Abstract: The present disclosure relates to method of producing an insect resistant transgenic cauliflower plant comprising of event CFE-4. The present disclosure also provides methods of detection of event CFE-4, and zygosity of the said event in plant genome. Further, also provided are primers, and DNA fragments that are useful in production and detection of the CFE-4 event in cauliflower plants.
1. A method of detecting transgenic cauliflower event CFE-4 in a biological sample, said method comprising: a. obtaining a biological sample comprising of cauliflower DNA5 ; b. contacting said biological sample with a first DNA primer and a second DNA primer; c. performing a DNA amplification reaction to produce a DNA amplicon molecule; and 10 d. detecting the presence of said DNA amplicon molecule, wherein the detection of presence of said DNA amplicon molecule is diagnostic for said CFE-4 event.
2. The method as claimed in claim 1, wherein the first DNA primer is selected from the group consisting of SEQ ID NO: 8, SEQ ID NO: 23, SEQ ID NO: 24, and 15 SEQ ID NO: 26, and wherein the second DNA primer is selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 25.
3. The method as claimed in claim 1, wherein said DNA amplicon comprises of at least 50 contiguous nucleotides selected from the group of sequences consisting of SEQ 20 ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 27, and complements thereof.
4. A method of determining the zygosity of DNA of a transgenic cauliflower plant comprising of event CFE-4, said method comprising: a. obtaining a biological sample comprising of cauliflower DNA; 25 b. contacting said biological sample with a first DNA primer, a second DNA primer, and a third DNA primer; c. performing a DNA amplification reaction to produce a DNA amplicon molecule; and d. detecting the presence of said DNA amplicon molecule, 57 wherein, detection of presence of more than one DNA amplicon having different nucleotide sequences is indicative of heterozygosity of the transgenic cauliflower event CFE-4, while detection of presence of one or more DNA amplicon with identical nucleotide sequence is indicative of homozygosity of the transgenic event CFE-4.
5. The method as claimed in claim 4, wherein the first DNA primer is selecte5 d from the group consisting of SEQ ID NO: 8, SEQ ID NO: 23, SEQ ID NO: 24, and SEQ ID NO: 26.
6. The method as claimed in claim 4, wherein the second DNA primer is selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 10, SEQ ID 10 NO: 11, and SEQ ID NO: 25.
7. The method as claimed in claim 4, wherein the third DNA primer is selected from the group consisting of SEQ ID NO: 8, SEQ ID NO: 23, SEQ ID NO: 24, and SEQ ID NO: 26.
8. A synthetic DNA molecule comprising of any of the DNA amplicons obtained from a method as claimed in claim 1.
9. The method as claimed in claim 1 or claim 4, wherein the biological sample is selected from the group consisting of cotyledon with petiole, hypocotyls, embryo, immature embryo, leaf lamina, cotyledonary axil, shoot tip, anther, root and callus or any other suitable explants.
10. A kit for detection of transgenic cauliflower event CFE-4 comprising of forward and reverse primers having at least 10 contiguous nucleotides selected from the group of sequences consisting of SEQ ID NO: 14, SEQ ID NO: 22, SEQ ID NO: 15, and SEQ ID NO: 27.
FIELD OF INVENTION
[0001] The present disclosure relates to transgenic cauliflower event CFE-4,
comprising cry1Ac gene. The transgenic cauliflower event CFE-4 confers resistance
against lepidopteran insects. The invention provides polynucleotide molecules and
sequences that are unique to this event. The invention also relates to insect resistan5 t
transgenic plants and methods for detecting the presence of said cauliflower event in a
cauliflower plant, parts thereof by detection of specific polynucleotide molecules that
are unique to the transgenic event.
10 BACKGROUND OF THE INVENTION
[0002] Cauliflower is a popular and widely consumed vegetable that has its origin in
the Mediterranean coast. India is one of the major cauliflower producing countries
(FAOSTAT 2010, http://faostat.fao.org/site/339/default.aspx). Cauliflower is grown for
its tender white head (curd) formed by flower parts. Cauliflower curds are mainly
15 consumed in various forms after cooking. The cauliflower vegetable is a good source of
vitamin B, vitamin C, vitamin A, minerals and proteins. (Salunkhe et al., Postharvest
Biotechnology of Fruits, 1984, Vol.2, CRC Press, Boca Raton, FL, USA).
[0003] Cauliflower production suffers from various insect infestations during different
growth stages. The predominant insect pest species attacking the crop is Plutella
20 xylostella L., commonly known as diamondback moth (DBM). The larvae of the DBM
feed on leaves, buds, flowers, green pods and stems causing extensive damage. The
management of DBM is generally through insecticide sprays, which over time leads to
development of resistance against the insecticide and pollution of the environment.
Farmers use large quantities of chemical insecticides routinely. It has been reported that
25 the damage caused by DBM results in an annual loss of $16 million US dollars in India
(Mohan et al., Crop Protection, 2003, 22, 495-504). In India, losses in yield of cabbage
and cauliflower due to DBM can reach up to 90% if no chemicals are used. In contrast
this number is reduced to 35% when chemicals are used. The cost of insecticides
accounts for one-third of the total input costs and just under one-fourth of total cost of
3
cultivation (Sandur S. Consultant Report for the Center for Environmental Stress and
Adaptation Research. LaTrobe University, Victoria, Australia, 2004, 31pp). Farmers
use large quantities of chemical insecticides singly or in combination to get blemish free
cauliflower head, which fetch premium prices in the market. This practice of
indiscriminate use of insecticides leads to the build-up of insecticide residues in th5 e
agricultural product, local ecological imbalance, pest resurgence due to resistance and
environmental pollution.
[0004] To reduce pest-linked damage in cauliflower crop as well as to protect the
environment from the adverse effects of insecticides, deploying the lepidopteran
10 specific cry1Ac gene under the control of a suitable promoter for high level of
expression in cauliflower would provide an effective built-in mechanism for pest
control. This would result in reduction of cauliflower cultivation costs, as the
contribution of chemical insecticides in cauliflower cultivation is sizable. Efforts to
control this pest solely through conventional insecticides have led to development of
15 resistance in the pests to most of the insecticides available in India (Singh et al., Impact
of Vegetable Research in India, Proceedings 13, March, 2002). Management of DBM
by integrated pest management using Bt crystal protein for spraying externally has been
tested successfully. These Bt formulations are effective in target pest control, but the
formulations get washed out in rain and get degraded when exposed to sunlight. Current
20 control methods for DBM and other brassica insect pests and the prospects for
improved management with lepidopteran-resistant Bt vegetable brassicas in Asia and
Africa (Grzywacz et al., Crop Protection, 2010, 29, 68-79). An alternative to external
application is to develop transgenic cauliflower expressing Bt genes for specific insect
resistance. A number of groups have carried out successful transformation of
25 cauliflower using Agrobacterium-mediated methods for transformation (Chakrabarty et
al., J Biosci., 2002, 27, 495-502). The source organism for cry1Ac gene is Bacillus
thuringiensis (Bt), which is a gram-positive bacterium that synthesizes insecticidal
crystalline (Cry) inclusions during sporulation. The cry1Ac gene encodes the 130kDa
Cry1Ac protein and is highly specific and toxic to Lepidpoteran larvae. Cry1Ac protein
4
containing leaves when ingested by pests causes paralysis of the insect gut and
subsequent death due to starvation. Bt protein does not affect non target organisms
(Birds, mammals etc) as they lack receptors or have a acidic pH where Bt proteins do
not work.
[0005] The expression of a foreign gene in plants is known to be influenced by th5 e
location of the transgene in the genome of the plant. Variations in transgene expression
occur due to insertion of the transgene into different chromatin regions, which may be
more (euchromatin) or less (heterochromatin) transcriptionally active. Examples of
these are methylated regions in which, gene expression is suppressed, or in the
10 proximity transcriptional regulation elements like enhancers and suppressors, which
increase or decrease gene expression respectively. Therefore, it is necessary to screen a
large number of independent transformation events for the expression of the transgene
and to identify the event showing desired expression characteristics of the heterologous
inserted gene (Chakrabarty et al., J Biosci., 2002, 27, 495-502).
15 [0006] US 20100003269 discloses a method of generation of transgenic Brassica
oleracea plants. The invention also provides a method for the production of
heterologous proteins using a cruciferae-based plant system, for example
pharmaceutical and/or recombinant proteins. In addition, the invention also relates to a
method for the production of transgenic collard and cauliflower, and to the large scale
20 production of pharmaceutical and/or therapeutic production, such as production of
cruciferae-based vaccine production however, the invention does not disclose event
development and its identification.
SUMMARY OF INVENTION
25 [0007] An aspect of the present disclosure relates to a method of detecting cauliflower
event CFE-4 event in a biological sample, said method comprising of (a) obtaining a
biological sample comprising of cauliflower DNA; (b) contacting said biological
sample with a first DNA primer and a second DNA primer, (c) performing a DNA
amplification reaction to produce a DNA amplicon molecule; and (d) detecting the
5
presence of said DNA amplicon molecule, wherein the detection of presence of said
DNA amplicon molecule is diagnostic for said CFE-4 event.
[0008] An aspect of the present disclosure relates to a method of determining the
zygosity of a transgenic cauliflower plant comprising of event CFE-4, said method
comprising: (a) obtaining a biological sample comprising of cauliflower DNA; (5 b)
contacting said biological sample with a first DNA primer, a second DNA primer, and a
third DNA primer, (c) performing a DNA amplification reaction to produce a DNA
amplicon molecule; and (d) detecting the presence of said DNA amplicon molecule,
wherein detection of presence of more than one DNA amplicon having different
10 nucleotide sequences is indicative of heterozygosity of the transgenic cauliflower event
CFE-4, while detection of presence of one or more DNA amplicon with identical
nucleotide sequence is indicative of homozygosity of the transgenic event CFE-4.
[0009] Another aspect of the present disclosure relates to synthetic DNA molecules
comprising of any of the DNA amplicons obtained from a method of detecting
15 cauliflower event CFE-4 event in a biological sample, said method comprising of (a)
obtaining a biological sample comprising of cauliflower DNA; (b) contacting said
biological sample with a first DNA primer and a second DNA primer, (c) performing a
DNA amplification reaction to produce a DNA amplicon molecule; and (d) detecting
the presence of said DNA amplicon molecule, wherein the detection of presence of said
20 DNA amplicon molecule is diagnostic for said CFE-4 event.
[00010] Yet another aspect of the present disclosure relates to a kit for detection
of transgenic cauliflower event CFE-4 comprising of forward and reverse primers
having at least 10 contiguous nucleotides selected from the group of sequences
consisting of SEQ ID NO 14, SEQ ID NO: 22, SEQ ID NO: 15, and SEQ ID NO: 27.
25
BRIEF DESCRIPTION OF ACCOMPANYING DRAWINGS
[00011] The following drawings form part of the present specification and are included
to further illustrate embodiments of the present invention. The invention may be better
6
understood by reference to the drawings in combination with the detailed description of
the specific embodiments presented herein.
[00012] Figure 1 shows T-DNA elements of the construct used for transformation
(pC2300ve10518c), in accordance with an embodiment of the present disclosure.
Directional arrows represent the direction of transcription5 .
[00013] Figure 2 shows the location and orientation of primers used to detect the
presence of event CFE-4, and zygosity, in accordance with an embodiment of the
present disclosure. Numbers denote the sequence identification number (SEQ ID NO:).
Lines represent the approximate span of the nucleotide sequence encoded by the
10 corresponding sequence. Uni-directional arrows represent the location and direction of
DNA primers. Adapters used for identification and analysis of transformants are
represented as boxes at each end.
[00014] Figure 3 shows the agarose gel image of the CFE-4 event using CFE-4 event
specific primers, in accordance with an embodiment of the present disclosure.
15
DETAILED DISCRIPTION OF THE INVENTION
[00015] Those skilled in the art will be aware that the invention described herein is
subject to variations and modifications other than those specifically described. It is to be
understood that the invention described herein includes all such variations and
20 modifications. The invention also includes all such steps, features, compositions and
compounds referred to or indicated in this specification, individually or collectively,
and any and all combinations of any or more of such steps or features.
Definitions
[00016] For convenience, before further description of the present invention, certain
25 terms employed in the specification, example and appended claims are collected here.
These definitions should be read in the light of the remainder of the disclosure and
understood as by a person of skill in the art. The terms used herein have the meanings
recognized and known to those of skill in the art, however, for convenience and
completeness, particular terms and their meanings are set forth below.
7
[00017] The articles “a”, “an” and “the” are used to refer to one or to more than one
(i.e., to at least one) of the grammatical object of the article.
[00018] The term “plurality” means more than one.
[00019] The terms “at least two”, “more than one” and “plurality” are used
interchangeably5 .
[00020] The terms “comprise” and “comprising” are used in the inclusive, open sense,
meaning that additional elements may be included. It is not intended to be construed as
“consists of only.
[00021] Throughout this specification, unless the context requires otherwise the word
10 “comprise”, and variations such as “comprises” and “comprising”, will be understood
to imply the inclusion of a stated element or step or group of element or steps but not
the exclusion of any other element or step or group of element or steps. The term
“including” is used to mean “including but not limited to”. “Including” and “including
but not limited to” are used interchangeably.
15 [00022] The term “heterologous Gene/DNA” refers to DNA sequence of foreign origin
inserted into the plant genome.
[00023] A "junction" is where one end of the transgenic DNA has inserted into the host
genomic DNA. A junction spans a portion of the inserted transgenic DNA and the
adjacent flanking cauliflower genomic DNA and as such comprises the connection
20 point of these two as one contiguous sequence. One junction is at the 5' end of the
inserted transgenic DNA and the other one at the 3' end of the inserted transgenic DNA.
A "junction sequence" or "junction region" refers to the DNA sequence and/or
corresponding DNA molecule of the junction.
[00024] A transgenic "event" as described in the present disclosure is produced by
25 transformation of plant cells with heterologous DNA (a nucleic acid construct that
includes a transgene of interest), regeneration of a population of plants resulting from
the insertion of the transgene into the genome of the plant, and selection of a particular
plant characterized by insertion into a particular genome location. The term "event"
refers to the original transformant and progeny of the transformant that include the
8
heterologous DNA. The term "event" also refers to progeny having the heterologous
DNA produced by a sexual cross between the transformant and another variety. Even
after repeated back-crossing to a recurrent parent, the inserted DNA and flanking DNA
from the transformed parent is present in the progeny of the cross at the same
chromosomal location. The term "event" also refers to DNA from the origina5 l
transformant comprising the inserted DNA and flanking genomic sequence immediately
adjacent to the inserted DNA that would be expected to be transferred to a progeny that
receives the inserted as a result of a sexual cross of one parental line that includes the
inserted DNA (e.g., the original transformant and progeny resulting from selfing) and a
10 parental line that does not contain the inserted DNA. The present invention relates to
the event CFE-4 DNA, plant cells, tissues, seeds and commodities derived from event
CFE-4.
[00025] "Primers" are synthesized nucleic acids that anneal to a complementary target
DNA strand by hybridization to form a hybrid between the primer and the target DNA
15 strand, and then extended along the target DNA strand by polymerase activity, e.g., a
DNA polymerase. Primer pairs described in the present invention refer to their use for
amplification of a target nucleic acid sequence, e.g., by polymerase chain reaction or
other conventional nucleic-acid amplification methods.
[00026] Methods for preparing and using probes and primers are described, for
20 example, in Molecular Cloning: A Laboratory Manual, 2nd ed., vol. 1-3, ed. Sambrook
et al., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989
(hereinafter, "Sambrook et al., 1989"); Current Protocols in Molecular Biology, ed.
Ausubel et al., Greene Publishing and Wiley-Interscience, New York, 1992 (with
periodic updates) (hereinafter, "Ausubel et al., 1992"); and Innis et al., PCR Protocols:
25 A Guide to Methods and Applications, Academic Press: San Diego, 1990. PCR-primers
can be derived from a known DNA sequence, for example, by using computer programs
intended for that purpose such as Primer (Version 0.5, © 1991, Whitehead Institute for
Biomedical Research, Cambridge, MA).
9
[00027] Primers based on the flanking DNA and insert sequences disclosed herein can
be used to confirm the disclosed sequences by conventional methods, e.g., by re-cloning
and sequencing such sequences.
[00028] "Amplified DNA" or "amplicon" refers to the product of nucleic acid
amplification of a target nucleic acid sequence that is part of a nucleic acid template5 .
For example, to determine whether the cauliflower plant progeny resulting from a
sexual cross contains the CFE-4 transgenic event, genomic DNA is extracted from a
cauliflower plant tissue sample and may be subjected to nucleic acid amplification
method using a primer pair that includes a primer derived from flanking sequence in the
10 genome of the cauliflower plant and a second primer derived from the inserted
heterologous DNA to produce an amplicon that is diagnostic for the presence of the
CFE-4 event. The amplicon is of a length and sequence that is diagnostic for the event.
[00029] SEQ ID NO: 1. Adapter sequence.
