Sign In to Follow Application
View All Documents & Correspondence

Industrially Useful Strains Of Yeast.

Abstract: Industrially useful strains of yeast. The invention relates to a method for the preparation of industrially useful strains of yeast Saccharomyces cerevisiae and the strain prepared by said method. In particular the invention relates to the creation of double mutant strains of said yeast that shows high ethanol conversion efficiency and substantially reduced acetic acid and glycerol production during fermentative production of ethanol from a sugar-based feedstock.

Get Free WhatsApp Updates!
Notices, Deadlines & Correspondence

Patent Information

Application #
Filing Date
12 December 2017
Publication Number
24/2019
Publication Type
INA
Invention Field
FOOD
Status
Email
Parent Application
Patent Number
Legal Status
Grant Date
2023-10-16
Renewal Date

Applicants

PRAJ INDUSTRIES LIMITED
PRAJ Tower, 274-275, Bhumkar Chowk – Hinjewadi Road, Hinjewadi, Pune – 411057, INDIA

Inventors

1. RISHI JAIN
PRAJ INDUSTRIES LIMITED PRAJ Tower, 274-275, Bhumkar Chowk – Hinjewadi Road, Hinjewadi, Pune – 411057, INDIA
2. DHEERAJ MADHUKAR MAHAJAN
PRAJ INDUSTRIES LIMITED PRAJ Tower, 274-275, Bhumkar Chowk – Hinjewadi Road, Hinjewadi, Pune – 411057, INDIA
3. SANJAY RATILAL MISTRY
PRAJ INDUSTRIES LIMITED PRAJ Tower, 274-275, Bhumkar Chowk – Hinjewadi Road, Hinjewadi, Pune – 411057, INDIA
4. RUTUJA SHIVAJI JAGTAP
PRAJ INDUSTRIES LIMITED PRAJ Tower, 274-275, Bhumkar Chowk – Hinjewadi Road, Hinjewadi, Pune – 411057, INDIA
5. MEGHA SHALIGRAM BILAIYA
PRAJ INDUSTRIES LIMITED PRAJ Tower, 274-275, Bhumkar Chowk – Hinjewadi Road, Hinjewadi, Pune – 411057, INDIA
6. 6 RAJESH KUMAR SINGH
PRAJ INDUSTRIES LIMITED PRAJ Tower, 274-275, Bhumkar Chowk – Hinjewadi Road, Hinjewadi, Pune – 411057, INDIA
7. GHANSHAM BABURAO DESHPANDE
PRAJ INDUSTRIES LIMITED PRAJ Tower, 274-275, Bhumkar Chowk – Hinjewadi Road, Hinjewadi, Pune – 411057, INDIA
8. PRAMOD SHANKAR KUMBHAR
PRAJ INDUSTRIES LIMITED PRAJ Tower, 274-275, Bhumkar Chowk – Hinjewadi Road, Hinjewadi, Pune – 411057, INDIA

Claims

1. A modified yeast strain for reduced production of fermentation by-products comprising: (a) a gene connoted ssk1 is inactivated; or (b) a gene connoted smp1 is inactivated; or (c) both genes connoted ssk1 and smp1 are inactivated; and (d) said genes inactivation causing no adverse effect on physiology of said strain.

2. A yeast strain as claimed in claim 1 is of a Saccharomyces sp.

3. A yeast strain as claimed in claim 1, wherein said ssk1 gene has DNA sequence of SEQ ID NO: 1 of S. cerevisiae or any gene with a sequence homology of about 50% to SEQ ID NO: 1.

4. A yeast strain as claimed in claim 1, wherein said smp1 gene has DNA sequence of SEQ ID NO: 2 of S. cerevisiae any gene with a sequence homology of about 50% to SEQ ID NO: 2.

5. A yeast strain as claimed in claim 1, wherein fermentation by-product acetic acid is produced up to 50% less compared with non-modified yeast strain.

6. A yeast strain as claimed in claim 1, wherein fermentation by-product glycerol is produced up to 30% less compared with non-modified yeast strain.

7. A yeast strain as claimed in claim 1, wherein fermentation product ethanol is produced up to 9% more compared with non-modified yeast strain.

8. A yeast strain as claimed in claim 1, when used for fermentation the spent wash produced is recyclable up to 30% in the next round of said fermentation process.

