Sign In to Follow Application
View All Documents & Correspondence

Inflammation Treatment, Detection And Monitoring Via Trem 1

Abstract: The present invention provides methods of treating inflammatory diseases/disorders in a subject by inhibiting/antagonizing TREM-1 expression/activity/signal transduction and/or DAP12/TyroBP expression and/or activity. Methods of detecting the presence of inflammatory disease in a subject by detecting TREM-1 and/or DAP12/TyroBP expression and/or activity in the subject or a sample obtained therefrom, wherein increased expression or activity is indicative of the inflammatory disease are also included. The present invention further provides methods for assessing the efficacy of a TREM-1-modulating agent administered to a patiem by detecting levels of secreted phosphoprotein 1 (SPP1) and/or one or more other biomarkers in the patient or in a sample from the patient.

Get Free WhatsApp Updates!
Notices, Deadlines & Correspondence

Patent Information

Application #
Filing Date
13 August 2009
Publication Number
38/2009
Publication Type
INA
Invention Field
BIOTECHNOLOGY
Status
Email
Parent Application

Applicants

WYETH
FIVE GIRALDA FARMS, MADISON, NJ 07940

Inventors

1. KUAI, JUN
15 FARMCREST AVENUE, LEXINGTON, MA 02421
2. DOWER, KEN
7 SMITH STREET, APT. 1, MEDFORD, MA 02155
3. FELDMAN, JEFFREY, L.
1 OLD COLONY LANE, APT. 12, ARLINGTON, MA 02476
4. PITTMAN, DEBRA, D.
20 NORTH SHORE ROAD, WINDHAM, NH 03087
5. CHATTERJEE-KISHORE, MOITREYEE
14 SHERWOOD DRIVE, WESTFORD, MA 01886
6. WINKLER, DAVID
127 GEORGE STREET, ARLINGTON, MA 02476
7. LIN, LIH-LING
107 COLLEGE ROAD, CONCORD, MA 01742
8. JELINSKY, SCOTT, ALAN
58 BLOSSOM STREET, WALTHAM, MA 02451
9. WILLIAMS, CARA
11 OBSERVATORY ROAD, METHUEN, MA 01844

Specification

INFLAMMATION TREATMENT, DETECTION AND MONITORING VIA
TREM-1
REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit of U.S. Provisional Patent Application
No. 61/001,687, filed November 2, 2007, U.S. Provisional Patent Application No.
60/923,131, filed April U, 2007, U.S. Provisional Patent Application No. 60/904,264,
filed February 28, 2007, and U.S. Provisional Patent Application No. 60/880,804, filed
January 16, 2007, the entire disclosures of each of which are hereby incorporated by
reference herein.
BACKGROUND
[0002] Rheumatoid arthritis (RA) is an autoimmune inflammatory disease that
affects about 1-2% of the population (Feldman (2002) Nature Rev. Immunol, 2(5):364-
371; Mount et al. (2005) Nature Rev. Drug Discovery 4(1):11-12). RA is characterized
by chronic inflammation and destruction of bone and cartilage in diarthrodial joints.
Disease onset is typically between 25 and 50 years of age, and one in three patients
becomes severely disabled within 20 years.
[0003] Although the precise etiology of RA is unknown, it has been proposed that
the initiating event in RA involves an infectious event or environmental exposure
(Firestein (2005) J. Clin. Rheumatology 11(3 Supp.):S39-44). Local induction of innate
immunity may activate cells in the synovial lining and prime the area for subsequent
adaptive immune responses in genetically susceptible individuals (Firestein (2005) L
Clin. Rheumatology 11(3 Supp.):S39-44). The synovium of established RA patients is
characterized by marked synovial intimal lining hyperplasia, increased vascularity, and
accumulation of inflammatory cells in the sublining. Biopsies of RA synovium have
revealed spontaneous production of a number of pro-inflammatory cytokines, such as
TNF-a, EL-ip, IL-6, and granulocyte-macrophage colony-stimulating factor (GM-CSF)
(Feldman et al. (1996) Ann. Rev. Immunol. 14:397-440). Antibodies that neutralize

TNF-α activity abrogate the production of multiple cytokines, a finding that led to the
discovery of novel anti-TNFa therapies to treat RA. Recent clinical findings highlight
the heterogeneity of RA, and suggest that additional factors may contribute to the
pathogenesis of the disease.
[0004] Triggering receptor expressed on myeloid cell-1 (TREM-1) is a recently
identified immunoglobulin-like cell surface receptor mainly expressed on neutrophils
and a subset of CDU14high monocytes (Colonna et al. (2000) Seminars in Immunol.
12(2): 121-27). TREM-I has a short intracellular domain, and TREM-1 signaling is
mediated through adaptor protein DAP12/TyproBP. DAP12yTyroBP is a
transmembrane protein with an immunoreceptor tyrosine-based activation motif
(ITAM) and functions as an adaptor protein, associating with TREM-1 and other
transmembrane receptors.
[0005] TREM-1 expression is up-regulated during acute inflammation and by
various Toll Like Receptor (TLR) ligands (Bouchon et al. (2001) Nature
410(6832): 1103-07; Bleharski etal. (2003) J. Immunol. 170(7):3812-18; Murakami et
al. (2006) 54(2):455-62). For instance, TREM-1 has been implicated in the acute
inflammation associated with sepsis (Colonna (2003) Nat. Rev. Immun. 3(6):445-53).
The expression of cell-surface and soluble TREM-1 is increased in sepsis in a manner
that correlates with disease severity (Gibot et al. (2005) New England J. Med.
350(5):451-58; Gibot et al. (2005) Critical Care Med. 33(4):792-96). In a monosodium
urate (MSU) induced inflammation model of gout, TREM-1 expression is rapidly
induced in the infiltrated peritoneal macrophages and neutrophils. Moreover, activation
of TREM-I stimulates production of multiple pro-inflammatory cytokines and
chemokines.
[0006] Furthermore, the synergistic effects of TREM-1 with TLRs and Nod-like
receptors in production of these cytokines amplify the inflammatory response (Bouchon
et al. (2001) Nature 410(6832): 1103-07; Bleharski et al. (2003) J. Immunol.
170(7):3812-18; Netea et al. (2006) J. Leukocyte Biol. 80(6): 1454-61). These data
suggest that increased TREM-1 expression and migration of the TREM-1 expressing

cells to the site of inflammation may contribute to acute inflammation through
amplification of the inflammatory responses.
[0007] A role for TREM-1 in acute inflammation was further demonstrated by the
protection of mice from the lethality of LPS- or bacteria-induced septic shock using the
TREM-1 ectodomain-Fc fusion or a synthetic peptide of TREM-1 ectodomain
(Bouchon et al. (2001) Nature 410(6832): 1103-07; Gibot et al. (2004) J. Exp. Med.
200(11): 1419-26). TREM-1-Fc also protects against zymosan-A induced granuloma
formation, which suggests that TREM-1 may play a role in chronic inflammation as
well as acute inflammation (Nochi et al. (2003) Am. J. Path. 162(4):1191-201).
Furthermore, accumulating evidence indicates that circulating levels of a soluble form
of TREM-1 is a biomarker for multiple inflammatory disorders, including sepsis,
pneumonia, acute pancreatitis, and peptic ulcer disease (Gibot et al. (2005) Intensive
Care Med. 31(4):594-97; Gibot et al. (2004) New England J. Med. 350(5):451-58;
Wang et al. (2004) World J. of Gastroenterology 10(18):2744-46; Koussoulas et al.
(2006) Eur. J. Gastroenterology & Hepatoiogy 18(4):375-79).
SUMMARY OF THE INVENTION
[0008] The present invention is based, in part, on the discovery that the
overexpression of TREM-1 and/or DAP12/TyroBP is associated with the presence of
autoimmune and/or inflammatory disease. Thus, TREM-1 and/or Dapl2/TyroBP are
novel therapeutic targets for the treatment or prevention of autoimmune and
inflammatory disorders. In one aspect, the invention relates to the use of TREM-1
and/or DAP12yTyroBP antagonists to treat or prevent an inflammatory disorder.
Antagonists that can be used in the invention include, for example, antibodies
(including, e.g., antibody fragments, single chain Fv, single domain antibodies derived
from any species, including, for example, human, mouse, camel, llama, shark, goat,
rabbit and bovine, as described more fully below); soluble receptors (including
truncated receptors, natural soluble receptors, or fusion proteins comprising a receptor
(or a fragment thereof) fused to a second protein, such as an Fc portion of an

immunoglobulin); peptide inhibitors; small molecules; ligand fusions; and binding
proteins. TREM-1 and DAP12/ryroBP are effective biomarkers for RA because these
genes are overexpressed in individuals afflicted with RA. TREM-1 is a cellular
receptor expressed on specific cell types, such as neutrophils and a subset of monocytes,
and TREM-1 also exists in a soluble form. TREM-1 signaling is mediated through an
adaptor protein, DAP12/ryroBP. Activation of TREM-1 induces production of
proinflammatory cytokines and chemokines. Thus, elevated expression of TREM-1
may cause or contribute to the inflammation observed in RA, asthma, and other
inflammatory diseases, such as chronic inflammatory diseases and respiratory
inflammatory disorders/diseases. Accordingly, TREM-1 and/or DAP12/TyroBP are
promising therapeutic targets for treating, modulating and/or preventing the symptoms
associated with RA and other inflammatory disorders.
[0009] In one aspect, the present invention provides a method of treating
inflammatory disease, such as, for example, chronic inflanmiatory disease (e.g., RA) or
respiratory disorder/disease (e.g., asthma), by reducing TREM-1-mediated signal
transduction. Reducing TREM-1-mediated signal transduction can include modulating,
inhibiting, and/or antagonizing the TREM-1 receptor and/or other molecules involved
in TREM-1 signal transduction {e.g., DAP12/TyroBP), thereby lessening, treating,
preventing, alleviating, and/or ameliorating symptoms associated with TREM-1
mediated inflammation. In some embodiments, TREM-1 protein expression is reduced
by inhibiting TREM-1 transcription; by selectively cleaving endogenous TREM-1
mRNA; or by inhibiting translation of endogenous TREM-1 mRNA. For example,
TREM-1 protein expression can be reduced by administering an interfering RNA, such
as an shRNA (e.g., an shRNA encoded by any of SEQ ID NOs:9-22) or an siRNA (e.g.,
any of SEQ ED NOs:23-26). In other embodiments, TREM-1 activation is inhibited by
administering a small molecule, a peptide mimetic, a peptide inhibitor, a ligand fusion
protein, an antibody or antibody fragment that binds TREM-1, an antibody or antibody
fragment that binds TREM-1 ligand, a soluble TREM-1 receptor or ligand-binding
portion thereof, or a soluble TREM-1 receptor fusion protein. Additional embodiments
of the invention provide methods for treating inflammatory disease, such as, for

example, chronic inflammatory disease (e.g., RA) or respiratory disorder/disease (e.g.,
asthma), by directly inhibiting non-TREM members (e.g., the TREM-1 accessory
protein DAP12/TyroBP) of the TREM-1 signaling pathway. In some embodiments,
TREM-1-mediated signal transduction is reduced in a human subject by inducing an
immune response to endogenous TREM-1 or DAP12/TyroBP protein in the subject.
For example, an immunogenic composition comprising an adjuvant and TREM-1 or
DAP12/TyroBP protein or an immunogenic fragment thereof can be administered to the
subject to provoke an immune response to the endogenous protein.
[0010] A further aspect of the invention provides for an antibody or antibody
fragment that binds to TREM-1 without activating the receptor. The antibody or
antibody fragment can be, for example, monoclonal. Additional embodiments of the
invention provide for methods of treating a subject (e.g., a human subject) which
include the step of administering to the subject a therapeutically effective quantity of an
antibody or antibody fragment that binds to TREM-1 without activating the receptor.
[0011] In another aspect, the invention provides for an shRNA encoded by any of
SEQ ID NOs:9-22.
[0012] The present invention provides that activation of TREM-1 results in the
differential expression of a number of genes, such as secreted phosphoprotein 1 (SPPl),
which can be used as markers for TREM-1 activity. Therefore, m another aspect, the
invention provides markers which are specific for and indicative of TREM-1 activity.
Changes in the level of one or more of these markers correlate with changes in TREM-1
activity. Thus, the invention also provides methods for assessing TREM-1 activity,
and/or the efficacy of a TREM-1-modulating agent administered to a patient (e.g., a
human patient) in need of such treatment, by detecting the level of one or more of these
markers. For example, secreted phosphoprotein 1 (SPPl; also known as osteopontin
(OPN), bone sialoprotein I (BSPI), early T-lymphocyte activation 1 (ETA-1), or
MGC110940) levels can be detected in the patient or in a sample from the patient, and
changes in SPPl levels correlate with changes in TREM-1 signaling. SPPl levels can
be detected in the patient or in any clinically relevant sample from the patient, such as a

body fluid sample (e.g., serum, synovial fluid, tracheobronchial fluid, sputum). In one
embodiment, the method includes the further step of comparing SPPl levels to a
reference level, wherein an increase in SPPl levels as compared to the reference level
can be indicative of an increase in TREM-1 activity, and wherein a decrease SPPl
levels as compared to the reference level can be indicative of a decrease in TREM-1
activity. The reference level can be, for example, SPPl levels detected in the patient or
in a sample from the patient at a time prior to administration of the TREM-1-
modulating agent. Additional markers which can be used to assess TREM-1 activity
according to the present invention are described more fully below, and in, for example,
HGURE 8A.
[0013] In a further aspect, the invention provides a method of screening for
candidate agents capable of modulating TREM-1 signaling. The method includes
contacting a TREM-1-expressing cell with a candidate agent and assessing the secreted
phosphoprotein 1 (SPPl) levels of the TREM-1-expressing cell to determine whether
the candidate agent modulates TREM-1 activation. Candidate agents which can be
screened in accordance with the invention include, for example, an interfering RNA, a
small molecule, a peptide mimetic, a peptide inhibitor, a ligand fusion protein, an
antibody or fragment thereof that binds TREM-1, an antibody or fragment thereof that
binds TREM-1 ligand, a soluble TREM-1 receptor, a soluble TREM-1 receptor fusion
protein, and combinations thereof. In other embodiments, the method includes
contacting the TREM-1-expressing cell with a TREM-1 activator (e.g., a crosslinking
antibody). In yet other embodiments, the method can include comparing the assessed
SPPl levels with a reference level. An increase in SPPl levels as compared to the
reference level can be indicative of an increase in TREM-1 signaling, and a decrease
SPPl levels as compared to the reference level can be indicative of a decrease in
TREM-l signaling. In one embodiment, the reference level corresponds to SPPl levels
of the TREM-1-expressing cell assessed at a time prior to contacting the TREM-1-
expressing cell with the candidate agent. Additional markers which can be used to
assess TREM-1 activity according to the present invention are described more fully
below, and in, for example, FIGURE 8A.