CTAATACGACTCACTATAGGGCTCGAGCGGCCGCCCGGGCAGGT
15 [00030] Second adapter sequence: P-ACCTGCCC-H2N
[00031] SEQ ID NO: 2. SP6 primer used for sequencing.
TATTTAGGTGACACTATAG
[00032] SEQ ID NO: 3. Reverse primer sequence complementary to the inserted
transgene sequence adjacent to the left border of the transgene useful for PCR detection
20 of said transgenic event.
CAGCGCATCGCCTTCTATC
[00033] SEQ ID NO: 4. Forward primer sequence designed from the adapter used for
PCR of adapter ligated genomic DNA of CFE-4 event.
GGATCCTAATACGACTCACTATAGGGC
25 [00034] SEQ ID NO: 5. Reverse primer sequence complementary to the inserted
transgene region adjacent to the left border of the transgene useful for PCR detection of
said transgenic event.
GGTTTCGCTCATGTGTTGAGC
10
[00035] SEQ ID NO: 6. Forward primer sequence designed from the adapter used for
PCR of adapter ligated genomic DNA CFE-4 event.
TATAGGGCTCGAGCGGC
[00036] SEQ ID NO: 7. Amplified DNA fragment sequence using primers with SEQ
ID NO: 5 and SEQ ID NO: 6. This SEQ ID NO: 7 consists of a part of the adapte5 r
sequence followed by cauliflower genomic DNA sequence flanking the left border of
the inserted transgene in event CFE-4, further followed by part of the inserted
transgene.
TATAGGGCTCGAGCGGCCGCCCGGGCAGGTAAAACGAAAAGATACAGAAAATAAA
10 TAAAAAAGGTTGGAGTGATGATGATAAGTCAAAAGTAGCTGGTTTATGATCACATC
TTTCCCGTAGGAAATCAATGGGAATCCGAATGATTTCTTTCATCATCCTTACCAACA
TTTAGCTCCCCTCAATACTTCAAAAACATTCATTCTAATAAACGACTAAGAGAGTA
AAATCACTAACGATATGTGCCTTCTAATGTATCAAAATAAGAATTCCTAAGAGAGA
AATTCAGACAAGAAAATCAATGAAAGACGCGAGATAAGAGCGTTGATGCAAGAAA
15 ACGTTGTTTCATTCTTTGTTGGAAGAGGAGACAAGAGATGTAATAGTATATATATA
CAAATTGACGCTTAGACAACTTAATAACACATTGCGGACGTTTTTAATGTACTGAAT
TAACGCCGAATTAATTCGGGGGATCTGGATTTTAGTACTGGATTTTGGTTTTAGGAA
TTAGAAATTTTATTGATAGAAGTATTTTACAAATACAAATACATACTAAGGGTTTCT
TATATGCTCAACACATGAGCGAAACC
20 [00037] SEQ ID NO: 8. Forward primer sequence designed from cauliflower genomic
DNA adjacent to the left flank border of the inserted transgene in event CFE-4.
GTAGGAAATCAATGGGAATCCGA
[00038] SEQ ID NO: 9. DNA fragment sequence consisting of a part of the adapter
sequence followed by cauliflower genomic sequence flanking the left border of the
25 inserted transgene in event CFE-4, further followed by part of the inserted transgene.
TATAGGGCTCGAGCGGCCGCCCGGGCAGGTAAAACGAAAAGATACAGAAAATAAA
TAAAAAAGGTTGGAGTGATGATGATAAGTCAAAAGTAGCTGGTTTATGATCACATC
TTTCCCGTAGGAAATCAATGGGAATCCGAATGATTTCTTTCATCATCCTTACCAACA
TTTAGCTCCCCTCAATACTTCAAAAACATTCATTCTAATAAACGACTAAGAGAGTA
30 AAATCACTAACGATATGTGCCTTCTAATGTATCAAAATAAGAATTCCTAAGAGAGA
AATTCAGACAAGAAAATCAATGAAAGACGCGAGATAAGAGCGTTGATGCAAGAAA
11
ACGTTGTTTCATTCTTTGTTGGAAGAGGAGACAAGAGATGTAATAGTATATATATA
CAAATTGACGCTTAGACAACTTAATAACACATTGCGGACGTTTTTAATGTACTGAAT
TAACGCCGAATTAATTCGGGGGATCTGGATTTTAGTACTGGATTTTGGTTTTAGGAA
TTAGAAATTTTATTGATAGAAGTATTTTACAAATACAAATACATACTAAGGGTTTCT
TATATGCTCAACACATGAGCGAAACCCTATAGGAACCCTAATTCCCTTATCTGGG5 A
ACTACTCACACATTATTATGGAGAAACTCGAGCTTGTCGATCGACTCTAGCTAGAG
GATCGATCCGAACCCCAGAGTCCCGCTCAGAAGAACTCGTCAAGAAGGCGATAGA
AGGCGATGCGCTGCGAATCGGGAGCGGCGATACCGTAAAGCACGAGGAAGCGGTC
AGCCCATTCGCCGCCAAGCTCTTCAGCAATATCACGGGTAGCCAACGCTATGTCCT
10 GATAGCGGTCCGCCACACCCAGCCGGCCACAGTCGATGAATCCAGAAAAGCGGCC
ATTTTCCACCATGATATTCGGCAAGCAGGCATCGCCATGTGTCACGACGAGATCCT
CGCCGTCGGGCATGCGCGCCTTGAGCCTGGCGAACAGTTCGGCTGGCGCGAGCCCC
TGATGCTCTTCG
[00039] SEQ ID NO: 10. Reverse primer sequence complementary to the inserted
15 transgene region adjacent to the left border of the transgene useful for PCR detection of
said transgenic event.
CAGGACATAGCGTTGGCTACC
[00040] SEQ ID NO: 11. Reverse primer sequence complementary to the inserted
transgene region adjacent to the left border of the transgene useful for PCR detection of
20 said transgenic event.
CGAAGAGCATCAGGGGCTC
[00041] SEQ ID NO: 12. Reverse primer sequence complementary to the cauliflower
plant genomic DNA sequence flanking the right border of the inserted transgene and
used for determining zygosity of the CFE-4 event.
25 GCCCATGAGCCCTCATTAG
[00042] SEQ ID NO: 13. DNA sequence spanning the adapter region followed by
cauliflower genomic DNA region flanking the left border of the inserted transgene,
further followed by inserted transgene sequence ending with start of the cry1Ac gene
sequence.
30 TATAGGGCTCGAGCGGCCGCCCGGGCAGGTAAAACGAAAAGATACAGAAAATAAA
TAAAAAAGGTTGGAGTGATGATGATAAGTCAAAAGTAGCTGGTTTATGATCACATC
12
TTTCCCGTAGGAAATCAATGGGAATCCGAATGATTTCTTTCATCATCCTTACCAACA
TTTAGCTCCCCTCAATACTTCAAAAACATTCATTCTAATAAACGACTAAGAGAGTA
AAATCACTAACGATATGTGCCTTCTAATGTATCAAAATAAGAATTCCTAAGAGAGA
AATTCAGACAAGAAAATCAATGAAAGACGCGAGATAAGAGCGTTGATGCAAGAAA
ACGTTGTTTCATTCTTTGTTGGAAGAGGAGACAAGAGATGTAATAGTATATATAT5 A
CAAATTGACGCTTAGACAACTTAATAACACATTGCGGACGTTTTTAATGTACTGAAT
TAACGCCGAATTAATTCGGGGGATCTGGATTTTAGTACTGGATTTTGGTTTTAGGAA
TTAGAAATTTTATTGATAGAAGTATTTTACAAATACAAATACATACTAAGGGTTTCT
TATATGCTCAACACATGAGCGAAACCCTATAGGAACCCTAATTCCCTTATCTGGGA
10 ACTACTCACACATTATTATGGAGAAACTCGAGCTTGTCGATCGACTCTAGCTAGAG
GATCGATCCGAACCCCAGAGTCCCGCTCAGAAGAACTCGTCAAGAAGGCGATAGA
AGGCGATGCGCTGCGAATCGGGAGCGGCGATACCGTAAAGCACGAGGAAGCGGTC
AGCCCATTCGCCGCCAAGCTCTTCAGCAATATCACGGGTAGCCAACGCTATGTCCT
GATAGCGGTCCGCCACACCCAGCCGGCCACAGTCGATGAATCCAGAAAAGCGGCC
15 ATTTTCCACCATGATATTCGGCAAGCAGGCATCGCCATGTGTCACGACGAGATCCT
CGCCGTCGGGCATGCGCGCCTTGAGCCTGGCGAACAGTTCGGCTGGCGCGAGCCCC
TGATGCTCTTCGTCCAGATCATCCTGATCGACAAGACCGGCTTCCATCCGAGTACGT
GCTCGCTCGATGCGATGTTTCGCTTGGTGGTCGAATGGGCAGGTAGCCGGATCAAG
CGTATGCAGCCGCCGCATTGCATCAGCCATGATGGATACTTTCTCGGCAGGAGCAA
20 GGTGAGATGACAGGAGATCCTGCCCCGGCACTTCGCCCAATAGCAGCCAGTCCCTT
CCCGCTTCAGTGACAACGTCGAGCACAGCTGCGCAAGGAACGCCCGTCGTGGCCAG
CCACGATAGCCGCGCTGCCTCGTCCTGGAGTTCATTCAGGGCACCGGACAGGTCGG
TCTTGACAAAAAGAACCGGGCGCCCCTGCGCTGACAGCCGGAACACGGCGGCATC
AGAGCAGCCGATTGTCTGTTGTGCCCAGTCATAGCCGAATAGCCTCTCCACCCAAG
25 CGGCCGGAGAACCTGCGTGCAATCCATCTTGTTCAATCCCCATGGTCGATCGACAG
ATCTGCGAAAGCTCGAGAGAGATAGATTTGTAGAGAGAGACTGGTGATTTCAGCGT
GTCCTCTCCAAATGAAATGAACTTCCTTATATAGAGGAAGGTCTTGCGAAGGATAG
TGGGATTGTGCGTCATCCCTTACGTCAGTGGAGATATCACATCAATCCACTTGCTTT
GAAGACGTGGTTGGAACGTCTTCTTTTTCCACGATGCTCCTCGTGGGTGGGGGTCCA
30 TCTTTGGGACCACTGTCGGCAGAGGCATCTTGAACGATAGCCTTTCCTTTATCGCAA
TGATGGCATTTGTAGGTGCCACCTTCCTTTTCTACTGTCCTTTTGATGAAGTGACAG
ATAGCTGGGCAATGGAATCCGAGGAGGTTTCCCGATATTACCCTTTGTTGAAAAGT
13
CTCAATAGCCCTTTGGTCTTCTGAGACTGTATCTTTGATATTCTTGGAGTAGACGAG
AGTGTCGTGCTCCACCATGTTATCACATCAATCCACTTGCTTTGAAGACGTGGTTGG
AACGTCTTCTTTTTCCACGATGCTCCTCGTGGGTGGGGGTCCATCTTTGGGACCACT
GTCGGCAGAGGCATCTTGAACGATAGCCTTTCCTTTATCGCAATGATGGCATTTGTA
GGTGCCACCTTCCTTTTCTACTGTCCTTTTGATGAAGTGACAGATAGCTGGGCAAT5 G
GAATCCGAGGAGGTTTCCCGATATTACCCTTTGTTGAAAAGTCTCAATAGCCCTTTG
GTCTTCTGAGACTGTATCTTTGATATTCTTGGAGTAGACGAGAGTGTCGTGCTCCAC
CATGTTGGCAAGCTGCTCTAGCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCC
GATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGC
10 GCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTA
TGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGA
AACAGCTATGACCATGATTACGAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGT
CAACAGAGGTGGATGGACAGACCCGTTCTTACACCGGACTGGGCGCGGGATAGGA
TATTCAGATTGGGATGGGATTGAGCTTAAAGCCGGCGCTGAGACCATGCTCAAGGT
15 AGGCAATGTCCTCAGCGTCGAGCCCGGCATCTATGTCGAGGGCATTGGTGGAGCGC
GCTTCGGGGATACCGTGCTTGTAACTGAGACCGGATATGAGGCCCTCACTCCGCTT
GATCTTGGCAAAGATATTTGACGCATTTATTAGTATGTGTTAATTTTCATTTGCAGT
GCAGTATTTTCTATTCGATCTTTATGTAATTCGTTACAATTAATAAATATTCAAATC
AGATTATTGACTGTCATTTGTATCAAATCGTGTTTAATGGATATTTTTATTATAATAT
20 TGATGATATCTCAATCAAAACGTAGATAATAATAATATTTATTTAATATTTTTGCGT
CGCACAGTGAAAATCTATATGAGATTACAAAATACCGACAACATTATTTAAGATAC
ATAGACATTAACCCTGAGACTGTTGGACATCAACGGGTAGATTCCTTCATGCATAG
CACCTCATTCTTGGGGACAAAAGCACGGTTTGGCCGTTCCATTGCTGCACGAACGA
GCTTTGCTATATCCTCGGGTTGGATCATCTCATCAGGTCCAATCAAATTTGTCCAAG
25 AACTCATGTTAGTCGCAACGAAACCGGGGCATATGTCGACCTGCAGGAATTCAGGC
CTCTAGATCTCATTATTCCTCCATCAAGAGAAGCTCCACGCTGTCCACGATGAAGGT
TCCCTCGGTTTCACCGATCTCGATCCACACTTTGTCGGTCTCAGGAAAGTACTCAAG
CTCCTTGGTAACATAGCCAACTGGAAGTGGTGTGTAGTCCCTGTAACCTCTGTTGAA
CTCGCAAGGGTTCTCACGTCTGCCATCTGTGTAGGATTTCTCCTCGTACACGGAGGC
30 ATAGTCAGCAGGAACGGAAGGAGCTTCGTTGTAACCTCTGTTACGGCTAGTGTAGG
CACCTCCGTACTCTTCCTGATTCACAGTGTAGTCGTTGCAAGTAACGGTGTTGTTGG
GATAGATTTCTTCCTCGACGCAGTTGGAGAACTTAAGCTCGTCGGTGTTGTTCTCGA
14
TCTCGTGGATGGTCACGCAACCCTCACCGTATCCCTCCTTGTAAGCGGTCACACGGA
GAATGTAGCCTCTACCTGGACAGACTCTAACCTCTTGGGACACTTCAGCTTCCCACT
CAGGCACAACCAGGACGGAACGCTGATTGTTCTGTTCCTCCACGTCCACATGACCT
TTCACATTCCAGCAGCTGAGGCCATTGTTGAAGTCACCGTTCTTGATGACGTTTCTG
GCATCGTACAAGGAGAATGCGGTAAAGATACGTCCCTCAAGTTCCTCGAAGATGG5 C
AGCGTTCACACCAGGGATCACGGACAACTCAGGCAAGTAAGCCTCACGAATGCTGT
GCACACGTTTGTCTGCGGCGTGGATCATGGCGATGTTGGTGTCGGCTTGCAACTGAT
CATATTGGGAGTTCACGAACAAAGCATCCACGGACTCTTTGGCCTCCTTGTAAACG
ATGTTAGTTTCCCATTCGAGTTTCTCACGTTTGTCCCTCCACTTCTTCTCTGCTCTCTT
10 CACACGAGCGAGAGCTTCACCGACCAATGGTTTCTCTTCGAGAAACTCAAGGTTGC
CAAGTCTTGCGTGTCCGTCTTGGGTCTTGATCTTGAAGATGACCCAGACTCCGAGGT
CCTCATTCAGGTCAGTACATCCCACATCGATGTCCAAGGAGAAGTGATGAGAATGG
TGGGCACACTTCTCGCCATCCCTGCAGGAGCAGTCCAAGTCAGGATTCCACTCAAG
GTGTGGAGCGCATCTGTTAGGCTCTCCACACTTCCCAATGGGAGATTGGGCAGAAA
15 GTGGCCAGAGGGAACCAGTACCTGGGACATTCACGGTCTCGTGCTTGGCATTGTAC
CTGATCGAGTAGATTTCAAGGTCTTGGCTGTCTTCGATGTAGCCTCTAAGTTGATAC
CTGGTGAAGGCTTTGAGTTTGGACTCATCGATCTTCTGGTACAAGTAGGTAGGGTA
GCACTCGTCGAAAGTTCCGGAGAGGGTGACGTAGTTCTCCTTGAACACATCGTCGC
CTCCTTGGATGGTGATCCCGGTGCTTCCACCCCAACCACGTTCTGGCTGCCTGTTGA
20 TGTCTTTGAAGTTGGAGTCTTGCAAGAGATTCCTCTCGTCGCTGAGACGCTTGGCGT
GTTTAACTTTCTCGGAGAGTTCACGCTTCTCGTCGAGGCAGAACTCATCGCTAAGGT
AGGTGACCAAGTTGGACACTTGGTCAATGTGATAGTCAGTAACGTTAGTTTTCAAG
CCAAGCTGATTGGTGGAGGTAAAGAGGGCGTTCACAGCCTTCTGGGCTCTCTCAAG
GTTGTACTCAGCCTCGAGTGTTGCAGTAACTGGAATGAACTCGAATCTGTCGATAA
25 TCACTCCTGCAGTCCCACTAAAGTTTCTAACACCCACGATGTTACCGAGTGAAGAT
GTAAAAGCATTGGCACTTTCAAAGTAACCGAAATCGCTGGATTGGAGATTATCCAA
GGAGGTAGCTGTAGCTGGAACTGTATTGGAGAAGATGGATGAATTACCCCAATTAA
CGTTGAGGTGAATAGGGGTCACAGAAGCATACCTCACACGAACTCTATATCTGGTA
GATGTGGATGGGAAGTGAATTGGAACTTCAATATACCCTCTATTCTGAATGTTATTT
30 CCACTGCTGTTGAGTCTAACGAGGTCTCCACCAGTGAATCCTGGTCCTGAAATGAC
AGAACCGTTGAAGAGAAAGTTTCCCTTCACTGCAGGGATTTGAGTAATACTATCGG
ATGCGATGATGTTGTTGAACTCAGCACTACGATGTATCCAAGAGAACATAGGAGCT
15
CTGATGATGCTCACGGAACTGTTGCTGAATCCGGAACGGAACATGGACACGTGGCT
CAACCTGTGGGAGAATCCTTGCCTGGGTGGCACATTGTTGTTCTGTGGTGGGATTTC
GTCCAAGGAATCAACGGTTCCGCTCTTTCTGTAAACAGCGGATGGCAAGTTAGAAG
AGGTTCCATAGGCGAACTCTGTTCCGTCAAGAACGGAAAGTTGCTGGTTGTTGATA
CCGATATTGAAGGGTCTTCTGTACAAGGTGGAAGACAAGGTTCTGTAGACACCCT5 G
ACCTAGTTGAGCAACGATACGTTGTTGTGGAGCGGCGTTTCCCATAGTTCCATAGA
GAGGAAAGGTAAACTCGGGCCCGCTGAATCCAACTGGAGAGGCCATGATCTGGTG
TCCAGACCAGTAATACTCTCCTCTGTGAGCATCGGTGTAGATAGTTATGCTGTTCAA
GATGTCCATCAAGTGTGGGCTCCTGATGGAGCCTTCGATACCTTGGGCAGAACCAC
10 GGAAGCTACCGTCGAAGTTCTCAAGAACTGGGTTAGTATAGATTTCTCTGGTAAGT
TGGGACACTGTACGGATAGGGTAGGTTCTGGAGTCATAGTTCGGGAAGAGAGACA
CAATGTCCAAAACTGTGAGGGTCAATTCTCTCCTGAACTGGTTGTATCTAATCCAAT
CTCTAGAATCAGGACCCCAGACACGCTCCAAGCCAGTGTTGTACCAACGAACAGCG
TGGTCGGTGTAGTTTCCAATCAGCCTAGTAAGGTCGTTGTAACGGCTATTGATGGTT
15 GCAGCATCGAATCCCCACCTTTGCCCAAACACGCTAACGTCTCGAAGCACGCTGAG
GTGAAGATTAGCTGCTTGAACGTACACGGACAAGAGAGGAACTTGGTAGTTCTGGA
CTGCGAACAATGGGATAGCTGTGGTCAAGGCGCTGTTCATGTCGTTGAATTGAATA
CGCATTTCCTCGCGGAGAGCTGGGTTAGTAGGATCGGCTTCCCACTCTCTGAAGCTC
TCTGCATAGATTTGGTAGAGATTGCTCAATCCTTCCAACCTAGAGATGGCCTGGTTC
20 CTGGCGAACTCTTCGATCCTCTGGTTGATCAACTGCTCAATTTGCACCAGGAATGCA
TCCCATTGAGATGGACCAAAGATACCCCAGATGATGTCAACTAGTCCGAGAACGAA
CCCAGCACCTGGCACGAACTCGCTGAGCAGAAACTGTGTCAAGGACAAGGAGATG
TCGATGGGAGTGTAACCGGTTTCAATGCGTTCTCCACCAAGTACTTCAACTTCTGGG
TTACTCAAGCAGTTGTATGGAATGCATTCGTTGATGTTTGGGTTGTTGTCCAT
25 [00043] SEQ ID NO: 14. Cauliflower genomic DNA sequence flanking the left border
of the inserted transgene.