9. A yeast product consisting of yeast strain as claimed in claim 1 for the production of ethanol. , Description:THE FIELD OF INVENTION The invention relates to a method for the preparation of industrially useful strains of yeast Saccharomyces cerevisiae and the strain prepared by said method. In particular the invention relates to the creation of double mutant strains of said yeast that shows high ethanol conversion efficiency and substantially reduced acetic acid and glycerol production during fermentative production of ethanol from a sugar-based feedstock. INTRODUCTION The energy demand has been increasing continuously and one of the ways to address it is by increasing the production of renewable liquid fuels like ethanol. Ethanol can serve as a supplement to fuel supply as it is a good substitute for gasoline or can be blended with it. This percentage of blending ranges from about 5% to 95% of gasoline. Mostly ethanol is produced by fermentation of sugars [largely sucrose or glucose] using the yeast S. cerevisiae. The major raw material required for ethanol production is hexose sugars. Sugarcane molasses is a widely used sucrose based feedstock for ethanol production in countries like India which is the second largest sugarcane producing country in the world. The molasses is a by-product of sugar processing unit and it contains about 45 to 50% of fermentable sugars. But the cost of this feedstock is a major challenge in ethanol production as it accounts up to 70% of the total production costs. It is therefore necessary to utilize the available carbon source to its maximum by increasing the ethanol yield from available sugars. Glycerol, acetic acid, and acetaldehyde are the by-products which are formed during ethanol production by fermentation. Here about 4 to 6% carbon flux can go towards glycerol and acetic acid production. To solve the problem of conversion of maximum sugar to ethanol, a reduction in glycerol or acetic acid production is one of the ways to achieve higher ethanol yields. Even a slight diversion of carbon flux from glycerol or acetic acid to ethanol may have huge impact at the industrial scale where ethanol is produced in terms of millions of litres. Glycerol is an intermediate metabolite in glycolysis pathway. S. cerevisiae produces this glycerol for two purposes. First purpose is to balance the high osmotic stress. Here glycerol production and accumulation in cells exposed to the high osmotic conditions helps to restore the turgor pressure and thus maintain the cellular integrity. Second purpose is to maintain the redox balance in the anaerobic growth conditions. These important roles of glycerol in yeast impose a challenge in reducing glycerol production by flux management as it directly hampers the growth of the organism. The glycerol synthesis thus cannot be completely eliminated but it can be reduced significantly and one of the approaches reported to reduce glycerol yield during ethanol production is genetic modification of the yeast strains. A major rate limiting step in glycerol synthesis is conversion of dihydroxyacetone phosphate to glycerol-3-phosphate by the enzyme glycerol-3-phosphate dehydrogenase, which is encoded by two isogenes GPD1 and GPD2. The deletion of GPD1 reduces the glycerol production; however, it causes an osmosentitive phenotype therefore causes negative effects on the growth and other fermentation properties like sugar consumption and product formation rate. Acetic acid is produced by S. cerevisiae by oxidation of acetaldehyde to acetate using aldehyde dehydrogenases. S. cerevisiae has five acetaldehyde dehydrogenase isogenes – ald2, ald3, ald4, ald5 and ald6. They are all cofactor dependent, either NAD+ or NADP+. All of the genes are also regulated differently and may function under different conditions. DETAILED DESCRIPTION The yeast S. cerevisiae possesses several pathways for the cell to adapt to different environmental stresses. Most of these pathways belong to class of mitogen activated protein kinase (MAPK) cascades. The high osmolarity glycerol (HOG) pathway is a MAPK pathway, which has a role in adaptation to hyperosmotic stress. Upstream of the HOG pathway are two branches, sln1 and sho1, both senses the osmolarity, but the sln1 branch is reported to be more sensitive. The present invention related to the deletion of ssk1 gene which blocks the sln1 signalling branch which lead to delayed nuclear localization response of activated hog1. Present invention also relates to the deletion of transcription factor SMP1. SMP1 is a hog1 dependent gene strongly induced upon osmotic stress. SMP1 encodes for a transcription factor belonging to the MEF2c family and strongly dependent on hog1. YEAST STRAINS AND GROWTH CONDITIONS In one of the embodiment of present invention, Escherichia coli (E coli) DH5? is used to multiply and carry plasmids. The S. cerevisiae strain (PRY201W) is used as wild type base strain. It is a diploid strain and widely used for the ethanol production at large industrial scales. The yeast peptone dextrose (YPD) medium is used for pre-culturing and maintaining the yeast strains. It is consisted of about 1% w/v of yeast extract, about 2% w/v of peptone and about 2% w/v of dextrose with initial pH 5 to 5.5. YPD agar contains about 2% agar in addition to other components. The sugarcane molasses medium consisted of sugarcane molasses as required and urea at about 0.05% w/v. All other methods used are standard methods used in the art. CONSTRUCTION OF YEAST MUTANTS: Deletion [or inactivation] of genes from parent wild type strain is carried out by replacing the desired locus with deletion cassette by homologous recombination of about 40 - 45 bp in both upstream and downstream regions of desired locus that is to be deleted. The deletion cassette consisted of a marker gene flanked by attB and attP sites recognized by phiC31 integrase enzyme of the bacteriophage phiC31. The cassette has a 45-bp homologous element to upstream region of the gene to be deleted at its 5’ end and a 45-bp homologous element to downstream region at its 3’end. The marker genes were simply an antibiotic resistant gene for the yeast. Parent yeast is a diploid yeast strain. The selected colonies on the antibiotic plate are screened with PCR, and clones where both alleles of the desired gene are deleted were selected. The selected stable engineered yeast mutants are allowed to recover further on YPD at about 30°C, at about 150 rpm overnight and plated on YPD agar with respective antibiotic for selection. Said mutant cultures are used further for fermentation of molasses to produce ethanol. The genotypes of the engineered yeast strains are given in Table A. The detailed procedures for creation of mutants are listed in Example 4 to 6. TABLE A: LIST OF YEAST STRAINS. Name Description/genotype Source PRY201W S. cerevisiae strain PRAJ internal collection PRY201A PRY201W?smp1 Disclosed in Example 4 PRY201B PRY201W?ssk1 Disclosed in Example 5 PRY201AB PRY201W?smp1, ?ssk1 Disclosed in Example 6 The strain PRY201A is constructed by deleting both the alleles of smp1 gene from parent yeast strain, PRY201W. The deletion was made by replacing both alleles of smp1 gene by deletion cassettes containing antibiotic selection marker genes in two steps and then excising out the marker genes in the third step. The colonies are selected on YPD agar plates with 200 µg/ml of geneticin and 25 µg/ml of phleomycin. The growing colonies are again screened by PCR to verify replacement of alleles by the deletion cassette. The antibiotic resistance genes were then looped out by transient expression of the PhiC 31 integrase enzyme from the selected colonies. The gene deletion and marker excision was further verified and confirmed by the DNA sequencing. Above procedure is then repeated for the construction of PRY201B. The strain PRY201B is constructed by deleting both the alleles of ssk1 gene from PRY201W. The strain PRY201AB was constructed by deleting both the alleles of ssk1 gene from PRY201A. The ssk1 gene has DNA sequence of SEQ ID NO: 1 of S. sereviciae. The smp1 gene has DNA sequence of SEQ ID NO: 2 of S. sereviciae. FERMENTATION STUDIES The above mutant yeast strains are pre-cultured twice before fermentation. First pre-culture is made by culturing yeast in YPD medium at about 30°C for about 18 hours under shaking conditions at about 150 rpm. Second pre-culture is prepared with same growth parameters in sterile sugarcane molasses medium having about 5% w/w of fermentable sugar and about 10% v/v of first pre-culture broth as inoculum. Said second pre-culture having about 108 cells/ml is used as the inoculum for the large –scale fermentations. The fermentation is carried out using unsterilized sugarcane molasses consisting of about 16% w/w fermentable sugar and about 10% v/v second pre-culture broth as inoculum at about 30°C and 150 rpm. Samples of fermentation broth at different time points were analyzed for residual sugar, acetic acid, ethanol and glycerol using standard high performance liquid chromatography methods. Said PRY201A produces about 3% to 5% more ethanol than parent strain, PRY201W. Said PRY201B also produces about 4% to 6% more ethanol than parent strain, PRY201W. While said double mutant PRY201AB produces about 6% to 9% more ethanol than the parent, PRY201W in identical fermentation conditions. In another embodiment of the invention, PRY201A shows up to 3% increase in glycerol production than the parent strain PRY201W. But PRY201B and PRY201AB produces less glycerol than the parent strain. Glycerol is reduced up to 21% in PRY201B and up to 31% in PRY201AB than the parent strain PRY201W. In another embodiment of the invention, acetic acid also reduced in modified strain than the parent, PRY201W. Said mutant strains produced between about 40% to about 70% less acetic acid compares with the parent strain PRY201W. SPENT WASH RECYCLE DURING FERMENTATION After completion of the fermentation, the fermented broth is distilled and the bottom stream from the distillation unit, known as spent wash, is recycled back into the fermentor to save on fresh water requirement of the process. As modified strain produces lesser acetic acid, the amount of spent wash recycled increased to about 30% of the fresh water requirement. For parent strain, due to the high concentration of acetic acid, only about 18% of the fresh water requirement could be substituted and if about 30% of spent wash is recycled then a significant drop in ethanol yield with increase in glycerol and acetic acid yields is observed. EXAMPLES Examples provided below give a wider utility of the invention without any limitations as to the variations that may be appreciated by the person skilled in the art. A non-limiting summary of various experimental results is given in the examples, which demonstrate the advantageous and novel aspects of the modified strains over the parent strain based on the comparative data from experimentation in shake flask fermentation, fermentation in bio reactor and commercial level fermentation with spent wash recycled during the fermentation. EXAMPLE 1: YEAST STRAINS AND CULTURING MEDIA The YPD medium used for pre-culturing consisted of yeast extract 1% w/v, peptone 2% w/v, dextrose 2% w/v with initial pH 5 to 5.5. YPD agar had 2% agar in addition to yeast extract 1% w/v, peptone 2% w/v and dextrose 2% w/v. The sugarcane molasses medium consisted of sugarcane molasses as required and urea at about 0.05% w/v. All other methods used are standard methods used in the art. The basic or wild type yeast used is named PRY201W. The double mutant strain is named PRY201AB and is also known as X2P3 in the internal records. EXAMPLE 2: IDENTITY OF GENES The genes referred as ssk1 and smp1 are described herein below. The ssk1 gene from S. cerevisiae has an SGD ID of S000003996 and a systematic name of YLR006C. The gene has about 2139 base pairs of nucleotides and the transcribed protein has 712 amino acids in the polypeptide. According to the yeast genome database, SSK1p is a cytoplasmic phosphorelase intermediate osmosensor and regulator. The smp1 gene in S. cerevisiae has an SGD ID of S000000386 and a systematic name of YBR182C. The gene has about 1359 base pairs of nucleotides and the transcribed protein has 452 amino acids in the polypeptide. According to the yeast genome database, SMP1p is a MADS-box transcription factor involved in osmotic stress response. EXAMPLE 3: ANALYTICAL METHODS Sugars were analyzed by using standard high performance liquid chromatography methods. The fermentation samples were loaded on Biorad Aminex HPX-87N columns. The column temperature was maintained at about 85°C. About 0.01 M disodium hydrogen phosphate was used as the mobile phase at a flow rate of about 0.6 ml/min. The RI detector maintained at about 40°C was used for sugar detection. The metabolites like ethanol, acetic acid and glycerol were also analyzed by using standard high performance liquid chromatography methods. The fermentation samples were loaded on Biorad Aminex HPX-87H columns. The column temperature was maintained at 55°C. About 0.005 M sulphuric acid was used as the mobile phase at a flow rate of about 0.6 ml/min. The RI detector maintained at 40°C was used for detection of ethanol, acetic acid and glycerol. EXAMPLE 4: CONSTRUCTION OF PRY201A The strain PRY201A was constructed by deleting both the alleles of smp1 gene from parent yeast strain, PRY201W. The smp1 gene sequence is as per SEQ. ID No. 2 or any gene with sequence homology about 50% to SEQ. ID No. 2 as listed in EXAMPLE 14. The deletion was made by replacing both alleles of smp1 gene by deletion cassettes containing antibiotic selection marker genes in two steps and then excising out the marker genes in the third step. In the first step, PRY201W was transformed