[0014] Another aspect of the invention provides a method of monitoring a patient
treated for inflammation or chronic inflammation. The method includes administering a
TREM-1 modulating agent to a patient (e.g., a human patient) in need thereof, detecting
secreted phosphoprotein 1 (SPPl) levels in the patient or in a sample from the patient,
and comparing the detected SPPl levels with a reference level. SPPl levels can be
detected in the patient or in a sample from the patient, such as a body fluid sample (e.g.,
serum, synovial fluid, tracheobronchial fluid, sputum). A reduction in SPPl levels as
compared to the reference level is indicative of a reduction in TREM-1 mediated
inflammation, and no change or an increase in SPPl levels as compared to the reference
level may indicate that there has been no change or an increase in TREM-1 mediated
inflammation, respectively. In some embodiments, the reference level corresponds to
SPPl levels detected in the patient or in a sample from the patient at a time prior to or
concurrent with administration of the TREM-1-modulating agent. In other
embodiments, the reference level corresponds to SPPl levels in a control subject (e.g., a
human) or a sample from the control subject, where the control subject is known not to
have chronic inflammation. Additional markers which can be used to assess TREM-1
activity according to the present invention are described more fully below, and in, for
example, FIGURE 8A.
[0015] In another aspect, the invention relates to a method of detecting the
presence of inflammatory disease, such as, for example, chronic inflammatory disease
(e.g., RA) or respiratory disorder/disease (e.g., asthma), in a subject (e.g., a human
subject). Inflammatory diseases include, for example, arthritis (including rheumatoid
arthritis, juvenile rheumatoid arthritis, osteoarthritis, psoriatic arthritis, lupus-associated
arthritis or ankylosing spondylitis), scleroderma, systemic lupus erythematosis,
vasculitis, multiple sclerosis, autoimmune thyroiditis, dermatitis (including atopic
dermatitis and eczematous dermatitis), autoimmune skin diseases, myasthenia gravis,
inflammatory bowel disease (EBD), Crohn's disease, colitis, ulcerative colitis, diabetes
mellitus (type I); inflammatory conditions of, e.g., the skin (e.g., psoriasis, acute and
chronic urticaria (hives)), cardiovascular system (e.g., atherosclerosis), nervous system
(e.g., Alzheimer's disease, amyotrophic lateral sclerosis), liver (e.g., hepatitis), kidney

(e.g., nephritis) and pancreas (e.g., pancreatitis); cardiovascular disorders, e.g.,
cholesterol metabolic disorders, oxygen free radical injury; disorders associated with
wound healing; respiratory disorders, e.g., asthma and COPD (e.g., cystic fibrosis);
acute inflammatory conditions (e.g., endotoxemia, septicemia, septic shock, toxic shock
syndrome and infectious disease); transplant rejection and allergy (e.g., anaphylaxis,
angioedema, atopy, insect sting allergies, allergic rhinitis). Additional conditions which
can be detected in accordance with the present invention include ischemia. The method
includes the step of detecting TREM-1 (e.g., membrane-bound TREM-1, soluble
TREM-1) or DAP12/TyroBP expression or activity in a subject or in a sample obtained
from the subject. (In this application, "or" can mean "and/or"; thus, the method can
include detection of both TREM-1 and DAPl2/TyroBP and can include detection of
expression and activity, if so desired.) Samples useful in the practice of this and other
methods of the invention are any samples in which TREM-1 and/or DAPl2/TyroBP can
be detected, including, for example, samples including joint tissue, synovial fluid,
synovial membranes, or any other clinically relevant body fluid or tissue, whether, for
example, circulating (e.g., blood, plasma, or lymph) or localized at a site of chronic
inflammation, in a tissue of the immune system, or in a tissue or fluid previously
exposed to a site of chronic inflammation. Detection of elevated TREM-1 or
DAP12/TyroBP expression or activity is indicative of the presence of the inflammatory
disease, such as, for example, chronic inflammatory disease, such as, for example, RA.
The method can include the additional step of comparing TREM-I or DAP12/TyroBP
expression or activity in a subject, or a sample derived from the subject, with a known
reference level. The outcome of the comparison (e.g., increased expression or activity)
is indicative of the presence of the inflammatory disease. The reference level can, for
example, be indicative of the presence of the inflanrunatory disease, or of a threshold for
differentiating between normal and increased expression.
[0016] The invention also provides a method for detecting the presence of
inflammatory disease, such as, for example, chronic inflammatory disease, such as, for
example, RA or asthma, in a subject (e.g., a human subject) by: detecting TREM-1 or
DAP12/TyroBP expression in a subject or a sample from the subject; and comparing

TREM-1 or DAP12/TyroBP expression in the subject or the sample to a reference level.
The outcome of the comparison (e.g., increased expression) is indicative of the presence
of the inflammatory disease. The reference level can be indicative of the presence of
the inflammatory disease, or of a threshold for differentiating between normal and
increased expression, etc.
[0017] In another aspect, the invention provides a method of monitoring
inflammatory disease, such as, for example, chronic inflammatory disease (e.g., RA) or
respiratory disorder/disease (e.g., asthma), in a subject (e.g., a human subject). The
method benefits from an appreciation that changes in TREM-1 or DAP12/TyroBP
expression or activity in a subject over time (as determined at different times in the
subject or as determined in samples obtained from the subject at different times) can be
used as an indication of changes in disease status. The method includes detecting
TREM-1 or DAP12/ryroBP expression or activity in the subject at two or more
different times (sometimes referred to herein as a first time and a second, later time) or
in samples obtained from the subject at two or more different times and comparing the
expression or activity observed. A decrease in TREM-1 or DAP12yTyroBP expression
or activity over time can be indicative of a reduction in the inflammatory disease,
whereas an increase in TREM-i or DAP12/TyroBP expression or activity over time can
be indicative of an increase in the inflammatory disease.
[0018] The monitoring method is also useful to evaluate a treatment for
inflammatory disease, such as, for example, chronic inflammatory disease (e.g., RA) or
respiratory disorder/disease (e.g., asthma), in a subject (e.g., a human subject). A
treatment is administered prior to the second, later time of detecting TREM-1 or
DAP12/TyroBP expression or activity in the subject or prior to taking the second, later
sample. The treatment can be administered before or after the monitoring method has
begun (before or after the first time of detection in the subject or the taking of the first
sample from the subject). Moreover, the course of treatment can be modified based
upon the comparison of TREM-1 or DAP12/TyroBP expression or activity at a first

time or in a first sample with TREM-1 or DAP12/TyroBP expression at a second, later
time or in a second sample.
[0019] These and other aspects and embodiments of the invention are also
described in the following sections of the application, which are provided to highlight
specific embodiments of the invention and are not intended to limit the invention, the
scope of which is limited only by the issued claims.
BRIEF DESCRIPTION OF THE DRAWINGS
[0020] The patent or application file contains at least one drawing executed in
color. Copies of this patent or patent application publication with color drawing(s) will
be provided by the Office upon request and payment of the necessary fee.
[0021] FIGURE lis a bar graph showing expression of TREM-1 and
DAPi2/TyroBP in synovium from RA patients.
[0022] HGURE 2 is a bar graph showing TREM-1 and DAP 12/ryroBP mRNA
expression in the murine collagen induced arthritis (CIA) model.
[0023] FIGURE 3A shows a representative image of immunohistochemistry
staining of human TREM-1 in a section of an RA positive synovium with a TREM-1-
positive index >1000.
[0024] FIGURE 3B shows a representative image of immunohistochemistry
staining of human TREM-1 in an osteoarthritis (OA) control section with a TREM-1-
positive index <20.
[0025] FIGURE 4 is a graph showing levels of soluble TREM-1 detected by
ELISA in human plasma samples obtained from RA and control (HVOS) patients.
[0026] FIGURE 5 shows an exemplary Western blot depicting a time-course of
mitogen activated protein kinase (MAPK) activation after crosslinking of TREM-1.

[0027] FIGURE 6 shows an exemplary ANOVA heat map clustering analysis of
genes regulated >2-fold with p<0.01. Individual donors are shown on the left, average
mean intensity is shown on the right.
[0028] FIGURE 7 shows an exemplary scatter plot of all present genes ("calls")-
Ln fold-changes plotted for TREM-1 (x-axis) and LPS (y-axis), with down-regulation
converted to negative values. Selected genes are highlighted. The 45° axis demarcates
genes comparably regulated by both treatments.
[0029] FIGURE 8A shows a table listing exemplary genes that are up-regulated
>4-fold upon TREM-1 activation.
[0030] FIGURE 8B shows a table listing exemplary genes that are up-regulated >4-
fold upon treatment with LPS.
[0031] FIGURE 9A shows a table listing exemplary genes that are commonly up-
regulated >4-foId; i.e., genes which are up-regulated both upon TREM-1 activation and
upon treatment with LPS.
[0032] FIGURE 9B shows a table listing exemplary genes that are down-regulated
>4-fold either upon TREM-1 activation or upon treatment with LPS.
[0033] FIGURES lOA-B show the results of an exemplary phagocytosis assay with
GFP-expressing human monocytic THP-1 cells. 1 jtM beads appear in red. FIGURE
lOA shows morphological changes in THP-1 cells after treatment. FIGURE lOB shows
that treatment with a-TREM-1 and LPS induces microsphere phagocytosis.
[0034] FIGURES 11A-F are graphs showing exemplary time-course ELIS As.
FIGURE llA shows GM-CSF, HGURE UB shows M-CSF, HGURE UC shows G-
CSF, FIGURE IID shows INHBA (inhibin, beta A (activin A, activin AB alpha
polypeptide)), HGURE 1 IE shows SPPl, HGURE 1 IF shows IL-23.
[0035] FIGURE 12 is a series of bar graphs showing that crosslinking of TREM-1
induces production of multiple cytokines in an RA tissue sample in a dose dependent
manner.

[0036] HGURES 13A-B are charts showing production multiple cytokine in tissue
samples prepared from three different donors. HGURE 13A shows a comparison of
spontaneous cytokine production in three donor samples. FIGURE 13B shows a
comparison of cytokine production upon crosslinking of TREM-1 in three donor
samples.
[0037] FIGURE 14 is a bar graph showing increased TREM-I expression in
K/BxN paws.
[0038] FIGURE 15 is a graph showing ankle thickening in mTREM-1-hFC
transgenic mice and wildtype mice in response to K/BxN serum transfer.
[0039] FIGURE 16 is a graph showing ankle thickening in mTREM- 1-hFC
transgenic mice on Day 14, in response to K/BxN serum transfer.
[0040] FIGURE 17 is a graph showing ear swelling after anti-IgE antibody
challenge in transgenic mice expressing a mTREM-1-hFc fusion protein.
[0041] FIGURE 18 is a graph showing ear swelling after anti-IgE antibody
challenge in mice pretreated with mTREM-1-mFc protein.
[0042] FIGURE 19 is a graph showing dose response of ear swelling after anti-IgE
antibody challenge in mice pretreated with mTREM-1-mFc protein.
[0043] FIGURE 20 is a graph showing ear swelling in TREM-1 knockout mice
after anti-IgE antibody challenge.
[0044] FIGURE 21 is a bar graph showing TREM-I expression by RT-PCR after
shRNA or siRNA knockdown.
[0045] FIGURES 22A-B show representative Western blots depicting TREM-1
expression after lentiviral shRNA knockdown of TREM-1 in TREM-1 over-expressing
cell lines.
[0046] FIGURE 23 is a table summarizing the results from global gene expression
profiling of purified human monocytes using Affymetrix® Human Genome Ul33_plus
2.0 arrays (see Example 6).

[0047] FIGURE 24 is a table further summarizing the results from global gene
expression profiling of purified human monocytes using Affymetrix® Human Genome
Ul33_plus 2.0 arrays (see Example 6).
DETAILED DESCRIPTION OF THE INVENTION
[0048] As used herein, the term "nucleic acid" refers to polynucleotides such as
deoxyribonucleic acid (DNA), and, where appropriate, ribonucleic acid (RNA). The
term should also be understood to include, as applicable to the embodiment being
described, single-stranded (such as sense or antisense) and double-stranded
polynucleotides.
[0049] As used herein, "RA positive," "RA sample," and "RA tissue" refer to a
subject, or any tissue, fluid, or other sample derived from a subject with rheumatoid
arthritis. "RA negative" refers to a subject, or any tissue, fluid, or other sample derived
from an unaffected subject.
[0050] As used herein, the term "RA" refers to rheumatoid arthritis. As used
herein, the term "OA" refers to osteoarthritis.
[0051] The term "antibody" includes intact molecules as well as functional
fragments thereof, such as Fab, Fab', F(ab')2, Fc, Fd, Fd', Fv, single chain antibodies
(scFv for example), single variable domain antibodies (Dab), diabodies (bivalent and
bispecific), and chimeric (e.g., humanized) antibodies, which may be produced by the
modification of whole antibodies or those synthesized de novo using recombinant DNA
technologies. These functional antibody fragments retain the ability to selectively bind
with their respective antigen or receptor. Antibodies and antibody fragments can be
from any class of antibodies including, but not limited to, IgG, IgA, IgM, IgD, and IgE,
and from any subclass (e.g., IgGl, IgG2, IgG3, and IgG4) of antibodies. The
antibodies of the present invention can be monoclonal or polyclonal. The antibody can
also be a human, humanized, CDR-grafted, or in vitro generated antibody. The
antibody can have a heavy chain constant region chosen from, e.g., IgGl, IgG2, IgG3,

or IgG4. The antibody can also have a light chain chosen from, e.g., kappa or lambda.
Constant regions of the antibodies can be altered, e.g., mutated, to modify the properties
of the antibody (e.g., to increase or decrease one or more of: Fc receptor binding,
antibody glycosylation, the number of cysteine residues, effector cell function, or
complement function). Typically, the antibody specifically binds to a predetermined
antigen, e.g., an antigen associated with a disorder, e.g., a neurodegenerative, metabolic,
inflammatory, autoimmune and/or a malignant disorder.
[0052] Antibodies of the present invention can also be single domain antibodies.
Single domain antibodies can include antibodies whose complementary determining
regions are part of a single domain polypeptide. Examples include, but are not limited
to, heavy chain antibodies, antibodies naturally devoid of light chains, single domain
antibodies derived from conventional 4-chain antibodies, engineered antibodies and
single domain scaffolds other than those derived from antibodies. Single domain
antibodies may be any of the art, or any future single domain antibodies. Single domain
antibodies may be derived from any species including, but not limited to mouse, human,
camel, llama, fish, shark, goat, rabbit, and bovine. In one aspect of the invention, a
single domain antibody can be derived from a variable region of the immunoglobulin
found in fish, such as, for example, that which is derived from the immunoglobulin
isotype known as Novel Antigen Receptor (NAR) found in the serum of shark.
Methods of producing single domain antibodies dervied from a variable region of NAR
("IgNARs") are described in WO 03/014161 and Streltsov (2005) Protein Sci. 14:2901-
2909. According to another aspect of the invention, a single domain antibody is a
naturally occurring single domain antibody known as heavy chain antibody devoid of
light chains. Such single domain antibodies are disclosed in WO 9404678, for example.
For clarity reasons, this variable domain derived from a heavy chain antibody naturally
devoid of light chain is known herein as a VHH or nanobody to distinguish it from the
conventional VH of four chain immunoglobulins. Such a VHH molecule can be
derived from antibodies raised in Camelidae species, for example in camel, llama,
dromedary, alpaca and guanaco. Other species besides Camelidae may produce heavy

chain antibodies naturally devoid of light chain; such VHHs are within the scope of the
invention.
[0053] The invention also contemplates the use of Small Modular
ImmunoPharmaceuticals ("SMIPsTM") which typically refers to binding domain-
immunoglobulin fusion proteins including a binding domain polypeptide that is fused or
otherwise connected to an immunoglobulin hinge or hinge-acting region polypeptide,
which in turn is fused or otherwise connected to a region comprising one or more native
or engineered constant regions from an immunoglobulin heavy chain, other than CHI,
for example, the CH2 and CHS regions of IgG and IgA, or the CH3 and CH4 regions of
IgE (see e.g., U.S. 2005/0136049 by Ledbetter, J. et al. for a more complete
description). The binding domain-inmiunoglobulin fusion protein can further include a
region that includes a native or engineered immunoglobulin heavy chain CH2 constant
region polypeptide (or CH3 in the case of a construct derived in whole or in part from
IgE) that is fused or otherwise connected to the hinge region polypeptide and a native or
engineered immunoglobulin heavy chain CH3 constant region polypeptide (or CH4 in
the case of a construct derived in whole or in part from IgE) that is fused or otherwise
connected to the CH2 constant region polypeptide (or CH3 in the case of a construct
derived in whole or in part from IgE). Typically, such binding domain-immunoglobulin
fusion proteins are capable of at least one inmiunological activity selected from the
group consisting of antibody dependent cell-mediated cytotoxicity, complement
fixation, and/or binding to a target, for example, a target antigen.
[0054] The term "antisense" as used herein refers to nucleotide sequences which
are complementary to a specific DNA or RNA sequence. The term "antisense strand" is
used in reference to a nucleic acid strand that is complementary to the "sense" strand.
Antisense molecules may be produced by any method, including synthesis by ligating
the gene(s) of interest in a reverse orientation to a viral promoter which permits the
synthesis of a complementary strand. Once introduced into a cell, this transcribed
strand combines natural sequences produced by the cell to form duplexes. These
duplexes then block either the further transcription or translation. The designation

"negative" is sometimes used in reference to the antisense strand, and "positive" is
sometimes used in reference to the sense strand.
[0055] As used herein, the terms "subject" and "patient" refers to any human or
nonhuman manmial.
[0056] As used herein, the term "detect" and all other forms of the root word
"detect" refer to the ascertainment of the presence or absence of one or more targets,
quantitation of one or more targets, or determination of the presence or absence of a
threshold value of one or more biomarkers.
[0057] As used herein, the term "joint tissue" refers to any tissue or fluid derived
from a joint area, including, by way of non-limiting example, tendons, ligaments, and
synovial membranes.
[0058] As used herein, the term "inflammatory disease" includes, by way of non-
limiting example, arthritis (including rheumatoid arthritis, juvenile rheumatoid arthritis,
osteoarthritis, psoriatic arthritis, lupus-associated arthritis or ankylosing spondylitis),
scleroderma, systemic lupus erythematosis, vasculitis, multiple sclerosis, autoimmune
thyroiditis, dermatitis (including atopic dermatitis and eczematous dermatitis),
autoimmune skin diseases, myasthenia gravis, inflammatory bowel disease (IBD),
Crohn's disease, colitis, ulcerative colitis, diabetes mellitus (type I); inflammatory
conditions of, e.g., the skin (e.g., psoriasis, acute and chronic urticaria (hives)),
cardiovascular system (e.g., atherosclerosis), nervous system (e.g., Alzheimer's disease,
amyotrophic lateral sclerosis), liver (e.g., hepatitis), kidney (e.g., nephritis) and
pancreas (e.g., pancreatitis); cardiovascular disorders, e.g., cholesterol metabolic
disorders, oxygen free radical injury; disorders associated with wound healing;
respiratory disorders, e.g., asthma and COPD (e.g., cystic fibrosis); acute inflammatory
conditions (e.g., endotoxemia, septicemia, septic shock, toxic shock syndrome and
infectious disease); transplant rejection and allergy (e.g., anaphylaxis, angioedema,
atopy, insect sting allergies, allergic rhinitis).

