Abstract: In various embodiments methods of determining methylation of DNA are provided. In one illustrative but non limiting embodiment the method comprises i) contacting a biological sample comprising a nucleic acid to a first matrix material comprising a first column or filter where said matrix material binds and/or filters nucleic acids in said sample and thereby purifies the DNA; ii) eluting the bound DNA from the first matrix material and denaturing the DNA to produce eluted denatured DNA; iii) heating the eluted DNA in the presence of bisulfite ions to produce a deaminated nucleic acid; iv) contacting said deaminated nucleic acid to a second matrix material comprising a second column to bind said deaminated nucleic acid to said second matrix material; v) desulfonating the bound deaminated nucleic acid and/or simultaneously eluting and desulfonating the nucleic acid by contacting the deaminated nucleic acid with an alkaline solution to produce a bisulfite converted nucleic acid; vi) eluting said bisulfite converted nucleic acid from said second matrix material; and vii) performing methylation specific PCR and/or nucleic acid sequencing and/or high resolution melting analysis (HRM) on said bisulfite converted nucleic acid to determine the methylation of said nucleic acid wherein at least steps iv) through vi) are performed in a single reaction cartridge.
[0001] This application claims priority to and benefit of USSN 62/175,916, filed on
June 15, 2015, which is incorporated herein by reference in its entirety for all purposes.
STATEMENT OF GOVERNMENTAL SUPPORT
[ Not Applicable ]
BACKGROUND
[0002] The genomes of higher eukaryotes contain the modified nucleoside 5-methyl cytosine (5-meC). This modification is usually found as part of the dinucleotide CpG in which cytosine is converted to 5-methylcytosine in a reaction that involves flipping a target cytosine out of an intact double helix and transfer of a methyl group from S-adenosylmethionine by a methyltransferase enzyme (see, e.g., Klimasauskas et al. (1994) Cell 76: 357-369). This enzymatic conversion is the primary epigenetic modification of DNA known to exist in vertebrates and is essential for normal embryonic development {see, e.g., Bird (1992) Ce// 70: 5-8; Laird and Jaenisch (1994) Human Mol. Genet. 3: 1487-1495; and Li et al. (1992) Cell 69: 915-926).
[0003] In eukaryotes, DNA methylation regulates normal cellular processes such as genomic imprinting, chromosomal instability, and X-chromosome inactivation. Typically, DNA methylation occurs at the fifth carbon position of cytosine at dinucleotide 5'-CpG-3' sites in or near gene promoters termed CpG islands or shores. Methylation controls gene expression by down-regulating transcription either by directly inhibiting transcriptional machinery or indirectly through the recruitment of chromatin remodeling proteins.
Chromosomal methylation patterns change dynamically during embryonic development, and the correct methylation patterns have to be maintained throughout an individual's lifetime. Changes in methylation patterns are linked to aging, and errors in DNA
methylation are among the earliest changes that occur during oncogenesis. Thus, the detection of methylation at gene promoters is important, inter alia, for diagnosing and/or monitoring patients with cancer.
[0004] Epigenetic alterations, including DNA methylation, interrupt the DNA-RNA-protein axis which describes how genetic information is transcribed into messenger RNAs (mRNAs). The correlation between genomic DNA variation, mRNA copy numbers and protein levels may be described by DNA methylation levels. Thus co-measurement of DNA methylation levels and corresponding down-stream mRNA levels can be important to understanding the mechanism of epigenetic cellular regulation.
[0005] Several methods have been developed to detect and quantify methylation efficiently and accurately. The most common technique is the bisulfite conversion method which converts unmethylated cytosines to uracil. Once converted, the methylation profile of DNA can be determined by standard PCR techniques, sequencing methods, and the like.
[0006] There are several DNA Methylation kits suitable for bisulfite conversion and
DNA cleanup (e.g., EZ DNA Methylation™ kits from Zymo Research). Most kits involve several steps, reagents, and incubation times and often require purified DNA before conversion although some kits can utilize tissue or plasma/serum as starting material.
[0007] Typically the bisulfite conversion process requires at least four steps: 1)
DNA Denaturation; 2) Bisulfite Incubation; 3) DNA Purification; and 4) Desulphonation. The final desulphonation step can be completed on-column or in solution followed by an ethanol precipitation. There are currently no methylation kits that allow a user to complete the entire process- DNA purification, bisulfite incubation, desulphonation, second DNA purification, and methylation-specific PCR all in one step.
SUMMARY
[0008] Various embodiments contemplated herein may comprise, but need not be limited to, one or more of the following:
[0009] Various embodiments contemplated herein may include, but need not be limited to, one or more of the following:
[0010] Embodiment 1 : A method of determining the methylation state of a nucleic acid, said method comprising:
[0011] i) contacting a biological sample comprising a nucleic acid to a first matrix material comprising a first column or filter where said matrix material binds and/or filters nucleic acids in said sample and thereby purifies the DNA;
[0012] ii) eluting the bound DNA from the first matrix material and denaturing the DNA to produce eluted denatured DNA;
[0013] iii) heating the eluted DNA in the presence of a bisulfite reagent to produce a deaminated nucleic acid;
[0014] iv) contacting said deaminated nucleic acid to a second matrix material comprising a second column to bind said deaminated nucleic acid to said second matrix material;
[0015] v) desulfonating the bound deaminated nucleic acid and/or simultaneously eluting and desulfonating the nucleic acid by contacting the deaminated nucleic acid with an alkaline solution to produce a converted (e.g., bisulfite converted) nucleic acid;
[0016] vi) eluting said bisulfite converted nucleic acid from said second matrix material; and
[0017] vii) performing methylation specific PCR and/or nucleic acid sequencing, and/or high resolution melting analysis (HRM) on said converted nucleic acid to determine the methylation of said nucleic acid, wherein at least steps iv) through vi) are performed in a single reaction cartridge.
[0018] Embodiment 2: The method of embodiment 1, wherein at least steps iv) through vi) are performed in a single reaction cartridge.
[0019] Embodiment 3 : The method of embodiment 1, wherein at least steps iii) through vi) are performed in a single reaction cartridge.
[0020] Embodiment 4: The method of embodiment 1, wherein at least steps ii) through vi) are performed in a single reaction cartridge.
[0021] Embodiment 5 : The method of embodiment 1, wherein at least steps i) through vi) are performed in a single reaction cartridge.
[0022] Embodiment 6: The method according to any one of embodiments 1-5, wherein step vii is performed in the same reaction cartridge.
[0023] Embodiment 7: The method according to any one of embodiments 1-6, wherein said first matrix material and said second matrix material are the same material forming the same column.
[0024] Embodiment 8: The method according to any one of embodiments 1-7, wherein said first matrix material and said second matrix material form different columns. [0025] Embodiment 9: The method according to any one of embodiments of embodiment 1-8, wherein said methylation specific PCR, when performed, is performed in said cartridge.
[0026] Embodiment 10: The method according to any one of embodiments 1-9, wherein said nucleic acid sequencing, when performed, is performed in said cartridge or in a device coupled to said cartridge.
[0027] Embodiment 11 : The method according to any one of embodiments 1-10, wherein said cartridge comprises a column comprising said first matrix material, a sample receiving chamber, a temperature controlled channel or chamber, a plurality of chambers containing reagents and/or buffers, and when in use at least one of said chambers contains a desulfonation/elution buffer, and wherein said cartridge optionally comprises a second column comprising said second matrix material.
[0028] Embodiment 12: The method of embodiment 11, wherein, when in use, at least one of said chambers contains a reagent that provides bisulfite ions.
[0029] Embodiment 13 : The method according to any one of embodiments 11-12, wherein said second column is absent.
[0030] Embodiment 14: The method according to any one of embodiments 11-13, wherein said second column is present.
[0031] Embodiment 15: The method according to any one of embodiments 11-14, wherein said cartridge comprises a thermocycling channel or chamber in addition to said temperature controlled channel or chamber.
[0032] Embodiment 16: The method according to any one of embodiments 11-14, wherein said temperature controlled channel or chamber is a thermocycling channel or chamber.
[0033] Embodiment 17: The method according to any one of embodiments 11-16, wherein said cartridge comprises one or more chambers containing one or more reagents selected from the group consisting of methylation specific PCR primers, methylation specific PCR probes, PCR enzyme(s), and PCR reaction buffer.
[0034] Embodiment 18: The method of embodiment 17, wherein said cartridge comprises one or more chambers containing one or more primers and probes for detection of methylation of a forward strand of a bisulfite-converted DNA.
[0035] Embodiment 19: The method according to any one of embodiments 17-18, wherein said cartridge comprises one or more chambers containing one or more primers and probes for detection of methylation of a reverse strand of a bisulfite-converted DNA.
[0036] Embodiment 20: The method according to any one of embodiments 11-19, wherein said sample receiving chamber, said column(s), said plurality of chambers, and when present, said temperature controlled channel or chamber and/or thermocycling channel or chamber, are selectively in fluid communication.
[0037] Embodiment 21 : The method of embodiment 20, wherein said sample receiving chamber, said column(s), said plurality of chambers, and when present, said thermocycling channel or chamber, are selectively in fluid communication by microfluidic channels and valves.
[0038] Embodiment 22: The method of embodiment 20, wherein said sample receiving chamber, said column(s), said plurality of chambers, and when present, said thermocycling channel or chamber or a port into said thermocycling channel or chamber, are disposed around a central valve and selectively in fluid communication with a channel in said central valve, wherein said central valve is configured to accommodate a plunger that is capable of drawing fluid into or out of a chamber in fluid communication with said central valve.
[0039] Embodiment 23 : The method according to any one of embodiments 11-22, wherein said cartridge, when in use, comprises:
[0040] a first chamber containing a sample;
[0041] a second chamber containing a guanidinium thiocyanate-ethanol (GTC-EtOH) solution;
[0042] a third chamber containing a bisulfite reagent;
[0043] a fourth chamber containing a buffer;
[0044] a fifth chamber containing a rinse solution; and
[0045] a sixth chamber containing an elution/desulfonation reagent.