AAAACGAAAAGATACAGAAAATAAATAAAAAAGGTTGGAGTGATGATGATAAGTC
AAAAGTAGCTGGTTTATGATCACATCTTTCCCGTAGGAAATCAATGGGAATCCGAA
TGATTTCTTTCATCATCCTTACCAACATTTAGCTCCCCTCAATACTTCAAAAACATTC
30 ATTCTAATAAACGACTAAGAGAGTAAAATCACTAACGATATGTGCCTTCTAATGTA
TCAAAATAAGAATTCCTAAGAGAGAAATTCAGACAAGAAAATCAATGAAAGACGC
16
GAGATAAGAGCGTTGATGCAAGAAAACGTTGTTTCATTCTTTGTTGGAAGAGGAGA
CAAGAGATGTAATAGTATATATAT
[00044] SEQ ID NO: 15. T-DNA sequence starting with cry1Ac gene up to the left
border of the transgene.
ACAAATTGACGCTTAGACAACTTAATAACACATTGCGGACGTTTTTAATGTACTG5 A
ATTAACGCCGAATTAATTCGGGGGATCTGGATTTTAGTACTGGATTTTGGTTTTAGG
AATTAGAAATTTTATTGATAGAAGTATTTTACAAATACAAATACATACTAAGGGTTT
CTTATATGCTCAACACATGAGCGAAACCCTATAGGAACCCTAATTCCCTTATCTGGG
AACTACTCACACATTATTATGGAGAAACTCGAGCTTGTCGATCGACTCTAGCTAGA
10 GGATCGATCCGAACCCCAGAGTCCCGCTCAGAAGAACTCGTCAAGAAGGCGATAG
AAGGCGATGCGCTGCGAATCGGGAGCGGCGATACCGTAAAGCACGAGGAAGCGGT
CAGCCCATTCGCCGCCAAGCTCTTCAGCAATATCACGGGTAGCCAACGCTATGTCC
TGATAGCGGTCCGCCACACCCAGCCGGCCACAGTCGATGAATCCAGAAAAGCGGC
CATTTTCCACCATGATATTCGGCAAGCAGGCATCGCCATGTGTCACGACGAGATCC
15 TCGCCGTCGGGCATGCGCGCCTTGAGCCTGGCGAACAGTTCGGCTGGCGCGAGCCC
CTGATGCTCTTCGTCCAGATCATCCTGATCGACAAGACCGGCTTCCATCCGAGTACG
TGCTCGCTCGATGCGATGTTTCGCTTGGTGGTCGAATGGGCAGGTAGCCGGATCAA
GCGTATGCAGCCGCCGCATTGCATCAGCCATGATGGATACTTTCTCGGCAGGAGCA
AGGTGAGATGACAGGAGATCCTGCCCCGGCACTTCGCCCAATAGCAGCCAGTCCCT
20 TCCCGCTTCAGTGACAACGTCGAGCACAGCTGCGCAAGGAACGCCCGTCGTGGCCA
GCCACGATAGCCGCGCTGCCTCGTCCTGGAGTTCATTCAGGGCACCGGACAGGTCG
GTCTTGACAAAAAGAACCGGGCGCCCCTGCGCTGACAGCCGGAACACGGCGGCAT
CAGAGCAGCCGATTGTCTGTTGTGCCCAGTCATAGCCGAATAGCCTCTCCACCCAA
GCGGCCGGAGAACCTGCGTGCAATCCATCTTGTTCAATCCCCATGGTCGATCGACA
25 GATCTGCGAAAGCTCGAGAGAGATAGATTTGTAGAGAGAGACTGGTGATTTCAGCG
TGTCCTCTCCAAATGAAATGAACTTCCTTATATAGAGGAAGGTCTTGCGAAGGATA
GTGGGATTGTGCGTCATCCCTTACGTCAGTGGAGATATCACATCAATCCACTTGCTT
TGAAGACGTGGTTGGAACGTCTTCTTTTTCCACGATGCTCCTCGTGGGTGGGGGTCC
ATCTTTGGGACCACTGTCGGCAGAGGCATCTTGAACGATAGCCTTTCCTTTATCGCA
30 ATGATGGCATTTGTAGGTGCCACCTTCCTTTTCTACTGTCCTTTTGATGAAGTGACA
GATAGCTGGGCAATGGAATCCGAGGAGGTTTCCCGATATTACCCTTTGTTGAAAAG
TCTCAATAGCCCTTTGGTCTTCTGAGACTGTATCTTTGATATTCTTGGAGTAGACGA
17
GAGTGTCGTGCTCCACCATGTTATCACATCAATCCACTTGCTTTGAAGACGTGGTTG
GAACGTCTTCTTTTTCCACGATGCTCCTCGTGGGTGGGGGTCCATCTTTGGGACCAC
TGTCGGCAGAGGCATCTTGAACGATAGCCTTTCCTTTATCGCAATGATGGCATTTGT
AGGTGCCACCTTCCTTTTCTACTGTCCTTTTGATGAAGTGACAGATAGCTGGGCAAT
GGAATCCGAGGAGGTTTCCCGATATTACCCTTTGTTGAAAAGTCTCAATAGCCCTT5 T
GGTCTTCTGAGACTGTATCTTTGATATTCTTGGAGTAGACGAGAGTGTCGTGCTCCA
CCATGTTGGCAAGCTGCTCTAGCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGC
CGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAG
CGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTT
10 ATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGG
AAACAGCTATGACCATGATTACGAATTCGAGCTCGGTACCCGGGGATCCTCTAGAG
TCAACAGAGGTGGATGGACAGACCCGTTCTTACACCGGACTGGGCGCGGGATAGG
ATATTCAGATTGGGATGGGATTGAGCTTAAAGCCGGCGCTGAGACCATGCTCAAGG
TAGGCAATGTCCTCAGCGTCGAGCCCGGCATCTATGTCGAGGGCATTGGTGGAGCG
15 CGCTTCGGGGATACCGTGCTTGTAACTGAGACCGGATATGAGGCCCTCACTCCGCT
TGATCTTGGCAAAGATATTTGACGCATTTATTAGTATGTGTTAATTTTCATTTGCAG
TGCAGTATTTTCTATTCGATCTTTATGTAATTCGTTACAATTAATAAATATTCAAATC
AGATTATTGACTGTCATTTGTATCAAATCGTGTTTAATGGATATTTTTATTATAATAT
TGATGATATCTCAATCAAAACGTAGATAATAATAATATTTATTTAATATTTTTGCGT
20 CGCACAGTGAAAATCTATATGAGATTACAAAATACCGACAACATTATTTAAGATAC
ATAGACATTAACCCTGAGACTGTTGGACATCAACGGGTAGATTCCTTCATGCATAG
CACCTCATTCTTGGGGACAAAAGCACGGTTTGGCCGTTCCATTGCTGCACGAACGA
GCTTTGCTATATCCTCGGGTTGGATCATCTCATCAGGTCCAATCAAATTTGTCCAAG
AACTCATGTTAGTCGCAACGAAACCGGGGCATATGTCGACCTGCAGGAATTCAGGC
25 CTCTAGATCTCATTATTCCTCCATCAAGAGAAGCTCCACGCTGTCCACGATGAAGGT
TCCCTCGGTTTCACCGATCTCGATCCACACTTTGTCGGTCTCAGGAAAGTACTCAAG
CTCCTTGGTAACATAGCCAACTGGAAGTGGTGTGTAGTCCCTGTAACCTCTGTTGAA
CTCGCAAGGGTTCTCACGTCTGCCATCTGTGTAGGATTTCTCCTCGTACACGGAGGC
ATAGTCAGCAGGAACGGAAGGAGCTTCGTTGTAACCTCTGTTACGGCTAGTGTAGG
30 CACCTCCGTACTCTTCCTGATTCACAGTGTAGTCGTTGCAAGTAACGGTGTTGTTGG
GATAGATTTCTTCCTCGACGCAGTTGGAGAACTTAAGCTCGTCGGTGTTGTTCTCGA
TCTCGTGGATGGTCACGCAACCCTCACCGTATCCCTCCTTGTAAGCGGTCACACGGA
18
GAATGTAGCCTCTACCTGGACAGACTCTAACCTCTTGGGACACTTCAGCTTCCCACT
CAGGCACAACCAGGACGGAACGCTGATTGTTCTGTTCCTCCACGTCCACATGACCT
TTCACATTCCAGCAGCTGAGGCCATTGTTGAAGTCACCGTTCTTGATGACGTTTCTG
GCATCGTACAAGGAGAATGCGGTAAAGATACGTCCCTCAAGTTCCTCGAAGATGGC
AGCGTTCACACCAGGGATCACGGACAACTCAGGCAAGTAAGCCTCACGAATGCTG5 T
GCACACGTTTGTCTGCGGCGTGGATCATGGCGATGTTGGTGTCGGCTTGCAACTGAT
CATATTGGGAGTTCACGAACAAAGCATCCACGGACTCTTTGGCCTCCTTGTAAACG
ATGTTAGTTTCCCATTCGAGTTTCTCACGTTTGTCCCTCCACTTCTTCTCTGCTCTCTT
CACACGAGCGAGAGCTTCACCGACCAATGGTTTCTCTTCGAGAAACTCAAGGTTGC
10 CAAGTCTTGCGTGTCCGTCTTGGGTCTTGATCTTGAAGATGACCCAGACTCCGAGGT
CCTCATTCAGGTCAGTACATCCCACATCGATGTCCAAGGAGAAGTGATGAGAATGG
TGGGCACACTTCTCGCCATCCCTGCAGGAGCAGTCCAAGTCAGGATTCCACTCAAG
GTGTGGAGCGCATCTGTTAGGCTCTCCACACTTCCCAATGGGAGATTGGGCAGAAA
GTGGCCAGAGGGAACCAGTACCTGGGACATTCACGGTCTCGTGCTTGGCATTGTAC
15 CTGATCGAGTAGATTTCAAGGTCTTGGCTGTCTTCGATGTAGCCTCTAAGTTGATAC
CTGGTGAAGGCTTTGAGTTTGGACTCATCGATCTTCTGGTACAAGTAGGTAGGGTA
GCACTCGTCGAAAGTTCCGGAGAGGGTGACGTAGTTCTCCTTGAACACATCGTCGC
CTCCTTGGATGGTGATCCCGGTGCTTCCACCCCAACCACGTTCTGGCTGCCTGTTGA
TGTCTTTGAAGTTGGAGTCTTGCAAGAGATTCCTCTCGTCGCTGAGACGCTTGGCGT
20 GTTTAACTTTCTCGGAGAGTTCACGCTTCTCGTCGAGGCAGAACTCATCGCTAAGGT
AGGTGACCAAGTTGGACACTTGGTCAATGTGATAGTCAGTAACGTTAGTTTTCAAG
CCAAGCTGATTGGTGGAGGTAAAGAGGGCGTTCACAGCCTTCTGGGCTCTCTCAAG
GTTGTACTCAGCCTCGAGTGTTGCAGTAACTGGAATGAACTCGAATCTGTCGATAA
TCACTCCTGCAGTCCCACTAAAGTTTCTAACACCCACGATGTTACCGAGTGAAGAT
25 GTAAAAGCATTGGCACTTTCAAAGTAACCGAAATCGCTGGATTGGAGATTATCCAA
GGAGGTAGCTGTAGCTGGAACTGTATTGGAGAAGATGGATGAATTACCCCAATTAA
CGTTGAGGTGAATAGGGGTCACAGAAGCATACCTCACACGAACTCTATATCTGGTA
GATGTGGATGGGAAGTGAATTGGAACTTCAATATACCCTCTATTCTGAATGTTATTT
CCACTGCTGTTGAGTCTAACGAGGTCTCCACCAGTGAATCCTGGTCCTGAAATGAC
30 AGAACCGTTGAAGAGAAAGTTTCCCTTCACTGCAGGGATTTGAGTAATACTATCGG
ATGCGATGATGTTGTTGAACTCAGCACTACGATGTATCCAAGAGAACATAGGAGCT
CTGATGATGCTCACGGAACTGTTGCTGAATCCGGAACGGAACATGGACACGTGGCT
19
CAACCTGTGGGAGAATCCTTGCCTGGGTGGCACATTGTTGTTCTGTGGTGGGATTTC
GTCCAAGGAATCAACGGTTCCGCTCTTTCTGTAAACAGCGGATGGCAAGTTAGAAG
AGGTTCCATAGGCGAACTCTGTTCCGTCAAGAACGGAAAGTTGCTGGTTGTTGATA
CCGATATTGAAGGGTCTTCTGTACAAGGTGGAAGACAAGGTTCTGTAGACACCCTG
ACCTAGTTGAGCAACGATACGTTGTTGTGGAGCGGCGTTTCCCATAGTTCCATAG5 A
GAGGAAAGGTAAACTCGGGCCCGCTGAATCCAACTGGAGAGGCCATGATCTGGTG
TCCAGACCAGTAATACTCTCCTCTGTGAGCATCGGTGTAGATAGTTATGCTGTTCAA
GATGTCCATCAAGTGTGGGCTCCTGATGGAGCCTTCGATACCTTGGGCAGAACCAC
GGAAGCTACCGTCGAAGTTCTCAAGAACTGGGTTAGTATAGATTTCTCTGGTAAGT
10 TGGGACACTGTACGGATAGGGTAGGTTCTGGAGTCATAGTTCGGGAAGAGAGACA
CAATGTCCAAAACTGTGAGGGTCAATTCTCTCCTGAACTGGTTGTATCTAATCCAAT
CTCTAGAATCAGGACCCCAGACACGCTCCAAGCCAGTGTTGTACCAACGAACAGCG
TGGTCGGTGTAGTTTCCAATCAGCCTAGTAAGGTCGTTGTAACGGCTATTGATGGTT
GCAGCATCGAATCCCCACCTTTGCCCAAACACGCTAACGTCTCGAAGCACGCTGAG
15 GTGAAGATTAGCTGCTTGAACGTACACGGACAAGAGAGGAACTTGGTAGTTCTGGA
CTGCGAACAATGGGATAGCTGTGGTCAAGGCGCTGTTCATGTCGTTGAATTGAATA
CGCATTTCCTCGCGGAGAGCTGGGTTAGTAGGATCGGCTTCCCACTCTCTGAAGCTC
TCTGCATAGATTTGGTAGAGATTGCTCAATCCTTCCAACCTAGAGATGGCCTGGTTC
CTGGCGAACTCTTCGATCCTCTGGTTGATCAACTGCTCAATTTGCACCAGGAATGCA
20 TCCCATTGAGATGGACCAAAGATACCCCAGATGATGTCAACTAGTCCGAGAACGAA
CCCAGCACCTGGCACGAACTCGCTGAGCAGAAACTGTGTCAAGGACAAGGAGATG
TCGATGGGAGTGTAACCGGTTTCAATGCGTTCTCCACCAAGTACTTCAACTTCTGGG
TTACTCAAGCAGTTGTATGGAATGCATTCGTTGATGTTTGGGTTGTTGTCCAT
[00045] SEQ ID NO: 16. DNA sequence of the left junction.