[0059] As used herein, the term "chronic inflammatory disease" refers to any
disease where the inflammatory response is of prolonged duration (e.g., weeks, months,
or even indefinitely) and whose extended time course is provoked by persistence of the
causative stimulus to inflammation in the tissue. The term "chronic inflammatory
disease" includes, for example, rheumatoid arthritis.
[0060] As used herein, the term "indicative" (e.g., indicative of the inflammatory
disease) means a sign or indication or factor to be considered, as opposed to being
definitive proof in and of itself. Generally, increased TREM-1 expression levels
correlate with an increased likelihood of inflammatory disease (e.g., RA); thus,
increased TREM-1 expression is indicative of the presence of the inflammatory disease
(e.g., RA). Likewise, normal TREM-1 expression levels generally correlate with an
increased likelihood of the absence of the inflammatory disease (e.g., RA).
[0061] As used herein, the term "PCR" refers to polymerase chain reaction.
[0062] The present invention includes the identification of TREM-1 and
DAP12/TyroBP as biomarkers for inflammatory disease, such as, for example, chronic
inflanmiatory disease, and, more specifically, as biomarkers for RA. A comparison of
transcriptional profiling of RA and normal synovial tissues revealed that TREM-1
mRNA expression was up-regulated 6.5 fold above normal in human RA samples, and
DAP12/TyroBP mRNA expression was up-regulated 2 fold above normal in human RA
samples (see Example 1). In a collagen induced arthritis (CIA) model, TREM-1 mRNA
was up-regulated 132 fold in CIA paws as compared to paws from normal mice, and
DAP12/TyroBP mRNA was up-regulated 8.21 fold in CIA paws as compared to paws
from normal mice (see Example 2). By immunohistochemistry, human RA synovial
samples contained an increased number of TREM-1-expressing cells (see Example 3).
Moreover, activation of TREM-1 in synovial cultures induced pro-inflammatory
cytokine and cytokine production in a dosage-dependent manner (see Example 9).
Further, soluble TREM-1 levels are elevated in human clinical plasma samples from
RA patients as compared to control patients (see Example 4). The identity of TREM-1
and DAP12yTyroBP as biomarkers for RA and the ability of TREM-1 to induce a pro-

inflammatory response make TREM-1 and members of the TREM-1 signaling pathway
ideal therapeutic targets for inflammatory disease, such as, for example, chronic
inflammatory disease, especially RA.
Detection of gene expression
[0063] The present invention provides methods for detecting and monitoring
inflammatory disease, such as, for example, chronic inflammatory disease by detecting
or quantitating the expression or activity of TREM-1 or DAP12/TyroBP. Many
methods of detection of a protein, nucleic acid, or activity level of interest, with or
without quantitation, are well known and can be used in the practice of the invention.
[0064] Target gene transcripts can be detected using numerous techniques that are
well known in the art. Some useful nucleic acid detection systems involve preparing a
purified nucleic acid fraction of a sample, and subjecting the sample to a direct
detection assay or an amplification process followed by a detection assay, such as an
assay of TREM-1 mRNA in a joint tissue sample. Amplification can be achieved, for
example, by polymerase chain reaction (PCR), reverse transcriptase (RT) and coupled
RT-PCR. Detection of a nucleic acid can be accomplished, for example, by probing the
purified nucleic acid fraction with a probe that hybridizes to the nucleic acid of interest,
and in many instances detection involves an amplification as well. Northern blots, dot
blots, microarrays, quantitative PCR, and quantitative RT-PCR are all well known
methods for detecting a nucleic acid in a sample. Nucleic acids also can be amplified
by ligase chain reaction, strand displacement amplification, self-sustained sequence
replication or nucleic acid sequence-based amplification. See, for example, Lewis
(1992) Genetic Engineering News 12(9):1; Guatelli et al. (1990) Proc. Natl. Acad. Sci.
USA 87:1874-1878; and Weiss (1991) Science 254:1292. Nucleic acids can also be
detected by sequencing; the sequencing can use a primer specific to the target nucleic
acid (e.g., a TREM-1 cDNA sequence) or a primer to an adaptor sequence attached to
the target nucleic acid. Sequencing of randomly selected mRNA or cDNA sequences
can provide an indication of the relative expression of a biomarker as indicated by the

percentage of all sequenced transcripts containing nucleic acid sequence corresponding
to the biomarker (e.g., to a TREM-1 cDNA or mRNA sequence). Alternatively, a
nucleic acid can be detected in situ, such as by hybridization, without extraction or
purification.
[0065] Target proteins can be detected, for example, immunologically using one or
more antibodies. In immunological assays, an antibody having specific binding affinity
for a biomarker or a secondary antibody that binds to such an antibody can be labeled,
either directly or indirectly. The antibody need not be complete: an antibody variable
domain or an artificial analog thereof, such as a single chain antibody, is sufficient.
Suitable labels include, without limitation, radionuclides (e.g., 1251,1311, 35S, 3H,
32P, 33P, or 14C), fluorescent moieties (e.g., fluorescein, FTTC, PerCP, rhodamine, or
PE), luminescent moieties (e.g., Qdot'"^ nanoparticles supplied by the Quantum Dot
Corporation, Palo Alto, CA), compounds that absorb light of a defined wavelength, or
enzymes (e.g., alkaline phosphatase or horseradish peroxidase). Antibodies can be
indirectly labeled by conjugation with biotin then detected with avidin or streptavidin
labeled with a molecule described above. Methods of detecting or quantifying a label
depend on the nature of the label and are known in the art. Examples of detectors
include, without limitation, x-ray film, radioactivity counters, scintillation counters,
spectrophotometers, colorimeters, fluorometers, luminometers, and densitometers.
Combinations of these approaches (including "multi-layer" assays) familiar to those in
the art can be used to enhance the sensitivity of assays.
[0066] Immunological assays for detecting a target protein can be performed in a
variety of known formats, including sandwich assays, competition assays (competitive
RIA), or bridge immunoassays. See, for example, U.S. Pat. Nos. 5,296,347; 4,233,402;
4,098,876; and 4,034,074. Methods of detecting a target protein generally include
contacting a biological sample with an antibody that binds to the protein and detecting
binding of the protein to the antibody. For example, an antibody having specific
binding affinity for TREM-1 can be immobilized on a solid substrate by any of a variety
of methods known in the art and then exposed to the biological sample. Binding of

TREM-1 to the antibody on the solid substrate can be detected by exploiting the
phenomenon of surface plasmon resonance, which results in a change in the intensity of
surface plasmon resonance upon binding that can be detected qualitatively or
quantitatively by an appropriate instrument, e.g., a Biacore® apparatus (Biacore
International AB, Rapsgatan, Sweden). Alternatively, the antibody can be labeled and
detected as described above. A standard curve using known quantities of a protein can
be generated to aid in the quantitation of bioraarker levels.
[0067] In other embodiments, a "sandwich" assay in which a capture antibody is
immobilized on a solid substrate is used to detect the level of a target protein. The solid
substrate can be contacted with the biological sample such that any target protein in the
sample can bind to the immobilized antibody. The level of the target protein bound to
the antibody can be determined using a "detection" antibody having specific binding
affinity for the target protein and the methods described above. It is understood that in
these sandwich assays, the capture antibody should not bind to the same epitope (or
range of epitopes in the case of a polyclonal antibody) as the detection antibody. Thus,
if a monoclonal antibody is used as a capture antibody, the detection antibody can be
another monoclonal antibody that binds to an epitope that is either completely
physically separated from or only partially overlaps with the epitope to which the
capture monoclonal antibody binds, or a polyclonal antibody that binds to epitopes
other than or in addition to that to which the capture monoclonal antibody binds. If a
polyclonal antibody is used as a capture antibody, the detection antibody can be either a
monoclonal antibody that binds to an epitope that is either completely physically
separated from or partially overlaps with any of the epitopes to which the capture
polyclonal antibody binds, or a polyclonal antibody that binds to epitopes other than or
in addition to that to which the capture polyclonal antibody binds. Sandwich assays can
be performed as sandwich ELISA assays, sandwich Western blotting assays, or
sandwich immunomagnetic detection assays.
[0068] Suitable solid substrates to which an antibody (e.g., a capture antibody) can
be bound include, without limitation, microtiter plates, tubes, membranes such as nylon

or nitrocellulose membranes, and beads or particles (e.g., agarose, cellulose, glass,
polystyrene, polyacrylamide, magnetic, or magnetizable beads or particles). Magnetic
or magnetizable particles can be particularly useful when an automated immunoassay
system is used.
[0069] Other techniques for detecting target polypeptides include mass-
spectrophotometric techniques such as electrospray ionization (ESI), and matrix-
assisted laser desorption-ionization (MAUDI). See, for example, Gevaert et al. (2001)
Electrophoresis 22(9): 1645-51; Chaurand et al. (1999) J. Am. Soc. Mass Spectrom.
10(2):91-103. Mass spectrometers useful for such applications are available from
Applied Biosystems (Foster City, CA); Bruker Daltronics (Billerica, MA); and GE
Healthcare (Piscataway, NJ).
[0070] It will be appreciated that the expression of any tJirget gene transcript or
target protein according to the present invention can be readily detected using one ore
more of the above techniques.
Detection ofTREM-1 activity
[0071] The activity of TREM-1 or DAP12/TyroBP can be assessed, for instance,
by assessing the expression levels of one or more {e.g., two or more than two, more than
three, more than four, more than five, more than ten, or more than twenty) TREM-1
responsive genes. The expression levels can be absolute or relative, e.g., as compared
to a control sample or a reference level. Differential gene expression can be determined
by transcriptional profiling of a test sample and, optionally, a control sample. The
reference level can be a transcriptional profile corresponding to a sample of known
disease state. A positive control can be, for example, a sample wherein TREM-1 and/or
DAP12/TyroBP have been intentionally over-expressed in one or more cells, a sample
of cells in which endogenous or recombinantly-expressed TREM-1 orDAP12/TyroBP
have been activated by, for example, addition of a cross-linking antibody, or a sample
obtained from a subject having an inflammatory disease or chronic inflammatory

disease (e.g., RA) of a known severity. A negative control can be, for example, a
sample wherein TREM-1 and/or DAP12/TyroBP have not been expressed or activated
or a sample from a subject without the inflammatory disease or chronic inflammatory
disease (e.g., RA).
[0072] Numerous protocols are available for using nucleic acid microarrays for
transcriptional profiling. Exemplary protocols include those provided by Affymetrix in
connection with the use of its GteneChip® arrays. Samples amenable to nucleic acid
microarray hybridization can be prepared from any human cell or tissue. Where a
nucleic acid microarray includes probes for non-human drug target genes, samples can
be prepared for cells or tissues of the corresponding non-human species.
[0073] The sample for hybridization to a nucleic acid microarray can be either
RNA (e.g., mRNA. or cRNA) or DNA (e.g., cDNA). Various methods are available for
isolating RNA from tissues. These methods include, but are not limited to, RNeasy®
kits (provided by Qiagen, Hilden, Germany), MasterPureTM kits (provided by
Epicentre Technologies), and Trizol® (provided by Gibco BRL, Carlsbad, CA). The
RNA isolation protocols provided by Affymetrix can also be used.
[0074] In one embodiment, isolated RNA is amplified or labeled before being
hybridized to a nucleic acid microarray. Suitable RNA amplification methods include,
but are not limited to, reverse transcriptase PCR, isothermal amplification, ligase chain
reaction, and Qbeta replicase method. The amplification products can be either cDNA
or cRNA. In one embodiment, the isolated mRNA is reverse transcribed to cDNA
using a reverse transcriptase and a primer consisting of oligo d(T) and a sequence
encoding the phage T7 promoter. The cDNA is single stranded. The second strand of
the cDNA can be synthesized using a DNA polymerase, combined with an RNase to
break up the DNA/RNA hybrid. After synthesis of the double stranded cDNA, T7 RNA
polymerase is added to transcribe cRNA from the second strand of the doubled stranded
cDNA. In one embodiment, the originally isolated RNA can be hybridized to a nucleic
acid microarray without amplification.

[0075] cDNA, cRNA, or other nucleic acid samples can be labeled with one or
more labeling moieties to allow for detection of hybridized polynucleotide complexes.
The labeling moieties can include compositions that are detectable by spectroscopic,
photochemical, biochemical, bioelectronic, immunochemical, electrical, optical or
chemical means. The labeling moieties include radioisotopes, chemiluminescent
compounds, labeled binding proteins, heavy metal atoms, spectroscopic markers, such
as fluorescent markers and dyes, magnetic labels, linked enzymes, mass spectrometry
tags, spin labels, electron transfer donors and acceptors, and the like.
[0076] Hybridization reactions can be performed in absolute or differential
hybridization formats. In the absolute hybridization format, polynucleotides derived
from one sample are hybridized to the probes in a nucleic acid microarray. Signals
detected after the formation of hybridization complexes correlate to the polynucleotide
levels in the sample. In the differential hybridization format, polynucleotides derived
from two samples are labeled with different labeling moieties. A mixture of these
differently labeled polynucleotides is added to a nucleic acid microarray. The nucleic
acid microarray is then examined under conditions in which the emissions from the two
different labels are individually detectable. In one embodiment, the fluorophores Cy3
and Cy5 (Amersham Pharmacia Biotech, Piscataway, NJ) are used as the labeling
moieties for the differential hybridization format.
[0077] Signals gathered from the nucleic acid microarrays can be analyzed using
commercially available software, such as those provided by Affymetrix or Agilent
Technologies. Controls for scan sensitivity, probe labeling, and cDNA or cRNA
quantitation, can be included in the hybridization experiments. Hybridization signals
can be scaled or normalized before being subject to further analysis. For instance,
hybridization signals for each individual probe can be normalized to take into account
variations in hybridization intensities when more than one microarray is used under
similar test conditions. Hybridization signals can also be normalized using the
intensities derived from internal normalization controls contained on each microarray.
In addition, genes with relatively consistent expression levels across the samples can be