[0046] Embodiment 24: The method of embodiment 23, wherien first chamber contains said sample in a GTC-EtOH- Tween extraction/precipitation reagent.
[0047] Embodiment 25: The method according to any one of embodiments 23-24, wherein the GTC-ETOH- Tween buffer is added at or near the time the sample is placed into the cartridge.
[0048] Embodiment 26: The method according to any one of embodiments 23-25, wherein the bisulfite reagent is added to the cartridge at or near the time the sample is placed in the cartridge.
[0049] Embodiment 27: The method of embodiment 23, wherein the GTC-ETOH-Tween buffer is provided as a component of the cartridge.
[0050] Embodiment 28: The method according to any one of embodiments 23-25, wherein the bisulfite reagent is provided as a component of the cartridge.
[0051] Embodiment 29: The method according to any one of embodiments 11-28, wherein said cartridge comprises a seventh chamber containing PCR primers and/or probes and/or PCR enzymes.
[0052] Embodiment 30: The method according to any one of embodiments 11-29, wherein said cartridge comprises an eighth chamber also containing PCR primers and/or probes and/or PCR enzymes.
[0053] Embodiment 31 : The method of embodiments 29-30, wherein said PCR primers, and/or probes, and/or enzymes are provided as beads.
[0054] Embodiment 32: The method according to any one of embodiments 1-31, wherein said biological sample comprises one or more samples selected from the group consisting of a cell, a tissue, and a biological fluid containing a nucleic acid.
[0055] Embodiment 33 : The method of embodiment 32, wherein said biological sample comprises a biological fluid selected from the group consisting of whole blood, plasma, serum, saliva, mucus, urine, sputum, pancreatic juice, and cerebrospinal fluid.
[0056] Embodiment 34: The method of embodiment 32, wherein said biological sample comprises a sample selected from the group consisting of a tissue sample, a formalin fixed paraffin embedded (FFPE) tissue, fresh frozen tissue, fine needle aspirates (FNA), and a core biopsy.
[0057] Embodiment 35: The method according to any one of embodiments 1-34, wherein said method comprises contacting said biological sample with a lysis solution.
[0058] Embodiment 36: The method of embodiment 35, wherein said method comprises providing said sample in said sample receiving chamber and contacting said sample with an extraction/precipitation solution.
[0059] Embodiment 37: The method according to any one of embodiments 1-36, wherein said matrix material comprises a column material selected from the group consisting of glass or silica, an ion exchange resin, cellulose, and hydroxyapatite.
[0060] Embodiment 38: The method of embodiment 37, wherein said matrix material comprises glass.
[0061] Embodiment 39: The method according to any one of embodiments 1-38, wherein said bisulfite ion is provided as compound selected from the group consisting of ammonium bisulfite, sodium metabi sulfite, potassium bisulfite, cesium bisulfite, and DABSO.
[0062] Embodiment 40: The method of embodiment 39, wherein said bisulfite ion is provided by ammonium bisulfite.
[0063] Embodiment 41 : The method according to any one of embodiments 1-40, wherein said bisulfite is provided in a reagent mix comprising scavengers to prevent sulfite oxidation and/or catalysts.
[0064] Embodiment 42: The method of embodiment 41, wherein said bisulfite is provided in a reagent mix comprising scavengers selected from the group consisting of Trolox and hydroquinone.
[0065] Embodiment 43 : The method according to any one of embodiments 41-42, wherein said bisulfite is provided in a reagent mix comprising polyamines as catalysts.
[0066] Embodiment 44: The method according to any one of embodiments 1-43, wherein said eluting the bound DNA comprises eluting and denaturing said DNA using a low concentration of potassium hydroxide or other base.
[0067] Embodiment 45: The method of embodiment 44, wherein said eluting the bound DNA comprises eluting and denaturing said DNA with an alkaline solution with a pH greater than ab out pH 10.5.
[0068] Embodiment 46: The method of embodiment 44, wherein said eluting the bound DNA comprises eluting and denaturing said DNA with an alkaline solution with a pH greater than about pH 12.
[0069] Embodiment 47: The method of embodiments 45-46, wherein said alkaline solution is a 10-15 mM KOH solution.
[0070] Embodiment 48: The method according to any one of embodiments 1-47, wherein said incubating the eluted DNA with bisulfite ions to produce a deaminated nucleic acid comprises incubating the DNA in an ammonium bisulfite solution having a
concentration that ranges from about 6M to about 7M.
[0071] Embodiment 49: The method of embodiment 48, wherein said incubating the eluted DNA with bisulfite ions to produce a deaminated nucleic acid comprises incubating the DNA in an ammonium bisulfite solution having a concentration of about 6.5M.
[0072] Embodiment 50: The method of embodiment 49, wherein said incubating comprises transferring the DNA in a concentrated bisulfite solution into a temperature controlled channel or chamber in said cartridge and heating said mixture.
[0073] Embodiment 51 : The method of embodiment 50, wherein said incubating comprises thermally cycling the concentrated bisulfite solution from a temperature of about 60°C to about 95°C.
[0074] Embodiment 52: The method according to any one of embodiments 1-51, wherein said contacting said deaminated nucleic acid to a second matrix material comprises mixing the DNA-bisulfite solution with fresh GTC-EtOH and dispensing the solution over said second matrix material.
[0075] Embodiment 53 : The method of embodiment 52, wherein said method comprises washing the DNA in said second matrix material with fresh GTC-EtOH, and then a rinse solution.
[0076] Embodiment 54: The method of embodiment 53, wherein said rinse solution comprises PEG200.
[0077] Embodiment 55: The method according to any one of embodiments 1-54, wherein said desulfonating the bound deaminated nucleic acid comprises eluting the DNA from said second column with a high pH desulphonation buffer and incubating said solution.
[0078] Embodiment 56: The method of embodiment 55, wherein said incubating is for a period of time ranging from about 1 minute to about 1 hour, or from about 5 minutes to about 30 minutes, or from about 10 minutes to about 20 minutes, or for about 15 minutes.
[0079] Embodiment 57: The method of embodiments 55-56, wherein said high pH desulphonation/elution buffer comprises KOH.
[0080] Embodiment 58: The method according to any one of embodiments 55-57, wherein said incubation is in a chamber that previously held said high pH desulphonation buffer (e.g., chamber 10).
[0081] Embodiment 59: The method according to any one of embodiments 1-58, wherein after the incubation with bisulfite ions, a temperature controlled channel or chamber is washed with a buffer to remove the residual bisulfite and neutralize pH.
[0082] Embodiment 60: The method according to any one of embodiments 1-59, wherein high resolution melting analysis (HRM) on said bisulfite-converted nucleic acid is performed to determine the methylation of said nucleic acid.
[0083] Embodiment 61 : The method according to any one of embodiments 1-60, wherein nucleic acid sequencing of said bisulfite-converted nucleic acid is performed to determine the methylation of said nucleic acid.
[0084] Embodiment 62: The method according to any one of embodiments 1-60, wherein methylation specific PCR is performed to determine methylation of target nucleic acid sequences.
[0085] Embodiment 63 : The method of embodiment 62, wherein said methylation specific PCR (MSP) is performed using primers specific for methylated sequences and/or primers specific for unmethylated sequences.
[0086] Embodiment 64: The method of embodiment 62, wherein said methylation specific PCR comprises a MethyLight protocol.
[0087] Embodiment 65 : The method of embodiment 62, wherein TaqMan PCR reactions are performed with primers specific for bisulfite-converted methylated and/or unmethylated sequences.
[0088] Embodiment 66: The method according to any one of embodiments 62-65, wherein said MSP utilizes one or more fluorescent probes that are markers for amplified methylated sequences and/or one or more fluorescent probes that are markers for amplified unmethylated sequences.
[0089] Embodiment 67: The method of embodiment 66, wherein said fluorescent probes comprise a fluorescent reporter dye and a quencher dye where the probe provides a signal upon cleavage by 5' to 3' nuclease activity of Taq DNA polymerase.
[0090] Embodiment 68: The method according to any one of embodiments 66-67, wherein a methylation signal is determined by the combined signal for a plurality of probes each specific to a different methylated region in an amplified region of interest.
[0091] Embodiment 69: The method according to any one of embodiments 66-67, wherein a methylation signal is determined by a plurality of probes specific for the same methylated region in an amplified region of interest.
[0092] Embodiment 70: The method according to any one of embodiments 66-67, wherein said plurality of probes comprise 2, 3, 4, 5, 6, 7, 8, 9, 10, or more probes.
[0093] Embodiment 71 : The method according to any one of embodiments 66-67, wherein a methylation signal is determined by a single probe in the amplified region of interest.
[0094] Embodiment 72: The method according to any one of embodiments 66-71, wherein said probes are run in simplex or multiplex.
[0095] Embodiment 73 : The method according to any one of embodiments 66-71, wherein said probes are run in a multiplex format.
[0096] Embodiment 74: The method according to any one of embodiments 66-73, wherein said probes are run as a nested PCR reaction.
[0097] Embodiment 75: The method according to any one of embodiments 66-74, wherein said PCR reaction comprises a bisulfite contamination control probe that that undergoes bisulfite-mediated cleavage during PCR if bisulfite is present in the reaction.
[0098] Embodiment 76: The method according to any one of embodiments 1-75, wherien PCR is performed for one or more mutated genes.
[0099] Embodiment 77: The method according to any one of embodiments 1-76, wherein PCR is performed for unconverted DNA as a control.
[0100] Embodiment 78: The method according to any one of embodiments 1-77, wherein PCR is performed for converted DNA as a control.
[0101] Embodiment 79: The method of embodiment 77, wherein PCR is performed for unconverted DNA where the unconverted DNA is a target for said method.
