll) 2-(2-chloro-4-fluorobenzyl)-3-{4-[(2,5-dimethylbenzyl)oxy]phenyl}-7- (trifluoromethyl)-2H-indazoIe; mmmmmm) 2-(2,4-dichlorobenzyI)-3-{4-[(2,5-dimethylbenzyl)oxy]phenyI}-7- (trifluoromethyl)-2H-indazoIe; nnnnnn) 3-{3-[(2,5-dimethylbenzyl)oxy]phenyl}-2-(2,4,6-trifluorobenzyl)-7- (trifluoromethyl)-2H-indazole; oooooo) {4-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3-yl]phenoxy}(3- methylphenyl)acetic acid; pppppp) {3-[2-benzyI-7-(trifluoromethyl)-2H-indazol-3-yl]phenoxy}(3- methylphenyl)acetic acid; adg) 2-benzyl-3-[4-(2-naphthylmethoxy)phenyl]-7-(trifluoromethyl)-2H- indazole; adh) 2-benzyl-3-[4-(l-naphthylmethoxy)phenyl]-7-(trifluoromethyl)-2H- indazole; adi) 2-benzyl-3-{4-{(3-methyl-2-naphthyl)methoxy]phenyl}-7- (trifluoromethyl)-2H-indazoIe; adj) 2-benzyl-3-[3-(2-naphthylmethoxy)phenyl]-7-(trifluoromethyl)-2H- indazole; adk) 2-benzyI-3-[3-(l-naphthylmethoxy)phenyl]-7-(trifluoromethyl)-2H- indazole; adl) 2-benzyl-3-{3-[(3-methyl-2-naphthyl)methoxy]phenyl}-7- (trifluoromethyl)-2H-indazole; adm) 2-benzyl-3 - {4-[(2-methyl-1 -naphthyl)methoxy]pheny 1} -7- (trifluoromethyl)-2H-indazole; adn) 3-[4-(9-anthrylmethoxy)phenyl]-2-benzyl-7-(trifluoromethyl)-2H- indazole; ado) 2-benzyl-3-{3-[(2-methyl-1 -naphthyl)methoxy]phenyl} -7- (trifluoromethyl)-2H-indazole; adp) 3-[3-(9-anthrylmethoxy)phenyl]-2-benzyl-7-(trifluoromethyl)-2H- indazole; : adq) 2-(4-chloro-2-fluorobenzyl)-3-{4-[(2,5-ditnethylbenzyI)oxy]phenyl}-7- (trifluoromethyl)-2H-indazole; adr) 2-(2,4-dimethylbenzyl)-3-{4-[(2,5-dimethylbenzyl)oxy]phenyl}-7- (trifluoromethyl)-2H-indazole; ads) 3-{4-[(2,5-dimethylbenzyl)oxy]phenyl}-2-(2,4,6-trifluorobenzyl)-7- (trifluoromethyl)-2H-indazole; adt) 2-(4-ch loro-2-fluorobenzyl)-3 - {3-[(2-methy 1-3 -n i trobenzy l)oxy] pheny 1} - 7-(trifluoromethyl)-2H-indazole; adu) 2-(4-chloro-2-fluorobenzyl)-3-{3-[(5-methyl-2-nitrobenzyl)oxy]phenyl}- 7-(trifluoromethyl)-2H-indazole; adv) 2-(4-chloro-2-fluorobenzyl)-3-{3-[(2-chloro-5-nitrobenzyl)oxy]phenyl}- 7-(trifluoromethyl)-2H-indazole; adw) 2-(4-chloro-2-fIuorobenzyl)-3-{3-[(2-fluoro-3- methylbenzyl)oxy] pheny 1} -7-(trifluoromethyI)-2H-indazole; adx) 2-(4-chloro-2-fluorobenzyl)-3-(3-{[5-fluoro-2- (trifluoromethyl)benzyl]oxy}phenyl)-7-(trifluoromethyI)-2H-indazoIe; ady) 2-(4-chloro-2-fluorobenzyl)-3-(3-{[2-chloro-3- (trifluoromethyl)benzyl]oxy}phenyl)-7-(trifluoromethyl)-2H-indazoIe; adz) 2-(4-chloro-2-fluorobenzyl)-3-{3-[(2-methoxy-5- nitrobenzyl)oxy]phenyl}-7-(trifluoromethyl)-2H-indazole; aea) • 2-(4-chloro-2-fluorobenzyl)-3-(3-{[2-methyl-5- (trifluoromothyl)benzyl]oxy}phenyl)-7-(trifluoromethyl)-2H-indazole; vvvvvv) 