with a deletion cassette having geneticin resistance gene marker as shown in Figure 1. The transformants were plated on YPD agar plates with 200 µg/ml of geneticin and incubated at 30°C to allow growth. The growing colonies were screened by PCR to verify deletion. Selected colony had one of the alleles of smp1 replaced with the deletion cassette. In the second step, the selected colony was again transformed with another deletion cassette which had phleomycin resistance gene marker as shown in Figure 1. The colonies were selected on YPD agar plates with 200 µg/ml of geneticin and 25 µg/ml of phleomycin. The growing colonies were again screened by PCR to verify replacement of the second allele by the deletion cassette. The antibiotic resistance genes were then looped out by transient expression of the PhiC 31 integrase enzyme from the selected colonies. The gene deletion and marker excision was further verified and confirmed by the DNA sequencing. The inactivation of smp1 did not causing no adverse effect on physiology of said mutant strain. EXAMPLE 5: CONSTRUCTION OF PRY201B The strain PRY201B was constructed by deleting both the alleles of ssk1 gene from parent yeast strain, PRY201W. The ssk1 gene sequence is as per SEQ. ID No. 1 or any gene with sequence homology about 50% to SEQ. ID No. 1 as listed in EXAMPLE 14. The deletion was made by replacing both alleles of ssk1 gene by deletion cassettes containing antibiotic selection marker genes in two steps and then excising out the marker genes in the third step. In the first step, PRY201W was transformed with a deletion cassette having geneticin resistance gene marker as shown in Figure 2. The transformants were plated on YPD agar plates with about 200 µg/ml of geneticin and incubated at about 30°C to allow growth. The growing colonies were screened by PCR to verify deletion. Selected colony had one of the alleles of ssk1 replaced with the deletion cassette. In the second step, the selected colony was again transformed with another deletion cassette which had hygromycin resistance gene marker. The colonies were selected on YPD agar plates with about 200 µg/ml of geneticin and about 300 µg/ml of hygromycin. The growing colonies were again screened by PCR to verify replacement of the second allele by the deletion cassette. The antibiotic resistance genes were then looped out by transient expression of the PhiC 31 integrase enzyme from the selected colonies. The gene deletion and marker excision was further verified and confirmed by the DNA sequencing. The inactivation of ssk1 did not causing no adverse effect on physiology of said mutant strain. EXAMPLE 6: CONSTRUCTION OF PRY201AB The strain PRY201AB was constructed by deleting both the alleles of ssk1 gene from PRY201A. The deletion was made by replacing both alleles of ssk1 gene by deletion cassettes containing antibiotic selection marker genes in two steps and then excising out the marker genes in the third step as described in Example 4. Table 1 illustrates the list of yeast strains disclosed herein. The double inactivation of smp1 and ssk1 did not causing no adverse effect on physiology of said mutant strain. TABLE 1: LIST OF YEAST STRAINS. Name S. cerevisiae Genotype Source PRY201W Wild Type PRAJ internal collection PRY201A PRY201W?smp1 Disclosed herein PRY201B PRY201W?ssk1 Disclosed herein PRY201AB PRY201W?smp1, ?ssk1 Disclosed herein EXAMPLE 7: SHAKE FLASK FERMENTATION STUDIES The yeast strains were pre-cultured twice before fermentation. First pre-culture was made by culturing yeast in 100 ml Erlenmeyer flask with about 40 ml sterile YPD medium at about 30°C for 18-20 hours (approximate OD600 of 20) under shaking conditions of about 150 rpm. Second pre-culture was prepared in sterile sugarcane molasses medium with about 5% w/w of fermentable sugar and about 10% v/v of first pre-culture broth as inoculum. Second pre-culture had working volume of about 100 ml in 250-ml Erlenmeyer flask and cultured for 18-20 hours (to approximate cell density = 2.5 x 108 cells/ml) with shaking at about 150 rpm. The main fermentation in shake flask was done with working volume of about 500 ml in a 1-liter Erlenmeyer flask. Here unsterilized sugarcane molasses medium was utilized consisting of about 16% w/w fermentable sugar and about 10% v/v second pre-culture broth as inoculum. Fermentation was done at about 30°C under shaking conditions of about 150 rpm. Samples of fermentation broth at different time points were analyzed for residual sugar, acetic acid, ethanol and glycerol. EXAMPLE 8: 1-L BIOREACTOR FERMENTATION STUDIES The fermentation in 1-L bioreactors was performed in fed-batch mode. Bench top fermentor with vessel capacity of 1.3-L was used in these experiments. The inoculum was prepared by pre-culturing yeast strains twice as disclosed in Example 6. The bioreactor was initially loaded with about 100 ml second pre-cultured broth as inoculum in about 400 ml water and about 0.5 g of urea. After this, about 500 ml of diluted sugarcane molasses consisting of about 32% w/w fermentable sugars was continuously dispensed in the bioreactor at a flow rate of about 0.55 ml/min to complete the feeding in about 16 h. The temperature in the bioreactor was maintained at about 30°C with help of the water jacket and mixing was achieved throughout the fermentation process by continuous agitation at about 250 rpm. Samples were taken at regular intervals and analyzed for residual sugars, acetic acid, ethanol and glycerol. EXAMPLE 9: ETHANOL PRODUCTION The results comparing the ethanol yields produced by all the strains are given in Table 2. PRY201A shows about 3% increase in shake flask and about 5% increase in bioreactor over the parent, PRY201. PRY201B shows about 4% increase in shake flask and about 6% increase in bioreactor over the parent, PRY201W. PRY201AB shows about 6% increase in shake flask and about 9% increase in bioreactor over the parent, PRY201W. TABLE 2: ETHANOL YIELDS (G OF ETHANOL/ G OF SUGAR [% DIFFERENCES ARE GIVEN IN BRACKETS]). SIZE PRY201W PRY201A PRY201B PRY201AB Shake flask 0.447 [0] 0.461 [3.1] 0.465 [4.0] 0.474 [6.0] Bioreactor 0.438 [0] 0.459 [4.8] 0.465 [6.2] 0.476 [8.7] EXAMPLE 10: GLYCEROL PRODUCTION The results comparing the glycerol yields produced by all the strains are given in Table 3. PRY201A shows a 3% increase in shake flask and 1% increase in bioreactor over the parent, PRY201W. PRY201B shows an 18% decrease in shake flask and 21% decrease in bioreactor over the parent, PRY201W. PRY201AB shows about 12% decrease in shake flask and 31% decrease in bioreactor over the parent, PRY201W. TABLE 3: GLYCEROL YIELDS (G OF GLYCEROL/ G OF SUGAR [% DIFFERENCES ARE GIVEN IN BRACKETS]). SIZE PRY201W PRY201A PRY201B PRY201AB Shake flask 0.0598 [0] 0.0616 [3.0] 0.0488 [-19.4] 0.0527 [-12.0] Bioreactor 0.0576 [0] 0.0582 [1.1] 0.0453 [-22.4] 0.0400 [-31.6] EXAMPLE 11: ACETIC ACID PRODUCTION The results comparing the acetic acid yields produced by all the strains are given in Table 4. PRY201A shows a 19% decrease in shake flask and 30% decrease in bioreactor over the parent, PRY201W. PRY201B shows a 42% decrease in shake flask and 40% decrease in bioreactor over the parent, PRY201W. PRY201AB shows a 50% decrease in shake flask and 50% decrease in bioreactor over the parent, PRY201W. TABLE 4: ACETIC ACID YIELDS (G OF ACETIC ACID/ G OF SUGAR [% DIFFERENCES ARE GIVEN IN BRACKETS]). SIZE PRY201W PRY201A PRY201B PRY201AB Shake flask 0.00616 [0] 0.00496 [-19.5] 0.00355 [-42.4] 0.00310 [-50.0] Bioreactor 0.00588 [0] 0.00412 [-30.0] 0.00353 [-40.0] 0.00294 [-50.0] EXAMPLE 12: FERMENTATION AT COMMERCIAL SCALE Fermentation using cane molasses medium was carried out at commercial scale in a fermentor of about 1-KL working volume. The comparative data were collected for an existing commercial strain X and PRY201AB on the ethanol, glycerol and acetic acid production yields. The results are shown in Table 5. The fermentation with the strain PRY201AB showed about 4% increase in ethanol yield over the commercial strain X. It further showed about 73% reduction in acetic acid compared to strain X. However, an increase of about 14% in glycerol was seen when using PRY201AB as compared to strain X. TABLE 5: COMPARISON OF YEAST STRAINS AT A COMMERCIAL SCALE [% DIFFERENCES ARE GIVEN IN BRACKETS]. Strain Ethanol yield (g/ g of sugar) Glycerol yield (g/ g of sugar) Acetic acid yield (g/ g of sugar) Strain X 0.449 [0] 0.0383 [0] 0.0163 [0] PRY201AB 0.469 [4.3] 0.0437 [12.4] 0.0044 [-73.0] EXAMPLE 13: SPENT WASH RECYCLE On the completion of fermentation in a 1-KL fermentor at the commercial scale, the fermented broth is distilled and the bottom stream from the distillation unit, known as spent wash, is recycled back to the fermentor to save on fresh water requirement of the process. As shown in Table 6, due to the high concentration of acetic acid, only about 18% of the fresh water requirement is substituted with spent wash when commercial strain X was used. However, with strain PRY201AB producing lesser acetic acid, the amount of spent wash recycled increased to about 30% of the fresh water requirement. However at about 30% of spent wash recycled, strain X shows a drop in ethanol yield with increase in glycerol and acetic acid yields. TABLE 6: COMPARISON OF YEAST STRAINS FOR SPENT WASH RECYCLED AT COMMERCIAL SCALE. Strain Spent wash recycle as percentage of water requirement [%] Ethanol yield (g/ g of sugar) Glycerol yield (g/ g of sugar) Acetic acid yield (g/ g of sugar) PY201AB 29 0.469 0.0597 0.0089 Strain X 28 0.429 0.0659 0.0155 Strain X 18 0.464 0.0627 0.0136 EXAMPLE 14: SEQUENCES OF GENES The ssk1 DNA sequence is SEQ ID NO. 1 [total 2229 nucleotides listed]: CTGCTGTAAATCAAAAACGAATCGATTTTGGGGAGACAAGTAAAAATGCTCAATTCTGCGTTACTGTGGAAGGTTTGGCTACGAATAGACAACTCCACTGATGAAGTAAACCAACCAATTGCTGTACAGTTCGATGAAATAGATACTGTTGATGATTTGAAGAGCAGGTTTTTTCAGAAACTGAGTTCGACTCGATGGCGAGAAATTAACGATAATGCTTCCATTGCAATAGGCCTCTACGCACCTAAATTTGACAATCAAGCCGACAATACCAGTAGTAACAACACTAACGATAATAGTTGTCGAAGTAAGAGTAACGGTGCTGGAAGTGGCGCCAACCTTTCCGTTAATAGCAATACCAAGAGTTCAGTGAGCCCCACAGCAGGATCATTTGGTCTTTCAAAAGACCTTGCAAAGGACAGGAATGTTCTCCAGCATCCTAAACCTACGCAGAAAAGAGGAGCATTATACGACGCCTTTGCCGCCGCGCCGACAGTGGCCGCGACTACCAATGTGGATTTTCCTCCCAACGAGGCGCCAATGCTAAGCCCGCAAAGACCATACTCTACTAGTCCTAAACAGTTTCCAGCAACAACTAAAAGTCCGTTACTGCGATTTGCCTCAGTCTCACCCTACCCTAAATTTCATCCTGATAATCAAATTATGGCATCAGCTGGTCTTACATACGTCTCACCGCATAATAAAAATAAATACACAAGGCCGTTGATTAGAAAAGGTTTAAATTTCACCACAGAATCAGTTAATGATTGCACTTATAAAATCATCTTTGAACCGGATGAATTGGCTATTAACATATATAAGGAACTGTTCGGAACCATGGGTTCCCAACCTGCATCGCAGCCTTTGCTGATATTTTCGAATGTTAATTTACGCCAGGATGTACCGCCTTTAGATATCTTAAATGTTGTAGACTATGTTCCTACGAATGAAGAAATTTCGCAGCAGAAAACTCAACCAACAGACCATGGGGCCGTTGGTGTTTTTCATCTAGACGATCATATTTCTCCGGGCGAACAAAGTCTTAAGCAAACAATTGGTGATAAAGCAGATCTTAAAGGTAAAGATGGCAATAGCAGCCCTCAGGAATTTAAATTAATAACTGATGAAGAGCAATTGAGAAGAGCGTCACAAGAACTGAAGGATGAGGAAAAGGATGCCGAGTCTCCTTGGCAAGCAATCTTGCTGTTACCAAAAGGTTATAAAGGAGGGGTAGATTTTCGAAATAAACCAGTGGCCCACACGGATTCATCTTTCAATAATGAAGACACAATTACTCATTCAGAGTTAGAAGTGAACACCGGATCCCCTTCGCAAGAAAGCGGATCACTTAATGAAGCTGGCATAGGCATAATGCAACCCATGTCGGAAGTACAAAGAAGAAAAGAAGACGTTACGCCCGCATCACCAATATTAACAAGTAGTCAAACGCCGCATTACTCAAACTCGCTTTATAACGCACCTTTTGCTGTTTCCTCTCCACCAGATCCTTTACCAAACCTTTTTACCACCACAAGTGAAAAAGTTTTCCCCAAAATTAATGTTTTAATAGTTGAAGACAACGTCATCAACCAAGCTATCTTAGGTTCCTTTCTGAGGAAACACAAAATCTCATATAAACTGGCTAAAAATGGTCAAGAAGCTGTTAATATTTGGAAGGAAGGCGGTCTTCATTTAATATTTATGGATTTACAGCTGCCTGTCTTGTCTGGTATAGAAGCTGCCAAGCAGATTAGGGACTTCGAAAAACAAAATGGCATTGGCATTCAAAAAAGTCTCAATAACTCACACTCCAATCTTGAAAAAGGTACTTCAAAGAGATTCTCTCAGGCGCCCGTGATTATTGTAGCATTGACCGCATCTAACTCTCAGATGGATAAAAGAAAAGCACTTCTTTCTGGTTGTAACGACTACCTGACTAAACCAGTGAATTTACACTGGCTTAGTAAGAAAATTACAGAGTGGGGATGTATGCAAGCCTTGATTGATTTTGACAGCTGGAAGCAGGGAGAAAGCCGGATGACCGACAGTGTTTTGGTTAAATCTCCACAGAAACCTATTGCACCTTCCAACCCTCACTCATTCAAACAAGCGACATCTATGACCCCTACACACAGCCCAGTAAGAAAAAATTCAAACCTCTCGCCCACTCAAATAGAATTGTGAGTTTGGTTGTACCGTGTAGAGGACATTATGATAGAATGTAACGAT The smp1 DNA sequence is SEQ ID NO. 2 [total 1449 nucleotides are listed]: CTCTAGATAAGCAAACACAATTATTTTCAAAAAAATTTCTGCTAAATGGGTAGAAGAAAAATTGAAATTGAACCTATCAAAGATGATAGAAATCGTACAGTTACTTTCATAAAGCGAAAAGCAGGACTGTTTAAAAAGGCTCATGAATTGTCAGTACTTTGCCAAGTAGACATTGCTGTCATTATTTTAGGATCCAATAATACATTCTACGAATACTCTTCTGTTGATATGAGTAACCTGCTTAATGTTCATCAAAACAACACTGATCTTCCTCATAATATCATAGAACCATCTGATTATGGTGACTATGTGAAAAAACCACGTGTTGTTCTGAATGAAAGGAAGCGCAGGCGAAGAAGAGCAACCGTGTTGCGACCAGCTTCTCATTCTGGGAGTTGTACAGTTTCGAGTCAAGATCCCTCCAGTGTACAAAACAATGGGAATTTAAGCGCTCCGTTGGCGTCAAATGACGCCGGGAACGCTGGTGTAAGTACACCATTGGTGCATTGCCACGGAGCAATATCACGTAGCGGATCCAATCATTCTGACTGTGCAAGAAATAGTGCAGATTATCAAATGTTGCAAGGCGGTTTAAATTCTGGTGGGAGTTTTCATGCTAATGATTATAAAGAAAGCGTAGACCAACAGCATGTTGCAAACGAGGCTATTCATAGGAATTTTATGAACAAGAGGATTAGGCCGGATACTCATTTACTACTTTCTGAATCTAACCACTCTAATTATCATAATTTTTACCCGTCGCCTTACGAGAATTTGCCAAAGCCTTCATTGCCTGCAAGTTTAGTGGGCAATATTCCATCCTTTCAATCGCAATTTGTACAGGTTATTCCGGCAAATAGTAACCCAATGGGAAAAGGATTTAATGGGACGGGTGACAGCGAGAGCTTTGAAGCAAAGCAAAAGATACACCCGACAGTTGCTATATCAAATACTTTGGAAGGTCCAGCTCCAGTGCAGGCGATGGTCCATCACCTGCACCAACTGAACAGCAATAGAGGAAAGCTCTCAGGGAAGCCATATTTAAAGCTAAATATTCCGAAGGCCACAAATGACGCTTGCCAGAGGTCGCCAGCAATGTATTCAGGAACCGCATCACCGAAAACGGATGTACAAGCCACTCCCAATCAAATGCTCGCCAGCAACATGTCCTCCCCTCTTTCTCGTTCAAAGTTTTTGGGATTCAAGAACAATGATATGGACGACTTATATCATAATGGCCGATGTGGCAGCACTTATGTAAATAACAAAACATTCTTTCTGAAACCGCCAATTGGAAGACCGCCTAAATTTCCGAAAAGCCCGTCTTCATCTATTGTGGTTTTTCCTTCCTCGGTAGCTAGTTCAACTTTGAAATCCACGAGTTCGACAAACTCTCCAGATTAATGAATCGCTTTCTAGCTACTTTTTACTACAAGAAAGCATTCGCTT The flanking regions for homologous recombination events are underlined and shown bold for the ssk1 and smp1 genes. The invention as disclosed in the specification uses the biological material from India and an application for the necessary permission has been made to the component authority. The strain disclosed herein is deposited with MTCC for safe deposit of proprietary biological resources.