[0102] Embodiment 80: The method according to any one of embodiments 1-79, wherein a bisulfite reaction and a PCR reaction, or a desulfonation reaction and a PCR reaction, or a bisulfite reaction, a desulfonation reaction and a PCR reaction are all performed in the same reaction tube or chamber.
[0103] Embodiment 81 : The method according to any one of embodiments 1-80, wherein said contacting a biological sample comprising a nucleic acid to a first matrix material comprises contacting a sample containing RNA to said first matrix material, where said matrix material binds said RNA thereby purifies the RNA.
[0104] Embodiment 82: The method of embodiment 81, wherein said method comprises eluting said RNA from said matrix material substantially independently of the DNA.
[0105] Embodiment 83 : The method of embodiment 82, wherein the RNA is eluted from said first matrix material using a Tris buffered elution.
[0106] Embodiment 84: The method according to any one of embodiments 81-83, wherein said RNA is eluted and stored in a chamber.
[0107] Embodiment 85: The method according to any one of embodiments 81-84, wherein reverse transcription (RT) is performed on said RNA and qRT-PCR is performed to determine the level of target RNA sequences.
[0108] Embodiment 86: The method according to any one of embodiments 82-85, where the RNA fraction is used to elute the bisulfite converted nucleic acid from said second matrix material and mix with the bisulfite-converted DNA, or is mixed with eluted bisulfite-converted DNA.
[0109] Embodiment 87: The method of embodiment 86, wherein RT is performed on said RNA prior to, or after, combination with the bisulfite-converted DNA.
[0110] Embodiment 88: The method according to any one of embodiments 86-87, wherein qRT-PCR is performed for RT RNA in the mixture to determine the level of target RNA sequences and methylation specific PCR is performed on the mixture to determine methylation of target DNA sequences.
[0111] Embodiment 89: The method according to any one of embodiments 1-88, where methylation is determined for a promoter region of a gene selected from the group consisting of MGMT. RASSF1A, ADAMTS1, BNC1, HIST1H3C, HOXB4, RASGRF2, TM6SF1, and AKR1B1.
[0112] Embodiment 90: The method according to any one of embodiments 81-89, wherein the expression level of RNA is determined for a methyltransferase.
[0113] Embodiment 91 : The method of embodiment 90, wherein the expression level of RNA is determined for a methyltransferase selected from the group consisting of DNMT1, DNMT2, DNMT3A, DNMT3B, and TNMT3L.
[0114] Embodiment 92: A cartridge for determining the methylation state of a nucleic acid, said cartridge comprising: a column comprising a first matrix material, a sample receiving chamber, a temperature controlled channel or chamber, a plurality of chambers containing reagents and/or buffers, and when in use at least one of said chambers contains a bisulfite reagent, and at least one of said chambers contains a
desulphonation/elution buffer, and wherein said cartridge optionally comprises a second column comprising said second matrix material.
[0115] Embodiment 93 : The cartridge of embodiment 92, wherein said cartridge, when in use, comprises a chamber containing a reagent comprising guanidinium thiocyanate ethanol (GTC-EtOH).
[0116] Embodiment 94: The cartridge according to any one of embodiments 92-93, wherein said second column is absent.
[0117] Embodiment 95: The cartridge according to any one of embodiments 92-93, wherein said second column is present.
[0118] Embodiment 96: The cartridge according to any one of embodiments 92-95, wherein said temperature controlled channel or chamber is a thermocycling channel or chamber.
[0119] Embodiment 97: The cartridge according to any one of embodiments 92-96, wherein said cartridge further comprises a second heating channel or chamber.
[0120] Embodiment 98: The cartridge according to any one of embodiment 92-97, wherein said bisulfite reagent comprises a compound selected from the group consisting of ammonium bisulfite, sodium metabi sulfite, potassium bisulfite, cesium bisulfite, and DABSO.
[0121] Embodiment 99: The cartridge of embodiment 98, wherein said bisulfite reagent comprises ammonium bisulfite.
[0122] Embodiment 100: The cartridge according to any one of embodiments 92- 99, wherein said bisulfite is provided in a reagent mix comprising scavengers to prevent sulfite oxidation and/or catalysts.
[0123] Embodiment 101 : The cartridge of embodiment 100, wherein said bisulfite is provided in a reagent mix comprising scavengers selected from the group consisting of Trolox and hydroquinone.
[0124] Embodiment 102: The cartridge according to any one of embodiments 100- 101, wherein said bisulfite is provided in a reagent mix comprising polyamines as catalysts.
[0125] Embodiment 103 : The cartridge according to any one of embodiments 92-102, wherein said first matrix material and/or said second matrix material, when present, comprises a material is selected from the group consisting of glass or silica, an ion exchange resin, and hydroxyapatite.
[0126] Embodiment 104: The cartridge according to any one of embodiments 92- 103, wherein said cartridge comprises one or more chambers containing one or more reagents selected from the group consisting of methylation specific PCR primers, methylation specific PCR probes, PCR enzyme(s), and PCR reaction buffer.
[0127] Embodiment 105: The cartridge of embodiment 104, wherein said cartridge contains at least two chambers containing one or more reagents selected from the group consisting of methylation specific PCR primers, methylation specific PCR probes, PCR enzyme(s), and PCR reaction buffer.
[0128] Embodiment 106: The cartridge according to any one of embodiments 92- 105, wherein said cartridge contains at least one chamber containing primers and probes for detection of methylation of a forward strand of a converted DNA.
[0129] Embodiment 107: The cartridge according to any one of embodiments 92-106, wherein said cartridge contains at least one chamber containing primers and probes for detection of methylation of a reverse strand of a converted DNA.
[0130] Embodiment 108: The cartridge according to any of embodiments 104-107, wherein said PCR primers, and/or probes, and/or enzymes are provided as beads.
[0131] Embodiment 109: The cartridge according to any one of embodiments 92-108, wherein said sample receiving chamber, said column(s), said plurality of chambers, and said temperature-controlled heating channel or chamber, are selectively in fluid communication.
[0132] Embodiment 110: The cartridge of embodiment 109, wherein said sample receiving chamber, said column(s), said plurality of chambers, and said temperature controlled channel or chamber, are selectively in fluid communication by microfluidic channels and valves.
[0133] Embodiment 111 : The cartridge of embodiment 109, wherein said sample receiving chamber, said column(s), said plurality of chambers, and said temperature controlled channel or chamber or a port into said temperature controlled channel or chamber, are disposed around a central valve and selectively in fluid communication with a channel in said central valve, wherein said central valve is configured to accommodate a plunger that is capable of drawing fluid into or out of a chamber in fluid communication with said central valve.
[0134] Embodiment 112: The cartridge according to any one of embodiments 92- 111, wherein said cartridge is configured so that, when in use, said cartridge comprises:
[0135] a first chamber containing a sample;
[0136] a second chamber containing a guanidinium thiosulfate-ethanol (GTC-EtOH) solution;
[0137] a third chamber containing a bisulfite reagent;
[0138] a fourth chamber containing a buffer;
[0139] a fifth chamber containing a rinse solution; and
[0140] a sixth chamber containing an elution/desulphonation reagent.
[0141] Embodiment 113 : The cartridge of embodiment 112, wherein said first chamber contains said sample in a GTC-EtOH-Tween extraction/precipitation reagent.
[0142] Embodiment 114: The cartridge according to any one of embodiments 92- 113, wherein the cartridge is configured for the bisulfite reagent to be added to the cartridge at or near the time the sample is placed in the cartridge.
[0143] Embodiment 115: The cartridge according to any one of embodiments 92- 113, wherein the bisulfite reagent is provided as a component of the cartridge.
[0144] Embodiment 116: The cartridge according to any one of embodiments 92- 115, wherein the cartridge is configured for addition of GTC-ETOH- Tween buffer at or near the time the sample is placed into the cartridge.
[0145] Embodiment 117: The cartridge according to any one of embodiments 92- 115, wherein the GTC-ETOH- Tween buffer is provided as a component of the cartridge.
[0146] Embodiment 118: The cartridge according to any one of embodiments 92- 117, wherein said cartridge comprises a seventh chamber containing PCR primers and/or probes and/or PCR enzymes.
[0147] Embodiment 119: The cartridge according to any one of embodiments 92-118, wherein said cartridge comprises an eighth chamber also containing PCR primers and/or probes and/or PCR enzymes.
[0148] Embodiment 120: The cartridge according to any one of embodiments 92- 119, wherein said cartridge comprises one or more chambers containing primers specific for bisulfite-converted methylated and/or unmethylated sequences.
[0149] Embodiment 121 : The cartridge according to any one of embodiments 92- 120, wherein said cartridge comprises one or more chambers containing reagents for TaqMan PCR reactions.
[0150] Embodiment 122: The cartridge according to any one of embodiments 92- 121, wherein said cartridge comprises one or more chambers containing one or more fluorescent probes that are markers for amplified methylated sequences and/or one or more fluorescent probes that are markers for amplified unmethylated sequences.
[0151] Embodiment 123 : The cartridge of embodiment 122, wherein said probes comprise a fluorescent reporter dye and a quencher dye, where the probes provides a signal upon cleavage by the 5' to 3' nuclease activity of Taq DNA polymerase.
[0152] Embodiment 124: The cartridge according to any one of embodiments 122- 123, wherein said cartridge comprises a plurality of probes each specific to a different methylated region in an amplified region of interest.
[0153] Embodiment 125: The cartridge according to any one of embodiments 122- 123, wherein said cartridge comprises a single probe specific to a methylated region in an amplified region of interest.
[0154] Embodiment 126: The cartridge according to any one of embodiments 122- 123, wherein said cartridge comprises a plurality of probes each specific to the same methylated region in an amplified region of interest.