25 GATGTAATAGTATATATATACAAATTGACGCTTAGAC
[00046] SEQ ID NO: 17. DNA sequence of the left junction.
GAGGAGACAAGAGATGTAATAGTATATATATACAAATTGACGCTTAGACAACTTAA
TAACAC
[00047] SEQ ID NO: 18. DNA sequence of the left junction.
20
GATGCAAGAAAACGTTGTTTCATTCTTTGTTGGAAGAGGAGACAAGAGATGTAATA
GTATATATATACAAATTGACGCTTAGACAACTTAATAACACATTGCGGACGTTTTTA
ATGTACTGAATTAACGCC
[00048] SEQ ID NO: 19. DNA sequence of the amplicon generated using forward
primer of SEQ ID NO: 8 and reverse primer of SEQ ID NO: 105 .
GTAGGAAATCAATGGGAATCCGAATGATTTCTTTCATCATCCTTACCAACATTTAGC
TCCCCTCAATACTTCAAAAACATTCATTCTAATAAACGACTAAGAGAGTAAAATCA
CTAACGATATGTGCCTTCTAATGTATCAAAATAAGAATTCCTAAGAGAGAAATTCA
GACAAGAAAATCAATGAAAGACGCGAGATAAGAGCGTTGATGCAAGAAAACGTTG
10 TTTCATTCTTTGTTGGAAGAGGAGACAAGAGATGTAATAGTATATATATACAAATT
GACGCTTAGACAACTTAATAACACATTGCGGACGTTTTTAATGTACTGAATTAACG
CCGAATTAATTCGGGGGATCTGGATTTTAGTACTGGATTTTGGTTTTAGGAATTAGA
AATTTTATTGATAGAAGTATTTTACAAATACAAATACATACTAAGGGTTTCTTATAT
GCTCAACACATGAGCGAAACCCTATAGGAACCCTAATTCCCTTATCTGGGAACTAC
15 TCACACATTATTATGGAGAAACTCGAGCTTGTCGATCGACTCTAGCTAGAGGATCG
ATCCGAACCCCAGAGTCCCGCTCAGAAGAACTCGTCAAGAAGGCGATAGAAGGCG
ATGCGCTGCGAATCGGGAGCGGCGATACCGTAAAGCACGAGGAAGCGGTCAGCCC
ATTCGCCGCCAAGCTCTTCAGCAATATCACGGGTAGCCAACGCTATGTCCTG
[00049] SEQ ID NO: 20. DNA sequence of the amplicon generated using forward
20 primer of SEQ ID NO: 8 and reverse primer of SEQ ID NO: 11.
GTAGGAAATCAATGGGAATCCGAATGATTTCTTTCATCATCCTTACCAACATTTAGC
TCCCCTCAATACTTCAAAAACATTCATTCTAATAAACGACTAAGAGAGTAAAATCA
CTAACGATATGTGCCTTCTAATGTATCAAAATAAGAATTCCTAAGAGAGAAATTCA
GACAAGAAAATCAATGAAAGACGCGAGATAAGAGCGTTGATGCAAGAAAACGTTG
25 TTTCATTCTTTGTTGGAAGAGGAGACAAGAGATGTAATAGTATATATATACAAATT
GACGCTTAGACAACTTAATAACACATTGCGGACGTTTTTAATGTACTGAATTAACG
CCGAATTAATTCGGGGGATCTGGATTTTAGTACTGGATTTTGGTTTTAGGAATTAGA
AATTTTATTGATAGAAGTATTTTACAAATACAAATACATACTAAGGGTTTCTTATAT
GCTCAACACATGAGCGAAACCCTATAGGAACCCTAATTCCCTTATCTGGGAACTAC
30 TCACACATTATTATGGAGAAACTCGAGCTTGTCGATCGACTCTAGCTAGAGGATCG
ATCCGAACCCCAGAGTCCCGCTCAGAAGAACTCGTCAAGAAGGCGATAGAAGGCG
21
ATGCGCTGCGAATCGGGAGCGGCGATACCGTAAAGCACGAGGAAGCGGTCAGCCC
ATTCGCCGCCAAGCTCTTCAGCAATATCACGGGTAGCCAACGCTATGTCCTGATAG
CGGTCCGCCACACCCAGCCGGCCACAGTCGATGAATCCAGAAAAGCGGCCATTTTC
CACCATGATATTCGGCAAGCAGGCATCGCCATGTGTCACGACGAGATCCTCGCCGT
CGGGCATGCGCGCCTTGAGCCTGGCGAACAGTTCGGCTGGCGCGAGCCCCTGATG5 C
TCTTCG
[00050] SEQ ID NO: 21. DNA sequence of the amplicon generated using forward
primer of SEQ ID NO: 8 and reverse primer of SEQ ID NO: 5.
GTAGGAAATCAATGGGAATCCGAATGATTTCTTTCATCATCCTTACCAACATTTAGC
10 TCCCCTCAATACTTCAAAAACATTCATTCTAATAAACGACTAAGAGAGTAAAATCA
CTAACGATATGTGCCTTCTAATGTATCAAAATAAGAATTCCTAAGAGAGAAATTCA
GACAAGAAAATCAATGAAAGACGCGAGATAAGAGCGTTGATGCAAGAAAACGTTG
TTTCATTCTTTGTTGGAAGAGGAGACAAGAGATGTAATAGTATATATATACAAATT
GACGCTTAGACAACTTAATAACACATTGCGGACGTTTTTAATGTACTGAATTAACG
15 CCGAATTAATTCGGGGGATCTGGATTTTAGTACTGGATTTTGGTTTTAGGAATTAGA
AATTTTATTGATAGAAGTATTTTACAAATACAAATACATACTAAGGGTTTCTTATAT
GCTCAACACATGAGCGAAACC
[00051] SEQ ID NO: 22. T-DNA internal complementary sequence comprising SEQ
ID NO: 5, 3, 10 and 11.
20 ACAAATTGACGCTTAGACAACTTAATAACACATTGCGGACGTTTTTAATGTACTGA
ATTAACGCCGAATTAATTCGGGGGATCTGGATTTTAGTACTGGATTTTGGTTTTAGG
AATTAGAAATTTTATTGATAGAAGTATTTTACAAATACAAATACATACTAAGGGTTT
CTTATATGCTCAACACATGAGCGAAACCCTATAGGAACCCTAATTCCCTTATCTGGG
AACTACTCACACATTATTATGGAGAAACTCGAGCTTGTCGATCGACTCTAGCTAGA
25 GGATCGATCCGAACCCCAGAGTCCCGCTCAGAAGAACTCGTCAAGAAGGCGATAG
AAGGCGATGCGCTGCGAATCGGGAGCGGCGATACCGTAAAGCACGAGGAAGCGGT
CAGCCCATTCGCCGCCAAGCTCTTCAGCAATATCACGGGTAGCCAACGCTATGTCC
TGATAGCGGTCCGCCACACCCAGCCGGCCACAGTCGATGAATCCAGAAAAGCGGC
CATTTTCCACCATGATATTCGGCAAGCAGGCATCGCCATGTGTCACGACGAGATCC
30 TCGCCGTCGGGCATGCGCGCCTTGAGCCTGGCGAACAGTTCGGCTGGCGCGAGCCC
CTGATGCTCTTCGTCCAGATCATCCTGATCGACA
22
[00052] SEQ ID NO: 23. Forward primer sequence in the cauliflower genomic region
adjacent to the left border of the inserted transgene useful for detection of transgenic
cauliflower event CFE-4.
CATCATCCTTACCAACATTTA
[00053] SEQ ID NO: 24. Forward primer sequence in the cauliflower genomic regio5 n
adjacent to the left border of the inserted transgene useful for detection of transgenic
cauliflower event CFE-4.
GTAGCTGGTTTATGACACATC
[00054] SEQ ID NO: 25. Forward primer sequence within the T-DNA region adjacent
10 to the right border of the inserted transgene useful for detection of the transgenic
cauliflower event CFE-4.
CCAACAGTTGCGCAGCCTGAATG
[00055] SEQ ID NO: 26. Reverse primer sequence complementary to the cauliflower
plant genomic DNA sequence flanking the right border region of T-DNA of the inserted
15 transgene and used for determining zygosity of the CFE-4 event.
CGTTCCGGAAGTAGACCAATC
[00056] SEQ ID NO: 27. DNA sequence of the amplicon generated using forward
primer of SEQ ID NO: 25 and reverse primer of SEQ ID NO: 26.
CGTTCCGGAAGTAGACCAATCGACCAAACTGATGGCCCATGAAGAAAAGGT
20 CCAGGCTATAAACTAGTGACCACATAGATAGCCCATGAGCCCTCATTAGGG
TCAAACACTGATAGTTTAAACTGAAGGCGGGAAACGACAATCTGATCCAAG
CTCAAGCTGCTCTAGCATTCGCCATTCAGGCTGCGCAACTGTTGG
[00057] In an embodiment of the present disclosure, there is provided a method of
detecting transgenic cauliflower event CFE-4 in a biological sample, said method
25 comprising of (a) obtaining a biological sample comprising of cauliflower DNA; (b)
contacting said biological sample with a first DNA primer and a second DNA primer;
(c) performing a DNA amplification reaction to produce a DNA amplicon molecule;
and (d) detecting the presence of said DNA amplicon molecule, wherein the detection
of presence of said DNA amplicon molecule is diagnostic for said CFE-4 event.
23
[00058] In an embodiment of the present disclosure, there is provided a method of
detecting transgenic cauliflower event CFE-4 as described herein, wherein the first
DNA primer is selected from the group consisting of SEQ ID NO: 8, SEQ ID NO: 23,
SEQ ID NO: 24, and SEQ ID NO: 26, and wherein the second DNA primer is selected
from the group consisting of SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 10, SEQ I5 D
NO: 11, and SEQ ID NO: 25.
[00059] In an embodiment of the present disclosure, there is provided a method of
detection of transgenic cauliflower event CFE-4 as described herein, wherein said DNA
amplicon comprises of at least 50 contiguous nucleotides selected from the group of
10 sequences consisting of SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID
NO: 27, and complements thereof.
[00060] In an embodiment of the present disclosure, there is provided a method of
determining the zygosity of DNA of a transgenic cauliflower plant comprising of event
CFE-4, said method comprising of (a) obtaining a biological sample comprising of
15 cauliflower DNA; (b) contacting said biological sample with a first DNA primer, a
second DNA primer, and a third DNA primer, (c) performing a DNA amplification
reaction to produce a DNA amplicon molecule; and (d) detecting the presence of said
DNA amplicon molecule, wherein detection of presence of more than one DNA
amplicon having different nucleotide sequences is indicative of heterozygosity of the
20 transgenic cauliflower event CFE-4, while detection of presence of one or more DNA
amplicon with identical nucleotide sequence is indicative of homozygosity of the
transgenic event CFE-4.
[00061] In an embodiment of the present disclosure, there is provided a method of
determining the zygosity of DNA of a transgenic cauliflower plant comprising of event
25 CFE-4 as described herein, wherein the first DNA primer is selected from the group
consisting of SEQ ID NO: 8, SEQ ID NO: 23, SEQ ID NO: 24, and SEQ ID NO: 26.
[00062] In an embodiment of the present disclosure, there is provided a method of
determining the zygosity of DNA of a transgenic cauliflower plant comprising of event
CFE-4 as described herein, wherein the second DNA primer is selected from the group
24
consisting of SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 10, SEQ ID NO: 11, and
SEQ ID NO: 25.
[00063] In an embodiment of the present disclosure, there is provided a method of
determining the zygosity of DNA of a transgenic cauliflower plant comprising of event
CFE-4 as described herein, wherein the third DNA primer is selected from the grou5 p
consisting of SEQ ID NO: 8, SEQ ID NO: 23, SEQ ID NO: 24, and SEQ ID NO: 26.
[00064] In an embodiment of the present disclosure, there are provided synthetic DNA
molecules comprising of any of the DNA amplicons obtained from the method of
detection of transgenic cauliflower event CFE-4 as described herein.
10 [00065] In an embodiment of the present disclosure, there is provided a kit for
detection of transgenic cauliflower event CFE-4 comprising of forward and reverse
primers having at least 10 contiguous nucleotides selected from the group of sequences
consisting of SEQ ID NO: 14, SEQ ID NO: 22, SEQ ID NO: 15, and SEQ ID NO: 27.
[00066] The present disclosure provides a transgenic cauliflower plant comprising an
15 event designated as CFE-4, progeny of the plant, and cells of the plant, as well as seeds
produced from the plant. Representative seed for growing the plant, for producing
progeny, for obtaining cells, or for producing a crop of said seed comprising the
transgenic event have been deposited with the National Collection of Industrial, Food
and Marine Bacteria (NCIMB) on February 08, 2011 and has the accession number
20 NCIMB 41809.
[00067] The present disclosure relates to transformation of cauliflower plant with the
cry1Ac gene for conferring lepidopteron resistance. The invention pertains to
transforming cauliflower plants with the plant expression vector pC2300ve10518 by
Agrobacterium-mediated transformation method. Events having a single copy insert
25 were identified and bioassay were performed for the identification of a transgenic line,
namely cauliflower event CFE-4. After selection of said transgenic event, the plant
sequences flanking the inserted heterologous region were obtained using PCR walking
and characterized. The sequence analysis of the plant region flanking the T-DNA
heterologous region revealed the sequence of the junction sequence specific for the
25
event. Further, primers were designed for the amplification of the junction sequence
characteristic for the transgenic cauliflower event CFE-4.
[00068] The transgenic cauliflower plants were produced by an Agrobacteriummediated
transformation of a cauliflower line (Brassica oleracea var. botrytis) with the
plasmid construct comprising of cry1Ac and nptII genes in the T-DNA. The plasmi5 d
construct pC2300ve10518 contains plant expression cassettes with the genetic
regulatory elements necessary for expression of the cry1Ac gene in cauliflower plant
cells wherein the cry1Ac gene expression is driven by the e35S Cauliflower Mosaic
Virus promoter. Transgenic cauliflower cells were regenerated into cauliflower plants
10 expressing the cry1Ac gene. Multiple independent events were generated using the same
gene construct. Transgenic cauliflower plants were obtained which were hardened and
grown in a green house. Each of these transgenic insertions in the individual transgenic
plants can be considered as distinct events since the insertion of the heterologous DNA
is likely in different locations and copy numbers within the plant genome. The
15 transgenic plants were characterized for the presence of single or multiple transgene
insertions in the heterologous DNA in the plant genome. Transgenic plants having
single transgene inserts were identified. Individual transgenic cauliflower events
(plants) were selected based on insect bioassays, and resistance to lepidopteran insect
infestation. Plants from insect-resistant events expressing Cry1Ac protein were selected
20 for further analysis. A number of transgenic cauliflower plants expressing Cry1Ac
protein were confirmed using ELISA method. ELISA positive lines were subjected to
the insect bio-assays using DBM larvae. Based on the ELISA and bioassay analysis, a
transgenic cauliflower event was identified having high expression of the Cry1Ac
protein and showing resistance to insects. This event was named as CFE-4 which was
25 further used for the molecular characterization of the junction sequence characteristic
for the event.