Specification

Claims:WE CLAIM:
1. A modified yeast strain for reduced production of fermentation by-products comprising:
(a) a gene connoted ssk1 is inactivated; or
(b) a gene connoted smp1 is inactivated; or
(c) both genes connoted ssk1 and smp1 are inactivated; and
(d) said genes inactivation causing no adverse effect on physiology of said strain.
2. A yeast strain as claimed in claim 1 is of a Saccharomyces sp.
3. A yeast strain as claimed in claim 1, wherein said ssk1 gene has DNA sequence of SEQ ID NO: 1 of S. cerevisiae or any gene with a sequence homology of about 50% to SEQ ID NO: 1.
4. A yeast strain as claimed in claim 1, wherein said smp1 gene has DNA sequence of SEQ ID NO: 2 of S. cerevisiae any gene with a sequence homology of about 50% to SEQ ID NO: 2.
5. A yeast strain as claimed in claim 1, wherein fermentation by-product acetic acid is produced up to 50% less compared with non-modified yeast strain.
6. A yeast strain as claimed in claim 1, wherein fermentation by-product glycerol is produced up to 30% less compared with non-modified yeast strain.
7. A yeast strain as claimed in claim 1, wherein fermentation product ethanol is produced up to 9% more compared with non-modified yeast strain.
8. A yeast strain as claimed in claim 1, when used for fermentation the spent wash produced is recyclable up to 30% in the next round of said fermentation process.
9. A yeast product consisting of yeast strain as claimed in claim 1 for the production of ethanol.
, Description:THE FIELD OF INVENTION
The invention relates to a method for the preparation of industrially useful strains of yeast Saccharomyces cerevisiae and the strain prepared by said method. In particular the invention relates to the creation of double mutant strains of said yeast that shows high ethanol conversion efficiency and substantially reduced acetic acid and glycerol production during fermentative production of ethanol from a sugar-based feedstock.