[0155] Embodiment 127: The cartridge according to any one of embodiments 92-126, wherein said cartridge contains primers and/or probes to determine methylation of a promoter region of a gene selected from the group consisting oiMGMT, RASSF1A, ADAMTS1, BNC1, HIST1H3C, HOXB4, RASGRF2, 1M6SF1, and AKR1B1.
[0156] Embodiment 128: The cartridge according to any one of embodiments 92- 126, wherein said cartridge contains one or more primers shown in Tables 5, 9, or 10, and/or one or more probes shown in Tables 5, 9, or 10.
[0157] Embodiment 129: The cartridge of embodiment 128, wherein said cartridge contains the following probes and primers for determining methylation of MGMT using a nested PCR reaction:
[0158] an external forward primer (248b) comprising the nucleotide sequence GTTTT(T*)AGAAYG(T*)TTTGYGTTT (SEQ ID NO:263);
[0159] an external reverse primer (249b) comprising the nucleotide sequence: AAAAAAC(T*)CCRCACTCTTCC (SEQ ID NO:265);
[0160] an internal forward primer (250) comprising the nucleotide sequence
TTTCGACGTTCGTAGGTTTTCGC (SEQ ID NO:266);
[0161] an internal reverse primer (251) comprising the nucleotide sequence
GCACTCTTCCGAAAACGAAACG (SEQ ID NO:267); and
[0162] a probe (252a) comprising the nucleotide sequence fluor- CCAAACAC(T*)CACCAAATC(N*)CAAAC-blocker (SEQ ID NO: 268).
[0163] Embodiment 130: The cartridge according to any one of embodiments 128- 129, wherein said cartridge contains the following probes and primers for determining methylation of ACTB {e.g., as a control) using a nested PCR reaction:
[0164] an external forward primer (102) comprising the nucleotide sequence:
GTGATGGAGGAGGTTTAGTAAGTT (SEQ ID NO: 103);
[0165] an external reverse primer (103) comprising the nucleotide sequence:
CCAATAAAACCTACTCCTCCCTTAA (SEQ ID NO: 104);
[0166] an internal forward primer (148) comprising the nucleotide sequence: GGTTTAGTAAGTTTTTTGGATTGTG (SEQ ID NO: 149);
[0167] an internal reverse primer (149) comprising the nucleotide sequence:
CCTTAAAAATTACAAAAACCACAAC (SEQ ID NO: 150); and
[0168] a probe (178) comprising the nucleotide sequence: fluor- CCACCACCCAACACA(N*)CAA(T*)AACAAACAC-blocker (SEQ ID NO: 179).
[0169] Embodiment 131 : The cartridge according to any one of embodiments 92- 130, wherein the cartridge is configured for determination of the expression level of RNA for a methyltransferase.
[0170] Embodiment 132: The cartridge of embodiment 131, wherein said methyltransferases is selected from the group consisting of DNMTl, DNMT2, DNMT3A, DNMT3B, and TNMT3L.
[0171] Embodiment 133 : A system for determining the methylation of a nucleic acid in a biological sample, said system comprising: an enclosure configured to contain one or more sample processing modules, each sample processing module configured to hold a removable cartridge according to any one of embodiments 92-132; where said system is configured to operate the sample processing modules to perform sample processing to determine methylation of one or more target nucleic acids and optionally to determine the level of one or more target DNA sequences within a corresponding removable sample cartridge, wherein said processing on a sample within the corresponding removable sample cartridge performs a method according to any one of embodiments 1-91.
[0172] Embodiment 134: The system of embodiment 133, wherein said system is configured to contain one sample processing module.
[0173] Embodiment 135 : The system of embodiment 133, wherein said system is configured to contain at least two sample processing modules, or at least 4 sample processing modules, or at least 8 sample processing modules, or at least 12 sample processing modules, or at least 16 sample processing modules, or at least 20 sample processing modules, or at least 24 sample processing modules, or at least 28 sample processing modules, or at least 32 sample processing modules, or at least 64 sample processing modules, or at least 128 sample processing modules.
[0174] Embodiment 136: The system according to any one of embodiments 133- 135, wherein said modules comprise one or more heating plates to heat a temperature controlled chamber or channel in said cartridge.
[0175] Embodiment 137: The system according to any one of embodiments 133- 136, wherein said modules comprise a fan configured to cool a temperature controlled channel or chamber in said cartridge.
[0176] Embodiment 138: The system according to any one of embodiments 133- 137, wherein said modules comprise circuitry to pass information (e.g., optical information) to a computer for analysis.
[0177] Embodiment 139: The system according to any one of embodiments 133- 138, wherein said modules comprise optical blocks to provide excitation and/or detection of one or more optical signals produced by reactions in said cartridge.
[0178] Embodiment 140: The system according to any one of embodiments 133-139, wherein said system is configured to operate said cartridge to perform a method according to any one of embodiments 1-91.
[0179] Embodiment 141 : The system according to any one of embodiments 133- 139, wherein said system is configured to operate said cartridge to: bind a sample to a column; elute DNA from the column and combine said DNA with a conversion reagent; heat the DN A/conversion reagent solution in a reaction chamber or tube to produce converted DNA; bind the converted DNA to a column; desulphonate and elute the DNA from the column; and perform PCR on the eluted desulphonated DNA in a reaction chamber or tube.
[0180] Embodiment 142: The system of embodiment 141, wherein said PCR is performed in the same reaction chamber or tube where the DN A/conversion reagent solution was previously heated.
[0181] Embodiment 143 : A cartridge for sample preparation, said cartridge comprising: a channel or chamber comprising an affinity matrix that binds DNA, a plurality of chambers disposed around a central valve assembly and selectively in fluid
communication with said central valve assembly where said central valve assembly is configured to accommodate a plunger that is capable of drawing fluid into or out of a chamber in fluid communication with said central valve wherein said plurality of chambers comprises: a chamber configured to receive up to about 5 ml or up to about 4 ml of sample solution; a chamber containing PEG; a chamber containing GTC-EtOH; a chamber containing an alkaline solution; and a chamber containing a buffer.
[0182] Embodiment 144: The cartridge of embodiment 143, wherein said plurality of chambers further comprises a chamber containing a bisulfite reagent.
[0183] Embodiment 145: The cartridge according to any one of embodiments 143- 144, wherein said plurality of chambers comprises a chamber containing a GTC-ethanol wash solution.
[0184] Embodiment 146: The cartridge of embodiment 145, wherein said GTC-ethanol wash solution comprises 1.25M guanidinium thiocyanate, 25 mM Tris pH 7.0, and 50% ethanol.
[0185] Embodiment 147: The cartridge according to any one of embodiments 143-146, wherein said PEG comprises PEG200.
[0186] Embodiment 148: The cartridge according to any one of embodiments 143- 147, wherein said alkaline solution comprises KOH.
[0187] Embodiment 149: The cartridge according to any one of embodiments 143- 148, wherein said buffer comprises Tris.
[0188] Embodiment 150: The cartridge according to any one of embodiments 143- 149, wherein said plurality of chambers comprises a chamber containing beads comprising one or more PCR primers and/or probes.
[0189] Embodiment 151 : The cartridge according to any one of embodiments 143- 150, wherein said chamber containing PEG contains about 1 ml of PEG.
[0190] Embodiment 152. The cartridge according to any one of embodiments
143-151, wherein said chamber containing an alkaline solution contains about 500 μΙ_, of solution.
[0191] Embodiment 153 : The cartridge according to any one of embodiments 143- 152, wherein said chamber containing GTC-EtOH contains about 2 ml GTC-EtOH.
[0192] Embodiment 154: The cartridge according to any one of embodiments 143- 153, wherein said chamber containing a buffer contains about 2 mL of buffer.
[0193] Embodiment 155: A high volume sample preparation (HVSP), said cartridge comprising: a channel or chamber comprising an affinity matrix that binds DNA, a plurality of chambers disposed around a central valve assembly and selectively in fluid
communication with said central valve assembly where said central valve assembly is configured to accommodate a plunger that is capable of drawing fluid into or out of a chamber in fluid communication with said central valve wherein said plurality of chambers comprises: at least two different chambers each configured to receive up to about 4.5 ml of sample solution; a chamber containing PEG; a chamber containing an alkaline solution; and a chamber containing a buffer.
[0194] Embodiment 156: The cartridge of embodiment 155, wherein said plurality of chambers comprises at least three different chambers each configured to receive up to 4 ml of sample solution.
[0195] Embodiment 157: The cartridge according to any one of embodiments 155-156, wherein said PEG comprises PEG200.
[0196] Embodiment 158: The cartridge according to any one of embodiments 155- 157, wherein said basic solution comprises KOH.
[0197] Embodiment 159: The cartridge according to any one of embodiments 155- 158, wherein said buffer comprises Tris.
[0198] Embodiment 160: The cartridge according to any one of embodiments 155- 159, wherein said plurality of chambers comprises a chamber containing a wash solution.
[0199] Embodiment 161 : The cartridge of embodiment 160, wherein said wash solution comprise 1.25M guanidinium thiocyanate, 25 mM Tris pH 7.0, and 50% ethanol.
[0200] Embodiment 162: The cartridge according to any one of embodiments 155-161, wherein said cartridge comprises a chamber configured for removal of a processed sample.
[0201] Embodiment 163 : The cartridge according to any one of embodiments 155- 162, wherein said sample chambers, when in use contain sample solution, GTC and isopropanol.
[0202] Embodiment 164: The cartridge of embodiment 163, wherein said sample chambers, when in use contain sample solution, GTC and isopropanol in substantially equal volumes.
[0203] Embodiment 165: The cartridge according to any one of embodiments 155- 164 wherein said cartridge, when in use, comprises 4 ml of sample solution disposed in each of said chambers configured to receive a sample.
[0204] Embodiment 166: The cartridge according to any one of embodiments 155- 165, wherein said cartridge provides DNA or RNA recovery that is substantially linear with respect to the sample volume between 0.5 ml and about 4 ml of sample.