used to normalize the expression levels of other genes. In one embodiment, probes for
certain maintenance genes are included in the nucleic acid microarray. These genes are
chosen because they show stable levels of expression across a diverse set of tissues.
Hybridization signals can be normalized or scaled based on the expression levels of
these maintenance genes.
Monitoring and evaluation of disease or treatment
[(X)78] The present invention provides methods for monitoring inflammatory
disease, such as, for example, chronic inflammatory disease, such as, for example, RA,
in a subject. Progression of an inflanmiatory disease in a subject can be monitored by
measuring a level of expression of mRNA corresponding to, or protein encoded by, or
activity of, one or more biomarkers, such as TREM-1 or DAP12/TyroBP. Target gene
mRNA or protein expression levels can be detected in vivo or in samples taken from,
for example, joint tissue, synovial fluid, synovial membranes, or any other clinically
relevant source. The level of expression of mRNA and/or protein corresponding to the
target gene can be detected by standard methods as described above. Disease state in a
subject can be monitored (e.g., for amelioration, aggravation, or reoccurrence of
disease) by comparing levels of target gene protein or RNA in the subject to the
subject's baseline level of target protein or RNA. For instance, TREM-1 expression
levels in the subject at a first time can be compared with TREM-1 expression levels in
the subject at a second, later dme. An increase in the level of expression of TREM-1
mRNA or protein over time is indicative of the progression of the inflammatory disease.
A decrease in the level of expression of TREM-1 mRNA or protein over time is
indicative of the reduction of the inflammatory disease.
[0079] The levels of, for instance, TREM-1 or DAP 12/TyroBP protein or RNA in a
subject also can be used to monitor the effectiveness of treatment. Typically, the
subject's baseline level of a target protein or RNA is obtained (e.g., before treatment)
and compared to the level of the target protein or RNA at various time points after or
between treatments (e.g., one or more days, weeks, or months after treatment). The

result of the comparison may reveal the effectiveness of past treatment, and future
treatment can be modified accordingly. For instance, a decrease in TREM-1 protein or
RNA levels relative to previously detected levels generally indicates a positive response
to a treatment regimen, and thus similar treatment should be continued. Similarly,
disease state in a subject can be monitored (e.g., for amelioration, aggravation, or
reoccurrence of disease) by comparing levels of a target protein or RNA in the subject
to the subject's baseline level, or to prior detected levels, of a target protein or RNA.
Treatment
[0080] The present invention provides methods for treating inflammatory disease,
such as, for example, chronic inflanmiatory disease {e.g., RA) or respiratory
disorder/disease {e.g., asthma), by inhibiting and/or antagonizing TREM-1-mediated
signal transduction. Inhibiting and/or antagonizing TREM-1-mediated signal
transduction can be accomplished by directly inhibiting TREM-1 or by inhibiting and/or
antagonizing non-TREM-1 members of the TREM-1 signaling pathway, such as the
TREM-1 accessory protein DAP12/TyroBP. Suitable inhibitors and/or antagonists can,
for example, decrease the expression of a nucleic acid encoding TREM-1, decrease
levels of the TREM-1 protein, or inhibit TREM-1 activity. Examples of inhibitors
and/or antagonists include, by way of non-limiting example: antisense oligonucleotides;
interfering RNAs; antibodies to TREM-1; antibodies to TREM-1 ligand; competitors
for TREM-1 ligand binding sites, including TREM-1 receptors and ligand-binding
fragments thereof, soluble truncated TREM-1 receptors, and soluble TREM-1 receptor
fusion proteins, such as, for example, a TREM-1 fusion containing the Fc portion of an
IgG immunoglobulin, ligand fusion proteins; peptide mimetics; peptide inhibitors; small
molecules; and combinations thereof.

Antisense Oligonucleotides
[0081] Antisense oligonucleotides can be used to inhibit TREM-1,
DAP12/TyroBP, or any other member of the TREM-1 or DAP12/TyroBP signaling
pathways by decreasing mRNA and protein levels of these targets. Antisense
suppression refers to administration or in situ generation of nucleic acid sequences or
their derivatives that specifically hybridize or bind under cellular conditions, with the
cellular mRNA and/or genomic DNA encoding one or more of the subject target alleles
so as to inhibit expression of that target allele, e.g. by inhibiting transcription and/or
translation. The binding may be by conventional base pair complementarity, or, for
example, in the case of binding to DNA duplexes, through specific interactions in the
major groove of the double helix. In general, antisense suppression refers to the range
of techniques generally employed in the art, and includes any suppression which relies
on specific binding to nucleic acid sequences. An antisense construct of the present
invention can be delivered, for example, as an expression plasmid which, when
transcribed in the cell, produces RNA that is complementary to at least a unique portion
of the cellular mRNA that encodes a target sequence or target allele of an endogenous
gene. Alternatively, the antisense construct can be a nucleic acid that is generated ex
vivo and which, when introduced into the cell, causes inhibition of expression by
hybridizing with the mRNA and/or genomic sequences of a target allele of an
endogenous gene. Such nucleic acids are preferably modified oligonucleotides that are
resistant to endogenous nucleases, e.g., exonucleases and/or endonucleases, and are
therefore stable in vivo. Modifications, such as phosphorothioates, have been made to
nucleic acids to increase their resistance to nuclease degradation, binding affinity and
uptake. Exemplary nucleic acid molecules for use as antisense oligonucleotides are
phosphoramidate, phosphothioate and methylphosphonate analogs of DNA (see also
U.S. Pat. Nos. 5,176,996; 5,264,564; and 5,256,775).
[0082] The antisense nucleic acids can be DNA or RNA or chimeric mixtures or
derivatives or "modified versions thereof," single-stranded or double-stranded. As

referred to herein, "modified versions thereof refers to nucleic acids that are modified,
e.g., at a base moiety, sugar moiety, or phosphate backbone, for example, to improve
stability, halflife, hybridization, effectiveness, etc. Possible modifications include but
are not limited to the addition of flanking sequences of ribonucleotides or
deoxyribonucleotides to the 5' and/or 3' ends of the molecule or the use of
phosphorothioate or 2' O-methyl rather than phosphodiesterase linkages within the
oligodeoxyribonucleotide backbone. The nucleic acid may include other appended
groups such as peptides (e.g., for targeting host cell receptors in vivo), or agents
facilitating transport across the cell membrane (see, e.g., PCT Publication No. WO
88/09810, published Dec. 15, 1988) or the blood-brain barrier (see, e.g., PCT
Publication No. WO 89/10134, published Apr. 25,1988), hybridization-triggered
cleavage agents or intercalating agents. To this end, the oligonucleotide may be
conjugated to another molecule, e.g., a peptide, hybridization triggered cross-linking
agent, transport agent, hybridization-triggered cleavage agent, etc.
[0083] The antisense nucleic acid can optionally include at least one modified base
moiety which is selected from the group including, but not limited to, 5-fluorouracil, 5-
bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xantine, 4-acetyIcytosine, 5-
(carboxyhydroxylmethyl) uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-
carboxymethylaminomet- hyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine,
N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-
methyladenine, 2-methyIguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-
methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-
D-mannosylqueosine, 5'-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-
N-6-isopente- nyladenine, uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil,
queosine, 2-thiocytosine, 5-methyI-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-
methyluracil, uracil-Soxyacetic acid methylester, uracil-5-oxyacetic acid (v), -5-methyl-
2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl) uracil, (acp3)w, and 2,6-diaminopurine.
[0084] Methods for synthesizing antisense oligonucleotides are known, including
solid phase synthesis techniques. Equipment for such synthesis is conmiercially

available from several vendors including, for example. Applied Biosystems (Foster
City, CA). Alternatively, expression vectors that contain a regulatory element that
directs production of an antisense transcript can be used to produce antisense molecules.
[0085] It is understood in the art that the sequence of an antisense oligonucleotide
need not be 100% complementary to that of its target nucleic acid to be hybridizable
under physiological conditions. Antisense oligonucleotides hybridize under
physiological conditions when binding of the oligonucleotide to the TREM-1 nucleic
acid interferes with the normal function of the TREM-1 nucleic acid, and non-specific
binding to non-target sequences is minimal.
RNAi
[0086] The present invention further contemplates the use of RNA interference
(RNAi) to inhibit the expression of TREM-1, DAP12/TyroBP, or any other member of
the TREM-1 or DAP12/ryroBP signaling pathways. The RNAi molecules of the
present invention can be designed to specifically inhibit TREM-1, DAPll/TyroBP, or
any other member of the TREM-1 or DAP12/TyroBP signaling pathways. Any type of
RNAi sequence can be used for the present invention. Non-limiting examples include
short interfering RNA (siRNA) molecules or short hairpin RNA (shRNA). A variety of
algorithms are available for RNAi sequence design. In one embodiment, the target
sequences for siRNA include about 18, 19, 20 or more nucleotides. 2dT's can be added
to the 3' end during siRNA synthesis, creating an "AA" overhang. In many instances,
the GC content of a target sequence is between 35% and 55%, and the sequence does
not include any four consecutive A or T (i.e., AAAA or TTTT), three consecutive G or
C (i.e., GGG or CCC), or seven "GC" in a row. More stringent criteria can also be
employed. For instance, the GC content of a target sequence can be limited to between
45% and 55%, and any sequence having three consecutive identical bases (i.e., GGG,
CCC, TTT, or AAA) or a palindrome sequence with 5 or more bases can be excluded.
Furthermore, the target sequence can be selected to have low sequence homology to
other variants or genes. The effectiveness of an RNAi molecule can be evaluated by

introducing or expressing the RNAi sequence in a cell that expresses the targeted gene
products. A substantial change in the mRNA or protein level of the targeted gene
products is indicative of the effectiveness of the RNAi molecule in inhibiting the
expression of that gene. Methods for expressing RNAi molecules in a cell are well
known in the art, and include, for example, lentivirus vectors.
Immunogenic Compositions
[0087] Compositions provoking an immune response to TREM-1 or
DAP12/TyroBP can be used to reduce TREM-1 signaling. The compositions can
include TREM-1 or DAP12/TyroBP protein or a fragment or variant thereof {e.g., a
variant or a fragment of which has enhanced binding to a human MHC molecule) useful
in provoking an immune response to human TREM-1 or human DAP12/TyroBP. The
protein, fragment or variant can be supplied as an isolated polypeptide or with
additional peptide sequence as, for example, in a fusion protein or a conjugate with
another polypeptide such as a carrier protein. In some embodiments, a nucleic acid
encoding the protein, fragment or variant is provided in the immunogenic composition
in lieu of providing the protein, fragment or variant itself.
[0088] An immunogenic composition preferably also contains an adjuvant. An
adjuvant can be any substance that enhances or potentiates an immune response
(antibody and/or cell-mediated) to an exogenous antigen. Examples of
immunostimulants include aluminum salts; biodegradable microspheres (e.g., polylactic
galactide); liposomes (into which the compound is incorporated); cytokines (such as, for
example, GM-CSF or IL-2, IL-7, or EL-12, or nucleic acids encoding them); and CpG
polynucleotides.
[0089] As noted above, a vaccine can contain DNA encoding TREM-1 or
DAP12/TyroBP protein or a portion or variant thereof and can also contain DNA
encoding an adjuvant protein such as a cytokine, such that the polypeptide or
polypeptides are generated in vivo. The DNA can be present within any of a variety of

delivery systems known to those of ordinary skill in the art, including nucleic acid
expression vectors, gene delivery vectors, and bacteria expression systems. Numerous
gene delivery techniques are well-known in the art. Appropriate nucleic acid
expression systems contain the necessary DNA sequences for expression in the subject
(such as a suitable promoter and terminating signal). Bacterial delivery systems involve
the administration of a bacterium (such as Bacillus-Calmette-Guerrin) that expresses an
immunogenic portion of the polypeptide on its cell surface or secretes such an epitope.
In one embodiment, the DNA is introduced using a viral expression system (e.g.,
vaccinia or other pox virus, retrovirus, or adenovirus), which may involve the use of a
non-pathogenic (defective), replication competent virus. Techniques for incorporating
DNA into such expression systems are well-known to those of ordinary skill in the art.
The DNA can also be "naked," as described, for example, in Ulmer et al. (1993)
Science 259:1745-1749. The uptake of naked DNA can be increased by coating the
DNA onto biodegradable beads, which are efficiently transported into the cells. A
vaccine may comprise both a polynucleotide and a polypeptide component. Such
vaccines may provide for an enhanced immune response.
Ligand binding competitors
[0090] TREM-1 signaling can also be inhibited by administration of a competitor
for binding to the ligand for TREM-1. This can be accomplished, for example, by
administration of a soluble fragment of a TREM-1 extracellular domain, optionally
coupled to a carrier protein, such as, for example, an IgG inmiunoglobulin known in the
art. For example, administration of a TREM-1-Fc fusion protein using a TREM-1
fragment and a human IgGl Fc portion has been described and shown to be effective to
protect against microbial sepsis (see, for example, U.S. Patent Application Publication
No. 2005-0260670, herein incorporated by reference in its entirety). The IgG Fc
portion of the fusion protein may be derived from any IgG subclass (e.g., IgGl, IgG2,
IgG3, and IgG4). Methods of making TREM-1/IgG fusions proteins are well known.
For example, Bouchon et al. (2000) Am. Assoc. Immun. l64(10):4991-95 describes and

teaches how to produce a soluble TREM-1-Fc fusion protein. It is now expected, based
on the association of TREM-1 and DAP12/TyroBP with RA, that similar administration
of a suitable TREM-1 fragment in RA patients should reduce the severity of the disease.
Importantly, treatment of a human does not necessarily require administration of a
fragment of wild-type human TREM-1: other TREM-1 fragments from other mammals
can be used, and one or more amino acid substitutions can be incorporated, so long as
the fragment retains the ability to compete with endogenous human TREM-1 for
binding to ligand.
Binding Partners
[0091] A further means for treating inflammatory disease, such as, for example,
RA and asthma, includes administration of a binding agent, such as a protein, a peptide
and/or an antibody or a portion thereof (e.g., a Fab, F(ab')2, Fv or a single chain Fv
fragment), that interacts with, e.g., binds to and/or neutralizes, a therapeutic target.
Therapeutic targets of the present invention include, for example, TREM-1, TREM-1
ligand, DAP12/TyroBP, and any other member of the TREM-1 signaling pathway.
Administration of an anti-TREM-1 binding agent, for example, an anti-TREM-1
antibody, to an RA or asthma patient can reduce the symptoms of the disease by
inhibiting and/or antagonizing TREM-1 or DAP12/TyroBP activity or TREM-1
signaling. The antibody can be an isolated antibody. In one embodiment, the antibody
is an antagonistic antibody. In another embodiment, the antibody is a neutralizing
antibody. In a further embodiment, the antibody modulates, reduces and/or inhibits one
or more TREM-1 associated activities, including, but not limited to, modulating,
reducing and/or inhibiting TREM-1 interaction with TREM-1 ligand and/or
DAP12/TyroBP; modulating, reducing and/or inhibiting TREM-1 mediated signal
transduction; modulating, reducing and/or inhibiting expression of TREM-1 activated
pro-inflammatory cytokines and/or chemokines; and modulating, reducing and/or
inhibiting the expression of TREM-1 activated genes, such as, for example, SPPl.
Anti-TREM-1 antibodies of the invention can include, for example, antibodies that

specifically bind TREM-1, and/or antibodies that bind the membrane-bound form of the
TREM-1 receptor without activating the TREM-1 receptor. In certain embodiments the
antibody or fragment thereof is directly or indirectly labeled with a detectable substance
to facilitate detection of the bound or unbound antibody. Suitable detectable substances
include, for example, enzymes, prosthetic groups, fluorescent materials, luminescent
materials and radioactive material. Methods of making and methods of screening
antibodies such as those useful for practicing the invention are well known in the art
(see, e.g., Harlow et al. (1988) Antibodies: A Laboratory Manual. (New York: Cold
Spring Harbor Laboratory). Anti-TREM-1 antibodies of the invention can also include
single domain antibodies derived from any species. Alternate binding domain
polypeptides, such as, for example, a SMBPTM can also be used to inhibit and/or
antagonize TREM-1 or DAP12/TyroBP activity or TREM-1 signaling. The antibodies,
or fragments thereof, can also be used in diagnosing, monitoring, and/or preventing in a
subject an inflammatory disease, such as, for example, RA and asthma.
EXAMPLES
[0092] Example 1: Transcriptional profiling analysis of TREM-1 and
DAPl2/TyroBP
[0093] Global analysis of messenger RNA by gene expression analysis has been
successfully applied to many diseases to identify genes that contribute to disease
pathogenesis and that are potential targets for novel therapies (Battiwalla et al. (2005)
Genes and Immunity 6(5):388-97). Using gene expression analysis, TREM-I and
DAP12/TyroBP were identified as a potential target for therapies for inflammation
diseases, such as, for example, RA.
[0094] Briefly, twenty-four synovial tissue samples were obtained from RA
patients during surgery as defined by American College of Rheumatology criteria, with
prior approval from the local research ethics committee. Of these twenty-four samples,
ten samples were obtained from joint synovium and fourteen samples were obtained