3-{3-[(2-bromo-5-methoxybenzyl)oxy]phenyl}-2-(4-chloro-2- fluorobenzyl)-7-(trifluoromethyl)-2H-indazole; wwwwww) 3-(3-{[2,5-bis(trifluoromethyl)benzyl]oxy}phenyl)-2-(4-chloro-2- fluorobenzyl)-7-(trifluoromethyI)-2H-indazole; xxxxxx) l-[3-({3-[2-(4-chIoro-2-fluorobenzyI)-7-(trifluoromethyl)-2H-indazol-3- yI]phenoxy}methyl)-4-methoxyphenyl]ethanone; yyyyyy) 2-(4-chloro-2-fluorobenzyl)-3-{3-[(2,5-difluorobenzyl)oxy]phenyI}-7- (trifluoromethyl)-2H-indazole; zzzzzz) 3-{3-[(2-bromo-5-fluorobenzyl)oxy]phenyl}-2-(4-chloro-2-fluorobenzyl)- 7-(trifluoromethyl)-2H-indazoIe; aaaaaaa) 2-(4-chloro-2-fluorobenzyI)-3-{3-[(3-chIoro-2-fluorobenzyl)oxy]phenyl}- 7-(trifluoromethyl)-2H-indazole; aeh) 2-(4-chloro-2-fluorobenzyl)-3-(3-{[2-fluoro-5- (trifluoromethyI)benzyl]oxy}phenyl)-7-(trifluoromethyl)-2H-indazole: aei) 2-(4-chloro-2-fluorobenzyl)-3-{3-[(2,3,6-trifluorobenzyl)oxy]phenyl}-7- (trifluoromethyl)-2H-indazole; aej) 2-(4-chloro-2-fluorobenzyl)-3-{3-[(2,5-dichlorobenzyl)oxy]phenyl}-7- (trifluoromethyl)-2H-indazole; aek) 2-(4-chloro-2-fluorobenzyl)-3-(3-{[2-chloro-5- (trifluoromethyI)benzyl]oxy}phenyl)-7-(trifluoromethyI)-2H-indazole; ael) 2-(4-chloro-2-fluorobenzyl)-3-(3-{[5-chloro-2- (trifluoromethyl)benzyl]oxy}phenyI)-7-(trifluoromethyl)-2H-indazole; aem) [4-({3-[2-(4-chloro-2-fluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}methyl)phenyl]acetic acid; aen) methyl [4-({3-[2-(4-chloro-2-fluorobenzyI)-7-(trifluoromethyl)-2H- indazol-3-yl]phenoxy}methyl)phenyl]acetate; aeo) 2-(4-chloro-2-fluorobenzyl)-3-{3-[(6-chloro-2-fluoro-3- methylbenzyl)oxy]phenyl}-7-(trifluoromethyl)-2H-indazoIe; aep) 3-{3-[(2-chioror3,6-difluorobenzyl)oxy]phenyl}-2-(4-chloro-2- fluorobenzyl)-7-(trifluoromethyl)-2H-indazole; aeq) 3-{3-[(3-chloro-2,6-difluorobenzyl)oxy]phenyl}-2-(4-chIoro-2- fluorobenzyl)-7-(trifluoromethyI)-2H-indazole; • aer) 2-(4-chloro-2-fluorobenzyl)-3-{3-[(5-chloro-2-fluorobenzyI)oxy]phcnyl}- 7-(trifluoromethyl)-2H-indazole; aes) 2-(4-chloro-2-fluorobenzyl)-3-{3-[(2,5-dimethoxybenzyl)oxy]phenyl}-7- (trifluoromethyl)-2H-indazole; act) 2-(4-chloro-2-fluorobenzyl)-3-{3-[(5-fluoro-2- methylbenzyl)oxy]phenyI}-7-(trifluoromethyl)-2H-indazole; aeu) 2-(4-chloro-2-fluorobenzyl)-3-{3-[(2,6-difluoro-3- methylbenzyl)oxy]phenyl}-7-(trifluoromethyl)-2H-indazole; aev) 2-(4-chloro-2-fluorobenzyl)-3-{3-[(2,6-difluorobenzyl)oxy]phenyl}-7- (trifluoromethyl)-2H-indazole; a6w) 2-(4-chIoro-2-fIuorobenzyl)-3-{3-[(2-chloro-6-fluorobenzyl)oxy]phenyI} - 7-(trifluoromethyl)-2H-indazole; aex) 2-(4-chloro-2-fluorobenzyl)-3-(3-{[2-methoxy-5- (trifluoromethoxy)benzyl]oxy}phenyl)-7-(trifluoromethyl)-2H-indazoIe: aey) 2-(4-chloro-2-fluorobenzyI)-3-{3-[(2,3-dimethoxybenzyl)oxy]phenyl}-7- (trifluoromethyl)-2H-indazole; aez) 3-[3-(benzyloxy)phenyl]-2-(4-chloro-2-fluorobenzyl)-7-(trifluoromethyl)- 2H-indazole; eeeeeee) 2-(4-chloro-2-fluorobenzyl)-3-{3-[(4-methyIbenzyl)oxy]phenyl}-7- (trifluoromethyl)-2H-indazole; fffffff) 2-(4-chloro-2-fluorobenzyl)-3-{3-[(2-chloro-5-fluorobenzyI)oxy]phenyl}- 7-(trifluoromethyl)-2H-indazole; ggggggg) 2-(2,4-dimethylbenzyl)-3-(3-{[5-fluoro-2- (trifluoromethyl)benzyl]oxy}phenyl)-7-(trifluoroniethyI)-2H-indazole; hhhhhhh) [4-({3-[2-methyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}methyl)phenyl]acetic acid; iiiiiii) 2-(4-chloro-2-fluorobenzyl)-3-{3-[(2-chIoro-6-fluoro-3- methyIbenzyl)oxy]phenyl}-7-(trifluoromethyl)-2H-indazole; jjjjjjj) [4-({3-[7-(trifluoromethyl)-lH-indazoI-3- yljphenoxy} methyl)phenyl]acetic acid; kkkkkkk) {3-[2-(4-chlQro-2-fluoroben2yl)-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}(phenyl)acetic acid; afh) 2-{3-[2-(4-chloro-2-fluorobenzyl)-7-(trifluoromethyI)-2H-indazol-3- yl]phenoxy}-2-phenylpropanoic acid; afi) {3-[2-(4-chloro-2-fluorobenzyl)-7-(trifluoromethyl)-'(-H-indazol-3- yl]phenoxy}(3-methylphenyl)acetic acid; afj) [4-({3-[2-(4-chloro-2-fluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy} methyl)-2,5-dimethylphenyl]acetic acid; afk) [4-({3-[2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}methyl)phenyl]aceticacid; afl) l-[4-({3-[2-(4-chIoro-2-fluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}methyl)phenyl]cyclopropanecarboxylic acid; afm) 3-(3-{[5-fluoro-2-(trifluoromethyl)benzyl]oxy}phenyl)-2-(2,4,6- trifluorobenzyl)-7-(trifluoromethyl)-2H-indazole; afn) [3-({3-[2-(4-chloro-2-fluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}methyI)-2,4-dimethylphenyl]acetic acid; afo) [4-({3-[2-(2,4-dimethyIbenzyI)-7-(trifluoromethyI)-2H-indazol-3- yl]phenoxy}methyl)phenyl]acetic acid; afp) 3,3'-[methylenebis(oxy-3,l-phenylene)]bis[2-(4-chloro-2-fluorobenzyl)-7- (trifluoromethyl)-2H-indazole]; afq) 2-[3-({4-[2-(2,4-dimethylbenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]phenyl}amino)phenyl]-2-methylpropanoic acid; afr) 3-(3-{[5-chloro-2-(trifluoromethyl)benzyl]oxy}phenyl)-2-(2,4,6- trifluorobenzyl)-7-(trifluoromethyI)-2H-indazole; afs) 3-(3-{[2-chloro-5-(trifluoromethyI)benzyl]oxy}phenyl)-2-(2,4,6- trifluorobenzyl)-7-(trifluoromethyl)-2H-indazole; aft) 2-(4-chloro-2-fluorobenzyl)-3-[3-(2-phenylethyl)phenyl]-7- (trifluoromethyl)-2H-indazoIe; afu) 2-(4-chloro-2-fluorobenzyl)-3-{3-[2-(2,5-dimethyIphenyl)ethyl]phenyl}- 7-(trifluoromethyI)-2H-indazole; afv) 