INTRODUCTION
The energy demand has been increasing continuously and one of the ways to address it is by increasing the production of renewable liquid fuels like ethanol. Ethanol can serve as a supplement to fuel supply as it is a good substitute for gasoline or can be blended with it. This percentage of blending ranges from about 5% to 95% of gasoline.
Mostly ethanol is produced by fermentation of sugars [largely sucrose or glucose] using the yeast S. cerevisiae. The major raw material required for ethanol production is hexose sugars. Sugarcane molasses is a widely used sucrose based feedstock for ethanol production in countries like India which is the second largest sugarcane producing country in the world. The molasses is a by-product of sugar processing unit and it contains about 45 to 50% of fermentable sugars. But the cost of this feedstock is a major challenge in ethanol production as it accounts up to 70% of the total production costs. It is therefore necessary to utilize the available carbon source to its maximum by increasing the ethanol yield from available sugars. Glycerol, acetic acid, and acetaldehyde are the by-products which are formed during ethanol production by fermentation. Here about 4 to 6% carbon flux can go towards glycerol and acetic acid production.
To solve the problem of conversion of maximum sugar to ethanol, a reduction in glycerol or acetic acid production is one of the ways to achieve higher ethanol yields. Even a slight diversion of carbon flux from glycerol or acetic acid to ethanol may have huge impact at the industrial scale where ethanol is produced in terms of millions of litres.
Glycerol is an intermediate metabolite in glycolysis pathway. S. cerevisiae produces this glycerol for two purposes. First purpose is to balance the high osmotic stress. Here glycerol production and accumulation in cells exposed to the high osmotic conditions helps to restore the turgor pressure and thus maintain the cellular integrity. Second purpose is to maintain the redox balance in the anaerobic growth conditions. These important roles of glycerol in yeast impose a challenge in reducing glycerol production by flux management as it directly hampers the growth of the organism. The glycerol synthesis thus cannot be completely eliminated but it can be reduced significantly and one of the approaches reported to reduce glycerol yield during ethanol production is genetic modification of the yeast strains. A major rate limiting step in glycerol synthesis is conversion of dihydroxyacetone phosphate to glycerol-3-phosphate by the enzyme glycerol-3-phosphate dehydrogenase, which is encoded by two isogenes GPD1 and GPD2. The deletion of GPD1 reduces the glycerol production; however, it causes an osmosentitive phenotype therefore causes negative effects on the growth and other fermentation properties like sugar consumption and product formation rate.
Acetic acid is produced by S. cerevisiae by oxidation of acetaldehyde to acetate using aldehyde dehydrogenases. S. cerevisiae has five acetaldehyde dehydrogenase isogenes – ald2, ald3, ald4, ald5 and ald6. They are all cofactor dependent, either NAD+ or NADP+. All of the genes are also regulated differently and may function under different conditions.

DETAILED DESCRIPTION
The yeast S. cerevisiae possesses several pathways for the cell to adapt to different environmental stresses. Most of these pathways belong to class of mitogen activated protein kinase (MAPK) cascades. The high osmolarity glycerol (HOG) pathway is a MAPK pathway, which has a role in adaptation to hyperosmotic stress. Upstream of the HOG pathway are two branches, sln1 and sho1, both senses the osmolarity, but the sln1 branch is reported to be more sensitive.
The present invention related to the deletion of ssk1 gene which blocks the sln1 signalling branch which lead to delayed nuclear localization response of activated hog1. Present invention also relates to the deletion of transcription factor SMP1. SMP1 is a hog1 dependent gene strongly induced upon osmotic stress. SMP1 encodes for a transcription factor belonging to the MEF2c family and strongly dependent on hog1.

YEAST STRAINS AND GROWTH CONDITIONS
In one of the embodiment of present invention, Escherichia coli (E coli) DH5? is used to multiply and carry plasmids. The S. cerevisiae strain (PRY201W) is used as wild type base strain. It is a diploid strain and widely used for the ethanol production at large industrial scales. The yeast peptone dextrose (YPD) medium is used for pre-culturing and maintaining the yeast strains. It is consisted of about 1% w/v of yeast extract, about 2% w/v of peptone and about 2% w/v of dextrose with initial pH 5 to 5.5. YPD agar contains about 2% agar in addition to other components. The sugarcane molasses medium consisted of sugarcane molasses as required and urea at about 0.05% w/v. All other methods used are standard methods used in the art.

CONSTRUCTION OF YEAST MUTANTS:
Deletion [or inactivation] of genes from parent wild type strain is carried out by replacing the desired locus with deletion cassette by homologous recombination of about 40 - 45 bp in both upstream and downstream regions of desired locus that is to be deleted. The deletion cassette consisted of a marker gene flanked by attB and attP sites recognized by phiC31 integrase enzyme of the bacteriophage phiC31. The cassette has a 45-bp homologous element to upstream region of the gene to be deleted at its 5’ end and a 45-bp homologous element to downstream region at its 3’end. The marker genes were simply an antibiotic resistant gene for the yeast. Parent yeast is a diploid yeast strain. The selected colonies on the antibiotic plate are screened with PCR, and clones where both alleles of the desired gene are deleted were selected. The selected stable engineered yeast mutants are allowed to recover further on YPD at about 30°C, at about 150 rpm overnight and plated on YPD agar with respective antibiotic for selection. Said mutant cultures are used further for fermentation of molasses to produce ethanol. The genotypes of the engineered yeast strains are given in Table A. The detailed procedures for creation of mutants are listed in Example 4 to 6.

TABLE A: LIST OF YEAST STRAINS.
Name Description/genotype Source
PRY201W S. cerevisiae strain PRAJ internal collection
PRY201A PRY201W?smp1 Disclosed in Example 4
PRY201B PRY201W?ssk1 Disclosed in Example 5
PRY201AB PRY201W?smp1, ?ssk1 Disclosed in Example 6

The strain PRY201A is constructed by deleting both the alleles of smp1 gene from parent yeast strain, PRY201W. The deletion was made by replacing both alleles of smp1 gene by deletion cassettes containing antibiotic selection marker genes in two steps and then excising out the marker genes in the third step. The colonies are selected on YPD agar plates with 200 µg/ml of geneticin and 25 µg/ml of phleomycin. The growing colonies are again screened by PCR to verify replacement of alleles by the deletion cassette. The antibiotic resistance genes were then looped out by transient expression of the PhiC 31 integrase enzyme from the selected colonies. The gene deletion and marker excision was further verified and confirmed by the DNA sequencing. Above procedure is then repeated for the construction of PRY201B. The strain PRY201B is constructed by deleting both the alleles of ssk1 gene from PRY201W. The strain PRY201AB was constructed by deleting both the alleles of ssk1 gene from PRY201A. The ssk1 gene has DNA sequence of SEQ ID NO: 1 of S. sereviciae. The smp1 gene has DNA sequence of SEQ ID NO: 2 of S. sereviciae.
FERMENTATION STUDIES
The above mutant yeast strains are pre-cultured twice before fermentation. First pre-culture is made by culturing yeast in YPD medium at about 30°C for about 18 hours under shaking conditions at about 150 rpm. Second pre-culture is prepared with same growth parameters in sterile sugarcane molasses medium having about 5% w/w of fermentable sugar and about 10% v/v of first pre-culture broth as inoculum. Said second pre-culture having about 108 cells/ml is used as the inoculum for the large –scale fermentations. The fermentation is carried out using unsterilized sugarcane molasses consisting of about 16% w/w fermentable sugar and about 10% v/v second pre-culture broth as inoculum at about 30°C and 150 rpm. Samples of fermentation broth at different time points were analyzed for residual sugar, acetic acid, ethanol and glycerol using standard high performance liquid chromatography methods.
Said PRY201A produces about 3% to 5% more ethanol than parent strain, PRY201W. Said PRY201B also produces about 4% to 6% more ethanol than parent strain, PRY201W. While said double mutant PRY201AB produces about 6% to 9% more ethanol than the parent, PRY201W in identical fermentation conditions.
In another embodiment of the invention, PRY201A shows up to 3% increase in glycerol production than the parent strain PRY201W. But PRY201B and PRY201AB produces less glycerol than the parent strain. Glycerol is reduced up to 21% in PRY201B and up to 31% in PRY201AB than the parent strain PRY201W.
In another embodiment of the invention, acetic acid also reduced in modified strain than the parent, PRY201W. Said mutant strains produced between about 40% to about 70% less acetic acid compares with the parent strain PRY201W.