from tenosynovium. Eight uninvolved (i.e., normal) synovial tissues were obtained
from non-RA patients. The uninvolved synovial tissues were isolated from three
patients who required amputation due to blunt trauma and the synovia were isolated
from sites distant from the points of trauma. Synovial samples from RA patients and
non-RA patients were harvested and immediately flash frozen in liquid nitrogen and
stored at -80°C until processed. Total RNA was isolated and analyzed using
Affymetrix® (Santa Clara, CA) HG_U95A and B (human samples) GeneChip®
oligonucleotide microarrays. Expression measurements from the arrays were generated
by the Affymetrix® MAS4 algorithm, and normalized to estimates of transcripts per
million by reference to spiked-in standards (Hill et al. (2001) Genome Biol.
2(12):RESEARCH0055).
RNA isolation
[0095] Frozen samples were disrupted and lysed in tissue lysis buffer (RNAgents®
Kit, Promega, Madison, WI) with a PowerGen^^ 700 homogenizer (Fisher Scientific,
Pittsburgh, PA). Total RNA was isolated with a modification of the manufacturer's
recommendations. Briefly, RNA was precipitated with the addition of isopropanol and
washed twice with cold 75% ethanol. The pellet was dissolved in RNeasy® minikit
sample lysis buffer (RLT) and RNA was purified according to the manufacturer's
recommendations (Qiagen, Hilden, Germany). For each sample, total RNA was
quantitated from a measure of UV absorption at 260 nm, and an aliquot was analyzed
with an Agilent® 2100 Bioanalyzer™ (Agilent Technologies, Santa Clara, CA) to
determine RNA integrity.
Preparation of Hybridization solutions for Oligonucleotide Array Analysis
[0096] Double-stranded cDNA was prepared from 5 μg of total RNA using the
Superscript® Choice™ kit (Invitrogen, Carlsbad, CA) and 33 pMol of oligo-dT primer
containing a T7 RNA polymerase promoter (Proligo, LLC, Boulder, CO). First strand
cDNA synthesis was initiated with the addition of the following kit components: first
strand buffer at IX, DTT at 10 mM, dNTPs at 500 μM, Superscript® RT H at 400 U,
and RNAse inhibitor at 40 U. The reaction proceeded at 47"C for 1 hour. Second

strand synthesis proceeded with the addition of the following kit components: second
strand buffer at IX, additional dNTPs at 200 μM, E. coli DNA polymerase I at 40 U, E.
coli RNaseH at 2 U, E.coli DNA ligase at 10 U. The reaction proceeded at 15.8°C for 2
hr. T4 DNA polymerase (New England BioLabs, Beverly, MA), at a final
concentration of 6 U, was added for the last five minutes of the second strand reaction.
Double stranded cDNA was purified using a solid-phase, reversible immobilization
technique, and collected in a volume of 20 μl of 10 mM Tris acetate, pH 7.8. Purified
cDNA (10 nO was transcribed with the BioArray™ High Yield™ RNA Transcript
Labeling Kit (T7), following the manufacturer's protocol (Enzo, Farmingdale, NY).
Biotin-labeled, anti-sense cRNA was purified using an RNeasy® mini kit as described
by the manufacturer (Qiagen, Hilden, Germany). The cRNA yield was determined
from a measure of UV absorption at 260 nm.
Oligonucleotide Microarrav Hybridization Procedures
[0097] To improve hybridization efficiencies, 15 ng of cRNA was fragmented.
The fragmented cRNA probes were used to create an oligonucleotide microarray
hybridization solution as suggested by the manufacturer (Affymetrix, Santa Clara, CA).
Hybridization solutions contained a mix of eleven prokaryotic RNAs, each at a different
known concentration, which were used to create an internal standard curve for each
microarray and was interpolated to determine the frequencies of detected genes.
Hybridization solutions were pre-hybridized to two glass beads (Fisher Scientific,
Pittsburgh, PA) at 45°C overnight. The hybridization solution was removed to a clean
tube and heated for 1-2 min at 95°C and microcentrifuged at maximum speed for 2
minutes to pellet insoluble debris. Labeled cRNA solutions were hybridized to
Affymetrix® (Santa Clara, CA) Hg_U95Av2 & B GeneChip® oligonucleotide
microarrays on which sequences for 25,128 human gene sequences were arrayed.
Following hybridization, cRNA solutions were recovered and microarrays were washed
and prepared for scanning according to Affymetrix protocols. Raw fluorescence data
were collected and reduced with the use of the GeneChip® 3.2 application (Affymetrix,
Santa Clara, CA).

Analysis of Expression Profiling Data
[0098] The primary data were processed using the hybrid scaled frequency
normalization described by Hill et al. (2001) Genome Biol. 2(12):RESEARCH0055.
The scaled frequency data were reduced and analyzed using GeneSpringGX^M v7.3
(Agilent Technologies, Santa Clara, CA). Two types of analyses were performed. In
the first, all diseased samples were compared against all normal samples. In the second,
the data were subdivided based upon site of disease, such that joint RA synovia were
normalized to the average values of the control joint synovial samples, and tenosynovial
RA samples were normalized to the average values of the control tenosynovial samples.
[0099] To identify transcripts that were associated with RA, gene transcript scaled
frequencies from each of the diseased samples were normalized to the average of all of
the non-rheumatoid gene transcript frequencies. Data were reduced by filtering for-
gene transcripts that had either increased or decreased levels of expression relative to
the average of the controls. In addition to the data normalization steps, several
statistical analyses were performed on the filtered data. False discovery rates (FDR)
and Bonferroni family-wise error rates (FWER) were determined using a cutoff p-value
of 0.05. In addition, an unsupervised hierarchical cluster analysis and a k-nearest
neighbor analysis of the data set were performed in GeneSpring"™. The resulting data
set was visualized with an unsupervised hierarchical cluster analysis.
[0100] In a second analysis, the joint and tendon samples were analyzed separately.
Joint synovial and tenosynovial samples were normalized to the averages of their
respective site-specific controls. The same filtration and statistical parameters were
applied to each of analysis as described above. The two resulting data sets were
combined using a Venn analysis and were subjected to an unsupervised hierarchical
cluster analysis of the genes and samples. An analysis using k-nearest neighbor was
used to discriminate between the four parameters: disease, non-disease, joint, and
tendon. The process for this analysis is described below. The genes with the best

discrimination were then subjected to an unsupervised hierarchical cluster analysis of
the samples and genes.
[0101] Statistical analysis of expression data was executed on log-2 transformed
expression measurements. Fold-changes between groups of samples were computed by
taking the difference of the means of the log-2 expression levels in each group, and
back-transforming the resulting log-fold-change to the linear scale. The significance of
differential expression between groups was determined by a permutation test. Briefly,
an F-statistic was computed for each probeset in each comparison of interest, using a
within-group error estimate derived from pooling the error estimates of probesets with
similar intensity levels. The observed F-statistics were referred to a null distribution of
identically calculated F-statistics from the same dataset after random permutation of the
sample labels. The p-value for differential expression was defined as the fraction of
permutation F-statistics that were greater than the observed F-statistic for each probeset
(Edington (1995) Randomization Tests (New York: Marcel Dekker); Zar (1999)
Biostatistical Analysis (New Jersey: Simon & Shuster)).
Results
[0102] Gene expression analysis of synovial biopsies revealed that TREM-1 and
DAP12/TyroBP mRNA expression is significantly up-regulated in RA patients.
FIGURE 1 is a bar graph showing expression of TREM-1 and DAP12/TyroBP in
synovium from RA patients. The fold changes of TREM-1 expression were normalized
to normal synovium specimens. TREM-1 mRNA was up-regulated 6.5 fold (p-value of
1.98 X 10 "*) in RA positive samples (n = 24) as compared to uninvolved samples (n =
8) (FIGURE 1). Moreover, DAP12/TyroBP mRNA was up-regulated 2 fold (p-value of
7.83 X 10 "^) in RA positive samples (n = 24) as compared to uninvolved samples (n =
8) (FIGURE 1).
[0103] In addition to being up-regulated in RA, TREM-1 and DAP12/TyToBP
mRNA expression levels vary with the severity of RA. Fourteen tendon samples from
RA patients were divided into two clinically defined disease subtypes, invasive and
encapsulated, invasive RA being the more progressive form. TREM-1 mRNA was up-

regulated 2.64 fold (p-value of 1.36 x 10 '*) in invasive tenosynovium samples (n = 7)
as compared to encapsulated tenosynovium samples (n = 7) (FIGURE 1). Likewise,
DAP12yTyrol2 mRNA was up-regulated 1.4 fold (p-value of 1.67 x 10 '^) in invasive
samples (n = 7) as compared to encapsulated samples (n = 7) (FIGURE 1).
[0104] A comparison of cell-specific gene expression in monocytes, neutrophils,
and macrophages indicates that inflammatory cell infiltration is only partly responsible
for increased TREM-1 expression levels in RA positive synovial tissues. In order to
identify whether the increased TREM-1 expression was due to the infiltration of
TREM-1 positive inflammatory cells in the RA synovium, we looked globally at the
expression levels of genes that were specifically expressed in monocytes (182 genes),
neutrophils (328 genes) and macrophages (34 genes). The mean expression levels of
these genes range from 1.22 to 1.59, with large standard deviations. The increased
expression of TREM-1 was mainly caused by the up-regulation of TREM-1 gene
expression rather than by a large increase in cell infiltration.
Example 2: Quantitative real-time PCR of TREM-1 and DAF12/TyroBP
[0105] TREM-1 and DAP12AryroBP mRNA are overexpressed in a collagen-
induced arthritis model. Collagen-induced arthritis (CIA) was performed in male
DBA/1 mice (Jackson Laboratories, Bar Harbor, ME) using bovine collagen type 0
(Chondrex, Redmond, WA). Mice were monitored for disease progression at least three
times a week. Individual limbs were assigned a clinical score based on the following
index: (0) normal; (1) visible erythema accompanied by one to two swollen digits; (2)
pronounced erythema, characterized by paw swelling and/or multi digit swelling; (3)
massive swelling extending into ankle or wrist joint; and (4) difficulty in use of limb or
joint rigidity. The sum of all limb scores for any given mouse yields a potential
maximum total body score of 16. Animals were euthanized and tissues were harvested
at various disease stages. RNA from disease animals was prepared from three score 3
paws and one score 4 paw. RNA extracted from normal animals was prepared from

four score 0 paws. TREM-1 mRNA was quantified using the following primers and
probe:
Forward primer CAGATGTGTTCACTCCTGTCATCA (413-436) (SEQ ID
NO:l);
Reverse primer CTGGGTGAGTATTTTGTGGTAATAAGG (494-468) (SEQ
ID N0:2);
Probe CCTATTACAAGGCTGACAGAGCGTCCCA (439-466) (SEQ ID
N0:3).
A standard curve was generated using known concentrations of mTREM-1.
DAP12/TyroBP mRNA was quantified using the following primers and probe:
Forward primer CCTGGTCTCCCGAGGTCAA (255-273) (SEQ ID NO:4);
Reverse primer GGCGACTCAGTCTCAGCAATG (323-302) (SEQ ID NO:5);
Probe TTGTTTCCGGGTCCCTTCCGCT (3(X)-279) (SEQ ED NO:6).
[0106] In order to calculate fold-changes in expression, TREM-1 RNA levels and
DAP12/TyroBP RNA levels were normalized to GAPDH mRNA. By RT-PCR,
TREM-1 mRNA was up-regulated 132 fold in CIA paws as compared to paws from
normal mice (HGURE 2), while DAP12/TyroBP was up-regulated 8.21 fold (HGURE
2). These results further confirm that expression of TREM-1 and proteins associated
with TREM-1 signaling are elevated in the sites of RA disease.
Example 3: TREM-1 expression by immunohistochemistry
[0107] Immunohistochemistry of various synovial samples was performed to
determine whether TREM-1 expression was increased at the protein level. Briefly, five
RA synovial samples were obtained from patients during surgery through the Kennedy
Institute of Rheumatology and two OA tissues were obtained from New England
Baptist Hospital. Tissues were fixed in formalin and embedded in paraffin.
Inmiunohistochemistry was performed on 4 μm tissue sections. Sections were first de-

paraffinized in xylene and rehydrated in a graded ethanol series. After washing with
PBS, antigens were retrieved and cells were permeablized with Tween 20. Samples
were immunostained with mouse anti-TREM-1 antibody (R&D Systems, Minneapolis,
MN) in a BiogenexTM i6000TM system according to a standard protocol. The
secondary antibody and detection reagent used were from a Mach3TM-mouse probe
HRP polymer kit (Biocare, Concord, CA). Cells positive for immunohistochemistry
staining were defined as those with brown pigments. For each slide, ten 200x fields of
view adjacent to the synovial surface were randomly selected and
immunohistochemistry-positive cells were counted and totaled as an
immunohistochemistry-positive cell index.
[0108] Immunohistochemistry on sections from five RA patients revealed high
TREM-1 levels in three out of five patients, with extremely high levels observed in one
patient, RA4 (Table 1). Two of the RA samples (RAI and RA2) had low TREM-1
levels and were similar to control samples (OAl and OA2) from osteoarthritis patients
(Table 1). FIGURE 3A depicts one representative field of an anti-TREM-1 labeled RA
synovial tissue sample. FIGURE 3B depicts one representative field of an anti-TREM-
1 labeled synovial tissue sample from a control, OA patient.
[0109] To identify the cell type of TREM-1 positive cells in RA samples, double
immunohistochemistry of TREM-1 and CD163, CD14, CD68 or myeloperoxidase was
performed sequentially by staining with TREM-1 antibody first, followed by CD 163
(10D16 from Labvision, Freemont, CA), CD 14 (Labvision, Freemont, CA), CD68 (PG-
Ml from Biocare, Concord, CA), or myeloperoxidase (Abeam, Cambridge, UK)
antibodies, respectively. None of the sections stained with myeloperoxidase suggesting
the absence of neutrophils. Surprisingly, only sections from RA5 stained with CD68,
but these sections did not co-stain with TREM-1. A small portion (3-10%) of TREM-1
positive cells from RA3 and RA5 were co-stained with CD14 or CD163. The
difference in the presence of these markers and TREM-1 in the five RA synovium
sections reflected the heterogeneity of the disease.