2-(4-chloro-2-fluorobenzyl)-3-{3-[2-(2,5-dichIorophenyl)ethyl]phenyI}-7- (trifluoromethyl)-2H-indazole; afw) 2-(4-chloro-2-fluorobenzyl)-3-{3-[2-(2,5-difluorophenyl)ethyl]phenyl}-7- (trifluoromethyl)-2H-indazole; afx) 2-(4-chloro-2-fluorobenzyl)-3-{3-[2-(5-chloro-2- fluorophenyl)ethyl]phenyl} -7-(trifluoromethyl)-2H-indazole; afy) 2-(4-chloro-2-fluorobenzyl)-3-{3-[2-(2-chloro-5- fluorophenyl)ethyl]phenyl}-7-(trifluoromethyl)-2H-indazole; afz) 2-(4-chloro-2-fluorobenzyl)-3-(3-{2-[2-fluoro-5- (trifluoromethyl)phenyl]ethyl}phenyI)-7-(trifluoromethyl)-2H-indazole; ooooooo) 2-(4-chloro-2-fluorobenzyl)-3-(3-{2- [3(trifluoromethoxy)phenyl]ethyl}phenyI)-7-(trifluoromethyl)-2H- indazole; ppppppp) 2-(4-chloro-2-fluorobenzyl)-3-{3-[2-(3-methoxyphenyl)ethyl]phenyl}-7- (trifluoromelhyl)-2H-indazole; age) 2-(4-chIoro-2-fluorobenzyl)-3-(3-{2-[3- (difluoromethoxy)phenyl]ethyl}phenyl)-7-(trifluoromethyl)-2H-indazo!e; rrrrrrr) 2-(4-chloro-2-fluorobenzyl)-3-(3- {2-[2-methy 1-5 - (trifluoromethyl)phenyl]ethyl}phenyl)-7-(trifluoromethyI)-2H-indazole; sssssss) 3-(3-{2-[2,5-bis(trifluoromethyl)phenyl]ethyI}phenyl)-2-(4-chloro-2- fluorobenzyl)-7-(trifluoromethyl)-2H-indazole; ttttttt) 2-(4-chloro-2-nuorobenzyl)-3-{3-[2-(2,3- dimethoxyphcnyI)ethyl]phenyl}-7-(trifluoromethyl)-2H-indazole; uuuuuuu) 2-(4-chloro-2-fluorobenzyI)-3-(3-{2-[2-chloro-5- (trifluoromethyl)phenyl]ethyl}phenyl)-7-(trifluoromethyl)-2H-indazole; agh) 2-(4-chIoro-2-fluorobenzyl)-3-(3-{2-[5-chloro-2- (trifluoromethyl)phenyl]ethyl}phenyl)-7-(trifluoromethyl)-2H-indazole; agi) 2-(4-chloro-2-fluorobenzyl)-3-(3-{2-[5-fluoro-2- (trifluoromethyl)phenyl]ethyl}phenyl)-7-(trifluoromethyI)-2H-indazoIe; agj) 2-benzyl-3-(3-phenoxyphenyl)-7-(trifluoromethyl)-2H-indazole; agk) 2-benzyl-3-[3-(4-methoxyphenoxy)phenyl]-7-(trifluoromethyl)-2H- indazole; agl) 3-{4-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl] phenoxy} benzaldehyde; agm) 2-benzyl-3-{3-[3-(l,3-dioxolan-2-ylmethyl)phenoxy]phenyl}-7- (trifluoromethyl)-2H-indazole; agn) (3-{3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phcrioxy}phenyl)acetic acid; ago) (3-{4-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}phenyl)acetic acid; agp) 2-benzyI-3-{4-[3-(l,3-dioxolan-2-ylmethyl)phenoxy]phenyl}-7- (trifluoromethyl)-2H-indazole; agq) 2-benzyl-3-[4-(3,5-dimethyIphenoxy)phenyl]-7-(trifluoromethyl)-2H- indazole; agr) methyl 2-(4-{3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}phenyl)-2-methylpropanoate; ags) methyl 3-{4-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- y 1] phenoxy} benzoate; agt) (3-{4-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}phenyl)methanol; agu) 