[00069] In an embodiment of the present disclosure, the portion of the
pC2300ve10518 plasmid DNA inserted in to the cauliflower genome, giving rise to the
transgenic cauliflower plant event CFE-4, consists of the left and right border segments
26
and the plant expression cassettes (encoding cry1Ac, and nptII) was characterized by
detailed molecular analysis.
[00070] Nucleic acid amplification can be accomplished by any one of the various
nucleic acid amplification methods known in the art, including the polymerase chain
reaction (PCR). A variety of amplification methods are known in the art and ar5 e
described in PCR protocols: ( Innis et al., Academic Press, San Diego, CA, USA, 1990.
[00071] In an embodiment of the present disclosure, backcrossing was performed to
move a transgene from a donor parent (transformed cauliflower plant containing CFE-4
event) to a recurrent parent (a desired cauliflower line). The backcross method was used
10 for transferring the CFE-4 event into other lines/hybrids of cauliflower. The progeny of
this cross, which had the CFE-4 event, was then back-crossed repeatedly to the
recurrent parent line to obtain a stable line with desired properties of the recurrent
parent and the CFE-4 event.
[00072] In an embodiment of the present disclosure, four ELISA positive primary
15 transformants that express the cry1Ac gene were regenerated. Out of the four lines,
Mendelian segregation pattern i.e. 3:1 ratio of the transgene (cry1Ac gene) inheritance
in two lines (T1 generation seedlings) indicated that integration of the cry1Ac gene was
confined to a single locus in the genome.
[00073] In an embodiment of the present disclosure, leaves of the transgenic
20 cauliflower, harbouring event CFE-4, expressing the cry1Ac gene showed 100% larval
mortality in insect bioassays using target pest whereas no larval mortality observed in
bioassays using leaves from non-transgenic cauliflower leaf not having event CFE-4.
[00074] In an embodiment of the present disclosure, bioassays using target pets were
carried out using leaves from transgenic cauliflower, harbouring events independent
25 from event CFE-4.
[00075] In an embodiment of the present disclosure, representative seed for growing
the plant, for producing progeny, for obtaining cells, or for producing a crop of said
seed comprising the transgenic event have been deposited with NCIMB on February
08, 2011 having accession number NCIMB 41809.
27
[00076] An embodiment of the present disclosure is to provide a method for
detecting the presence of a cauliflower event CFE-4 or a progeny thereof in a biological
sample, the method comprises: obtaining a biological sample comprising of cauliflower
DNA; contacting the biological sample with a first DNA primer and a second DNA
primer wherein first DNA primer recognizes a sequence within SEQ ID NO: 14 and 5 a
second DNA primer, which recognizes a sequence within SEQ ID NO: 15 or SEQ ID
NO: 22; performing a DNA amplification reaction to produce a DNA amplicon
molecule; detecting said DNA amplicon molecule; wherein the detection of said
amplicon is diagnostic for said CFE-4 event in the sample.
10 [00077] Another embodiment of the disclosure provides a method for detecting the
presence of a cauliflower event CFE-4 or a progeny thereof in a biological sample, the
method comprises: obtaining a biological sample comprising of cauliflower DNA;
contacting the biological sample with a first DNA primer and a second DNA primer,
wherein the first DNA primer is selected from the group consisting of SEQ ID NO: 23,
15 SEQ ID NO: 8, SEQ ID NO: 24, and SEQ ID NO:26 and a second DNA primer
selected from the group consisting of SEQ ID NO: 5, SEQ ID NO: 3, SEQ ID NO: 10,
SEQ ID NO: 11, and SEQ ID NO: 25 ; performing a DNA amplification reaction to
produce a DNA amplicon molecule; detecting said DNA amplicon molecule; wherein
the detection of said amplicon is diagnostic for said CFE-4 event in the sample.
20 [00078] Yet another embodiment of the disclosure provides a method for detecting the
presence of a cauliflower event CFE-4 or a progeny thereof in a biological sample, the
method comprises: obtaining a biological sample comprising of cauliflower DNA;
contacting the biological sample with a first DNA primer of SEQ ID NO: 8 and a
second DNA primer of SEQ ID NO: 5; performing a DNA amplification reaction to
25 produce a DNA amplicon molecule; detecting said DNA amplicon molecule; wherein
the detection of said amplicon of size 471bp is diagnostic for event CFE-4 in the
sample. The nucleotide sequence of the 471bp DNA amplicon molecule is as set forth
in SEQ ID NO: 21 or its complement.
28
[00079] In still another embodiment the present disclosure provides a method for
detecting the presence of a cauliflower event CFE-4 or a progeny thereof in a biological
sample, the method comprising: obtaining a biological sample comprising of
cauliflower DNA; contacting the biological sample with a first DNA primer of SEQ ID
NO: 8 and a second DNA primer of SEQ ID NO: 10; performing a DNA amplificatio5 n
reaction to produce a DNA amplicon molecule; detecting said DNA amplicon molecule;
wherein the detection of said amplicon of size 724bp is diagnostic for event CFE-4 in a
said sample. The nucleotide sequence of the 724bp DNA amplicon molecule is as set
forth in SEQ ID NO: 19 or its complement.
10 [00080] In still another embodiment, the disclosure provides a method for detecting
the presence of a cauliflower event CFE-4 or a progeny thereof in a biological sample,
the method comprising: obtaining a biological sample comprising of cauliflower DNA;
contacting the biological sample with a first DNA primer of SEQ ID NO: 8 and a
second DNA primer of SEQ ID NO: 11; performing a DNA amplification reaction to
15 produce a DNA amplicon molecule; detecting said DNA amplicon molecule; wherein
the detection of said amplicon of size 902bp is diagnostic for event CFE-4 in a said
sample. The nucleotide sequence of the 902bp DNA amplicon molecule is as set forth
in SEQ ID NO: 20 or its complement.
[00081] In an embodiment of the present disclosure, there is provided a method for
20 detecting the presence of a cauliflower event CFE-4 or a progeny thereof in a biological
sample, the method comprising: obtaining a biological sample comprising of
cauliflower DNA; contacting the biological sample with a first DNA primer of SEQ ID
NO: 25 and a second DNA primer of SEQ ID NO: 26; performing a DNA amplification
reaction to produce a DNA amplicon molecule; detecting said DNA amplicon molecule;
25 wherein the detection of said amplicon of size 198bp is diagnostic for event CFE-4 in a
said sample. The nucleotide sequence of the 198bp DNA amplicon molecule is as set
forth in SEQ IDNO: 27 or its complement.
[00082] Another embodiment of the disclosure provides a method for determining the
zygosity of a cauliflower plant comprising cauliflower event CFE-4 DNA in a
29
biological sample, the method comprising: obtaining a sample of cauliflower DNA;
contacting the sample having cauliflower DNA with a first DNA primer of SEQ ID NO:
8, a second DNA primer of SEQ ID NO: 5 and a third DNA primer of SEQ ID NO: 12 ;
performing a DNA amplification reaction to produce a DNA amplicon molecule;
detecting said DNA amplicon molecule; wherein the detection of two different DN5 A
amplicon molecules of sizes 471bp and 326bp indicates heterozygosity of the
cauliflower event CFE-4. Detection of only a DNA amplicon molecule of 471bp
indicates homozygosity of the CFE-4 event.
[00083] Another embodiment of the disclosure provides a method for determining the
10 zygosity of a cauliflower plant comprising cauliflower event CFE-4 DNA in a
biological sample, the method comprising: obtaining a sample of cauliflower DNA;
contacting the sample having cauliflower DNA with a first DNA primer of SEQ ID NO:
8, a second DNA primer of SEQ ID NO: 5 and a third DNA primer of SEQ ID NO: 26;
performing a DNA amplification reaction to produce a DNA amplicon molecule;
15 detecting said DNA amplicon molecule; wherein the detection of two different DNA
amplicon molecules of sizes 471bp and 407 indicates heterozygosity of the cauliflower
event CFE-4. Detection of only a DNA amplicon molecule of 471bp indicates
homozygosity of the CFE-4 event.
[00084] Yet another embodiment of the disclosure provides a method for determining
20 the zygosity of a cauliflower plant comprising cauliflower event CFE-4 DNA in a
biological sample, the method comprising: obtaining a sample of cauliflower DNA;
contacting the sample having cauliflower DNA with a first DNA primer of SEQ ID NO:
8, a second DNA primer of SEQ ID NO: 10 and a third DNA primer of SEQ ID NO:
12; performing a DNA amplification reaction to produce a DNA amplicon molecule;
25 detecting the said DNA amplicon molecule; wherein the presence of two different DNA
amplicon molecules of sizes 724bp and 326bp indicates heterozygosity of the
cauliflower event CFE-4. Detection of a single DNA amplicon molecule of 724bp
indicates homozygosity of the CFE-4 event.
30
[00085] Another embodiment of the disclosure provides a method for determining the
zygosity of a cauliflower plant comprising cauliflower event CFE-4 DNA in a
biological sample, the method comprising: obtaining a sample of cauliflower DNA;
contacting the sample having cauliflower DNA with a first DNA primer of SEQ ID NO:
8, a second DNA primer of SEQ ID NO: 10 and a third DNA primer of SEQ ID NO5 :
26; performing a DNA amplification reaction to produce a DNA amplicon molecule;
detecting said DNA amplicon molecule; wherein the detection of two different DNA
amplicon molecules of sizes 724bp and 407 indicates heterozygosity of the cauliflower
event CFE-4. Detection of only a DNA amplicon molecule of 724bp indicates
10 homozygosity of the CFE-4 event
[00086] Still another embodiment of the disclosure provides a method of determining
the zygosity of a cauliflower plant comprising cauliflower event CFE-4 DNA in a
biological sample, the method comprising: obtaining a sample of cauliflower DNA;
contacting the sample having cauliflower DNA with a first DNA primer of SEQ ID NO:
15 8, a second DNA primer of SEQ ID NO: 11 and a third DNA primer of, SEQ ID NO:
12; performing a DNA amplification reaction to produce a DNA amplicon molecule;
detecting the said DNA amplicon molecule; wherein the detection of two DNA
amplicon molecules of sizes 902bp and 326bp indicates heterozygosity of the
cauliflower event CFE-4. Detection of a single DNA amplicon molecule of 902bp
20 indicates homozygosity of the CFE-4 event.
[00087] Another embodiment of the disclosure provides a method for determining the
zygosity of a cauliflower plant comprising cauliflower event CFE-4 DNA in a
biological sample, the method comprising: obtaining a sample of cauliflower DNA;
contacting the sample having cauliflower DNA with a first DNA primer of SEQ ID NO:
25 8, a second DNA primer of SEQ ID NO: 11 and a third DNA primer of SEQ ID NO:
26; performing a DNA amplification reaction to produce a DNA amplicon molecule;
detecting said DNA amplicon molecule; wherein the detection of two different DNA
amplicon molecules of sizes 902bp and 407 indicates heterozygosity of the cauliflower
31
event CFE-4. Detection of only a DNA amplicon molecule of 902bp indicates
homozygosity of the CFE-4 event
[00088] In an embodiment of the disclosure, there is provided isolated DNA
molecules as disclosed in the present invention comprising a sequence selected from the
group consisting of SEQ ID NO: 16, SEQ ID NO: 17, and SEQ ID NO: 18 an5 d
complements thereof .
[00089] Another embodiment of the invention provides an isolated DNA molecule
selected from the group consisting of SEQ ID NO: 21, SEQ ID NO: 19, SEQ ID NO:
20, and SEQ ID NO: 27, which is a junction sequence amplified by the pair of DNA
10 primers SEQ ID NO: 8 and 5, SEQ ID NO: 8 and 10, SEQ ID NO: 8 and 11, and SEQ
ID NO: 25 and 26 respectively.
[00090] In an embodiment of the present disclosure, there is provided DNA primer
sequences for detection of the CFE-4 event in cauliflower. The DNA primer sequence
as disclosed in the present invention having a nucleotide sequence selected from the
15 group consisting of SEQ ID NO: 24, SEQ ID NO: 8, SEQ ID NO: 23, SEQ ID NO: 5,
SEQ ID NO: 3, SEQ ID NO: 10, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 12,
and SEQ ID NO: 11.
[00091] Another embodiment of the present disclosure provides an insect resistant
transgenic cauliflower plant or part thereof containing Bt gene comprising event CFE-4.
20 Representative cauliflower seed comprising event CFE-4 have been deposited under
NICMB accession number NCIMB 41809.
[00092] Yet another embodiment of the present disclosure provides a cauliflower
plant or part thereof, the part of the plant as disclosed in the invention is selected from
the group consisting of cell, flower, shoot, inflorescence meristem, root, leaf, seed and
25 stem.
[00093] In an embodiment of the present disclosure provides cauliflower plant or part
thereof as disclosed in the disclosure is a progeny of a cauliflower plant comprising said
event CFE-4.
32
[00094] Another embodiment of the present disclosure provides a plant or part thereof
as disclosed in the present disclosure comprises a junction sequence amplified using a
pair of DNA primers wherein said pair is selected from the group consisting of SEQ ID
NO: 8 and 5, SEQ ID NO: 8 and 10, SEQ ID NO: 8 and 11, and SEQ ID NO: 25 and
26. DNA amplicon molecules thus produced are represented by SEQ ID NO: 21, S5 EQ
ID NO: 19, SEQ ID NO: 20, and SEQ ID NO: 27 respectively or complements thereof.
[00095] Another embodiment of the present disclosure provides a cauliflower plant or
part thereof as disclosed in the present disclosure as resistant to insect infestation. A
method of producing a cauliflower plant resistant to insect infestation is provided,
10 wherein the cauliflower plant comprises of Bt protein encoding DNA sequences.
[00096] In an embodiment the present disclosure provides a cauliflower commodity
product produced from the plant, wherein said commodity product comprises said event
CFE-4 and produces a DNA amplicon molecule diagnostic for the event.
[00097] Another embodiment of the present disclosure provides a method as disclosed
15 in the present disclosure comprises crossing a plant comprising event CFE-4 with a
second plant and selecting progeny comprising the CFE-4 event.
[00098] In an embodiment the present disclosure, there is provided a hybrid
cauliflower plant produced from plant comprising cauliflower event CFE-4.
[00099] Another embodiment of the present disclosure provides a biological sample
20 as disclosed in the present disclosure selected from a group consisting of cotyledon with
petiole, hypocotyls, embryo, immature embryo, leaf lamina, cotyledonary axil, shoot
tip, anther, root and callus or any other suitable explant.
[000100] In an embodiment of the present disclosure, there is provided a kit for
detection of the CFE-4 event, said kit comprising a first primer (SEQ ID NO: 23, SEQ
25 ID NO: 8, SEQ ID NO: 24, SEQ ID NO: 26 ) and a second primer (SEQ ID NO: 5,
SEQ ID NO: 3, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 25), reagents, reaction
buffers, detection reagents and control DNA.
[000101] Another embodiment of the present disclosure provides a kit for detection of
zygosity said kit has a first primer, a second primer, and a third primer. The first primer
33
as disclosed in present invention has sequence as set forth in SEQ ID NO: 23, or SEQ
ID NO: 8, or SEQ ID NO: 24, the second primer has sequence as set forth in SEQ ID
NO: 5, or SEQ ID NO: 3, or SEQ ID NO: 10, or SEQ ID NO: 11 and the third primer
has sequence as set forth in SEQ ID NO: 12.
[000102] Another embodiment of the present disclosure provides a kit for detection o5 f
zygosity said kit has a first primer, a second primer, and a third primer. The first primer
as disclosed in present invention has sequence as set forth in SEQ ID NO: 23, or SEQ
ID NO: 8, or SEQ ID NO: 24, the second primer has sequence as set forth in SEQ ID
NO: 5, or SEQ ID NO: 3, or SEQ ID NO: 10, or SEQ ID NO: 11 and the third primer
10 has sequence as set forth in SEQ ID NO: 26 or SEQ ID NO: 12.
[000103] In an embodiment of the present disclosure, there is provided DNA amplicons
that can be produced from the sequences described herein that are diagnostic for the
presence of the transgenic cauliflower event CFE-4 DNA in a biological sample. An
amplicon diagnostic of transgenic cauliflower event CFE-4 DNA in a biological sample
15 comprises a junction sequence having nucleotide sequence as set forth in SEQ ID
NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID
NO:21, and SEQ ID NO: 27. These amplicons can be produced using DNA primer
sequences as described herein below from any biological sample of DNA derived from
a transgenic cauliflower, which harbours event CFE-4. Such biological sample sources
20 of DNA corresponding to the transgenic cauliflower event CFE-4 can be cauliflower
pollen, cauliflower ovule, cauliflower seed, cauliflower roots, or cauliflower leaves.