Example 4: Detection of soluble TREM-1 in human clinical plasma samples
[0110] An enzyme-linked immunosorbent assay (ELIS A) was performed to
demonstrate that TREM-1 protein levels are both detectable and elevated in human RA
samples. Plasma from RA patients was obtained from a phase two, double-blinded,
placebo-controlled, parallel, randomized, multicenter, out-patient, comparative study in
subjects with active RA and an inadequate response to stable dosages of methotrexate
(MTX) (7.5 to 20 mg once weekly). Subjects were enrolled at 81 sites worldwide. At
selected sites, 32 subjects who agreed to participate in the voluntary sample collection
for exploratory biomarker studies provided blood samples. Data reported here is from
plasma samples taken on day 1 (predose). The control group plasma was collected from
subjects enrolled in a healthy volunteer multicenter, prospective, non-interventional
observational study. Each clinical site's institutional review board or ethics committee
approved these studies, and no procedures were performed before obtaining informed
consent from each patient.
[0111] An ELISA protocol for detecting soluble TREM-1 in human clinical plasma
samples was adapted from a DuoSet® ELISA Development System, which is
commercially available from R&D Systems (Minneapolis, MN; catalog number
DY1278). The adapted ELISA protocol reduced false positives and improved the linear
dynamic range of the standard curve. Briefly, ELISA was performed in a sandwich
format with 4.0 ug/ml of capture antibody and 200 ng/ml of detection antibody. The

plasma samples were diluted 1:2 fold in GFl buffer, which is commercially available
from Meso Scale Discovery (Gaithersburg, Maryland; catalog number R54BB-3). The
standard was also diluted with 1:2 dilution of neat plasma in GFl buffer. The limit of
the detection was 1.37 pg/ml using a four parameter curve fit (XL-Fit IDBS, Burlington,
MA) with R^ of 0.999 in the range of 1.37 to 1000 pg/ml.
[0112] Using the above ELISA method, 32 samples from RA patients and 25
samples from healthy volunteers (HVOS) were tested. FIGURE 4 is a graph showing
protein levels of soluble TREM-1 detected by ELISA in human plasma samples
obtained from RA and control patients (HVOS). As seen in FIGURE 4, the average
amount of soluble TREM-1 in RA plasma was 10.04 ± 1.626 (n=32) pg/ml, while the
average amount of soluble TREM-1 in healthy volunteers (HVOS) was 2.549 ± 0.6253
(n=25) pg/ml. The level of soluble TREM-1 in RA plasma is higher (more than three
fold) than that of healthy volunteers, with a p-value of <0.000l (unpaired t test). Thus,
detection of increased levels of human soluble TREM-1 in plasma correlates with and is
indicative of RA.
[0113] In addition, a significant association between elevated plasma TREM-1
levels and elevated levels of rheumatoid factor was detected.
Example 5: Activation of mitogen activated protein kinases after crosslinking of
TREM-1
[0114] Purified human monocytes were seeded into wells pre-coated with either
isotype-matched control antibody or a-TREM-1 cross-linking antibody to determine
whether TREM-1 receptor activation triggers the activation of mitogen activated protein
kinases (MAPKs). Briefly, human leukopacks (Buffycoats) from healthy volunteers
were obtained from the Massachusetts General Hospital Clinical Hematology
Laboratory (Boston, MA). Buffycoats were stored at 4°C overnight for cell isolation
the following day. Monocytes were isolated by negative selection using RosetteSep®
(StemCell Technologies, Vancouver, BC; 15068) as per the manufacturer's protocol by

density centrifugation over Histopaque® (SIGMA, H8889). All incubations were at
37°C in a tissue culture incubator maintained at 5% CO2. Purified monocytes were
maintained in RPMI1640 medium supplemented with 10% heat-inactivated fetal
bovine serum. Tissue culture-treated plates were treated with a 5 |xg/ml solution of a-
TREM-1 crosslinking antibody (R&D Systems, Minneapolis, MN; MAB1278) in PBS
overnight in a tissue culture incubator. Control wells were similarly treated with an
isotype-matched antibody to E. tenella (Wyeth, Madison, NJ). Wells were washed
twice with PBS immediately prior to cell addition. Western blots were performed using
standard protocols over a time course of 5 to 180 minutes (see FIGURE 5). a-phospho-
ERK, α-phospho-p38, and a-phospho-JNK antibodies were purchased from Cell
Signaling Technologies (Danvers, MA; 9101,9211 and 9251, respectively), a-actin
antibody was purchased from Sigma (St. Louis, MO; A2103). As seen in FIGURE 5,
activation of TREM-1 with a crosslinking antibody results in broad activation of
MAPKs. p38 and JNK were previously unknown to be responsive to TREM-1
activation. These broad pro-inflammatory responses were corroborated by global gene
expression changes arising from TREM-1 activation in purified human monocytes (see
Example 10).
Example 6: Transcriptional profiling analysis after a-TREM-1 and LPS treatments
[0115] Transcription profiling analysis was employed to identify genes that are
differentially expressed upon activation of the TREM-1 receptor. Using transcriptional
profiling, secreted phosphoprotein 1 (SPPl; also known as osteopontin (OPN), bone
sialoprotein 1 (BSPI), early T-lymphocyte activation 1 (ETA-1), or MGCl 10940) was
identified as a marker specific for TREM-1 activation, as opposed to being an
obligatory pro-inflammatory readout.
Tissue culture preparation and RNA isolation
[0116] Purified human monocytes from multiple donors were prepared as
described in Example 9 and were seeded into tissue-culture treated wells. Tissue-

culture treated wells were either untreated (for untreated control and lipopolysaccharide
(LPS) treatment), or pre-coated with either isotype-control antibody or a-TREM-1
crosslinking antibody as described in Example 9. For LPS treatments, gel filtration
chromatography purified LPS from S. enterica (Sigma, St. Louis, MO; L2262) was
added to a final concentration of 1 ng/ml. Subsequently, 5x106 monocytes were plated
into untreated or antibody-coated 12-well tissue culture-treated plates. After 2 hours
treatment, total RNA was isolated using Qiagen® QLAshredderTM columns and
RNeasy® Mini Kits (Valencia, CA; 79654 and 74104, respectively) as per the
manufacturer's protocols. A 2 hour time-point was chosen to minimize the contribution
of secondary and/or differentiation effects, while generating gene expression changes
suitable for high-confidence analysis. Total RNA yields ranged from 1-6 ^g. Total
RNA was further purified by DNase treatment, followed by phenol-chloroform
extraction and ethanol precipitation, using standard protocols. Microarray analysis was
performed using Affymetrix® HG_U133 2.0 Plus arrays according to estabhshed
protocols. For each array, all probe sets were normalized to a mean intensity value of
100. Default GeneChip® Operating System (GCOS) statistical values were used for all
analyses. Monocytes from a total of U healthy donors were analyzed.
Analysis of Expression Profiling Data
[0117] Qualifiers present at >50 signal and called present in >66% of treatment
groups were considered for analysis. Normalized signal values were transformed to
log2 values prior to ANOVA analysis. Qualifiers with p<0.01 and >2-fold change (FC)
in expression between any treatment groups were used to generate the heat-map in
FIGURE 6 and for subsequent analyses. Fold reductions are reported as negative fold-
changes. For genes represented by multiple qualifiers, the qualifier with the highest
average intensity in the untreated sample was chosen for further analysis.
[0118] FIGURE 6 shows a heat-map clustering analysis of the transcriptional
profiling data. In FIGURE 6, individual donors are shown on the left (each column
represents an individual donor) and average mean intensity is shown on the right; each
row represents an individual qualifier. Fluorescent intensities are shown. a-TREM-1-

treated samples were compared to control antibody-treated samples and LPS-treated
samples were compared to no treatment. A hierarchical clustering algorithm was used
to group qualifiers with similar patterns of expression. In FIGURE 6, bracketed regions
indicate heat map regions corresponding to qualifiers up-regulated by TREM-1
activation, up-regulated by LPS, common down-regulated, down-regulated by TREM-1
activation, or down-regulated by LPS.
[0119] FIGURE 7 shows an exemplary scatter plot of all present calls. For scatter
plot analysis. In fold-changes plotted for TREM-1 (x-axis) and LPS (y-axis), with
down-regulation converted to negative values. In FCs (α-TREM-1/control antibody and
LPS/no treatment) for all present calls were calculated and plotted, with down-regulated
genes plotted as In (-1/FC). Selected genes are highlighted. The 45° axis demarcates
genes comparably regulated by both treatments.
[0120] FIGURES 23 and 24 are tables listing genes which were determined to be
responsive to TREM-1 activation and/or treatment with LPS. FIGURE 23 shows the
qualifier, gene name, gene description, and average intensity of identified genes with
various treatments. Treatments included: untreated (control), isotype antibody
(control), a-TREM-1 antibody, LPS, isotype antibody plus a-TREM-1 antibody, and a-
TREM-1 antibody plus LPS. FIGURE 24 shows the qualifier of identified genes as
well as the p-value and ratio for comparisons between different treatments. The
following treatments were compared: a-TREM-1 v. isotype; LPS v. untreated; a-
TREM-1 V. LPS; a-TREM-1 plus LPS v. isotype; a-TREM-1 v. a-TREM-1 plus LPS;
and LPS v. a-TREM-1 plus LPS.
Results
[0121] Multiple genes were identified as being differentially expressed in response
to a-TREM-1 treatment and/or LPS treatment (see FIGURES 7, 8A-B, 9A-B, and 23-
34) and can therefore be used as biomarkers to evaluate agents that modulate TREM-1
and/or LPS signaling. Differentially expressed genes fell into three main categories:
TREM-1 biased genes, LPS biased genes, and genes which were comparably expressed

in response to both a-TREM-1 and LPS treatments. The genes listed in FIGURES 8A-
B are ranked by TREM-1/LPS ratio or LPS/TREM-1 ratio, respectively. The TREM-
1/LPS ratio (see HGURE 8A) and LPS/TREM-l ratio (see HGURE SB) were
calculated from a direct pairwise comparison, which accounts for any variation with
respect to fold-changes in individual treatments. Fold-changes in gene expression
resulting from dual treatment, i.e., treatment with both a-TREM-1 antibody and LPS,
are also shown in FIGURES 8A-B, 9A-B, 23 and 24.
[0122] Genes which passed the above filtering criteria and which demonstrated >4-
fold changes in expression were considered for further analysis. By these criteria, 238
genes were up-regulated >4-fold with either TREM-1 activation or LPS. Of these, 69
genes were induced >4-fold in both treatments, or >4-fold in only one treatment but
within 2-fold in a direct pairwise comparison between the two treatments; these genes
have been categorized as commonly up-regulated. The remainder of genes up-regulated
>4-fold with either TREM-1 activation (62 genes) or LPS treatment (101 genes) have
been categorized as treatment-specific (i.e., treatment-biased).
[0123] A summary of TREM-1 biased genes that are up-regulated >4-fold in
response to TREM-1 activation is shown in FIGURE 8A. Provided are fold-changes
with TREM-1 activation (TREM), LPS (LPS), and combined TREM-1 activation plus
LPS (dual), ranked by the ratio of TREM-1/LPS. p-values for genes up-regulated >4-
-4 -12
fold with TREM-1 activation ranged from 7.7 x 10 to 2.6 x 10 . Genes identified as
preferentially induced by TREM-1 activation include SPRY2, cytokines and related
molecules (TNFSF14, CSFl, SPPl, CCL7, IL1F5, LIF), metallothioneins (MTIK,
MTIE, MTIF), phosphatases (DUSP14, DUSP4), transcription factors (EGR2, ATF3),
factors involved in lipid metabolism and/or signaling (EDG3, LPL, PPAP2B, PLCXDl,
NPCl, FABP3, ACSL3), MMP19, and PPARG. Of these genes, SPPl is up-regulated
28.0 fold (p = 1.2 X 10'°'') in response to TREM-1 activation (see FIGURES 8A and
1 IE), but is not appreciably up-regulated after LPS treatment. Thus, SPPl is not an
obligate pro-inflammatory readout and can serve as a marker for TREM-1 activity in a
patient (or patient sample) and in screening assays for identifying TREM-1 modulating

agents. Moreover, SPPl can also serve as an indicator of the efficacy or potential
efficacy of a TREM-1 therapy for the treatment of inflammation or chronic
inflammation, such as RA, in a patient. Additional genes which may be used as
markers for TREM-1 activity are listed in FIGURES 8A, 23 and 24. Genes that met the
filtering criteria but which are not listed in FIGURE 8A include C6orfll4, C6orgl28,
C9orf47, KIAA1199, KIAA1393, LOC440995, and MGC33212. In general, genes
preferentially induced by TREM-1 activation were largely unaffected by LPS treatment.
[0124] A summary of LPS biased genes that are up-regulated >4-fold in response
to LPS treatment is shown in FIGURE 8B. Provided are fold-changes with TREM-1
activation (TREM), LPS (LPS), and combined TREM-1 activation plus LPS (dual),
ranked by the ratio of LPS/TREM-1. p-values for genes up-regulated >4-fold with LPS
-3 -14
in this Table ranged from 1,2x10 to3.6xl0 . Genes identified as preferentially
induced by LPS include interleukins (IL23A, IL12B, EBI3, IL1F9, ILIO, ILIA, IL18),
interleukin receptors (IL15RA, IL2RA, IL7R), cytokines and related molecules (CSF3,
CCL23, CXCLl, TSLP, CCL5, CLC, EREG, TNFSF9), factors involved in lipid
metabolism and/or signaling (SGPP2, PLAIA, MGLL), kinases (MAP3K8, RIPK2,
MAP3K4, TBKl, PIM3), regulators of NF-KB signaling (TNIP3, NFKBIZ), CCR7, and
CIASl. Genes that met the filtering criteria but which are not listed in FIGURE 8B
include C10orf78, C21orni, FU14490, FU23231, FU25590, FU32499, KIAA0286,
KIAA0376, LOC90167, LOC123872, LOC285628, LOC338758, LOC341720,
LOCLOC374443, LOC387763, LOC400581, LOC441366, MGC10744, and
MGC11082.
[0125] FIGURE 9A shows a summary of common up-regulated genes (i.e., genes
up-regulated by and TREM-1 activation and LPS treatment). Provided are fold-changes
with TREM-1 activation (TREM), LPS (LPS), and combined TREM-1 activation plus
LPS (dual), ranked by fold-induction with TREM-1 activation, p-values for genes up-
-3 -10
regulated >4-fold with TREM-1 activation ranged from 1.7 x 10 to 1.5 x 10 , and
-3 -14
those for LPS ranged from 4.1 x 10 to 2.0 x 10 . Genes identified as being
commonly up-regulated include TNF superfamily members and modulators (TNFSF15,

BRE, TNF), chemokines (CXCL3, CXCL2, CCL20. CXCL5, CCL3), other cytokines
and mitogenic factors (CSF2, IL-6, AREG), matrix metalloproteinases (MMPl,
MMPIO), and PTGS2/COX2. These results are consistent with both TREM-1
activation and LPS eliciting pro-inflammatory responses. Also present are INHBA,
coagulation and vascularization factors (F3, EDNl, TFPI2, SERPINB2), transcription
and DNA binding factors (HES4, EGRi, FOSLl, E2F7, EGR3, MAFF, ETS2, HESl),
and factors involved in lipid metabolism and/or signaling (PLDl, EL0VL7, SYNJ2,
GLA, STARD4). Genes that met the filtering criteria but which are not listed in
FIGURE 9A include C20orfl39, K1AA1718, LOC348938. LOC401151, LOC401588,
LOC92162, and MGC4504.
[0126] In the combined (dual) treatment, the expression change for the majority of
the genes in FIGURE 9A was within 2-fold of the sum of those in individual treatments.
One exception was CSF2 (i.e., GM-CSF), whose mRNA induction was significantly
increased in combined treatment with respect to individual treatments (9.6-, 18.9-, and
192.4-fold with TREM-1 activation, LPS, and combined treatment, respectively).
[0127] A summary of genes with fold-changes <-4 (i.e., down-regulated >4-fold)
with either TREM-1 activation or LPS treatment is shown in FIGURE 9B. Provided are
fold-changes with TREM-1 activation (TREM), LPS (LPS), and combined TREM-1
activation plus LPS (dual), ranked by fold-induction with TREM-1 activation, p-values
-3
for genes down-regulated >4-fold with TREM-1 activation ranged from 5.6 x 10 to 5.7
-12 -3 -14
X 10 , and those for LPS ranged from 2.4 x 10 to 1.1 x 10 . As seen in FIGURE 6, a
comparable number of genes were down-regulated in our analysis as were up-regulated,
although there was less treatment specificity among these genes. Genes identified as
being down-regulated include chemokine receptors (CCR2, CX3CR1), transcription
factors (OLIGl, ZNF555, OLIG2), GTPases of immunity-associated proteins
(GIMAP6, GIMAP7, GIMAP8, GIMAPl), and CCL8. CCR2, the down-regulation of
which is a marker for monocyte-to-macrophage differentiation, is down-regulated in
both a-TREM-1 and LPS treatments (see HGURE 9B). In addition, TLRl and NOD-
like receptore (CARD12, NALP12) are also down-regulated. Genes that met the

filtering criteria but which are not listed in FIGURE 9B include C9orf59, FLJ12442,
FU33641, LOC90120, MGC2941, and MGC17791. The dynamic range in down-
regulation was lower than that for up-regulation, as expected, given the limiting kinetic
contribution of mRNA half-lives to the analysis.
[0128] In general, relatively few genes were down-regulated in one treatment but
not the other. One gene that was not commonly down-regulated is the oligodendrocyte
transcription factor OLIG2, which was up-regulated 3.1-fold by TREM-1 activation and
down-regulated 5.6-fold by LPS (see FIGURE 9B).
[0129] In addition, TREM-1 and LPS differentially regulate CSF production, with
M-CSF being TREM-1-biased and G-CSF being LPS-specific (see HGURES 7, 8A-B).
Example 7: Phagocytosis assay
[0130] Human THP-1 cells were treated with a-TREM-1 and LPS to compare the
effects of a-TREM-1 treatment and LPS treatment on THP-1 cell morphology and
behavior. Human THP-1 cells (ATCC; TIB-202) were maintained according to the
recommended propagation guidelines. For enhanced visualization, THP-1 cells were
transduced with a GFP-expressing lentivirus prior to the indicated treatments in tissue
culture-treated wells for 5 days. Phagocytosis assays were performed by adding
Fluoresbrite™ polychromatic red 1.0 micron microspheres (Polysciences, Inc.,
Warrington, PA; 18660), incubating in a tissue culture incubator for 30 minutes, and
washing with growth medium to remove un-opsonized beads prior to imaging, a-
TREM-1 treatment induced morphological changes in THP-1 cells (FIGURE lOA).
Moreover, both a-TREM-1 treatment and LPS treatment induced phagocytosis of
labeled microspheres (1 μM beads appear in red), consistent with a role for TREM-1
activation in stimulating an immune response (FIGURE lOB).