3-{4-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3-yl]phenoxy}-N- methoxy-N-methy Ibenzam ide; agv) 3-{4-[2-benzyl-7-(trifluoromethyl)-2H-indazoI-3-yl]phenoxy}-N,N- dimethylbenzamide; agw) 3-{4-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3-yl]phenoxy}-N- methylbenzamide; agx) 3-{4-[2-benzyl-7-(trifluoromethyI)-2H-indazol-3-yl]phenoxy}benzamide; agy) 2-(2,4-dimethylbenzyl)-3-[4-(2-methoxyphenoxy)phenyl]-7- (trifluoromethyl)-2H-indazole; agz) 3-[4-(2-methoxyphenoxy)phenyl]-2-(2,4,6-trifluorobenzyl)-7- (trifluoromethyl)-2H-indazole; aha) 2-(4-chloro-2-fluorobenzyl)-3-[4-(2-methoxyphenoxy)phenyl]-7- (trifluoromethyl)-2H-indazole; ahb) (3-{4-[2-(2,4-dimethylbenzyl)-7-(trifluoromethyl)-2H-indazol-3-; ahc) yl]phenoxy}phenyl)dimethylamine; ahd) N,N-dimethyl-3-{4-[2-(2,4,6-trinuorobenzyl)-7-(trifluoromethyI)-2H- indazol-3-yl]phenoxy}aniline; ahe) (3-{4-[2-(4-chloro-2-fluorobenzyI)-7-(trifluoromethyl)-2H-indazol-3-, yl]phenoxy}phenyl)dimethylamine; ahf) 3-{4-[2-(2,4-dimethylbenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}-N-methoxy-N-methylbenzamide; ahg) N-methoxy-N-methyl-3 - {4-[2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyI)- 2H-indazoi-3-yl]phenoxy}benzamide; ahh) 3-{4-[2-(4-chIoro-2-fluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}-N-methoxy-N-methylbenzamide; ahi) 5-{4-[2-(4-chIoro-2-fluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}-3,4-dihydronaphtha!en-l(2H)-one; ahj) 2-benzyl-3-{4-[2-(trifluoromethoxy)phenoxy]phenyI}-7- (trifluoromethy!)-2H-indazole; ahk) 2-benzyl-3-[4-(l-naphthyloxy)phenyl]-7-(trifluoromethyl)-2H-indazole; ahl) 3-{4-[2-(4-chlorO'2-fluorobenzyl)-7-(trifluoromethyl)-2H-indazo!-3- yljphenoxy} benzaldehyde; ahm) 2-(4-chloro-2-fluorobenzyI)-3-[4-(5,6,7,8-tetrahydronaphthalen-1 - yIoxy)phenyl]-7-(trifluoromethyI)-2H-indazole; ahn) 5-{4-[2-(4-chloro-2-fluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy} -1,2,3,4-tetrahydronaphthalen-1 -ol; aho) 2-{3-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yljphenoxy} benzaldehyde; ahp) 3-{4-[2-(4-chloro-2-fluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}-N,N-dimethylbenzamide; ahq) 3-{4-[2-(4-chloro-2-fluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}-N,N-diethyIbenzamide; ahr) 2-(4-chloro-2-fluorobenzyl)-3-{4-[3-(pyrrolidin-l- ylcarbonyl)phenoxy]phenyl}-7-(trifluoromethyl)-2H-indazole; ahs) 2-(4-chloro-2-fluorobenzyl)-3-{4-[3-(piperidin-l- ylcarbonyl)phenoxy]phenyl}-7-(trifluoromethyl)-2H-indazole; aht) 2-(4-chloro-2-fluorobenzyI)-3-{4-[3-(morpholin-4- ylcarbony l)phenoxy]phenyl} -7-(tri fluoromethyl)-2H-indazole; ahu) 