[000104] In an embodiment of the present disclosure, there is provided a method of
protecting cauliflower plant from lepidopteran insect infestation, said method
comprising providing in the diet of the lepidopteran insect one or more transgenic
25 cauliflower plant cells, or tissues, wherein each transgenic cauliflower plant cell
genome comprises a polynucleotide sequence as set forth in SEQ ID NO: 16 or its
complement, SEQ ID NO: 17 or its complement, SEQ ID NO: 18 or its complement,
and SEQ ID NO: 27 or its complement.
34
[000105] In an embodiment of the present disclosure, lepidopteran insect that feeds on
transgenic cauliflower plant cells is inhibited from further feeding on the transgenic
cauliflower plant from which the transgenic cauliflower plant cells are derived.
[000106] In an embodiment of the present disclosure, there is provided a variety of
cauliflower comprising DNA diagnostic for the presence of a transgenic event, CFE-5 4.
Transgenic event, CFE-4 DNA can be obtained by breeding a cauliflower plant
comprising transgenic cauliflower event CFE-4 with a cauliflower plant devoid of event
CFE-4 to produce a hybrid cauliflower plant comprising DNA diagnostic for said CFE-
4 event. Such a hybrid cauliflower plant comprising DNA diagnostic for the transgenic
10 cauliflower event CFE-4 is within the scope of the present disclosure, including seeds
produced from the hybrid, pollen, ovule, seed, roots, and leaves of the hybrid
cauliflower plant harbouring event CFE-4.
[000107] Cauliflower plants grown from seed that are homozygous for the transgenic
cauliflower event CFE-4 are also within the scope of the present invention. Cauliflower
15 plants grown from seed that are heterozygous for the transgenic cauliflower event CFE-
4 are also within the scope of the present invention so long as these seed also comprise
the diagnostic DNA sequences. Cells, seed, tissue and hybrid produced from such plants
comprising the diagnostic DNA are also within the scope of the present invention.
[000108] In an embodiment of the present disclosure, there is provided a method of
20 detecting transgenic cauliflower event CFE-4 or a progeny thereof in a biological
sample, said method comprising (a) obtaining a biological sample comprising of
cauliflower DNA, (b) contacting the biological sample with a first DNA primer and a
second DNA primer, wherein the first DNA primer recognizes a sequence within SEQ
ID: 14 and the second DNA primer recognizes a sequence within SEQ ID: 15 or SEQ
25 ID: 22, (c) performing a DNA amplification reaction to produce a DNA amplicon
molecule, and detecting the presence of said DNA amplicon molecule,
wherein the presence of said DNA amplicon molecule is diagnostic for said CFE-4
event in the said sample.
35
[000109] Having illustrated and described the principles of the present invention, it
should be apparent to a person skilled in the art that the invention can be modified in
arrangement and detail without departing from such principles. We claim all
modifications that are within the spirit and scope of the appended embodiments.
[000110] In an embodiment of the present disclosure, there is provided a method o5 f
detecting transgenic cauliflower event CFE-4 or a progeny thereof in a biological
sample, said method comprising (a) obtaining a biological sample comprising of
cauliflower DNA, (b) contacting the biological sample with the first DNA primer and
the second DNA primer, wherein the first DNA primer is selected from the group
10 consisting of SEQ ID: 24, SEQ ID: 8, SEQ ID: 23, and SEQ ID NO: 26, and a second
DNA primer is selected from the group consisting of SEQ ID: 5, SEQ ID: 3, SEQ ID:
10, SEQ ID: 11, and SEQ ID NO: 25, (c) performing a DNA amplification reaction to
produce a DNA amplicon molecule, and (d) detecting the presence of said DNA
amplicon molecule, wherein the presence of said DNA amplicon molecule is diagnostic
15 for said event in the said sample.
[000111] In an embodiment of the present disclosure, there is provided a method of
detecting transgenic cauliflower event CFE-4 or a progeny thereof in a biological
sample, said method comprising (a) contacting the biological sample with a first DNA
primer having nucleotide sequence as set forth in SEQ ID NO: 8, and a second DNA
20 primer having nucleotide sequence as set forth in SEQ ID NO: 5, (c) performing a DNA
amplification reaction to produce a DNA amplicon molecule, and (d) detecting the
presence of said DNA amplicon molecule, wherein the presence of said DNA amplicon
molecule is diagnostic for said event in the said sample.
[000112] In an embodiment of the present disclosure, there is provided a method of
25 detecting transgenic cauliflower event CFE-4 using DNA primers as set forth in SEQ
ID NO: 8 and SEQ ID NO: 5, wherein the length of the DNA amplicon is 471bp and the
nucleotide sequence of the DNA amplicon is as set forth in SEQ ID: 21 or its
complement.
36
[000113] In an embodiment of the present disclosure, there is provided a method of
detecting transgenic cauliflower event CFE-4 or a progeny thereof in a biological
sample, said method comprising (a) contacting the biological sample with a first DNA
primer having nucleotide sequence as set forth in SEQ ID NO: 8, and a second DNA
primer having nucleotide sequence as set forth in SEQ ID NO: 10, (c) performing 5 a
DNA amplification reaction to produce a DNA amplicon molecule, and (d) detecting
the presence of said DNA amplicon molecule, wherein the presence of said DNA
amplicon molecule is diagnostic for said event in the said sample.
[000114] In an embodiment of the present disclosure, there is provided a method of
10 detecting transgenic cauliflower event CFE-4 using DNA primers as set forth in SEQ
ID NO: 8 and SEQ ID NO: 10, wherein the length of the DNA amplicon is 724bp and
the nucleotide sequence of the DNA amplicon is as set forth in SEQ ID: 19 or its
complement.
[000115] In an embodiment of the present disclosure, there is provided a method of
15 detecting transgenic cauliflower event CFE-4 or a progeny thereof in a biological
sample, said method comprising (a) contacting the biological sample with a first DNA
primer having nucleotide sequence as set forth in SEQ ID NO: 8, and a second DNA
primer having nucleotide sequence as set forth in SEQ ID NO: 11, (c) performing a
DNA amplification reaction to produce a DNA amplicon molecule, and (d) detecting
20 the presence of said DNA amplicon molecule, wherein the presence of said DNA
amplicon molecule is diagnostic for said event in the said sample.
[000116] In an embodiment of the present disclosure, there is provided a method of
detecting transgenic cauliflower event CFE-4 using DNA primers as set forth in SEQ
ID NO: 8 and SEQ ID NO: 11, wherein the length of the DNA amplicon is 902bp and
25 the nucleotide sequence of the DNA amplicon is as set forth in SEQ ID: 20 or its
complement.
[000117] In an embodiment of the present disclosure, there is provided a method of
detecting transgenic cauliflower event CFE-4 or a progeny thereof in a biological
sample, said method comprising (a) contacting the biological sample with a first DNA
37
primer having nucleotide sequence as set forth in SEQ ID NO: 26, and a second DNA
primer having nucleotide sequence as set forth in SEQ ID NO: 25, (c) performing a
DNA amplification reaction to produce a DNA amplicon molecule, and (d) detecting
the presence of said DNA amplicon molecule, wherein the presence of said DNA
amplicon molecule is diagnostic for said event in the said sample5 .
[000118] In an embodiment of the present disclosure, there is provided a method of
detecting transgenic cauliflower event CFE-4 using DNA primers as set forth in SEQ
ID NO: 26 and SEQ ID NO: 25, wherein the length of the DNA amplicon is 198 bp and
the nucleotide sequence of the DNA amplicon is as set forth in SEQ ID: 27 or its
10 complement.
[000119] In an embodiment of the present disclosure, there is provided a method of
determining the zygosity of DNA of a transgenic cauliflower plant comprising of event
CFE-4 in a biological sample, said method comprising (a) obtaining a biological sample
comprising of cauliflower DNA, (b) contacting the sample having cauliflower DNA
15 with a first DNA primer, a second DNA primer, and a third DNA primer, wherein the
first DNA primer recognizes a sequence as set forth in SEQ ID: 8, the second DNA
primer recognizes a sequence as set forth in SEQ ID: 5 and the third DNA primer
recognizes a sequence as set forth in SEQ ID: 12, (c) performing a DNA amplification
reaction to produce a DNA amplicon molecule, and (d) detecting the presence of said
20 DNA amplicon molecule, wherein the presence of two DNA amplicons of sizes 471bp
and 326bp indicates heterozygosity of the transgenic cauliflower event CFE-4 and
presence of a single amplicon of size 471bp indicates homozygosity of the said event.
[000120] In an embodiment of the present disclosure, there is provided a method of
determining the zygosity of DNA of a transgenic cauliflower plant comprising of event
25 CFE-4 in a biological sample, said method comprising (a) obtaining a biological sample
comprising of cauliflower DNA, (b) contacting the sample having cauliflower DNA
with a first DNA primer, a second DNA primer, and a third DNA primer, wherein the
first DNA primer recognizes a sequence as set forth in SEQ ID: 8, the second DNA
primer recognizes a sequence as set forth in SEQ ID: 5 and the third DNA primer
38
recognizes a sequence as set forth in SEQ ID: 26, (c) performing a DNA amplification
reaction to produce a DNA amplicon molecule, and (d) detecting the presence of said
DNA amplicon molecule, wherein the presence of two DNA amplicons of sizes 471bp
and 407 indicates heterozygosity of the transgenic cauliflower event CFE-4 and
presence of a single amplicon of size 471bp indicates homozygosity of the said even5 t
[000121] In an embodiment of the present disclosure, there is provided a method of
determining the zygosity of DNA of a transgenic cauliflower plant comprising of event
CFE-4 in a biological sample, the method comprising (a) obtaining a biological sample
comprising of cauliflower DNA, (b) contacting the sample having cauliflower DNA
10 with a first DNA primer, a second DNA primer and a third DNA primer, wherein the
first DNA primer recognizes a sequence as set forth in SEQ ID: 8, the second DNA
primer recognizes a sequence as set forth in SEQ ID: 10 and the third DNA primer
recognizes a sequence as set forth in SEQ ID: 12, (c) performing a DNA amplification
reaction to produce a DNA amplicon molecule, and (d) detecting the presence of said
15 DNA amplicon molecule, wherein the presence of two DNA amplicons of sizes 724bp
and 326bp indicates heterozygosity of the transgenic cauliflower event CFE-4 and
presence of a single amplicon of size 724bp indicates homozygosity of the said event.
[000122] In an embodiment of the present disclosure, there is provided a method of
determining the zygosity of DNA of a transgenic cauliflower plant comprising of event
20 CFE-4 in a biological sample, said method comprising (a) obtaining a biological sample
comprising of cauliflower DNA, (b) contacting the sample having cauliflower DNA
with a first DNA primer, a second DNA primer, and a third DNA primer, wherein the
first DNA primer recognizes a sequence as set forth in SEQ ID: 8, the second DNA
primer recognizes a sequence as set forth in SEQ ID: 12 and the third DNA primer
25 recognizes a sequence as set forth in SEQ ID: 26, (c) performing a DNA amplification
reaction to produce a DNA amplicon molecule, and (d) detecting the presence of said
DNA amplicon molecule, wherein the presence of two DNA amplicons of sizes 724bp
and 407 indicates heterozygosity of the transgenic cauliflower event CFE-4 and
presence of a single amplicon of size 724bp indicates homozygosity of the said event.
39
[000123] In an embodiment of the present disclosure, there is provided a method of
determining the zygosity of DNA of a transgenic cauliflower plant comprising of event
CFE-4 in a biological sample, the method comprising (a) obtaining a biological sample
comprising of cauliflower DNA, (b) contacting the sample having cauliflower DNA
with a first DNA primer, a second DNA primer and a third DNA primer, wherein th5 e
first DNA primer recognizes a sequence as set forth in SEQ ID: 8, the second DNA
primer recognizes a sequence as set forth in SEQ ID: 11 and the third DNA primer
recognizes a sequence as set forth in SEQ ID: 12, (c) performing a DNA amplification
reaction to produce a DNA amplicon molecule, and (d) detecting the presence of said
10 DNA amplicon molecule, wherein the presence of two DNA amplicons of sizes 902bp
and 326bp indicates heterozygosity of the transgenic cauliflower event CFE-4 and
presence of a single amplicon of size 902bp indicates homozygosity of the said event.
[000124] In an embodiment of the present disclosure, there is provided a method of
determining the zygosity of DNA of a transgenic cauliflower plant comprising of event
15 CFE-4 in a biological sample, said method comprising (a) obtaining a biological sample
comprising of cauliflower DNA, (b)contacting the sample having cauliflower DNA
with a first DNA primer, a second DNA primer, and a third DNA primer, wherein the
first DNA primer recognizes a sequence as set forth in SEQ ID: 8, the second DNA
primer recognizes a sequence as set forth in SEQ ID: 11, and the third DNA primer
20 recognizes a sequence as set forth in SEQ ID: 26, (c)performing a DNA amplification
reaction to produce a DNA amplicon molecule, and (d)detecting the presence of said
DNA amplicon molecule, wherein the presence of two DNA amplicons of sizes 902bp
and 407indicates heterozygosity of the transgenic cauliflower event CFE-4 and presence
of a single amplicon of size 902bp indicates homozygosity of the said event.
25 [000125] In an embodiment of the present disclosure, there is provided an isolated
DNA molecule comprising any one of the DNA amplicon molecules having sequence
as set forth in SEQ ID NO: 21, or SEQ ID NO: 19, or SEQ ID NO: 20, or SEQ ID NO:
27..
40
[000126] In an embodiment of the present disclosure, there is provided DNA amplicon
molecules, wherein the sequence of the said DNA amplicon molecules is selected from
the group consisting of SEQ ID: 16, SEQ ID: 17, SEQ ID: 18, SEQ ID: 19, SEQ ID: 20,
SEQ ID: 21, SEQ ID NO: 27, and complements thereof.
[000127] In an embodiment of the present disclosure, there is provided an isolate5 d
DNA molecule comprising of junction sequence amplified by a primer pair that
recognizes the nucleotide sequence as set forth in SEQ ID: 21, SEQ ID: 19, SEQ ID: 20
and SEQ ID NO: 27.
[000128] In an embodiment of the present disclosure, DNA primers having nucleotide
10 sequence as set forth in SEQ ID NO: 8 and SEQ ID NO: 5 are used to produce a
polynucleotide fragment having sequence as set forth in SEQ ID NO: 21, wherein said
polynucleotide fragment is indicative of transgenic event CFE-4.
[000129] In an embodiment of the present disclosure, DNA primers having nucleotide
sequence as set forth in SEQ ID NO: 8 and SEQ ID NO: 10 are used to produce a
15 polynucleotide fragment having sequence as set forth in SEQ ID NO: 19, wherein said
polynucleotide fragment is indicative of transgenic event CFE-4.
[000130] In an embodiment of the present disclosure, DNA primers having nucleotide
sequence as set forth in SEQ ID NO: 8 and SEQ ID NO: 11 are used to produce a
polynucleotide fragment having sequence as set forth in SEQ ID NO: 20, wherein said
20 polynucleotide fragment is indicative of transgenic event CFE-4.
[000131] In an embodiment of the present disclosure, DNA primers having nucleotide
sequence as set forth in SEQ ID NO: 25 and SEQ ID NO: 26 are used to produce a
polynucleotide fragment having sequence as set forth in SEQ ID NO: 27, wherein said
polynucleotide fragment is indicative of transgenic event CFE-4.
25 [000132] In an embodiment of the present disclosure, there is provided primer DNA
sequences for detection of the transgenic cauliflower event CFE-4, wherein the primer
DNA sequences are selected from the group consisting of SEQ ID: 24, SEQ ID: 8. SEQ
ID: 23, SEQ ID: 5, SEQ ID: 3, SEQ ID: 10, SEQ ID NO: 25, SEQ ID NO: 26, and SEQ
ID: 11.
41
[000133] In an embodiment of the present disclosure, there is provided an insect
resistant transgenic cauliflower plant or part thereof expressing Bt gene comprising
event CFE-4, wherein representative cauliflower seeds comprising event CFE-4 have
been deposited under accession number NCIMB 41809.
[000134] In an embodiment of the present disclosure, there is provided a transgeni5 c
plant or parts thereof comprising a junction sequence amplified using a pair of primers
as set forth in SEQ ID: 8 and SEQ ID: 5, or SEQ ID: 8 and SEQ ID: 10, or SEQ ID: 8
and SEQ ID: 11 or SEQ ID NO: 25 and SEQ ID NO: 26.
[000135] In an embodiment of the present disclosure, there is provided a cauliflower
10 commodity product, wherein said commodity product comprises a transgenic event
CFE-4, and produces a DNA amplicon molecule diagnostic for said event.
[000136] In an embodiment of the present disclosure, there is provided a hybrid
cauliflower plant produced from a plant comprising a transgenic cauliflower event CFE-
4.
15 [000137] In an embodiment of the present disclosure, there is provided a biological
sample for detection of transgenic event CFE-4, wherein the biological sample is
selected from the group consisting of cotyledon with petiole, hypocotyls, embryo,
immature embryo, leaf lamina, cotyledonay axil, shoot tip, anther, root, and callus.