Example 8: ELISA profiling of gene expression
[0131] Differential expression of selected genes in response to a-TREM-1 and LPS
treatments were confirmed by ELISA. ELISAs were performed on conditioned media
as per the manufacturers' protocols. The levels of proteins secreted into cell-culture
media following either TREM-1 activation or LPS were measured over an 8 hour time-
course. GM-CSF was an analyte on custom-coated plates ordered from Meso Scale
Discovery (Gaithersburg, MD). M-CSF, G-CSF, INHBA, and SPPl detection kits were
purchased from R&D Systems (Minneapolis, MN; DMCOO, DCS50, DY338, and
DOSTOO, respectively). The IL-23 detection kit was purchased from eBioscience (San
Diego, CA; 88-7237).
[0132] Detection of target protein levels (with fold changes in transcript levels for
TREM-1 and LPS, respectively, in parentheses) confirmed that SPPl (28.0 and 3.7;
FIGURE 1 IE) and M-CSF (22.0 and 1.8; FIGURE 1 IB) are up-regulated in response to
TREM-1 activation, but not in response to LPS treatment. These results also
demonstrate that secreted SPPl protein is detectable in extracellular fluids, such as
tissue culture medium. Moreover, protein levels of G-CSF (1.3 and 45.2; FIGURE
1IC) and IL-23 (-1.1 and 31.8; FIGURE 1 IF) confirmed that these genes are up-
regulated in response to LPS treatment. Finally, protein levels of INHBA (96.7 and
97.0; FIGURE 1 ID) and GM-CSF (9.6 and 18.9; HGURE 11 A) confirmed that these
genes are comparably up-regulated in response to both TREM-1 activation and
treatment with LPS.
[0133] These ELISA results validate the use of transcriptional profiling analysis to
identify genes responsive to TREM-1 activation and LPS treatment. These results also
identify, for the first time, cytokines or related factors which are induced by TREM-1
activation but which are not also induced by LPS. Moreover, the ELISA results show
that SPPl is up-regulated at the protein level in response to TREM-1 activation and that
SPPl can be used as a marker for TREM-1 activation. Additional genes which may be
used as markers for TREM-1 activity are listed in FIGURES 8A, 23 and 24.

Example 9: Analysis of cytokine production from synovium ofRA patients upon TREM-
1 activation
[0134] Activation of TREM-1 with a crosslinking antibody has been shown to
trigger the production of pro-inflammatory factors in both human monocytes, and
neutrophils. We therefore tested whether TREM-1 activation had a similar pro-
inflammatory effect in RA positive synovial cultures. The synovium culture assay was
performed as first described by Brennan et al. (1989) J. Autoimmunity 2 Supp: 177-86.
Briefly, synovial tissues were obtained during arthroscopic knee surgery of three
different RA patients (Arthritis and Osteoporosis Center of Maryland in Frederick,
MD). Samples were placed in RPMI with 5% fetal calf serum (FCS) for transport. To
disrupt tissue and release cells, tissues from Donor 1 and Donor 2 were treated with 50
ml of RPMI with 5% FCS containing 5 mg/ml coUagenase IV (Invitrogen, Carlsbad,
CA) and 0.15 mg/ml DNase I (Sigma, St. Louis, MO) and rotated at 37''C for 90 min.
Tissue from Donor 3 was prepared similarly, except that Liberase Blendzyme 4
(Roche) was substituted for the collagenase/DNase, and was used according to the
manufacturer's suggested protocol. Liberase Blendzyme 4 is promoted as being
virtually endotoxin-free. Debris was removed by passing the sample over 100 μm
nylon mesh. Cells were washed and resuspended in RPMI with 0.5% FCS for plating.
For antibody activation of TREM-1, tissue culture treated plates were coated with 100
\i\ of antibody solution containing either anti-hTREM-1 antibody (MAB1278, R&D
Systems, Minneapolis, MN) or an isotype-matched control antibody, anti-E. tenella
(Wyeth, Madison, New Jersey), at indicated concentrations for 3 hours prior to cell
addition. Anti-hTREM-1 antibody was assayed at concentrations of 0.12, 0.37, 1.11,
3.33, and 10 ng/ml; control antibody was assayed at concentrations of 0.12, 1.11, and
10 μg/ml. Wells were washed twice with PBS prior to adding 100 μl of cell suspension
at a cell density of 6 x 105 cells/ml. After 24 hours, supematants were assayed for the
indicated factors using multiplex ELISA plates (Meso-Scale Discovery, Gaithersburg,
Maryland).

[0135] As seen in FIGURE 12, which represents data from one individual,
activation of TREM-1 in these cultures using a cross-linking antibody induced the
production of TNF-a, IL-6, IL-ip and GM-CSF in a dose dependent manner. Similar
results were obtained from all three donor samples. Moreover, FIGURE 13A shows a
comparison of spontaneous cytokine production in each of the three donor samples, and
FIGURE 13B shows a comparison of cytokine production upon crosslinking of TREM-
1 in each of the three donor samples. As shown in FIGURE 13 A, Donor 3 spontaneous
cytokine levels are considerably lower than those for Donors 1 and 2, which is
consistent with less endotoxin contamination, but could also be due to donor variability.
The results from all three donors indicate that TREM-1 is functionally present in RA
cultures and that TREM-1 is capable amplifying the inflammatory response in RA
synovium.
Example 10: mTREM-1-hFc transgenic mouse
[0136] Transgenic mice were generated to constitutively express a fusion protein
comprising extracellular domain of mouse TREM-1 and the Fc portion of a human
IgGl C'mTREM-l-hFc"). The nucleotide and protein sequences of the fusion protein
construct are shown in SEQ ID NO:7 and SEQ ID N0:8, respectively. Alternatively,
transgenic mice can be generated where the TREM-1-hFc construct is under the control
of an inducible promoter rather than being constitutively expressed. Soluble TREM-1-
Fc fusion proteins are also well known in the art, and have been shown to protect
against LPS and septic shock as well as zymosan-A induced granuloma formation.
K/BxN transfer in mTREM-1-hFc transgenic mice
[0137] A murine K/BxN model is a mouse model that resembles many forms of
human inflammatory arthritis, including RA (Ditzel (2004) Trends Mol. Med. 10(1):40-
45). As shown in FIGURE 14, TREM-1 mRNA expression was markedly increased in
K/BxN paws as compared to normal paws. Therefore, serum or antibody from arthritic

K/BxN mice can be transferred to experimental animals to determine if the mTREM-1-
hFc construct inhibits the inflammatory response to K/BxN serum or antibody.
[0138] In one experiment, transgenic mice expressing a soluble mTREM-1-hFc
fusion protein were challenged with K/BxN serum to assess whether soluble TREM-1
reduces arthritic inflammation. Briefly, TREM-1 transgenic ('Tg) mice were generated
on a C57BL/6 background to express a soluble mTREM-1-hFc fusion protein under the
control of a CAGGS promoter, which is a ubiquitously strong fusion promoter that is
comprised of the CMV enhancer and the P-actin promoter. The overall construct was
CAGGS/mTREM-1-hFc/rabbit p-globulin poly A. The soluble mTREM-1-hFc protein
level in the blood plasma of transgenic mice was about 1-2 mg/ml. TREM-1 transgenic
male mice (n=7) and wildtype male mice (n=7) were injected with 150 |J1 of K/BxN
serum intraperitoneally (ip) on day 0 and day 2. Ankle diameter was measured
periodically until day 14.
[0139] FIGURE 15 shows the average ankle thickening of C57BL/6-TREM-1
transgenic mice compared to wildtype controls. As shown in FIGURE 15, TREM-1
transgenic mice developed a similar phenotype as wildtype mice until day 6. Starting at
day 7, ankle swelling subsided in TREM-1 transgenic mice while swelling continued in
wildtype controls. Subsequently, a significant reduction in ankle swelling was observed
from days 9-14 (p<0.05) in TREM-1 transgenic mice compared to wildtype controls.
Moreover, peak swelling in TREM-1 transgenic mice was about half the peak swelling
observed in the wildtype controls. By day 14, ankle swelling in TREM-1 transgenic
mice was about a quarter of the amount of swelling observed in wildtype controls
(FIGURE 16). Thus, soluble TREM-1 is effective at significantly reducing the amount
of inflammation associated with inflammatory arthritis, demonstrating that the use of
TREM-1 antagonists, for example, TREM-1 fusion proteins and/or anti-TREM-1
antibodies, to modulate, reduce and/or inhibit TREM-1 and/or TREM-1 signaling is an
effective method for treating inflammatory disorders, including, for example, RA.
[0140] Transcriptional and translational regulatory sequences used for generating
fusion proteins of the invention may include, but are not limited to, promoter sequences.

ribosomal binding sites, transcriptional start and stop sequences, translational start and
stop sequences, and enhancer or activator sequences. In one embodiment, the
regulatory sequences include a promoter and transcriptional start and stop sequences.
[0141] Promoter sequences may encode constitutive or inducible promoters. The
promoters may be either naturally occurring promoters or hybrid promoters. Hybrid
promoters, which combine elements of more than one promoter, are also known in the
art, and may be used in the present invention.
[0142] Additional experimental animals can be generated by backcrossing a
mTREM-1-hFc heterozygous mouse to a wildtype mouse, and wildtype offspring can
serve as in-litter controls. Experimental animals can be tested in various animal models
of inflanmiatory disease known in the art, such as, for example, LPS, and CIA, to
determine if various mTREM-1-hFc constructs are protective of inflammatory disease.
The mTREM-1-hFc construct can be constitutively expressed, or expression of the
mTREM-1-hFc construct can be induced prior to, concurrently with, and/or at one or
more time points after challenge with LPS and CIA. Transgenic mice expressing a
soluble form of the TREM-1 receptor can also be generated to screen for putative
inhibitors of inflammatory disease.
[0143] In a lipopolysaccharide (LPS) model of endotoxic shock, experimental
animals are injected with LPS to determine the effectiveness of the mTREM-1-hFc
construct in reducing the inflammatory response to LPS-induced shock. Further,
experimental animals can be tested in a CIA model, such as in Example 2, to determine
the effectiveness of the mTREM-1-hFc construct in reducing the inflammatory response
to CIA.
[0144] Based on the association of TREM-1 and DAP12/TyroBP with RA, the
mTREM-1-hFc construct is expected to be protective of LPS and CIA challenges in
mice. Likewise, administration of a suitable TREM-1 construct and/or a suitable
TREM-1 protein to a human subject afflicted with an inflammatory disease, such as
RA, can reduce the severity of the inflammatory disease.

Example 11: Anti-hTREM-l antibodies
[0145] Anti-hTREM-l antibodies are screened for the ability to inhibit production
of pro-inflammatory cytokines in human RA synovium culture assays. RA and asthma
models, such as in Example 9 and Example 12, have been used successfully as models
of inflammatory disease to develop therapeutic antibodies which neutralize one or more
aspects of the inflammatory response. Based, in part, upon the association of TREM-1
with inflammatory diseases, such as RA and asthma, anti-hTREM-1 antibodies are
expected to inhibit production of pro-inflammatory cytokines in RA synovium culture
assays and asthma models. Likewise, administration of suitable antibodies to a human
subject afflicted with an inflammatory disease, such as RA or asthma, should reduce the
severity of the inflammatory disease and/or lessen the symptoms of the disease.
ExamplelZ: TREM-1 and challenge with anti-IgE antibodies
[0146] Mast cells and IgE are well established players in allergic reactions, for
example, acute respiratory disorders such as asthma or anaphylaxis, since crosslinkage
of IgE on the surface of mast cells will induce signaling events that lead to mast cell
activation and degranulation. This signaling cascade and the downstream consequences
of mast cell activation and degranulation can be investigated in vivo in the mouse using
a passive cutaneous anaphylaxis (PCA) model in which rat anti-mouse IgE is injected
intradermally (id) into the ear. Anti-IgE antibody will bind and crosslink the IgE that is
bound to the FceRI receptors on the surface of mast cells to induce mast cell activation
and degranulation. The ensuing inflammatory/edematous reaction results in a
measurable swelling within the ear that can be calculated using an engineer's
micrometer. Inagaki et al, "Mouse ear PCA as a model for evaluating antianaphylactic
agents," Int Areh Allerev Apol Immunol.. 74(l):91-2 (1984).
Anti-IgE challenge in transgenic TREM-1 mice
[0147] Transgenic TREM-1 mice and wildtype mice were challenged with anti-IgE
antibodies using the ear swelling model. Transgenic mice were produced as in Example

10. The transgenic mouse strain used in this experiment contained a blood plasma level
of mTREM-I-hFc protein of about 200 μg/ml. While under isofluorane anesthesia, ears
of TREM-1 wildtype mice and transgenic heterozygous mTREM-1-hFc mice were
measured for ear thickness. Anti-mouse IgE was diluted to 10 ng/20 ul in 0.9% saline.
Transgenic and wildtype mice were challenged with anti-IgE antibody (BD
PharMingen, San Diego, CA; catalog 553413) at time 0 in the left ear, while a separate
group of transgenic and wildtype mice were challenged with endotoxin free 0.9%
normal saline vehicle, as indicated in Table 2. Ear measurements were taken at +1
hour, +2 hours, +4 hours, and +6 hours following challenge.

[0148] As shown in FIGURE 17, reduced ear swelling was observed in TREM-1
transgenic mice as compared to wildtype controls. TREM-1 may therefore play a role
in the allergic response in vivo since C57BL/6 mice overexpressing a mTREM-1-hFC
chimeric protein have reduced cutaneous ear swelling. Thus, soluble TREM-1 is
effective at reducing the inflammation associated with anti-IgE challenge. For example,
soluble TREM-1 is expected to be effective at modulating asthma, anaphylaxis, acute

and chronic urticaria (hives), angioedema, allergic rhinitis, insect sting allergies, and
atopy.
Anti-IgE challenge in wildtypc mice pretreated with soluble TREM-1
[0149] Mice were pretreated with a soluble TREM-1 fusion protein to assess
whether administration of soluble TREM-1 is protective of inflammation in an ear
swelling model. The day prior to study, mice were either injected intraperitoneally with
0.9% saline, mTREM-1-mFc (500 ug/400 ul, 250 ug/400 ul, or 100 ug/400 ul) or anti-E.
lenella-IgG 2a (500 ug/400 ul), as indicated in Table 3. Anti-mouse IgE was diluted to
10 ng/20 ul in 0.9% saline. Recombinant mTREM-l-mFc was generated comprising
the extracellular domain of mouse TREM-1 and the Fc portion of a mutated mouse
IgG2a ("mTREM-1-mFc") (SEQ ID NO:27). The Fc region was mutated to reduce
complement and Fc receptor binding. mTREM-1-mFc and anti-E. tenella-IgG 2a
(Wyeth, Madison NJ) were diluted in PBS to the desired dose level. Prior to challenge,
ears of all the mice were measured to determine baseline ear thickness. Mice were
challenged with anti-IgE (10 ng/20 ul/ id) at time 0 in the left ear, while the right ear
was challenged with 0.9% normal saline (20 ul/ id). Ear measurements were taken at
+1 hour, +2 hour, +4 hour, and +5 hour following challenge.