2-(3-{4-[2-benzyl-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}phenyl)propan-2-ol; ahv) l-(3-{4-[2-(4-chIoro-2-fluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}phenyl)ethanone; ahw) N,N-dimethyI-3-{4-[2-(2,4,6-trifluorobenzyI)-7-(trifluoromethyl)-2H- indazol-3-yl]phenoxy}benzamide; ahx) 3-{4-[2-(2,4-dimethylben2yl)-7-(trifluoromethyl)-2H-indazoI-3- yl]phenoxy}-N,N-dimethylbenzamide; ahy) 2-(3-{4-[2-(4-chloro-2-fluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}phenyl)propan-2-ol; ahz) 3-{3-[2-benzyl-7-(trifluoromet-hyl)-2H-indazol-3-yl]phenoxy}-N,N- dimethylbenzamide; aia) (1 S)-5- {4-[2-(4-chloro-2-fluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy} -1,2,3,4-tetrahydronaphthalen-1 -ol; aib) (lR)-5-{4-[2-(4-chloro-2-fluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yljphenoxy} -1,2,3,4-tetrahydronaphthalen-1 -ol; aic) 2-(3-{3-[2-benzyl-7-(trifluoromcthyl)-2H-indazol-3-yl]phenoxy}phenyl)- 2-methylpropanoic acid; aid) 3 - {4-[3-(piperidin-1 -y!carbonyl)phenoxy]phenyl} -2-(2,4,6- trifluorobenzyl)-7-(trifluoromethyl)-2H-indazoIe; aie) 2-(3-{4-[2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}phenyl)propan-2-ol; aif) 3-{4-[3-(morpholin-4-ylcarbonyl)phenoxy]phenyl}-2-(2,4,6- trifluorobenzyl)-7-(trifluoromethyl)-2H-indazolc; aig) 5-{3-[2-(2-chloro-4-fluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yI]phenoxy}-3,4-dihydronaphthalen-l (2H)-one; aih) 2-(2-chloro-4-fluorobenzyI)-3-(4-methoxyphenyl)-7-(trifluoromethyl)- 2H-indazole; aii) 2-(4-chloro-2-fluorobenzyl)-3-(4-methoxyphenyl)-7-(trifluoromethyl)- 2H-indazoIe; aij) 3-(4-methoxyphenyl)-2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyl)-2H- indazole; aik) 5-{3-[2-(2-chloro-4-fluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- .yl]phenoxy}quinoline; ail) 5-{3-[2-(2-chloro-4-nuorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}isoquinoline; aim) 4-{3-[2-(2-chloro-4-fluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yljphenoxy} quinazoline; ain) 6-{3-[2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy} -3,4-dihydronaphthalen-1 (2H)-one; aio) 2-(2-chlorb-4iflUOrobenzyl)-3-[3-(5,6,7,8-tetrahydronaphthalen-2- yloxy)phenyl]-7-(trifluoromethyl)-2H-indazole; aip) 2-(2-chloro-4-flaorobenzyl)-3-[3-(5,6,7,8-tetrahydronaphthalen-1 - yloxy)pheriyl]-7-(trifluoromethyl)-2H-indazole; *.iq) 2-{4-[2-(2,4,6-trifliiorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- y l]pheny 1} -1 H-indole-5 -carbonitri le; air) 3-[4-(5-fluoro-lH-indol-2-yl)phenyl]-2-(2,4,6-trifluorobenzyl)-7- (trifluoromethyI)-2H-indazole; ais) 