SPENT WASH RECYCLE DURING FERMENTATION
After completion of the fermentation, the fermented broth is distilled and the bottom stream from the distillation unit, known as spent wash, is recycled back into the fermentor to save on fresh water requirement of the process. As modified strain produces lesser acetic acid, the amount of spent wash recycled increased to about 30% of the fresh water requirement. For parent strain, due to the high concentration of acetic acid, only about 18% of the fresh water requirement could be substituted and if about 30% of spent wash is recycled then a significant drop in ethanol yield with increase in glycerol and acetic acid yields is observed.

EXAMPLES
Examples provided below give a wider utility of the invention without any limitations as to the variations that may be appreciated by the person skilled in the art. A non-limiting summary of various experimental results is given in the examples, which demonstrate the advantageous and novel aspects of the modified strains over the parent strain based on the comparative data from experimentation in shake flask fermentation, fermentation in bio reactor and commercial level fermentation with spent wash recycled during the fermentation.

EXAMPLE 1: YEAST STRAINS AND CULTURING MEDIA
The YPD medium used for pre-culturing consisted of yeast extract 1% w/v, peptone 2% w/v, dextrose 2% w/v with initial pH 5 to 5.5. YPD agar had 2% agar in addition to yeast extract 1% w/v, peptone 2% w/v and dextrose 2% w/v. The sugarcane molasses medium consisted of sugarcane molasses as required and urea at about 0.05% w/v. All other methods used are standard methods used in the art. The basic or wild type yeast used is named PRY201W. The double mutant strain is named PRY201AB and is also known as X2P3 in the internal records.

EXAMPLE 2: IDENTITY OF GENES
The genes referred as ssk1 and smp1 are described herein below. The ssk1 gene from S. cerevisiae has an SGD ID of S000003996 and a systematic name of YLR006C. The gene has about 2139 base pairs of nucleotides and the transcribed protein has 712 amino acids in the polypeptide. According to the yeast genome database, SSK1p is a cytoplasmic phosphorelase intermediate osmosensor and regulator. The smp1 gene in S. cerevisiae has an SGD ID of S000000386 and a systematic name of YBR182C. The gene has about 1359 base pairs of nucleotides and the transcribed protein has 452 amino acids in the polypeptide. According to the yeast genome database, SMP1p is a MADS-box transcription factor involved in osmotic stress response.

EXAMPLE 3: ANALYTICAL METHODS
Sugars were analyzed by using standard high performance liquid chromatography methods. The fermentation samples were loaded on Biorad Aminex HPX-87N columns. The column temperature was maintained at about 85°C. About 0.01 M disodium hydrogen phosphate was used as the mobile phase at a flow rate of about 0.6 ml/min. The RI detector maintained at about 40°C was used for sugar detection. The metabolites like ethanol, acetic acid and glycerol were also analyzed by using standard high performance liquid chromatography methods. The fermentation samples were loaded on Biorad Aminex HPX-87H columns. The column temperature was maintained at 55°C. About 0.005 M sulphuric acid was used as the mobile phase at a flow rate of about 0.6 ml/min. The RI detector maintained at 40°C was used for detection of ethanol, acetic acid and glycerol.

EXAMPLE 4: CONSTRUCTION OF PRY201A
The strain PRY201A was constructed by deleting both the alleles of smp1 gene from parent yeast strain, PRY201W. The smp1 gene sequence is as per SEQ. ID No. 2 or any gene with sequence homology about 50% to SEQ. ID No. 2 as listed in EXAMPLE 14. The deletion was made by replacing both alleles of smp1 gene by deletion cassettes containing antibiotic selection marker genes in two steps and then excising out the marker genes in the third step. In the first step, PRY201W was transformed with a deletion cassette having geneticin resistance gene marker as shown in Figure 1. The transformants were plated on YPD agar plates with 200 µg/ml of geneticin and incubated at 30°C to allow growth. The growing colonies were screened by PCR to verify deletion. Selected colony had one of the alleles of smp1 replaced with the deletion cassette. In the second step, the selected colony was again transformed with another deletion cassette which had phleomycin resistance gene marker as shown in Figure 1. The colonies were selected on YPD agar plates with 200 µg/ml of geneticin and 25 µg/ml of phleomycin. The growing colonies were again screened by PCR to verify replacement of the second allele by the deletion cassette. The antibiotic resistance genes were then looped out by transient expression of the PhiC 31 integrase enzyme from the selected colonies. The gene deletion and marker excision was further verified and confirmed by the DNA sequencing. The inactivation of smp1 did not causing no adverse effect on physiology of said mutant strain.

EXAMPLE 5: CONSTRUCTION OF PRY201B
The strain PRY201B was constructed by deleting both the alleles of ssk1 gene from parent yeast strain, PRY201W. The ssk1 gene sequence is as per SEQ. ID No. 1 or any gene with sequence homology about 50% to SEQ. ID No. 1 as listed in EXAMPLE 14. The deletion was made by replacing both alleles of ssk1 gene by deletion cassettes containing antibiotic selection marker genes in two steps and then excising out the marker genes in the third step. In the first step, PRY201W was transformed with a deletion cassette having geneticin resistance gene marker as shown in Figure 2. The transformants were plated on YPD agar plates with about 200 µg/ml of geneticin and incubated at about 30°C to allow growth. The growing colonies were screened by PCR to verify deletion. Selected colony had one of the alleles of ssk1 replaced with the deletion cassette. In the second step, the selected colony was again transformed with another deletion cassette which had hygromycin resistance gene marker. The colonies were selected on YPD agar plates with about 200 µg/ml of geneticin and about 300 µg/ml of hygromycin. The growing colonies were again screened by PCR to verify replacement of the second allele by the deletion cassette. The antibiotic resistance genes were then looped out by transient expression of the PhiC 31 integrase enzyme from the selected colonies. The gene deletion and marker excision was further verified and confirmed by the DNA sequencing. The inactivation of ssk1 did not causing no adverse effect on physiology of said mutant strain.

EXAMPLE 6: CONSTRUCTION OF PRY201AB
The strain PRY201AB was constructed by deleting both the alleles of ssk1 gene from PRY201A. The deletion was made by replacing both alleles of ssk1 gene by deletion cassettes containing antibiotic selection marker genes in two steps and then excising out the marker genes in the third step as described in Example 4. Table 1 illustrates the list of yeast strains disclosed herein. The double inactivation of smp1 and ssk1 did not causing no adverse effect on physiology of said mutant strain.

TABLE 1: LIST OF YEAST STRAINS.
Name S. cerevisiae Genotype Source
PRY201W Wild Type PRAJ internal collection
PRY201A PRY201W?smp1 Disclosed herein
PRY201B PRY201W?ssk1 Disclosed herein
PRY201AB PRY201W?smp1, ?ssk1 Disclosed herein

EXAMPLE 7: SHAKE FLASK FERMENTATION STUDIES
The yeast strains were pre-cultured twice before fermentation. First pre-culture was made by culturing yeast in 100 ml Erlenmeyer flask with about 40 ml sterile YPD medium at about 30°C for 18-20 hours (approximate OD600 of 20) under shaking conditions of about 150 rpm. Second pre-culture was prepared in sterile sugarcane molasses medium with about 5% w/w of fermentable sugar and about 10% v/v of first pre-culture broth as inoculum. Second pre-culture had working volume of about 100 ml in 250-ml Erlenmeyer flask and cultured for 18-20 hours (to approximate cell density = 2.5 x 108 cells/ml) with shaking at about 150 rpm. The main fermentation in shake flask was done with working volume of about 500 ml in a 1-liter Erlenmeyer flask. Here unsterilized sugarcane molasses medium was utilized consisting of about 16% w/w fermentable sugar and about 10% v/v second pre-culture broth as inoculum. Fermentation was done at about 30°C under shaking conditions of about 150 rpm. Samples of fermentation broth at different time points were analyzed for residual sugar, acetic acid, ethanol and glycerol.

EXAMPLE 8: 1-L BIOREACTOR FERMENTATION STUDIES
The fermentation in 1-L bioreactors was performed in fed-batch mode. Bench top fermentor with vessel capacity of 1.3-L was used in these experiments. The inoculum was prepared by pre-culturing yeast strains twice as disclosed in Example 6. The bioreactor was initially loaded with about 100 ml second pre-cultured broth as inoculum in about 400 ml water and about 0.5 g of urea. After this, about 500 ml of diluted sugarcane molasses consisting of about 32% w/w fermentable sugars was continuously dispensed in the bioreactor at a flow rate of about 0.55 ml/min to complete the feeding in about 16 h. The temperature in the bioreactor was maintained at about 30°C with help of the water jacket and mixing was achieved throughout the fermentation process by continuous agitation at about 250 rpm. Samples were taken at regular intervals and analyzed for residual sugars, acetic acid, ethanol and glycerol.