[000138] In an embodiment of the present disclosure, there is provided a kit for
20 detection of transgenic cauliflower event CFE-4, said kit comprises of a first DNA
primer of nucleotide sequence selected from the group consisting of SEQ ID: 24, SEQ
ID: 8, SEQ ID NO: 26, and SEQ ID: 23 and a second DNA primer of nucleotide
sequence selected from the group consisting of SEQ ID: 5, SEQ ID: 3, SEQ ID: 10,
SEQ ID NO: 25, and SEQ ID: 11, reagents, reaction buffers, detection reagents and
25 control DNA molecule.
[000139] In an embodiment of the present disclosure, there is provided a kit for
detection of zygosity of transgenic cauliflower event CFE-4, said kit comprises of a first
primer of nucleotide sequence selected from the group consisting of SEQ ID: 24, SEQ
ID: 8, and SEQ ID: 23, a second primer of nucleotide sequence selected from the group
42
consisting of SEQ ID: 5, SEQ ID: 3, SEQ ID: 10, and SEQ ID: 11 and a third primer of
nucleotide sequence selected from the group consisting of SEQ ID: 12, and SEQ ID
NO: 26, reagents, reaction buffers, detection reagents and control DNA molecule.
[000140] In an embodiment of the present disclosure, there is provided an insect
resistant transgenic cauliflower plant harbouring event CFE-5 4.
[000141] In an embodiment of the present disclosure, there is provided an insect
resistant transgenic cauliflower plant or parts thereof, including seeds, harbouring event
CFE-4.
EXAMPLES
10 [000142] The disclosure will now be illustrated with working examples, which is
intended to illustrate the working of disclosure and not intended to take restrictively to
imply any limitations on the scope of the present disclosure. Unless defined otherwise,
all technical and scientific terms used herein have the same meaning as commonly
understood to one of ordinary skill in the art to which this disclosure belongs. Although
15 methods and materials similar or equivalent to those described herein can be used in the
practice of the disclosed methods and compositions, the exemplary methods, devices
and materials are described herein.
Example 1
Transformation of Cauliflower
20 [000143] Plant material: Cauliflower seeds (Brassica oleracea L., variety SUNGRO ES-
67) were surface sterilized in 0.1% (weight/volume) Mercury II Chloride (HgCl2) in
distilled water for five-minutes at room temperature. Sterilized seeds were washed five
times in sterile water and placed on CC0 medium for germination. The cotyledons were
excised from four-day old seedlings and were used in transformations. Table 1 provides
25 details and the medium used
Table 1: Media code with composition
MEDIA
CODE
MEDIA COMPOSITION
CC0 MS salts (Murashige and Skoog 1962), phytagel 0.7%
43
MEDIA
CODE
MEDIA COMPOSITION
CC1 MS salts (Murashige and Skoog 1962), B5 vitamin
(Gamborg et al. 1968), phytagel 0.7%, sucrose 2%
CC2 CC1 + BAP 3mg/l, NAA 0.02 mg/l, GA3 0.01 mg/l, Silver
nitrate 0.5 mg/l, cefotaxime 500mg/l
CC2 (S-1) CC2 with kanamycin 30 mg/l
CC2 (S-2) CC2 with kanamycin 30 mg/l, phytagel 0.3%
MSI MS salts, B5 vitamins, sucrose 3% phytagel 0.3%, IBA
2mg/l,
cefotaxime 250 mg/l, kanamycin 30 mg/l
pH of all the above media were adjusted to 6 except MSI to 5.8
Transformation using cry1Ac and nptII genes
[000144] Cauliflower transformations were performed using Agrobacterium
tumefaciens strain EHA105 carrying plasmid pC2300ve10518, wherein the cry1Ac gene
expression is driven by the e35S Cauliflower Mosaic Virus promoter. The cry1Ac gen5 e
cloned into the vector pCAMBIA2300 plasmid and introduced into the Agrobacterium
tumefaciens strain EHA105 was used for transformations. Transformed Agrobacterium
tumefaciens was inoculated in 25mL of 2YT medium (pH 7.0) in a flask with respective
antibiotics (kanamycin & chloramphenicol) for the selective growth of transformed
10 Agrobacterium tumefaciens with plasmid pC2300ve10518. The culture was kept on a
shaker at 280C with 180RPM to get optical density of 0.3 (measured at 600nm).
Incubation of explants with transformed Agrobacterium tumefaciens and shoot bud
induction
[000145] Cotyledons excised from four-day old seedlings were incubated in a
15 suspension containing transformed Agrobacterium tumefaciens having recombinant
plasmid, pC2300ve10518 for 15 minutes, and blotted dry on sterile filter paper. The
dried cotyledons were subsequently transferred to CC1 medium for co-cultivation. No
44
more than 20 cotyledons per petri dish were plated. The petri dishes were incubated at
25+1°C for four days in a tissue culture incubation room.
[000146] After four days of cultivation period the explants were transferred to postculture
medium (CC2) with no more than 10 cotyledons per plate. After seven days of
post-culturing the cotyledons at 25+1°C, the cotyledons were transferred on to CC2 (S-5 1)
for selection I. (See Table 1).
[000147] The cotyledons obtained from selection I were transferred on to selection II
medium CC2 (S-2) as indicated in (Table 1) and after 3-4 weeks of growth at 25+1°C,
Kanamycin resistant putative transgenic shoots were developed. The shoots thus
10 obtained were subcultured on MSI medium wherein shoots were rooted. The rooted
plants were transplanted from MSI medium and allowed to grow further in sterile potting
mixture. After the establishment of the plants, the plants were subsequently shifted to
larger earthen pots. The tissue samples obtained from rooted plants were used in various
assays.
15 ELISA analysis for Cry1Ac protein
[000148] The putative transgenic plants carrying the cry1Ac gene were tested for the
expression of Cry1Ac protein using ELISA method. The ELISA plates, supplied by
Desigen Diagnostics, Maharashtra, India were coated with monoclonal antibodies
specific to the Cry1Ac protein. Tissue samples from non-transgenic plants were used as
20 negative control for the ELISA assay.
Example 2
Identification of cauliflower plant harbouring the CFE-4 event and having insect
resistance
A subset of the ELISA positive lines were subjected to the insect bio-assays using DBM
25 larvae.
[000149] Four ELISA positive primary transformants were regenerated that express
the Cry1Ac gene. Out of the four lines analysed, Mendelian segregation pattern i.e. 3:1
ratio (Table 2) of transgene (cry1Ac gene) inheritance in two lines (T1 generation
seedlings) indicated that the integration of the cry1Ac gene was confined to a single
45
locus in the plant host genome. The transgenic leaves expressing the cry1Ac gene
showed complete protection from the target pest in the bioassays and 100% susceptibility
was observed in the case of non-transgenic cauliflower leaf discs as indicated in Table 3.
Table 2: Segregation analysis of cry1Ac gene expression in transgenic T1 plants
obtained from selfed four T0 line5 s
S.NO. PLANT
/EVENT
NUMBER OF
SEEDLINGS
c2
VALUE
(3:1)
Total Total Cry1Ac
+
Cry1Ac
-
1. CFE -1 19 06 13 19.09
2. CFE-2 09 03 06 8.24
3. CFE -3 09 05 04 1.83
4. CFE -4 10 07 03 0.04
[000150] It can be inferred from Table 2 that event CFE-4 represents a transgenic
cauliflower with a single locus insert of the transgene in the transformed host.
Table 3: Cauliflower CFE-4 Bioassay Results
Transgenic Plant : Cauliflower
10 Name of the Insect : Plutella xylostella
Stage of Insects : 1st instar larva
No. of Insects : 4 larvae/ replication
PLANT CODE REPLICATION
FEEDING
AREA
(Sq mm)
STATUS OF
LARVAE
LIVE DEAD
Control (non Bt)
1 50 4 0
2 35 4 0
3 30 4 0
CFE-4 1 2 0 4
46
PLANT CODE REPLICATION
FEEDING
AREA
(Sq mm)
STATUS OF
LARVAE
LIVE DEAD
2 2 0 4
3 2 0 4
CFE-4
1 2 0 4
2 2 0 4
3 2 0 4
Example 3
Molecular characterization of the event CFE-4
[000151] Transgenic cauliflower containing CFE-4 event was analysed to identify the
cauliflower genomic DNA sequences flanking the cry1Ac gene expression cassette. The
identification of genomic DNA sequences flanking the cry1Ac gene expression cassett5 e
was done using the method as described in Cottage et al., Plant Molecular Biology
Reporter, 2001, 19:321-327. Plant genomic DNA was extracted from fresh young (2-3
weeks old) leaves containing event CFE-4 (Dellaporta et al., Plant Mol. Bio. Rep.,
1983, 1, 19-22). The extracted genomic DNA (2μg) was digested with Dra-I enzyme in
10 a total volume of 20μl as indicated in Table 4. The digestion reaction was incubated at
37ºC for 18-20 hours. The digestion reaction was subsequently incubated at 65ºC for 30
minutes for enzyme inactivation and the digested DNA was precipitated with 3M
sodium acetate and ethanol. Purified DNA was air-dried and dissolved in 12μl of sterile
distilled water. Adapters having complementary nucleotide sequences were first
15 annealed to each other and then the annealed adapters were further ligated to the
digested genomic DNA fragments as per manufacturer’s (NEB) guidelines. The ligation
mixture was incubated at 140C for 16-18 hours for the ligation of digested genomic
DNA to the annealed adapters. The ligation mixture was diluted to 100 μl for obtaining
adapter library.
20 Table 4: Components of Restriction Digestion:
47
COMPONENTS AMOUNT
Reaction buffer (10X) (final concentration
1x)
2.0 μl
Dra-I enzyme (10units/ μl) 1.0 μl
Genomic DNA (isolated from plant
sample) (2 μg)
12.0 μl
Sterile water 5 μl.
Total Amount of Reaction Mixture 20 μl
Table 5: Components of Ligation Reaction
COMPONENTS AMOUNT
Digested Genomic DNA (heat inactivated) (2 μg) 12.0 μl
Annealed adapters(100 ng/μl) 2.0 μl
10X Reaction buffer (final concentration 1x) 3.0 μl
T4-ligase enzyme(5units/μl ) 1.0 μl
Sterile water 12 μl
Total Amount of Reaction Mixture 30 μl
[000152] The adapter library obtained was used to identify the plant genomic
sequence flanking the transgenic insertion site by PCR method. A first round of PCR
amplification was carried out using a forward and a reverse primer combination. Th5 e
forward primer has nucleotide sequence as set forth in SEQ ID NO: 3 and is
complementary to the inserted transgene sequence and the reverse primer has nucleotide
sequence as set forth in SEQ ID NO: 4. Components used for the first PCR reaction and
thermal cycler details are indicated in Table 6 & 7.
10 Table: 6 Components of First PCR Reaction:
COMPONENTS AMOUNT
10X reaction buffer (with MgCl2) 2.5 μl
10mM dNTP’s 0.5 μl
48
COMPONENTS AMOUNT
Forward Primer (SEQ ID NO:3)(100ng/μl) 1.0 μl
Reverse Primer (SEQ ID NO: 4)(100 ng/μl) 1.0 μl
Taq DNA polymerase (5 units/μl) 0.5 μl
DNA template 3.0 μl
Nuclease-free water 11.5 μl
Total Amount of Reaction Mixture 25 μl
Table 7: Thermal Cycler program
TEMPERATURE TIME CYCLES
95 °C 5 min 1
95 0C 30 seconds
458 0C 30 seconds 0
68 0C 4 minutes
68° C 10 minutes 1
4 °C hold
[000153] The second round of PCR reaction was carried out to obtain the specific
plant genomic flanking region adjacent to the left border of the inserted heterologous
5 gene. The PCR reaction was carried out using forward primer having nucleotide
sequences as set forth in SEQ ID NO: 5 and a reverse primer having nucleotide
sequences as set forth in SEQ ID NO: 6. Components used for the second PCR reaction
and thermal cycler details are indicated in Table 8 & 9
Table 8: Components of second PCR Reaction:
COMPONENTS AMOUNT
10X reaction buffer (with MgCl2) 2.5 μl
10mM dNTP’s 0.5 μl
Forward Primer (SEQ ID NO:5)(100ng/μl) 1.0 μl
Reverse Primer (SEQ ID NO: 6)(100 ng/μl) 1.0 μl
49
COMPONENTS AMOUNT
Taq DNA polymerase (5 units/μl) 0.5 μl
DNA template 2.0 μl
Nuclease-free water 12.5 μl
Total Amount of Reaction Mixture 25 μl
Table 9: Thermal Cycler program:
TEMPERATURE TIME CYCLES
950c 5 minutes 1
950c
580c
680c
30 seconds
30 seconds
4 minutes
40
680c 10 minutes 1
40c hold
[000154] A small amount of PCR product was analysed on a 1% agarose gel, and the
amplified fragment was eluted from the gel by using methods well known in the art. A
DNA fragment (amplicon) of 588bp was amplified from the left border region of the TDNA
after two rounds of PCR (using a forward primer as set forth in SEQ ID NO: 5 6
and a reverse primer as set forth in SEQ ID NO: 5). The amplified fragment (amplicon)
was cloned into pGEM-T Easy vector to obtain a recombinant vector. The recombinant
vector was transformed into a strain of E.coli (e.g. DH5α) by using methods wellknown
in the art. The clone comprising this recombinant vector was selected for
10 analysing the sequence of the flanking nucleotide regions and was designated as CFE-4
-Clone 1Dra I. Plasmid DNA from the clone CFE-4-Clone 1Dra I was isolated using
standard methods known in the art. The cloned fragment (amplicon) was sequenced
using SP-6 primer. The polynucleotide sequence of the cloned fragment is represented
by sequence as set forth in SEQ ID NO: 7. The SEQ ID NO: 7 contains the a part of the
15 adapter sequence, cauliflower genomic DNA sequence flanking the left border of the
inserted transgene and T-DNA from the left border up to SEQ ID NO: 5.
[000155] Sequence ID NO: 7 consists of a part of the adapter starting with primer
50
sequence as set forth in SEQ ID NO: 6 followed by cauliflower genomic DNA sequence
of flanking the left side of the CFE-4 event, followed by T-DNA sequence terminating
in sequence as set forth in SEQ ID NO: 5. The junction sequence of the cauliflower
CFE-4 event has been characterized by sequence analysis. The junction nucleotide
sequence is represented by the DNA sequence as set forth in SEQ ID NO: 16, SEQ I5 D
NO: 17 and SEQ ID NO: 18. The plant flanking sequences are represented by DNA
sequence as set forth in SEQ ID NO: 14. SEQ ID NO: 15 represents the T-DNA
heterologous insert sequence starting from the left border up to the Cry1Ac gene start
sequence.
10 Example 4
Diagnostic methods for identification of the CFE-4 event:
[000156] To detect the presence or absence of the transgenic cauliflower event CFE-4,
a molecular diagnostic method was developed. The sequence of the polynucleotide
fragment as set forth in SEQ ID NO: 7 was used to design primers that amplify the
15 transgenic insertion locus. Primers were developed to amplify the left junction sequence
in the CFE-4 event. Amplification of the polynucleotide sequence in the CFE-4 event
requires two primers; the first primer in the plant flanking region and a second primer in
the heterologous insert region comprising the cry1Ac gene. The first primer having
nucleotide sequence as set forth in SEQ ID NO: 8 and the second primer having
20 nucleotide as set forth in SEQ ID NO: 5 were used to amplify the transgenic insertion
locus left junction sequence from event CFE-4 genomic DNA. The DNA amplicon thus
obtained from the primers comprises the junction sequence represented by nucleotide
sequences as set forth in SEQ ID NO: 16, SEQ ID NO: 17 and SEQ ID NO: 18.
Detection of said amplicon is used as diagnostic tool for the detection of the presence of
25 a transgenic cauliflower CFE-4 event.
[000157] The primer pair used for the amplification of sequences specific to
cauliflower event CFE-4 are the nucleotide sequences as set forth in SEQ ID NO: 8 and
SEQ ID NO: 5, but the amplicon obtained from the primer pair is not limited to
nucleotide sequences as set forth in SEQ ID NO: 8 and SEQ ID NO: 5. For the
51
amplification of the 5’region, any primer pair derived from nucleotide sequences as set
forth in SEQ ID NO: 14 and SEQ ID NO: 15 or SEQ ID NO: 22 can be used and
wherein the DNA amplification reaction produces a DNA amplicon molecule diagnostic
for said event CFE-4 is an embodiment of the present invention.
[000158] Similar to amplification of left border junction sequences as discusse5 d
above, primers having SEQ ID NO: 25 and SEQ ID NO: 26 were used to amplify right
border junction sequences (amplicon sequence is as set forth in SEQ ID NO: 27).
[000159] SEQ ID NO: 9 consists of a part of the adapter followed by cauliflower
genomic DNA sequence flanking the left side of the CFE-4 event, followed by partial
10 T-DNA sequence.
[000160] However, any modification of the above said methods that use DNA
molecules or complements thereof to produce a DNA amplicon molecule diagnostic for
the event CFE-4 is within the ordinary skill of the art. For example, primers as set forth
in SEQ ID: 8 when used in combination with a primer having nucleotide sequence as
15 set forth in SEQ ID NO: 10, will produce a DNA amplicon molecule of 724 bp, or in
combination with a primer having nucleotide sequence as set forth in SEQ ID NO: 11,
will amplify a 902 bp DNA amplicon molecule from event CFE-4.