5-{3-[2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy} -3,4-dihydronaphthalen-1 (2H)-one; ait) 6-{3-[2-(2-chloro-4-fluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy} -3 ;4-dihydronaphthaIen-1 (2H)-one; aiu) 3-[3-(5-bromo-6-methyl-lH-indol-2-yl)phenyl]-2-(2,4,6-trifluorobenzyl)- 7-(trifluoromethyl)-2H-indazole; aiv) 3-[4-(5-bromo-6-methyl-lH-indol-2-yl)phenyl]-2-(2,4,6-trifluorobenzyl)- 7-(trifluoromethyl)-2H-indazole; aiw) l-methyl-2-{4-[2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyl)-2H-indazol- 3-yl]phenyl}-lH-indoIe-5-carbonitrile; aix) 3-[4-(5-fluoro-l-methyl-lH-indol-2-yl)phenyl]-2-(2,4,6-trifluorobenzyl)- 7-(trifluoromethyl)-2H-indazole; aiy) 6-{3-[2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}-3,4-dihydronaphthalen- l(2H)-one; aiz) 2-{4-[2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]phenyl}-lH-indole-5-carbonitrile; aja) 3-[4-(5-fluoro-lH-indol-2-yl)phenyl]-2-(2,4,6-trifluorobenzyl)-7- (trifluoromethyl)-2H-indazole; ajb) 5-{3-[2-(2,4,6-trifluorobenzyl)-7-(trinuoromethyI)-2H-indazol-3- yl]phenoxy}-3,4-dihydronaphthalen-l(2H)-one; ajc) 6-{3-[2-(2-chIoro-4-fluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy} -3,4-dihydronaphthalen-1 (2H)-one; ajd) methyl (5-{3-[2-(2-chloro-4-fluorobenzyl)-7-(trifluoromethyl)-2H- indazol-3-yl]phenoxy}-l-hydroxy-l,2,3,4-tetrahydronaphthalen-l- yl)acetate; aje) ethyl [4-({3-[2-(2,4,6-trifluorobenzyl)-7-(trifluoromethyI)-2H-indazol-3- yl]phenoxy}methyl)phenyl]acetate; ajf) (5-{3-[2-(2-chloro-4-fluorobenzyl)-7-(trifluoromethyl)-2H-indazol-3- yl]phenoxy}-3,4-dihydronaphtha!en-l-yl)acetic acid; ajg) ethyl [4-({4-[2-(4-chloro-2-fluorobenzyl)-7-(trifluoromethyl)-2H-indazol- 3-yl]phenoxy}methyl)phenyI]acetate; ajh) 5-{3-[2-(4-chloro-2-fluorobenzyl)-7-(trifluoromethyl)-2H-inda7.oI-3- yljphenoxy} -1,2,3,4-tetrahydronaphthalen-1 -ol; or a pharmaceutical ly acceptable salt thereof. 32. A compound as claimed in preceding claims is useful for treating or inhibiting atherosclerosis or atherosclerotic lesions, Alzheimer's disease or dementia, type I or type II diabetes, acute coronary syndrome or restenosis, celiac or thyroiditis: treating multiple sclerosis, rheumatoid arthritis, inflammatory bowel disease. Crone's disease, or endometriosis, a Thl-mediated disease such as multiple sclerosis, rheumatoid arthritis, autoimmune thyroid disease, inflammatory bouel disease, Crohn's disease or atherosclerosis; inhibiting cholesterol absorption: lowering LDL cholesterol levels; increasing HDL cholesterol levels: increasing reverse cholesterol transport; suppressing lymphocyte function or activation exemplified by lymphokine production, macrophage function or activation, cytokine production; and increasing ABCAl activity by 20% or more while increasing SREBP-lc activity by 25% or less, in mammal in need thereof. 