EXAMPLE 9: ETHANOL PRODUCTION
The results comparing the ethanol yields produced by all the strains are given in Table 2. PRY201A shows about 3% increase in shake flask and about 5% increase in bioreactor over the parent, PRY201. PRY201B shows about 4% increase in shake flask and about 6% increase in bioreactor over the parent, PRY201W. PRY201AB shows about 6% increase in shake flask and about 9% increase in bioreactor over the parent, PRY201W.

TABLE 2: ETHANOL YIELDS (G OF ETHANOL/ G OF SUGAR [% DIFFERENCES ARE GIVEN IN BRACKETS]).
SIZE PRY201W PRY201A PRY201B PRY201AB
Shake flask 0.447 [0] 0.461 [3.1] 0.465 [4.0] 0.474 [6.0]
Bioreactor 0.438 [0] 0.459 [4.8] 0.465 [6.2] 0.476 [8.7]

EXAMPLE 10: GLYCEROL PRODUCTION
The results comparing the glycerol yields produced by all the strains are given in Table 3. PRY201A shows a 3% increase in shake flask and 1% increase in bioreactor over the parent, PRY201W. PRY201B shows an 18% decrease in shake flask and 21% decrease in bioreactor over the parent, PRY201W. PRY201AB shows about 12% decrease in shake flask and 31% decrease in bioreactor over the parent, PRY201W.
TABLE 3: GLYCEROL YIELDS (G OF GLYCEROL/ G OF SUGAR [% DIFFERENCES ARE GIVEN IN BRACKETS]).
SIZE PRY201W PRY201A PRY201B PRY201AB
Shake flask 0.0598
[0] 0.0616
[3.0] 0.0488
[-19.4] 0.0527
[-12.0]
Bioreactor 0.0576
[0] 0.0582
[1.1] 0.0453
[-22.4] 0.0400
[-31.6]

EXAMPLE 11: ACETIC ACID PRODUCTION
The results comparing the acetic acid yields produced by all the strains are given in Table 4. PRY201A shows a 19% decrease in shake flask and 30% decrease in bioreactor over the parent, PRY201W. PRY201B shows a 42% decrease in shake flask and 40% decrease in bioreactor over the parent, PRY201W. PRY201AB shows a 50% decrease in shake flask and 50% decrease in bioreactor over the parent, PRY201W.

TABLE 4: ACETIC ACID YIELDS (G OF ACETIC ACID/ G OF SUGAR [% DIFFERENCES ARE GIVEN IN BRACKETS]).
SIZE PRY201W PRY201A PRY201B PRY201AB
Shake flask 0.00616
[0] 0.00496
[-19.5] 0.00355
[-42.4] 0.00310
[-50.0]
Bioreactor 0.00588
[0] 0.00412
[-30.0] 0.00353
[-40.0] 0.00294
[-50.0]
EXAMPLE 12: FERMENTATION AT COMMERCIAL SCALE
Fermentation using cane molasses medium was carried out at commercial scale in a fermentor of about 1-KL working volume. The comparative data were collected for an existing commercial strain X and PRY201AB on the ethanol, glycerol and acetic acid production yields. The results are shown in Table 5. The fermentation with the strain PRY201AB showed about 4% increase in ethanol yield over the commercial strain X. It further showed about 73% reduction in acetic acid compared to strain X. However, an increase of about 14% in glycerol was seen when using PRY201AB as compared to strain X.
TABLE 5: COMPARISON OF YEAST STRAINS AT A COMMERCIAL SCALE [% DIFFERENCES ARE GIVEN IN BRACKETS].
Strain Ethanol yield (g/ g of sugar) Glycerol yield (g/ g of sugar) Acetic acid yield (g/ g of sugar)
Strain X 0.449 [0] 0.0383 [0] 0.0163 [0]
PRY201AB 0.469 [4.3] 0.0437 [12.4] 0.0044 [-73.0]

EXAMPLE 13: SPENT WASH RECYCLE
On the completion of fermentation in a 1-KL fermentor at the commercial scale, the fermented broth is distilled and the bottom stream from the distillation unit, known as spent wash, is recycled back to the fermentor to save on fresh water requirement of the process. As shown in Table 6, due to the high concentration of acetic acid, only about 18% of the fresh water requirement is substituted with spent wash when commercial strain X was used. However, with strain PRY201AB producing lesser acetic acid, the amount of spent wash recycled increased to about 30% of the fresh water requirement. However at about 30% of spent wash recycled, strain X shows a drop in ethanol yield with increase in glycerol and acetic acid yields.

TABLE 6: COMPARISON OF YEAST STRAINS FOR SPENT WASH RECYCLED AT COMMERCIAL SCALE.
Strain Spent wash recycle as percentage of water requirement [%] Ethanol yield (g/ g of sugar) Glycerol yield (g/ g of sugar) Acetic acid yield (g/ g of sugar)
PY201AB 29 0.469 0.0597 0.0089
Strain X 28 0.429 0.0659 0.0155
Strain X 18 0.464 0.0627 0.0136

EXAMPLE 14: SEQUENCES OF GENES
The ssk1 DNA sequence is SEQ ID NO. 1 [total 2229 nucleotides listed]:
CTGCTGTAAATCAAAAACGAATCGATTTTGGGGAGACAAGTAAAAATGCTCAATTCTGCGTTACTGTGGAAGGTTTGGCTACGAATAGACAACTCCACTGATGAAGTAAACCAACCAATTGCTGTACAGTTCGATGAAATAGATACTGTTGATGATTTGAAGAGCAGGTTTTTTCAGAAACTGAGTTCGACTCGATGGCGAGAAATTAACGATAATGCTTCCATTGCAATAGGCCTCTACGCACCTAAATTTGACAATCAAGCCGACAATACCAGTAGTAACAACACTAACGATAATAGTTGTCGAAGTAAGAGTAACGGTGCTGGAAGTGGCGCCAACCTTTCCGTTAATAGCAATACCAAGAGTTCAGTGAGCCCCACAGCAGGATCATTTGGTCTTTCAAAAGACCTTGCAAAGGACAGGAATGTTCTCCAGCATCCTAAACCTACGCAGAAAAGAGGAGCATTATACGACGCCTTTGCCGCCGCGCCGACAGTGGCCGCGACTACCAATGTGGATTTTCCTCCCAACGAGGCGCCAATGCTAAGCCCGCAAAGACCATACTCTACTAGTCCTAAACAGTTTCCAGCAACAACTAAAAGTCCGTTACTGCGATTTGCCTCAGTCTCACCCTACCCTAAATTTCATCCTGATAATCAAATTATGGCATCAGCTGGTCTTACATACGTCTCACCGCATAATAAAAATAAATACACAAGGCCGTTGATTAGAAAAGGTTTAAATTTCACCACAGAATCAGTTAATGATTGCACTTATAAAATCATCTTTGAACCGGATGAATTGGCTATTAACATATATAAGGAACTGTTCGGAACCATGGGTTCCCAACCTGCATCGCAGCCTTTGCTGATATTTTCGAATGTTAATTTACGCCAGGATGTACCGCCTTTAGATATCTTAAATGTTGTAGACTATGTTCCTACGAATGAAGAAATTTCGCAGCAGAAAACTCAACCAACAGACCATGGGGCCGTTGGTGTTTTTCATCTAGACGATCATATTTCTCCGGGCGAACAAAGTCTTAAGCAAACAATTGGTGATAAAGCAGATCTTAAAGGTAAAGATGGCAATAGCAGCCCTCAGGAATTTAAATTAATAACTGATGAAGAGCAATTGAGAAGAGCGTCACAAGAACTGAAGGATGAGGAAAAGGATGCCGAGTCTCCTTGGCAAGCAATCTTGCTGTTACCAAAAGGTTATAAAGGAGGGGTAGATTTTCGAAATAAACCAGTGGCCCACACGGATTCATCTTTCAATAATGAAGACACAATTACTCATTCAGAGTTAGAAGTGAACACCGGATCCCCTTCGCAAGAAAGCGGATCACTTAATGAAGCTGGCATAGGCATAATGCAACCCATGTCGGAAGTACAAAGAAGAAAAGAAGACGTTACGCCCGCATCACCAATATTAACAAGTAGTCAAACGCCGCATTACTCAAACTCGCTTTATAACGCACCTTTTGCTGTTTCCTCTCCACCAGATCCTTTACCAAACCTTTTTACCACCACAAGTGAAAAAGTTTTCCCCAAAATTAATGTTTTAATAGTTGAAGACAACGTCATCAACCAAGCTATCTTAGGTTCCTTTCTGAGGAAACACAAAATCTCATATAAACTGGCTAAAAATGGTCAAGAAGCTGTTAATATTTGGAAGGAAGGCGGTCTTCATTTAATATTTATGGATTTACAGCTGCCTGTCTTGTCTGGTATAGAAGCTGCCAAGCAGATTAGGGACTTCGAAAAACAAAATGGCATTGGCATTCAAAAAAGTCTCAATAACTCACACTCCAATCTTGAAAAAGGTACTTCAAAGAGATTCTCTCAGGCGCCCGTGATTATTGTAGCATTGACCGCATCTAACTCTCAGATGGATAAAAGAAAAGCACTTCTTTCTGGTTGTAACGACTACCTGACTAAACCAGTGAATTTACACTGGCTTAGTAAGAAAATTACAGAGTGGGGATGTATGCAAGCCTTGATTGATTTTGACAGCTGGAAGCAGGGAGAAAGCCGGATGACCGACAGTGTTTTGGTTAAATCTCCACAGAAACCTATTGCACCTTCCAACCCTCACTCATTCAAACAAGCGACATCTATGACCCCTACACACAGCCCAGTAAGAAAAAATTCAAACCTCTCGCCCACTCAAATAGAATTGTGAGTTTGGTTGTACCGTGTAGAGGACATTATGATAGAATGTAACGAT