[000161] For the analysis of a DNA amplicon molecule diagnostic for event CFE-4, it
is important to have both positive and negative controls. The PCR method was designed
20 in order to distinguish the CFE-4 event from the other cauliflower transgenic and nontransgenic
events. Genomic DNA from cauliflower event CFE-4 was isolated from
leaves using the method described by Dellaporta et al., (Plant Mol. Bio. Rep., 1983,
1:19-22). Genomic DNA isolated from other cauliflower transgenic events and nontransgenic
cauliflower lines serve as negative controls for the PCR detection method. A
25 control reaction having no DNA in the reaction mixture was also included. The genomic
DNA from different plants was subjected to amplification.
Table: 10 Components of Event ID PCR
COMPONENTS AMOUNT
PCR Reaction buffer (with MgCl2) 2.5 μl
52
COMPONENTS AMOUNT
(10X)
dNTP mix (10 mM) 0.5 μl
Primer (SEQ ID NO: 5) (100 ng/μl) 1.0 μl
Primer (SEQ ID NO: 8) (100 ng/μl) 1.0 μl
Taq DNA polymerase (5 units/μl) 0.5 μl
Genomic DNA (isolated from plant
sample)
2.0 μl
Nuclease-free water Make up to 25 μl
Total Amount of Reaction Mixture 25 μl
Table 11: Thermal Cycler program
TEMPERATURE TIME CYCLES
95 °C 5 min 1
950 C
30
seconds
3560 C 5
30
seconds
720 C
40
seconds
72 °C 5 min 1
4 °C Hold ---
[000162] The amplified product was analyzed on 1% agarose gel as shown in Figure
5 3.
Lane 1: molecular weight marker.
Lane 2: no DNA sample.
Lane 3: DNA from non-transgenic cauliflower plant.
Lane 4: DNA from transgenic plants that do not contain event CFE-4.
53
Lane 5: DNA from event CFE-4.
From figure 3, it is inferred that the 471bp fragment is amplified only from the
cauliflower CFE-4 event but not from other transgenic cauliflower events or nontransgenic
cauliflower plants. The sequence of the 471bp DNA amplicon molecule is set
forth in SEQ ID NO: 215 .
[000163] Similarly, PCR was carried out with the combination of primers having
nucleotide sequence as set forth in SEQ ID NO: 8 and SEQ ID NO: 10 to yield a DNA
amplicon molecule of size 724bp having nucleotide sequence as set forth in SEQ ID NO:
19.
10 [000164] PCR carried out with the combination of primers having nucleotide sequence
as set forth in SEQ ID NO: 8 and SEQ ID NO: 11 to yield a DNA amplicon molecule of
size 902bp having nucleotide sequence as set forth in SEQ ID NO: 20.
[000165] PCR carried out with the combination of primers having nucleotide sequence
as set forth in SEQ ID NO: 25 and SEQ ID NO: 26 yield a DNA amplicon molecule of
15 size 198bp having nucleotide sequence as set forth in SEQ ID NO: 27.
Example 5
Zygosity assay for cauliflower CFE-4 event
[000166] Cauliflower genomic DNA sequence from the right border of the T-DNA
from event CFE-4 was analyzed and a reverse primer was designed having nucleotide
20 sequence as set forth in SEQ ID NO: 12. The primer having nucleotide sequence as set
forth in SEQ ID NO: 8, when used in combination with a primer having nucleotide
sequence as set forth in SEQ ID NO: 5, will amplify a nucleotide sequence of 471bp
(event CFE-4 specific band). The primer having nucleotide sequence as set forth in
SEQ ID NO: 8, when used in combination with the primer having nucleotide sequence
25 as set forth in SEQ ID NO: 12, will amplify a nucleotide sequence of 326bp (nontransgenic
allele/plant band). The details of the PCR conditions for conducting zygosity
PCR for event CFE-4 event is indicated in Table 12 and Table 13.
[000167] Primer having sequence as set forth in SEQ ID NO: 26 can also be used in
place of SEQ ID NO: 12. The amplicon generated by PCR using primers having
54
sequence as set forth in SEQ ID NO: 8 and SEQ ID NO: 26 yield an amplicon of length
407 in a non-transgenic plant.
Table 12: The PCR conditions for conducting zygosity PCR for CFE-4 event
COMPONENTS AMOUNT
10X reaction buffer (with MgCl2) 2.5 μl
10mM dNTP’s 0.5 μl
Primer (SEQ ID NO: 8)(100 ng/μl) 1.0 μl
Primer (SEQ ID NO: 5)(100 ng/μl) 1.0 μl
Primer (SEQ ID NO: 12/26)(100
ng/μl)
1.0 μl
Taq DNA polymerase (5 U/μl) 0.5 μl
DNA template 2.0 μl
Nuclease-free water Make up to
25 μl
Total Amount of Reaction Mixture 25 μl
Table 13: Thermal Cycler program5 :
STEP TEMPERATURE TIME CYCLES
1 950c 5 minutes 1
2
950c
550c
720c
30 seconds
30 seconds
90 seconds
35
3 720c 5 minutes 1
4 40c Hold ---
[000168] On using primers having nucleotide sequence as set forth in SEQ ID NO: 8,
SEQ ID NO: 5, and SEQ ID NO: 12 the presence of two bands of sizes 471bp and
326bp is indicative of heterozygosity of said transgenic CFE-4 event, while presence of
55
a single 471bp band is indicative of homozygosity of said transgenic event CFE-4.
Absence of the 471bp band is indicative of absence of the said transgenic event CFE-4.
[000169] Similarly, primers having nucleotide sequence as set forth in SEQ ID NO:
24 or SEQ ID NO: 23 and SEQ ID NO: 3 or SEQ ID NO: 10 or SEQ ID NO: 11 and
SEQ ID NO: 12 can be used to determine the zygosity of the said transgenic event 5 CFE-
4.
56
I/We claim:
1. A method of detecting transgenic cauliflower event CFE-4 in a biological
sample, said method comprising:
a. obtaining a biological sample comprising of cauliflower DNA5 ;
b. contacting said biological sample with a first DNA primer and a second
DNA primer;
c. performing a DNA amplification reaction to produce a DNA amplicon
molecule; and
10 d. detecting the presence of said DNA amplicon molecule,
wherein the detection of presence of said DNA amplicon molecule is diagnostic for said
CFE-4 event.
2. The method as claimed in claim 1, wherein the first DNA primer is selected
from the group consisting of SEQ ID NO: 8, SEQ ID NO: 23, SEQ ID NO: 24, and
15 SEQ ID NO: 26, and wherein the second DNA primer is selected from the group
consisting of SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 10, SEQ ID NO: 11, and
SEQ ID NO: 25.
3. The method as claimed in claim 1, wherein said DNA amplicon comprises of at
least 50 contiguous nucleotides selected from the group of sequences consisting of SEQ
20 ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 27, and complements
thereof.
4. A method of determining the zygosity of DNA of a transgenic cauliflower plant
comprising of event CFE-4, said method comprising:
a. obtaining a biological sample comprising of cauliflower DNA;
25 b. contacting said biological sample with a first DNA primer, a second
DNA primer, and a third DNA primer;
c. performing a DNA amplification reaction to produce a DNA amplicon
molecule; and
d. detecting the presence of said DNA amplicon molecule,
57
wherein, detection of presence of more than one DNA amplicon having different
nucleotide sequences is indicative of heterozygosity of the transgenic cauliflower event
CFE-4, while detection of presence of one or more DNA amplicon with identical
nucleotide sequence is indicative of homozygosity of the transgenic event CFE-4.
5. The method as claimed in claim 4, wherein the first DNA primer is selecte5 d
from the group consisting of SEQ ID NO: 8, SEQ ID NO: 23, SEQ ID NO: 24, and
SEQ ID NO: 26.
6. The method as claimed in claim 4, wherein the second DNA primer is selected
from the group consisting of SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 10, SEQ ID
10 NO: 11, and SEQ ID NO: 25.
7. The method as claimed in claim 4, wherein the third DNA primer is selected
from the group consisting of SEQ ID NO: 8, SEQ ID NO: 23, SEQ ID NO: 24, and
SEQ ID NO: 26.
8. A synthetic DNA molecule comprising of any of the DNA amplicons obtained
from a method as claimed in claim 1.
9. The method as claimed in claim 1 or claim 4, wherein the biological sample is
selected from the group consisting of cotyledon with petiole, hypocotyls, embryo,
immature embryo, leaf lamina, cotyledonary axil, shoot tip, anther, root and callus or
any other suitable explants.
10. A kit for detection of transgenic cauliflower event CFE-4 comprising of forward
and reverse primers having at least 10 contiguous nucleotides selected from the group
of sequences consisting of SEQ ID NO: 14, SEQ ID NO: 22, SEQ ID NO: 15, and SEQ
ID NO: 27.
| Section | Controller | Decision Date |
|---|---|---|
| # | Name | Date |
|---|---|---|
| 1 | 3177-del-2013-Correspondence-Others-(12-02-2014).pdf | 2014-02-12 |
| 1 | 3177-DEL-2013-NBA INTIMATION TO APPLICANT COMPLY WITH REQUIREMENT-04-07-2023.pdf | 2023-07-04 |
| 2 | 3177-del-2013-GPA.pdf | 2014-03-21 |
| 2 | 3177-DEL-2013-Undertaking for compliance of Applicant's declaration given in Form 1(Para 12(iii)) [09-02-2023(online)].pdf | 2023-02-09 |
| 3 | 3177-DEL-2013-NBA Approval Submission [01-02-2023(online)].pdf | 2023-02-01 |
| 3 | 3177-del-2013-Form-3.pdf | 2014-03-21 |
| 4 | 3177-DEL-2013-NBA INTIMATION TO APPLICANT COMPLY WITH REQUIREMENT-05-01-2023.pdf | 2023-01-05 |
| 4 | 3177-del-2013-Form-2.pdf | 2014-03-21 |
| 5 | 3177-DEL-2013-US(14)-HearingNotice-(HearingDate-15-10-2020).pdf | 2021-10-17 |
| 5 | 3177-del-2013-Form-1.pdf | 2014-03-21 |
| 6 | 3177-DEL-2013-Response to office action [04-03-2021(online)].pdf | 2021-03-04 |
| 6 | 3177-del-2013-Drawings.pdf | 2014-03-21 |
| 7 | 3177-DEL-2013-FORM-26 [10-12-2020(online)].pdf | 2020-12-10 |
| 7 | 3177-del-2013-Description (Provisional).pdf | 2014-03-21 |
| 8 | 3177-del-2013-Correspondence-others.pdf | 2014-03-21 |
| 8 | 3177-DEL-2013-8(i)-Substitution-Change Of Applicant - Form 6 [22-11-2020(online)].pdf | 2020-11-22 |
| 9 | 3177-DEL-2013-ASSIGNMENT DOCUMENTS [22-11-2020(online)].pdf | 2020-11-22 |
| 9 | SPEC FOR FILING.pdf | 2014-10-07 |
| 10 | 3177-DEL-2013-FORM 13 [22-11-2020(online)]-1.pdf | 2020-11-22 |
| 10 | FIGURES.pdf | 2014-10-07 |
| 11 | 3177-DEL-2013-FORM 13 [22-11-2020(online)].pdf | 2020-11-22 |
| 11 | Form-2(Online).pdf | 2016-07-23 |
| 12 | 3177-DEL-2013-PA [22-11-2020(online)].pdf | 2020-11-22 |
| 12 | Form 18 [22-11-2016(online)].pdf | 2016-11-22 |
| 13 | 3177-DEL-2013-FER.pdf | 2019-12-04 |
| 13 | 3177-DEL-2013-RELEVANT DOCUMENTS [22-11-2020(online)]-1.pdf | 2020-11-22 |
| 14 | 3177-DEL-2013-OTHERS [02-06-2020(online)].pdf | 2020-06-02 |
| 14 | 3177-DEL-2013-RELEVANT DOCUMENTS [22-11-2020(online)].pdf | 2020-11-22 |
| 15 | 3177-DEL-2013-FER_SER_REPLY [02-06-2020(online)].pdf | 2020-06-02 |
| 15 | 3177-DEL-2013-Written submissions and relevant documents [29-10-2020(online)].pdf | 2020-10-29 |
| 16 | 3177-DEL-2013-Correspondence to notify the Controller [15-10-2020(online)].pdf | 2020-10-15 |
| 16 | 3177-DEL-2013-FORM-26 [12-06-2020(online)].pdf | 2020-06-12 |
| 17 | 3177-DEL-2013-FORM-26 [12-06-2020(online)].pdf | 2020-06-12 |
| 17 | 3177-DEL-2013-Correspondence to notify the Controller [15-10-2020(online)].pdf | 2020-10-15 |
| 18 | 3177-DEL-2013-FER_SER_REPLY [02-06-2020(online)].pdf | 2020-06-02 |
| 18 | 3177-DEL-2013-Written submissions and relevant documents [29-10-2020(online)].pdf | 2020-10-29 |
| 19 | 3177-DEL-2013-OTHERS [02-06-2020(online)].pdf | 2020-06-02 |
| 19 | 3177-DEL-2013-RELEVANT DOCUMENTS [22-11-2020(online)].pdf | 2020-11-22 |
| 20 | 3177-DEL-2013-FER.pdf | 2019-12-04 |
| 20 | 3177-DEL-2013-RELEVANT DOCUMENTS [22-11-2020(online)]-1.pdf | 2020-11-22 |
| 21 | 3177-DEL-2013-PA [22-11-2020(online)].pdf | 2020-11-22 |
| 21 | Form 18 [22-11-2016(online)].pdf | 2016-11-22 |
| 22 | 3177-DEL-2013-FORM 13 [22-11-2020(online)].pdf | 2020-11-22 |
| 22 | Form-2(Online).pdf | 2016-07-23 |
| 23 | 3177-DEL-2013-FORM 13 [22-11-2020(online)]-1.pdf | 2020-11-22 |
| 23 | FIGURES.pdf | 2014-10-07 |
| 24 | SPEC FOR FILING.pdf | 2014-10-07 |
| 24 | 3177-DEL-2013-ASSIGNMENT DOCUMENTS [22-11-2020(online)].pdf | 2020-11-22 |
| 25 | 3177-DEL-2013-8(i)-Substitution-Change Of Applicant - Form 6 [22-11-2020(online)].pdf | 2020-11-22 |
| 25 | 3177-del-2013-Correspondence-others.pdf | 2014-03-21 |
| 26 | 3177-del-2013-Description (Provisional).pdf | 2014-03-21 |
| 26 | 3177-DEL-2013-FORM-26 [10-12-2020(online)].pdf | 2020-12-10 |
| 27 | 3177-del-2013-Drawings.pdf | 2014-03-21 |
| 27 | 3177-DEL-2013-Response to office action [04-03-2021(online)].pdf | 2021-03-04 |
| 28 | 3177-del-2013-Form-1.pdf | 2014-03-21 |
| 28 | 3177-DEL-2013-US(14)-HearingNotice-(HearingDate-15-10-2020).pdf | 2021-10-17 |
| 29 | 3177-del-2013-Form-2.pdf | 2014-03-21 |
| 29 | 3177-DEL-2013-NBA INTIMATION TO APPLICANT COMPLY WITH REQUIREMENT-05-01-2023.pdf | 2023-01-05 |
| 30 | 3177-del-2013-Form-3.pdf | 2014-03-21 |
| 30 | 3177-DEL-2013-NBA Approval Submission [01-02-2023(online)].pdf | 2023-02-01 |
| 31 | 3177-DEL-2013-Undertaking for compliance of Applicant's declaration given in Form 1(Para 12(iii)) [09-02-2023(online)].pdf | 2023-02-09 |
| 31 | 3177-del-2013-GPA.pdf | 2014-03-21 |
| 32 | 3177-DEL-2013-NBA INTIMATION TO APPLICANT COMPLY WITH REQUIREMENT-04-07-2023.pdf | 2023-07-04 |
| 32 | 3177-del-2013-Correspondence-Others-(12-02-2014).pdf | 2014-02-12 |
| 33 | 3177-DEL-2013-NBA INTIMATION TO APPLICANT COMPLY WITH REQUIREMENT-13-01-2025.pdf | 2025-01-13 |
| 34 | 3177-DEL-2013-NBA INTIMATION TO APPLICANT COMPLY WITH REQUIREMENT-25-09-2025.pdf | 2025-09-25 |
| 35 | 3177-DEL-2013-Undertaking for compliance of Applicant's declaration given in Form 1(Para 12(iii)) [27-10-2025(online)].pdf | 2025-10-27 |
| 1 | TPO_02-12-2019.pdf |
| 2 | NCBIBlast_NucleotideSequence_02-12-2019.pdf |
| 3 | INSECTRESISTANTTRANSGENICCAULIFLOWERPLANt-GoogleScholarAE_28-08-2020.pdf |