[0150] As shown in FIGURE 18, pretreatment of mice with soluble mTREM-1-
mFc protein reduced ear-swelling as compared to controls. Moreover, as shown in
HGURE 19, the reduction in ear swelling is dose dependent. These data further
demonstrate that soluble TREM-1 reduces the inflammation associated with anii-IgE
challenge and that antagonists of TREM-1 and/or TREM-1 signaling, such as, for
example, soluble TREM-1 fusion proteins and/or anti-TREM-1 antibodies, can be
administered to a patient for treatment of inflammation associated with anti-IgE
challenge. For example, soluble TREM-1 and/or anti-TREM-1 antibodies, are expected
to be effective at modulating asthma, anaphylaxis, acute and chronic urticaria (hives),
angioedema, allergic rhinitis, insect sting allergies, and atopy.
Anti-IeE challenge in TREM-1 knockout mice
[0151] TREM-1 heterozygous (+/-) and homozygous (-/-) knockout mice were
generated to assess whether ear swelling is reduced in the absence of functional TREM-
1. Straight TREM-1 knockout mice were generated in which exon 1 and exon 2 of the
TREM-1 gene were replaced by a lox P-flanked dual promoter driven Neo resistance

gene, resulting in a reading frame shift in the TREM-1 gene. Gene targeting was
conducted in C57BL/6 embryonic stem cells. TREM-1 knockout mice were bred with
Protamine-Cre mice to generate Neo deleted TREM-1 knockout mice. On day 0, while
under isofluorane anesthesia, ears of all of the mice were measured to determine
baseline ear thickness. Mice were challenged with anti-IgE (10ng/20ul/ id) at time 0 in
the left ear, while the right ear was challenged with 0.9% normal saline (20uiy id), as
indicated in Table 4. Anti-mouse IgE was diluted to 10 ng/20 ul in 0.9% saline. Ear
measurements were taken at +1 hour following challenge.

[0152] As shown in FIGURE 20, mice that are heterozygous (+/-) for the TREM-1
gene and TREM-1 homozygous (-/-) knockout mice have a reduced ear swelling
response following intradermal challenge with anti-IgE compared with wildtype (+/+)
counterparts. This further demonstrates that TREM-1 is involved in the inflammatory
response, and that TREM-1 is a therapeutic target for IgE-mediated inflammatory
diseases/disorders, such as, for example, asthma, anaphylaxis, acute and chronic
urticaria (hives), angioedema, allergic rhinitis, insect sting allergies, and atopy. Thus,

antagonizing and/or inhibiting TREM-land/or TREM-1 signaling is effective at
significantly reducing the amount of inflammation associated with IgE-mediated
inflammatory diseases/disorders, demonstrating that the use of TREM-1 antagonists, for
example, TREM-1 fusion proteins and/or anti-TREM-1 antibodies, to modulate, reduce
and/or inhibit TREM-1 and/or TREM-1 signaling, is an effective method for treating
IgE-mediated inflammatory diseases/disorders.
Example 13: shRNA and siRNA knockdown of TREM-1
[0153] To demonstrate the utility of interfering RNA-based treatments for
inflammatory disease, TREM-1 expression in THP-1 monocytes was measured after
shRNA and siRNA knockdown. Briefly, various human TREM-1 and mouse TREM-1
shRNA sequences were generated and individually tested for the ability to reduce
TREM-1 expression. Representative shRNA sequences are shown in Table 5. shRNAs
were expressed in TKDP-1 monocytes by lentivirus transduction. Human TREM-1
siRNAs are commercially available from Dharmacon (Lafayette, CO), and were
introduced into THP-l monocytes by nucleofection. Representative siRNA sequences
are shown in Table 6. After knockdown, TREM-1 expression was measured by
TaqMan® RT-PCR at 72 hours post-transduction (in the case of shRNA) or 48 hours
post-nucleofection (in the case of siRNA).
[0154] FIGURE 21 is a bar graph showing TREM-1 expression by RT-PCR after
ShRNA or siRNA knockdown. As shown in HGURE 21, sh247, sh533, sh382, and
pooled TREM-1 siRNAs effectively knocked-down endogenous TREM-1 expression in
THP-1 monocytes as compared to vGFP and scramble siRNA controls. Thus, shRNA
and siRNA knockdown are an effective means for reducing TREM-1 expression and
can therefore be used in treating inflammatory disease.
[0155] To demonstrate that RNA-based treatments can effectively knock-down
TREM-1 over-expression, TREM-1 was over-expressed in CHO cells prior to lentivirus
shRNA knockdown. In one experiment, a human TREM-1-FLAG fusion protein was
stably over-expressed in a CHO cell line. In another experiment, a mouse TREM-1-
FLAG fusion protein was stably over-expressed in a CHO cell line. Subsequent to

TREM-1-FLAG over-expression, shRNAs were expressed in each CHO cell line using
a lentivirus. Various human and mouse TREM-1 shRNA sequences were generated and
individually tested for the ability to reduce TREM-1 over-expression. Representative
shRNA sequences are shown in Table 5. After exposure lentiviral shRNA, TREM-1
expression levels were assayed by Western blot using anti-FLAG antibodies as a probe.
[0156] FIGURES 22A-B show representative Western blots depicting TREM-1
expression after lentiviral shRNA knockdown of TREM-1 in TREM~1 over-expressing
cell lines. As shown in FIGURE 22A, shll4, sh247, sh247, sh280, sh315, sh360,
sh450, and sh533 effectively knocked-down human TREM-1-FLAG over-expression as
compared to controls, while sh382 and sh600 were ineffective at knocking-down human
TREM-1-FLAG over-expression. As shown in HGURE 22B, sh75, sh284, and sh414
effectively knocked-down mouse TREM-1-FLAG over-expression as compared to
controls, while sh591 was ineffective at knocking-down mouse TREM-1-FLAG over-
expression. Thus, shRNA knockdown is an effective means for reducing TREM-1
over-expression and therefore treating TREM-1 associated inflammatory disease.


Incorporation by Reference
[0157] All publications and patent documents cited in this application are
incorporated by reference in their entirety for all purposes to the same extent as if the
contents of each individual publication or patent document was incorporated herein.
[0158] What is claimed is:

1. A method of treating inflammatory disease in a subject, the method comprising
the step of reducing TREM-1-mediated signal transduction.
2. The method of claim 1, wherein the inflammatory disease is mediated by IgE.
3. The method of claim 1, wherein the inflammatory disease is a respiratory
disease.
4. The method of claim 1, wherein the disease is asthma.
5. The method of claim 1 wherein the inflammatory disease is rheumatoid arthritis.
6. The method of claim 1, wherein the reducing step comprises reducing TREM-1
expression.
7. The method of claim 6, wherein the reducing step comprises administering an
interfering RNA to the subject.
8. The method of claim 7, wherein the interfering RNA is an shRNA.
9. The method of claim 8, wherein the shRNA comprises an RNA encoded by any
of SEQ ID NOs:9-18.
10. The method of claim 7, wherein the interfering RNA is an siRNA.
11. The method of claim 10, wherein the siRNA comprises any of SEQ ID NOs:23-
26.
12. The method of claim 1, wherein the reducing step comprises inhibiting TREM-1
activation.
13. The method of claim 12, wherein TREM-1 activation is inhibited by
administering a compound selected from the group consisting of a small
molecule, a peptide mimetic, a peptide inhibitor, a ligand fusion protein, an
antibody or fragment thereof that specifically binds TREM-1, an antibody or
fragment thereof that specifically binds TREM-1 ligand, a soluble TREM-1
receptor, a soluble TREM-1 receptor fusion protein, and combinations thereof.

14. The method of claim 1, wherein the reducing step comprises directly inhibiting
expression or activity of a non-TREM-1 protein involved in TREM-1-mediated
signal transduction.
15. The method of claim 14, wherein the non-TREM-1 protein is DAP 12/TyroBP.
16. The method of claim 1, wherein the reducing step comprises inducing an
inunune response to endogenous TREM-1 or DAP12/TyroBP protein in the
subject.
17. The method of claim 16, wherein the reducing step comprises administering to
the subject an immunogenic composition comprising an adjuvant and TREM-1
or DAP12/TyroBP protein or an immunogenic fragment thereof.
18. An antibody or fragment thereof that specifically binds TREM-1.
19. The antibody or fragment thereof of claim 18 wherein the antibody or fragment
thereof is monoclonal.
20. The antibody or fragment thereof of claim 18, wherein the antibody or fragment
thereof is a single domain antibody
21. A method of treating a subject, the method comprising the step of administering
to the subject a therapeutically effective quantity of the antibody or fragment
thereof of claim 19.
22. An shRNA comprising an RNA encoded by any of SEQ ID NOs:9-22.
23. A method of treating inflammatory disease in a subject in need thereof, the
method comprising the step of reducing TREM-1-mediated signal transduction
by administering a compound selected from the group consisting of a small
molecule, a peptide mimetic, a peptide inhibitor, a ligand fusion protein, an
antibody or fragment thereof that specifically binds TREM-1, an antibody or
fragment thereof that specifically binds TREM-1 ligand, a soluble TREM-1
receptor, a soluble TREM-1 receptor fusion protein, and combinations thereof.

24. A method for assessing the efficacy of a TREM-1-modulating agent
administered to a patient in need thereof, the method comprising detecting
secreted phosphoprotein 1 (SPPl) levels in the patient or in a sample from the
patient.
25. The method of claim 24, wherein the SPPl levels are detected in a body fluid
sample from the patient.
26. The method of claim 24, further comprising the step of comparing SPPl levels
to a reference, wherein an increase in SPPl levels as compared to the reference
is indicative of an increase in TREM-1 activity, and wherein a decrease SPPl
levels as compared to the reference is indicative of a decrease in TREM-1
activity.
27. The method of claim 26, wherein the reference corresponds to SPPl levels
detected in the patient or in a sample from the patient at a time prior to
administration of the TREM-1-modulating agent.
28. A method of screening for candidate agents capable of modulating TREM-1
signaling, the method comprising the steps of:
contacting a TREM-1-expressing cell with a candidate agent; and
assessing secreted phosphoprotein 1 (SPPl) levels of the TREM-1-expressing
cell to determine whether the candidate agent modulates TREM-1 activation.
29. A method of monitoring a patient treated for chronic inflammation, the method
comprising the steps of:
administering a TREM-1 modulating agent to a patient in need thereof;
detecting secreted phosphoprotein 1 (SPPl) levels in the patient or in a sample
from the patient; and
comparing the detected SPPl levels with a reference, thereby monitoring the
patient.

30. The method of claim 29, wherein the SPPl levels are detected in a body fluid
sample from the patient.
31. The method of claim 29, wherein a reduction in SPPl levels as compared to the
reference is indicative of a reduction in TREM-1 mediated inflammation.
32. The method of claim 29, wherein no change in SPPl levels as compared to the
reference is indicative of no change in TREM-1 mediated inflammation.
33. The method of claim 29, wherein an increase in SPPl levels as compared to the
reference is indicative of an increase in TREM-I mediated inflammation.
34. The method of claim 29, wherein the reference corresponds to SPPl levels
detected in the patient or in a sample from the patient at a time prior to or
concurrent with admdnistration of the TREM-1-modulating agent.
35. The method of claim 29, wherein the reference corresponds to SPPl levels in a
control subject known not to have chronic inflammation.
36. A method of detecting the presence of inflammatory disease in a subject, the
method comprising the step of:
detecting TREM-1 or DAP12/TyroBP expression or activity in the subject or a
sample obtained therefrom, wherein increased expression or activity is indicative of the
inflammatory disease.
37. A method of monitoring inflammatory disease in a subject, the method
comprising the steps of:
(a) detecting TREM-1 or DAP12/TyroBP expression or activity in the
subject at a first time or in a first sample obtained therefrom;
(b) detecting TREM-1 or DAP12/TyroBP expression or activity in the
subject at a second, later time or in a second, later sample obtained therefrom; and
(c) comparing the expression or activity of (a) and (b), wherein a change in
expression or activity is indicative of a change in disease status.

38. The method of claim 37, wherein the inflammatory disease is rheumatoid
arthritis.
39. A method of evaluating a treatment for inflammatory disease in a subject, the
method comprising the steps of:

(a) detecting TREM-1 or DAP12/TyroBP expression or activity in the
subject at a first time or in a first sample obtained therefrom;
(b) detecting TREM-1 or DAP12/TyroBP expression or activity in the
subject at a second, later time or in a second, later sample obtained therefrom;
(c) administering a treatment prior to the second, later time or the second,
later sample; and
(d) comparing the expression or activity of (a) and (b), wherein a change in
expression or activity is indicative of a change in disease status.

40. The method of claim 39, wherein the treatment is administered after the first
time or first sample.
41. The method of claim 39, further comprising modifying a course of treatment for
the subject based on the outcome of the comparison.

The present invention provides methods of treating inflammatory diseases/disorders in a subject by inhibiting/antagonizing
TREM-1 expression/activity/signal transduction and/or DAP12/TyroBP expression and/or activity. Methods of detecting
the presence of inflammatory disease in a subject by detecting TREM-1 and/or DAP12/TyroBP expression and/or activity in the
subject or a sample obtained therefrom, wherein increased expression or activity is indicative of the inflammatory disease are also
included. The present invention further provides methods for assessing the efficacy of a TREM-1-modulating agent administered to
a patiem by detecting levels of secreted phosphoprotein 1 (SPP1) and/or one or more other biomarkers in the patient or in a sample
from the patient.

Documents

Application Documents

# Name Date
1 2921-KOLNP-2009-(26-09-2011)-CORRESPONDENCE.pdf 2011-09-26
1 2921-KOLNP-2009-AbandonedLetter.pdf 2017-07-01
2 2921-KOLNP-2009-FER.pdf 2016-07-05
2 2921-KOLNP-2009-(26-09-2011)-ASSIGNMENT.pdf 2011-09-26
3 abstract-2921-kolnp-2009.jpg 2011-10-07
3 2921-kolnp-2009-abstract.pdf 2011-10-07
4 2921-kolnp-2009-specification.pdf 2011-10-07
4 2921-KOLNP-2009-ASSIGNMENT.pdf 2011-10-07
5 2921-kolnp-2009-sequence listing.pdf 2011-10-07
5 2921-kolnp-2009-claims.pdf 2011-10-07
6 2921-kolnp-2009-pct request form.pdf 2011-10-07
6 2921-KOLNP-2009-CORRESPONDENCE-1.1.pdf 2011-10-07
7 2921-kolnp-2009-pct priority document notification.pdf 2011-10-07
7 2921-kolnp-2009-correspondence.pdf 2011-10-07
8 2921-kolnp-2009-international publication.pdf 2011-10-07
8 2921-kolnp-2009-description (complete).pdf 2011-10-07
9 2921-kolnp-2009-gpa.pdf 2011-10-07
9 2921-kolnp-2009-drawings.pdf 2011-10-07
10 2921-kolnp-2009-form 1.pdf 2011-10-07
10 2921-kolnp-2009-form 5.pdf 2011-10-07
11 2921-KOLNP-2009-FORM 3-1.1.pdf 2011-10-07
11 2921-kolnp-2009-form 3.pdf 2011-10-07
12 2921-KOLNP-2009-FORM 3-1.1.pdf 2011-10-07
12 2921-kolnp-2009-form 3.pdf 2011-10-07
13 2921-kolnp-2009-form 1.pdf 2011-10-07
13 2921-kolnp-2009-form 5.pdf 2011-10-07
14 2921-kolnp-2009-drawings.pdf 2011-10-07
14 2921-kolnp-2009-gpa.pdf 2011-10-07
15 2921-kolnp-2009-description (complete).pdf 2011-10-07
15 2921-kolnp-2009-international publication.pdf 2011-10-07
16 2921-kolnp-2009-correspondence.pdf 2011-10-07
16 2921-kolnp-2009-pct priority document notification.pdf 2011-10-07
17 2921-KOLNP-2009-CORRESPONDENCE-1.1.pdf 2011-10-07
17 2921-kolnp-2009-pct request form.pdf 2011-10-07
18 2921-kolnp-2009-claims.pdf 2011-10-07
18 2921-kolnp-2009-sequence listing.pdf 2011-10-07
19 2921-kolnp-2009-specification.pdf 2011-10-07
19 2921-KOLNP-2009-ASSIGNMENT.pdf 2011-10-07
20 abstract-2921-kolnp-2009.jpg 2011-10-07
20 2921-kolnp-2009-abstract.pdf 2011-10-07
21 2921-KOLNP-2009-FER.pdf 2016-07-05
21 2921-KOLNP-2009-(26-09-2011)-ASSIGNMENT.pdf 2011-09-26
22 2921-KOLNP-2009-AbandonedLetter.pdf 2017-07-01
22 2921-KOLNP-2009-(26-09-2011)-CORRESPONDENCE.pdf 2011-09-26