The smp1 DNA sequence is SEQ ID NO. 2 [total 1449 nucleotides are listed]:
CTCTAGATAAGCAAACACAATTATTTTCAAAAAAATTTCTGCTAAATGGGTAGAAGAAAAATTGAAATTGAACCTATCAAAGATGATAGAAATCGTACAGTTACTTTCATAAAGCGAAAAGCAGGACTGTTTAAAAAGGCTCATGAATTGTCAGTACTTTGCCAAGTAGACATTGCTGTCATTATTTTAGGATCCAATAATACATTCTACGAATACTCTTCTGTTGATATGAGTAACCTGCTTAATGTTCATCAAAACAACACTGATCTTCCTCATAATATCATAGAACCATCTGATTATGGTGACTATGTGAAAAAACCACGTGTTGTTCTGAATGAAAGGAAGCGCAGGCGAAGAAGAGCAACCGTGTTGCGACCAGCTTCTCATTCTGGGAGTTGTACAGTTTCGAGTCAAGATCCCTCCAGTGTACAAAACAATGGGAATTTAAGCGCTCCGTTGGCGTCAAATGACGCCGGGAACGCTGGTGTAAGTACACCATTGGTGCATTGCCACGGAGCAATATCACGTAGCGGATCCAATCATTCTGACTGTGCAAGAAATAGTGCAGATTATCAAATGTTGCAAGGCGGTTTAAATTCTGGTGGGAGTTTTCATGCTAATGATTATAAAGAAAGCGTAGACCAACAGCATGTTGCAAACGAGGCTATTCATAGGAATTTTATGAACAAGAGGATTAGGCCGGATACTCATTTACTACTTTCTGAATCTAACCACTCTAATTATCATAATTTTTACCCGTCGCCTTACGAGAATTTGCCAAAGCCTTCATTGCCTGCAAGTTTAGTGGGCAATATTCCATCCTTTCAATCGCAATTTGTACAGGTTATTCCGGCAAATAGTAACCCAATGGGAAAAGGATTTAATGGGACGGGTGACAGCGAGAGCTTTGAAGCAAAGCAAAAGATACACCCGACAGTTGCTATATCAAATACTTTGGAAGGTCCAGCTCCAGTGCAGGCGATGGTCCATCACCTGCACCAACTGAACAGCAATAGAGGAAAGCTCTCAGGGAAGCCATATTTAAAGCTAAATATTCCGAAGGCCACAAATGACGCTTGCCAGAGGTCGCCAGCAATGTATTCAGGAACCGCATCACCGAAAACGGATGTACAAGCCACTCCCAATCAAATGCTCGCCAGCAACATGTCCTCCCCTCTTTCTCGTTCAAAGTTTTTGGGATTCAAGAACAATGATATGGACGACTTATATCATAATGGCCGATGTGGCAGCACTTATGTAAATAACAAAACATTCTTTCTGAAACCGCCAATTGGAAGACCGCCTAAATTTCCGAAAAGCCCGTCTTCATCTATTGTGGTTTTTCCTTCCTCGGTAGCTAGTTCAACTTTGAAATCCACGAGTTCGACAAACTCTCCAGATTAATGAATCGCTTTCTAGCTACTTTTTACTACAAGAAAGCATTCGCTT

The flanking regions for homologous recombination events are underlined and shown bold for the ssk1 and smp1 genes.
The invention as disclosed in the specification uses the biological material from India and an application for the necessary permission has been made to the component authority. The strain disclosed herein is deposited with MTCC for safe deposit of proprietary biological resources.

Documents

Orders

Section Controller Decision Date
43 Bhanumathi R 2021-11-03
15 Bhanumathi R 2023-10-16

Application Documents

# Name Date
1 201721044702-SEQUENCE LISTING(PDF) [12-12-2017(online)].pdf 2017-12-12
2 201721044702-SEQUENCE LISTING [12-12-2017(online)].jpg 2017-12-12
3 201721044702-FORM 1 [12-12-2017(online)].pdf 2017-12-12
4 201721044702-DRAWINGS [12-12-2017(online)].pdf 2017-12-12
5 201721044702-COMPLETE SPECIFICATION [12-12-2017(online)].pdf 2017-12-12
6 201721044702-FORM-26 [02-04-2018(online)].pdf 2018-04-02
7 201721044702-FORM 18 [26-04-2018(online)].pdf 2018-04-26
8 201721044702-FORM 18 [26-04-2018(online)]-1.pdf 2018-04-26
9 abstract1.jpg 2018-08-11
10 201721044702-ORIGINAL UNDER RULE 6 (1A) FORM 1 FORM 3 FORM 5-181217.pdf 2018-08-11
11 201721044702-REQUEST FOR CERTIFYING OFFICE COPIES [05-12-2018(online)].pdf 2018-12-05
12 201721044702-REQUEST FOR CERTIFIED COPY [07-12-2018(online)].pdf 2018-12-07
13 201721044702-Request Letter-Correspondence [10-12-2018(online)].pdf 2018-12-10
14 201721044702-Form 1 (Submitted on date of filing) [10-12-2018(online)].pdf 2018-12-10
15 201721044702-CORRESPONDENCE(IPO)-(CERTIFIED COPY)-(7-12-2018).pdf 2018-12-11
16 201721044702-Form 3-241218.pdf 2019-04-09
17 201721044702-FORM 3 [20-02-2020(online)].pdf 2020-02-20
18 201721044702-FORM 3 [16-10-2020(online)].pdf 2020-10-16
19 201721044702-OTHERS [17-03-2021(online)].pdf 2021-03-17
20 201721044702-FER_SER_REPLY [17-03-2021(online)].pdf 2021-03-17
21 201721044702-CORRESPONDENCE [17-03-2021(online)].pdf 2021-03-17
22 201721044702-REQUEST FOR ADJOURNMENT OF HEARING UNDER RULE 129A [19-08-2021(online)].pdf 2021-08-19
23 201721044702-Response to office action [05-10-2021(online)].pdf 2021-10-05
24 201721044702-Annexure [05-10-2021(online)].pdf 2021-10-05
25 201721044702-US(14)-HearingNotice-(HearingDate-26-08-2021).pdf 2021-10-18
26 201721044702-US(14)-ExtendedHearingNotice-(HearingDate-24-09-2021).pdf 2021-10-18
27 201721044702-FER.pdf 2021-10-18
28 201721044702-PETITION UNDER RULE 137 [25-10-2021(online)].pdf 2021-10-25
29 201721044702-NBA INTIMATION TO APPLICANT COMPLY WITH REQUIREMENT-04-01-2023.pdf 2023-01-04
30 201721044702-Undertaking for compliance of Applicant's declaration given in Form 1(Para 12(iii)) [03-02-2023(online)].pdf 2023-02-03
31 201721044702-NBA Approval Submission [21-09-2023(online)].pdf 2023-09-21
32 201721044702-PatentCertificate16-10-2023.pdf 2023-10-16
33 201721044702-IntimationOfGrant16-10-2023.pdf 2023-10-16
34 201721044702-FORM-27 [12-08-2025(online)].pdf 2025-08-12

Search Strategy

1 searchE_17-09-2020.pdf

ERegister / Renewals

3rd: 18 Oct 2023

From 12/12/2019 - To 12/12/2020

4th: 18 Oct 2023

From 12/12/2020 - To 12/12/2021

5th: 18 Oct 2023

From 12/12/2021 - To 12/12/2022

6th: 18 Oct 2023

From 12/12/2022 - To 12/12/2023

7th: 18 Oct 2023

From 12/12/2023 - To 12/12/2024

8th: 18 Oct 2023

From 12/12/2024 - To 12/12/2025

9th: 10 Nov 2025

From 12/12/2025 - To 12/12/2026