[0205] Embodiment 167: The cartridge according to any one of embodiments 155-166, wherein said cartridge contains or is configured to receive a conversion reagent. [0206] Embodiment 168: The cartridge of embodiment 167, wherein said cartridge, when in use, performs a bisulfite conversion of DNA.
[0207] Embodiment 169: A lysis solution for preparation of a DNA sample from serum or plasma, said lysis solution comprising: GTC, a buffer, a detergent, and optionally an anti-foaming agent.
[0208] Embodiment 170: The lysis solution of embodiment 169, wherein said lysis solution for serum or plasma comprises GTC, Tris pH 7.0, Tween 20, and antifoam SE15.
[0209] Embodiment 171 : The lysis solution of embodiment 170, wherein said lysis solution for serum or plasma comprises about 4.5M GTC, about 45mM Tris pH 7.0, about 1% Tween20, and about 0.01% Antifoam SE15.
[0210] Embodiment 172: A lysis solution for preparation of a DNA sample from an
FFPE sample.
[0211] Embodiment 173 : The lysis solution of embodiment 172, wherein said lysis solution for FFPE samples comprises a buffer, a detergent, NaCl, MgCl2, a chelating agent, antifoam SE15, and sodium azide.
[0212] Embodiment 174: The lysis solution of embodiment 173, wherein said lysis solution for FFPE samples comprises about 1% Tween20, about 400mM NaCl, about 25mM EDTA, about lOmM MgCl2, about 50mM HEPES pH 7.2, about 0.01% antifoam SE15, and about 0.01% sodium azide.
[0213] Embodiment 175: A kit for the determination of DNA methylation, said kit comprising: a container containing a cartridge for determining the methylation state of a nucleic acid according to any one of embodiments 92-136.
[0214] Embodiment 176: The kit of embodiment 175, wherein said kit further comprises a container containing a lysis solution.
[0215] Embodiment 177: The kit of embodiment 176, wherein said lysis solution is a lysis solution for serum or plasma according to any one of embodiments 169-171.
[0216] Embodiment 178: The kit of embodimentx 176, wherein said lysis solution is a lysis solution for an FFPE sample according to any one of embodiments 172-174.
[0217] Embodiment 179: The kit according to any one of embodiments 175-178, wherein said kit comprises a container containing proteinase K.
[0218] Embodiment 180: The kit according to any one of embodiments 175-179, wherein said kit comprises a conversion reagent in said cartridge or in a container separate from the cartridge.
[0219] Embodiment 181 : The kit of embodiment 180, wherein said kit comprises said conversion reagent in a container separate from the cartridge.
[0220] Embodiment 182: The kit of embodiment 180, wherein said kit comprises said conversion reagent is provided in a chamber of the cartridge.
[0221] Embodiment 183 : The according to any one of embodiments 180-182, wherein said conversion reagent comprises a compound selected from the group consisting of sodium metabi sulfite, potassium bisulfite, cesium bisulfite, ammonium bisulfite, and DABSO.
[0222] Embodiment 184: The kit of embodiment 183, wherein said conversion reagent comprises ammonium bisulfite.
[0223] Embodiment 185: The kit according to any one of embodiments 175-184, wherein said kit comprises a container containing a sample processing reagent.
[0224] Embodiment 186: The kit of embodiment 185, wherein said sample processing reagent comprises guanidium thiocyanate.
[0225] Embodiment 187: The kit according to any one of embodiments 185-186, wherein said sample processing reagent comprise ethanol.
What is claimed is:
1. A method of determining the methylation state of a nucleic acid, said method comprising:
i) contacting a biological sample comprising a nucleic acid to a first matrix material comprising a first column or filter where said matrix material binds and/or filters nucleic acids in said sample and thereby purifies the DNA;
ii) eluting the bound DNA from the first matrix material and denaturing the DNA to produce eluted denatured DNA;
iii) heating the eluted DNA in the presence of a bisulfite reagent to produce a deaminated nucleic acid;
iv) contacting said deaminated nucleic acid to a second matrix material comprising a second column to bind said deaminated nucleic acid to said second matrix material;
v) desulfonating the bound deaminated nucleic acid and/or simultaneously eluting and desulfonating the nucleic acid by contacting the deaminated nucleic acid with an alkaline solution to produce a converted (e.g., bisulfite converted) nucleic acid;
vi) eluting said bisulfite converted nucleic acid from said second matrix material; and
vii) performing methylation specific PCR and/or nucleic acid sequencing, and/or high resolution melting analysis (HRM) on said converted nucleic acid to determine the methylation of said nucleic acid, wherein at least steps iv) through vi) are performed in a single reaction cartridge.
2. The method of claim 1 , wherein:
at least steps iv) through vi) are performed in a single reaction cartridge; or
at least steps iii) through vi) are performed in a single reaction cartridge; or
at least steps ii) through vi) are performed in a single reaction cartridge; or
at least steps i) through vi) are performed in a single reaction cartridge; and/or
3. The method according to any one of claims 1-2, wherein step vii is performed in the same reaction cartridge.
4. The method according to any one of claims 1-3, wherein:
said first matrix material and said second matrix material are the same material forming the same column; or
said first matrix material and said second matrix material form different columns.
5. The method according to any one of claims 1-4, wherein said methylation specific PCR, when performed, is performed in said cartridge.
6. The method according to any one of claims 1-5, wherein said nucleic acid sequencing, when performed, is performed in said cartridge or in a device coupled to said cartridge.
7. The method according to any one of claims 1-6, wherein said cartridge comprises a column comprising said first matrix material, a sample receiving chamber, a temperature controlled channel or chamber, a plurality of chambers containing reagents and/or buffers, and wherein when in use at least one of said chambers contains a desulfonation/elution buffer, and wherein said cartridge optionally comprises a second column comprising said second matrix material.
8. The method of claim 7, wherein, when in use, at least one of said chambers contains a reagent that provides bisulfite ions.
9. The method according to any one of claims 7-8, wherein said second column is absent.
10. The method according to any one of claims 7-9, wherein said temperature controlled channel or chamber comprises a thermocycling channel or chamber.
11. The method according to any one of claims 7-10, wherein said cartridge comprises one or more chambers containing one or more reagents selected from the group consisting of methylation specific PCR primers, methylation specific PCR probes, PCR enzyme(s), and PCR reaction buffer.
12. The method of claim 11, wherein said cartridge comprises:
one or more chambers containing one or more primers and probes for detection of methylation of a forward strand of a bisulfite-converted DNA; and/or
one or more chambers containing one or more primers and probes for detection of methylation of a reverse strand of a bisulfite-converted DNA.
13. The method according to any one of claims 7-12, wherein said sample receiving chamber, said column(s), said plurality of chambers, and when present, said temperature controlled channel or chamber and/or thermocycling channel or chamber, are selectively in fluid communication.
14. The method of claim 13, wherein said sample receiving chamber, said column(s), said plurality of chambers, and when present, said thermocycling channel or chamber, are selectively in fluid communication by microfluidic channels and valves.
15. The method of claim 13, wherein said sample receiving chamber, said column(s), said plurality of chambers, and when present, said thermocycling channel or chamber or a port into said thermocycling channel or chamber, are disposed around a central valve and selectively in fluid communication with a channel in said central valve, wherein said central valve is configured to accommodate a plunger that is capable of drawing fluid into or out of a chamber in fluid communication with said central valve.
16. The method according to any one of claims 7-15, wherein said cartridge, when in use, comprises:
a first chamber containing a sample;
a second chamber containing a guanidinium thiocyanate-ethanol (GTC-EtOH) solution;
a third chamber containing a bisulfite reagent;
a fourth chamber containing a buffer;
a fifth chamber containing a rinse solution; and a sixth chamber containing an elution/desulfonation reagent.
17. The method of claim 16, wherien said first chamber contains said sample in a GTC-EtOH- Tween extraction/precipitation reagent.
18. The method according to any one of claims 16-17, wherein:
the GTC-ETOH-Tween buffer is added at or near the time the sample is placed into the cartridge; and/or
the bisulfite reagent is added to the cartridge at or near the time the sample is placed in the cartridge; and/or .
19. The method according to any one of claims 16-17, wherein:
the GTC-ETOH-Tween buffer is provided as a component of the cartridge; and/or
the bisulfite reagent is provided as a component of the cartridge.
20. The method according to any one of claims 7-19, wherein said cartridge comprises a seventh chamber containing PCR primers and/or probes and/or PCR enzymes.
21. The method of claim 20, wherein said PCR primers, and/or probes, and/or enzymes are provided as beads.
22. The method according to any one of claims 1-21, wherein said biological sample comprises:
one or more samples selected from the group consisting of a cell, a tissue; and/or
a biological fluid containing a nucleic acid and/or a biological fluid selected from the group consisting of whole blood, plasma, serum, saliva, mucus, urine, sputum, and cerebrospinal fluid; and/or
a sample selected from the group consisting of a tissue sample, a formalin fixed paraffin embedded (FFPE) tissue, fresh frozen tissue, fine needle aspirates (FNA), and a core biopsy.
23. The method according to any one of claims 1-22, wherein:
said method comprises contacting said biological sample with a lysis solution; and/or
said method comprises providing said sample in said sample receiving chamber and contacting said sample with an extraction/precipitation solution.
24. The method according to any one of claims 1-23, wherein said bisulfite ion is provided as compound selected from the group consisting of sodium metabi sulfite, potassium bisulfite, cesium bisulfite, ammonium bisulfite, and DAB SO.