33. A pharmaceutical composition comprises a compound as claimed in any one of claims 1 to 31, or a pharmaceutically acceptable salt thereof and a pharmaceutical carrier. 34. The compound as claimed in any one of claims I to 31 is also useful in the manufacture of a medicament capable of treating or inhibiting atherosclerosis or atherosclerotic lesions, lowering LDL cholesterol levels, increasing HDL. cholesterol levels, increasing reverse cholesterol transport, inhibiting cholcsteiv absorption, treating or inhibiting Alzheimer's disease or dementia, treating or inhibiting type I or type II diabetes, treating or inhibiting acute coronary syndrome or restenpsis, treating multiple sclerosis, rheumatoid arthritis, inflammatory bowel disease, Crone's disease, or endometriosis, treating or inhibiting celiac or thyroiditis, treating a Thl -mediated disease, suppressing lymphocyte function preferably lymphokine production or activation, suppressing macrophage function or activation, suppressing cytokine production, or increasing ABCA1 activity by 20% or more while increasing SREBP-lc activity by 25% or less, preferably Thl -mediated disease is multiple sclerosis, rheumatoid arthritis, autoimmune thyroid disease, inflammatory bowel disease, Crohn's disease or atherosclerosis in a mammal in need thereof. 35. The compound as claimed in claim 1 including all variables, a composition containing the said compound and use of the said compound and composition substantially such as herein described.

Documents

Application Documents

# Name Date
1 1011-DELNP-2007-Form-3-(11-08-2009).pdf 2009-08-11
2 1011-DELNP-2007-Correspondence-Others-(11-08-2009).pdf 2009-08-11
3 1011-DELNP-2007-Form-3 (18-01-2010).pdf 2010-01-18
4 1011-DELNP-2007-Correspondence-Others (18-01-2010).pdf 2010-01-18
5 abstract.jpg 2011-08-21
6 1011-delnp-2007-pct-237.pdf 2011-08-21
7 1011-delnp-2007-pct-220.pdf 2011-08-21
8 1011-delnp-2007-pct-210.pdf 2011-08-21
9 1011-delnp-2007-gpa.pdf 2011-08-21
10 1011-delnp-2007-form-5.pdf 2011-08-21
11 1011-DELNP-2007-Form-3.pdf 2011-08-21
12 1011-delnp-2007-form-2.pdf 2011-08-21
13 1011-delnp-2007-form-1.pdf 2011-08-21
14 1011-delnp-2007-description (complete).pdf 2011-08-21
15 1011-DELNP-2007-Correspondence-Others.pdf 2011-08-21
16 1011-delnp-2007-claims.pdf 2011-08-21
17 1011-DELNP-2007-Assignment.pdf 2011-08-21
18 1011-delnp-2007-abstract.pdf 2011-08-21
19 1011-DELNP-2007_EXAMREPORT.pdf 2016-06-30