25. The method according to any one of claims 1-24, wherein:
said eluting the bound DNA comprises eluting and denaturing said DNA with an alkaline solution with a pH greater than about pH 10.5 or greater than about pH 12; and/or
said incubating the eluted DNA with bisulfite ions to produce a deaminated nucleic acid comprises transferring the DNA in a concentrated bisulfite solution into a temperature controlled channel or chamber (e.g., a thermocy cling channel or chamber) in said cartridge and heating said mixture; and/or
said contacting said deaminated nucleic acid to a second matrix material comprises mixing the DNA-bisulfite solution with GTC-EtOH and dispensing the solution over said second matrix material; and/or
said desulfonating the bound deaminated nucleic acid comprises eluting the DNA from said second column with a high pH desulphonation buffer and incubating said solution.
26. The method according to any one of claims 1-25, wherein after the incubation with bisulfite ions, said temperature controlled channel or chamber is washed with a buffer to remove the residual bisulfite and neutralize pH.
27. The method of claim 26, wherine said temperature controlled channel or chamber is sufficiently free of bisulfite ion to permit PCR to be performed in said channel or chamber.
28. The method according to any one of claims 1-27, wherein
methylation specific PCR is performed to determine methylation of target nucleic acid sequences.
29. The method of claim 28, wherein:
methylation specific PCR (MSP) is performed using primers specific for methylated sequences and/or primers specific for unmethylated sequences; and/or
TaqMan PCR reactions are performed with primers specific for bisulfite-converted methylated and/or unmethylated sequences.
30. The method of claim 28, wherein said methylation specific PCR comprises a MethyLight protocol.
31. The method according to any one of claims 28-30, wherein said MSP utilizes one or more fluorescent probes that are markers for amplified methylated sequences and/or one or more fluorescent probes that are markers for amplified unmethylated sequences.
32. The method of claim 31, wherein said fluorescent probes comprise a fluorescent reporter dye and a quencher dye where the probe provides a signal upon cleavage by 5' to 3' nuclease activity of Taq DNA polymerase.
33. The method according to any one of claims 31-32, wherein
a methylation signal is determined by the combined signal for a plurality of probes each specific to a different methylated region in an amplified region of interest; and/or
a methylation signal is determined by a plurality of probes specific for the same methylated region in an amplified region of interest.
34. The method according to any one of claims 31-32, wherein a methylation signal is determined by a single probe in the amplified region of interest.
35. The method according to any one of claims 31-34, wherein said probes are run singleplex or multiplex.
36. The method according to any one of claims 31-35, wherein a plurality of probes are run as a nested PCR reaction.
37. The method according to any one of claims 1-36, wherein:
PCR is performed for unconverted DNA as a control; and/or
PCR is performed for unconverted DNA as a control.
38. The method according to any one of claims 1-37, wherein a bisulfite reaction and a PCR reaction, or a desulfonation reaction and a PCR reaction, or a bisulfite reaction, a desulfonation reaction and a PCR reaction are all performed in the same reaction tube or chamber.
39. The method according to any one of claims 1-38, wherein said contacting a biological sample comprising a nucleic acid to a first matrix material comprises contacting a sample containing RNA to said first matrix material, where said matrix material binds said RNA thereby purifies the RNA.
40. The method of claim 39, wherein said method comprises eluting said
RNA from said matrix material substantially independently of the DNA.
41. The method according to any one of claims 39-40, wherein:
said RNA is eluted and stored in a chamber; and/or
reverse transcription (RT) is performed on said RNA and qRT-PCR is performed to determine the level of target RNA sequences.
42. The method according to any one of claims 40-41, where the RNA fraction is used to elute the bisulfite converted nucleic acid from said second matrix material and mix with the bisulfite-converted DNA, or is mixed with eluted bisulfite-converted DNA.
43. The method of claim 42, wherein RT is performed on said RNA prior to, or after, combination with the bisulfite-converted DNA.
44. The method according to any one of claims 42-43, wherein qRT-PCR is performed for RT RNA in the mixture to determine the level of target RNA sequences and methylation specific PCR is performed on the mixture to determine methylation of target DNA sequences.
45. The method according to any one of claims 1-44, where methylation is determined for a promoter region of a gene selected from the group consisting oiMGMT. RASSF1A, ADAMTS1, BNC1, HIST1H3C, HOXB4, RASGRF2, 1M6SF1, and AKR1B1.
46. The method according to any one of claims 39-45, wherein the expression level of RNA is determined for a methyltransferase.
47. A cartridge for determining the methylation state of a nucleic acid, said cartridge comprising:
a column comprising a first matrix material, a sample receiving chamber, a temperature controlled channel or chamber, a plurality of chambers containing reagents and/or buffers, and when in use at least one of said chambers contains a bisulfite reagent, and at least one of said chambers contains a desulphonation/elution buffer, and wherein said cartridge optionally comprises a second column comprising said second matrix material.
48. The cartridge of claim 47, wherein said cartridge, when in use, comprises a chamber containing a reagent comprising guanidinium thiocyanate ethanol (GTC-EtOH).
49. The cartridge according to any one of claims 47-48, wherein said second column is absent.
50. The cartridge according to any one of claims 47-49, wherein said temperature controlled channel or chamber is a thermocycling channel or chamber.
51. The cartridge according to any one of claim 47-50, wherein said bisulfite reagent comprises a compound selected from the group consisting of ammonium bisulfite sodium metabi sulfite, potassium bisulfite, cesium bisulfite, and DABSO.
52. The cartridge according to any one of claims 47-51, wherein said cartridge comprises one or more chambers containing one or more reagents selected from the group consisting of methylation specific PCR primers, methylation specific PCR probes, PCR enzyme(s), and PCR reaction buffer.
53. The cartridge of claim 52, wherein said cartridge contains at least two chambers containing one or more reagents selected from the group consisting of
methylation specific PCR primers, methylation specific PCR probes, PCR enzyme(s), and PCR reaction buffer.
54. The cartridge according to any one of claims 47-53, wherein
said cartridge contains at least one chamber containing primers and probes for detection of methylation of a forward strand of a converted DNA; and/or
said cartridge contains at least one chamber containing primers and probes for detection of methylation of a reverse strand of a converted DNA.
55. The cartridge according to any of claims 52-54, wherein said PCR primers, and/or probes, and/or enzymes are provided as beads.
56. The cartridge according to any one of claims 47-55, wherein said sample receiving chamber, said column(s), said plurality of chambers, and said temperature-controlled heating channel or chamber, are selectively in fluid communication.
57. The cartridge of claim 56, wherein said sample receiving chamber, said column(s), said plurality of chambers, and said temperature controlled channel or chamber, are selectively in fluid communication by microfluidic channels and valves.
58. The cartridge of claim 56, wherein said sample receiving chamber, said column(s), said plurality of chambers, and said temperature controlled channel or chamber or a port into said temperature controlled channel or chamber, are disposed around a central valve and selectively in fluid communication with a channel in said central valve, wherein said central valve is configured to accommodate a plunger that is capable of drawing fluid into or out of a chamber in fluid communication with said central valve.
59. The cartridge according to any one of claims 47-58, wherein said cartridge is configured so that, when in use, said cartridge comprises:
a first chamber containing a sample;
a second chamber containing a guanidinium thiosulfate-ethanol
(GTC-EtOH) solution;
a third chamber containing a bisulfite reagent;
a fourth chamber containing a buffer;
a fifth chamber containing a rinse solution; and a sixth chamber containing an elution/desulphonation reagent.
60. The cartridge of claim 59, wherein said first chamber contains said sample in a GTC-EtOH- Tween extraction/precipitation reagent.
61. The cartridge according to any one of claims 47-60, wherein:
the cartridge is configured for the bisulfite reagent to be added to the cartridge at or near the time the sample is placed in the cartridge; and/or
the cartridge is configured for addition of GTC-ETOH- Tween buffer at or near the time the sample is placed into the cartridge.
62. The cartridge according to any one of claims 47-60, wherein:
the bisulfite reagent is provided as a component of the cartridge; and/or
the GTC-ETOH-Tween buffer is provided as a component of the cartridge.
63. The cartridge according to any one of claims 47-62, wherein said cartridge comprises a seventh chamber containing PCR primers and/or probes and/or PCR enzymes.
64. The cartridge according to any one of claims 47-63, wherein
said cartridge comprises one or more chambers containing primers specific for bisulfite-converted methylated and/or unmethylated sequences; and/or
said cartridge comprises one or more chambers containing reagents for TaqMan PCR reactions; and/or
said cartridge comprises one or more chambers containing one or more fluorescent probes that are markers for amplified methylated sequences and/or one or more fluorescent probes that are markers for amplified unmethylated sequences.
65. The cartridge of claim 64, wherein said probes comprise a fluorescent reporter dye and a quencher dye, where the probes provides a signal upon cleavage by the 5' to 3' nuclease activity of Taq DNA polymerase.
66. The cartridge according to any one of claims 64-65, wherein
said cartridge comprises a plurality of probes each specific to a different methylated region in an amplified region of interest; or
said cartridge comprises a plurality of probes each specific to the same methylated region in an amplified region of interest; or
said cartridge comprises a single probe specific to a methylated region in an amplified region of interest.
67. The cartridge according to any one of claims 47-66, wherein
said cartridge contains primers and/or probes to determine
methylation of a promoter region of a gene selected from the group consisting oiMGMT, RASSF1A, ADAMTS1, BNC1, HIST1H3C, HOXB4, RASGRF2, 1M6SF1, and AKR1B1; and/or
said cartridge contains one or more primers shown in Tables 5, 9, or 10, and/or one or more probes shown in Tables 5, 9, or 10.
68. The cartridge according to any one of claims 47-67, wherein the cartridge is configured for determination of the expression level of RNA for a
methyltransferase.
69. A system for determining the methylation of a nucleic acid in a biological sample, said system comprising:
an enclosure configured to contain one or more sample processing modules, each sample processing module configured to hold a removable cartridge according to any one of claims 47-68;
where said system is configured to operate the sample processing modules to perform sample processing to determine methylation of one or more target nucleic acids and optionally to determine the level of one or more target DNA sequences within a corresponding removable sample cartridge, wherein said processing on a sample within the corresponding removable sample cartridge performs a method according to any one of claims 1-46.
70. The system of claim 69, wherein:
said system is configured to contain one sample processing module; or
said system is configured to contain at least two sample processing modules, or at least 4 sample processing modules, or at least 8 sample processing modules, or at least 12 sample processing modules, or at least 16 sample processing modules, or at least 20 sample processing modules, or at least 24 sample processing modules, or at least 28 sample processing modules, or at least 32 sample processing modules, or at least 64 sample processing modules, or at least 128 sample processing modules.
71. The system according to any one of claims 69-70, wherein:
said modules comprise one or more heating plates to heat a temperature controlled chamber or channel in said cartridge; and/or
said modules comprise a fan configured to cool a temperature controlled channel or chamber in said cartridge, is a thermocycling channel or chamber; and/or
said modules comprise circuitry to pass information (e.g., optical information) to a computer for analysis; and/or
said modules comprise optical blocks to provide excitation and/or detection of one or more optical signals produced by reactions in said cartridge.
72. The system according to any one of claims 69-71, wherein:
said system is configured to operate said cartridge to perform a method according to any one of claims 1-46; and/or
said system is configured to operate said cartridge to:
bind a sample to a column;
elute DNA from the column and combine said DNA with a conversion reagent;
heat the DNA/conversion reagent solution in a reaction chamber or tube to produce converted DNA;
bind the converted DNA to a column;
desulphonate and elute the DNA from the column; and perform PCR on the eluted desulphonated DNA in a reaction chamber or tube.
73. The system of claim 72, wherein said PCR is performed in the same reaction chamber or tube where the DNA/conversion reagent solution was previously heated.
74. A cartridge for sample preparation, said cartridge comprising:
a channel or chamber comprising an affinity matrix that binds DNA, a plurality of chambers disposed around a central valve assembly and selectively in fluid communication with said central valve assembly where said central valve assembly is configured to accommodate a plunger that is capable of drawing fluid into or out of a chamber in fluid communication with said central valve wherein said plurality of chambers comprises:
a chamber configured to receive up to about 5 ml or up to about 4 ml of sample solution;
a chamber containing PEG;
a chamber containing GTC-EtOH;
a chamber containing an alkaline solution; and a chamber containing a buffer.
75. The cartridge of claim 74, wherein:
said plurality of chambers further comprises a chamber containing a bisulfite reagent; and/or
said plurality of chambers comprises a chamber containing a GTC-ethanol wash solution.
76. The cartridge according to any one of claims 74-75. wherein said plurality of chambers comprises a chamber containing beads comprising one or more PCR primers and/or probes.
77. The cartridge according to any one of claims 74-76, wherein
said chamber containing PEG contains about 1 ml of PEG; and/or said chamber containing an alkaline solution contains about 500 μΙ_, of solution; and/or
said chamber containing GTC-EtOH contains about 2 ml GTC-EtOH; and/or
said chamber containing a buffer contains about 2 mL of buffer.
78. A high volume sample preparation (HVSP), said cartridge
comprising:
a channel or chamber comprising an affinity matrix that binds DNA, a plurality of chambers disposed around a central valve assembly and selectively in fluid communication with said central valve assembly where said central valve assembly is configured to accommodate a plunger that is capable of drawing fluid into or out of a chamber in fluid communication with said central valve wherein said plurality of chambers comprises:
at least two different chambers each configured to receive up to about 4.5 ml of sample solution;
a chamber containing PEG;
a chamber containing an alkaline solution; and a chamber containing a buffer.
79. The cartridge of claim 78, wherein said plurality of chambers comprises at least three different chambers each configured to receive up to 4 ml of sample solution.
80. The cartridge according to any one of claims 78-79, wherein
said PEG comprises PEG200; and/or
said basic solution comprises KOH; and/or
said buffer comprises Tris.
81. The cartridge according to any one of claims 78-80, wherein said plurality of chambers comprises a chamber containing a wash solution.
82. The cartridge according to any one of claims 78-81, wherein said sample chambers, when in use contain sample solution, GTC and isopropanol.
83. The cartridge according to any one of claims 78-82 wherein said cartridge, when in use, comprises 4 ml of sample solution disposed in each of said chambers configured to receive a sample.
84. The cartridge according to any one of claims 78-83, wherein said cartridge provides DNA or RNA recovery that is substantially linear with respect to the sample volume between 0.5 ml and about 4 ml of sample.
85. The cartridge according to any one of claims 78-84, wherein said cartridge contains or is configured to receive a conversion reagent.
86. The cartridge of claim 85, wherein said cartridge, when in use, performs a bisulfite conversion of DNA.
87. A lysis solution for preparation of a DNA sample from serum or plasma, said lysis solution comprising: GTC, a buffer, a detergent, and optionally an anti-foaming agent.
88. The lysis solution of claim 87, wherein said lysis solution for serum or plasma comprises GTC, Tris pH 7.0, Tween 20, and antifoam SE15.
89. The lysis solution of claim 88, wherein said lysis solution for serum or plasma comprises about 4.5M GTC, about 45mM Tris pH 7.0, about 1% Tween20, and about 0.01% Antifoam SE15.
90. A lysis solution for preparation of a DNA sample from an FFPE sample.
91. The lysis solution of claim 90, wherein said lysis solution for FFPE samples comprises a buffer, a detergent, NaCl, MgCl2, a chelating agent, antifoam SE15, and sodium azide.
92. The lysis solution of claim 91, wherein said lysis solution for FFPE samples comprises about 1% Tween20, about 400mM NaCl, about 25mM EDTA, about lOmM MgCl2, about 50mM HEPES pH 7.2, about 0.01% antifoam SE15, and about 0.01% sodium azide.
93. A kit for the determination of DNA methylation, said kit comprising: a container containing a cartridge for determining the methylation state of a nucleic acid according to any one of claims 47-71.
94. The kit of claim 93, wherein said kit further comprises a container containing a lysis solution for serum or plasma according to any one of claims 87-89; and/or
a container containing a lysis solution for an FFPE sample according to any one of claims 90-92; and/or
a container containing proteinase K; and/or
a conversion reagent in said cartridge or in a container separate from the cartridge; and/or
a container containing a cartridge for sample preparation according to any one of claims 78-84.
95. A cartridge for the detection of methylation markers of a cancer, said cartridge comprising:
a plurality of chambers and a thermocycling channel or chamber, wherein said plurality of chambers and a port into said thermocycling channel or chamber are disposed around a central valve assembly and selectively in fluid communication with said central valve assembly where said central valve assembly is configured to
accommodate a plunger that is capable of drawing fluid into or out of a chamber or port in fluid communication with said central valve wherein said plurality of chambers comprises:
a sample receiving chamber;
a chamber containing or configured to receive a bisulfite reagent
(conversion reagent);
a chamber containing a wash solution;
a chamber containing a Tris buffer;
a chamber containing an alkaline solution comprising KOH;
a chamber containing beads that provide a PCR master mix; and
a chamber containing beads that provide PCR primers and probes to detect methylation of one or more gene promoters whose methylation state is a marker for a cancer.
96. The cartridge of claim 95, wherein said bisulfite reagent comprises a compound selected from the group consisting of sodium metabi sulfite, potassium bisulfite, cesium bisulfite, ammonium bisulfite, and DABSO.
97. The cartridge according to any of claims 95-96, wherein said chamber containing beads that provide PCR primers and probes to detect methylation of one or more gene promoters comprises beads that provide PCR primers and probes to detect methylation of one or more gene promoters whose methylation state is a marker for a cancer selected from the group consisting of breast cancer, pancreatic cancer, prostate cancer, brain cancer, and lung cancer.
98. The cartridge according to any of claims 95-97, wherein said chamber containing beads that provide PCR primers and probes to detect methylation of one or more gene promoters comprises beads that provide PCR primers and probes to detect methylation of the promoters of one or more genes selected from the group consisting of RASSF1A, AKR1B1, HOXB4, HIST1H3C, RASGRF2, M6SF1, BRCA1, BNC1, ADAMTS1, CDOl, SOX17, TAC1, HOXA 7, and MGMT.
99. The cartridge according to any of claims 95-98, wherein:
said chamber containing beads that provide PCR primers and probes to detect methylation of one or more gene promoters comprises beads that provide PCR primers and probes to detect methylation of one or more gene promoters whose methylation state is a marker for pancreatic cancer; and/or
said chamber containing beads that provide PCR primers and probes to detect methylation of one or more gene promoters comprises beads that provide PCR primers and probes to detect methylation of one or more gene promoters whose methylation state is a marker for breast cancer; and/or
said chamber containing beads that provide PCR primers and probes to detect methylation of one or more gene promoters comprises beads that provide PCR primers and probes to detect methylation of one or more gene promoters whose methylation state is a marker for lung cancer; and/or
said chamber containing beads that provide PCR primers and probes to detect methylation of one or more gene promoters comprises beads that provide PCR primers and probes to detect methylation of one or more gene promoters whose methylation state is a marker for brain cancer
100. The cartridge of claim 99, wherein
said chamber containing beads that provide PCR primers and probes to detect methylation of one or more gene promoters comprises beads that provide PCR primers and probes to detect methylation of genes whose methylation state is a marker for pancreatic cancer wherein the primers and/or probes comprise primers and/or probes to detect methylation of the promoters of ADAMTS1, and/or BNC1;
said chamber containing beads that provide PCR primers and probes to detect methylation of one or more gene promoters comprises beads that provide PCR primers and probes to detect methylation of genes whose methylation state is a marker for breast cancer wherein the primers and/or probes comprise primers and/or probes to detect methylation of the promoters of one, two, three, four, five, or all genes selected from the group consisting oiBRCAl, RASSF1A, AKR1B1, HOXB4, HIST1H3C, RASGRF2, and IM6SF1; and/or
said chamber containing beads that provide PCR primers and probes to detect methylation of one or more gene promoters comprises beads that provide PCR primers and probes to detect methylation of genes whose methylation state is a marker for lung cancer wherein the primers and/or probes comprise primers and/or probes to detect methylation of the promoters of one, two, three, or all genes selected from the group consisting oi CDOl, SOX17, TAC1, and HOXA7; and/or
said chamber containing beads that provide PCR primers and probes to detect methylation of one or more gene promoters comprises beads that provide PCR primers and probes to detect methylation of genes whose methylation state is a marker for brain cancer wherein the primers and/or probes comprise primers and/or probes to detect methylation of the promoter of MGMT.
101. A method of preparing a sample of cfDNA from serum or plasma, said method comprising:
combining a proteinase K treated sample of serum or plasma with a lysis solution according to any one of claims 87-89, and an alcohol to form a sample solution;
loading said sample solution into a sample receiving chamber in a cartridge according to any one of claims 74-77, or into a sample receiving chamber in a cartridge according to any one of claims 78-86; and
operating said cartridge to bind DNA in said sample to said affinity matrix and then to wash and release said DNA from said matrix.
102. The method of claim 101, wherein said combining a proteinase K treated sample of serum or plasma comprises combining said sample, lysis solution and alcohol in proportions corresponding to about 1.3 ml proteinase K treated serum or plasma, 2.2 mL lysis solution; and about 1.5 ml alcohol.
103. The method according to any one of claims 101-102, wherein
said sample comprises serum; and/or
said sample comprises plasma.
104. The method according to any one of claims 101-103, wherein said method comprises:
introducing said cartridge into a sample processing module in a system according to any one of claims 69-73; and/or
operating said cartridge to convert said DNA for methylation detection; and/or
operating said cartridge to perform one or more PCR reactions using said DNA or converted DNA as a template.
105. The method according to any one of claims 101-104, wherein said loading comprise loading said sample solution into one or more sample receiving chambers in a cartridge according to any one of claims 78-83.
106. The method of claim 105, wherein said method further comprises transferring the released DNA to a second cartridge for methylation detection and/or PCR.
107. The method of claim 106, wherein said second cartridge is a cartridge according to any one of claims 47-68.
108. The method according to any one of claims 106-107, wherein:
said method further comprises operating said second cartridge to convert said DNA for methylation detection; and/or
said method further comprises operating said second cartridge to perform one or more PCR reactions using said DNA or converted DNA as a template.
109. The method according to any one of claims 106-108, wherein said operating said second cartridge comprises introducing said second cartridge into a sample processing module in a system according to any one of claims 69-73.
110. A method of preparing a DNA from an FFPE sample, said method comprising:
combining a formalin-fixed paraffin embedded sample with a lysis solution according to any one of claims 90-92;
heating said lysis solution containing said sample;
adding an alcohol to said sample to form a sample solution;
loading said sample solution into a sample receiving chamber in a cartridge according to any one of claims 74-77, or into a sample receiving chamber in a cartridge according to any one of claims 78-86; and
operating said cartridge to bind DNA in said sample to said affinity matrix and then to wash and release said DNA from said matrix.
111. The method of claim 110, wherein:
said heating comprises adding proteinase K to said sample and heating said sample; and/or
said heating comprises adding about 50 μΙ_, proteinase K to about 1.2 mL of FFPE lysis solution containing a FFEP sample; and/or
said heating comprises heating said lysis solution to a temperature ranging from about 50°C to about 60°C; and/or
said heating is for a period of time ranging up to about 4 hours, or up to about 5 hours, or up to about 6 hours.
112. The method of claim 110-111, wherein said method comprises: adding alcohol to said lysis solution in a volume ratio of about 1 : 1 lysis solutiomalcohol; and/or
operating said cartridge comprises introducing said cartridge into a sample processing module in a system according to any one of claims 69-73; and/or
operating said cartridge to convert said DNA for methylation detection; and/or
operating said cartridge to perform one or more PCR reactions using said DNA or converted DNA as a template.
113. The method according to any one of claims 110-112, wherein:
said loading comprise loading said sample solution into one or more sample receiving chambers in a cartridge according to any one of claims 78-83; and/or said method further comprises transferring the released DNA to a second cartridge for methylation detection and/or PCR wherein said second cartridge is a cartridge according to any one of claims 47-68.
114. The method of claim 113, wherein:
said method further comprises operating said second cartridge to convert said DNA for methylation detection; and/or
said method further comprises operating said second cartridge to perform one or more PCR reactions using said DNA or converted DNA as a template;
and/or
said operating said second cartridge comprises introducing said second cartridge into a sample processing module in a system according to any one of claims 69-73.
115. A method of detecting a cancer and/or staging a cancer, and/or the predisposition to a cancer in a subject, said method comprising:
providing a biological sample from said subject, wherein said sample comprises a DNA;
utilizing a cartridge according to any one of claims 95-100 to detect methylation of one or more gene promoters in said DNA whose methylation state is a marker for a cancer, where an increase in methylation of said one or more gene promoters is indicative of the presence of a cancer or a predisposition to a cancer or a stage of a cancer or precancer.
116. The method of claim 115, wherein said cancer is a cancer selected from the group consisting of breast cancer, pancreatic cancer, prostate cancer, brain cancer, a lung cancer, a B cell lymphoma, lung cancer, a bronchus cancer, a colorectal cancer, a a stomach cancer, an ovarian cancer, a urinary bladder cancer, a brain or central nervous system cancer, a peripheral nervous system cancer, an esophageal cancer, a cervical cancer, a melanoma, a uterine or endometrial cancer, a cancer of the oral cavity or pharynx, a liver cancer, a kidney cancer, a biliary tract cancer, a small bowel or appendix cancer, a salivary gland cancer, a thyroid gland cancer, a adrenal gland cancer, an osteosarcoma, a
chondrosarcoma, a liposarcoma, a testes cancer, and a malignant fibrous histiocytoma.
117. The method according to any one of claims 115-116, wherein
said sample comprise a sample from serum or plasma; and/or said sample comprise an FFPE sample.
118. The method according to any one of claims 115-117, wherein said one or more gene promoters comprise the promoters of one or more genes selected from the group consisting of RASSFIA, AKRIBI, HOXB4, HIST1H3C, RASGRF2, M6SF1, BRCAl, BNC1, ADAMTSl, CDOl, SOX17, TAC1, HOXA7, and MGMT.
119. The method according to any one of claims 115-117, wherein
said cancer is pancreatic cancer and said one or more gene promoters comprise the promoters of one, two, three, or four genes selected from the group consisting of ADAMTSl, and BNC1; and/or
said cancer is breast cancer and said one or more gene promoters comprise the promoters of one, two, three, four, five, or all genes selected from the group consisting of BRCAl, RASSFIA, AKRIBI, HOXB4, HIST1H3C, RASGRF2, and TM6SF1; and/or .
said cancer is lung cancer and said one or more gene promoters comprise the promoters of one, two, three, for all genes selected from the group consisting of CDOl, SOX17, TAC1, and HOXA7; and/or
said cancer is brain cancer and said one or more gene promoters comprise the promoter of MGMT.
120. A method of converting cytosine residues in a DNA to uracil, while leaving 5-methylcytosine residues substantially unaffected, said method comprising:
contacting a sample comprising DNA with DAB SO to convert said
DNA; and
desulfonating the converted DNA, to produce a DNA in which cytosine residues are converted to uracil, but 5-methylcytosine residues substantially unaffected.
121. The method of claim 120, wherein
said contacting comprises heating the DABSO/DNA solution to a temperature ranging from about 55°C to about 90°C and/or
said DABSO is reacted with the DNA for a period of time ranging from about 15 minutes up to about 90 minutes.
A method of analyzing DNA methylation, said method comprising: providing a DNA sample;
converting DNA in said sample according to any one of claims 120- 121; and
performing methylation specific PCR and/or nucleic acid sequencing, and/or high resolution melting analysis (HRM) on the converted nucleic acid to determine the methylation of said nucleic acid.
123. The method of claim 122, wherein said providing a DNA sample comprises preparing a sample according to any one of claims 101-104 or according to any one of claims 110-114.
124. A kit for detection of methylation state of a DNA, said kit comprising:
a container containing a conversion reagent comprising DABSO; and a container containing a desulphonation reagent.
The kit of claim 124, wherein said kit comprises:
a column comprising an affinity matrix; and/or a container containing a binding buffer; and/or a container containing an elution buffer; and/or a container containing a wash buffer; and/or
a container containing a lysis solution according to any one of claims 87-89; and/or
a container containing a lysis solution according to any one of claims
90-92.
126. The kit according to any one of claims 124-125, wherein said kit comprises:
a cartridge according to any one of claims 74-78; and/or
a cartridge according to any one of claims 78-84.
127. A set of primers and probes for the determination of methylation of MGMT using a nested PCR reaction, optionally with the determination of methylation of ACTB as a control, said set comprising the following primers and probes:
an external forward primer comprising the nucleotide sequence GTTTT(T*)AGAAYG(T*)TTTGYGTTT (SEQ ID NO:263);
an external reverse primer comprising the nucleotide sequence AAAAAAC(T*)CCRCACTCTTCC (SEQ ID NO:265);
an internal forward primer comprising the nucleotide sequence TTTCGACGTTCGTAGGTTTTCGC (SEQ ID NO:266);
an internal reverse primer comprising the nucleotide sequence
GCACTCTTCCGAAAACGAAACG (SEQ ID NO:267); and
a probe comprising the nucleotide sequence fluor-CCAAACAC(T*)CACCAAATC(N*)CAAAC-blocker (SEQ ID NO: 268); and
optionally further comprising the following primers and probes for the detection of ACTB methylation:
an external forward primer (102) comprising the nucleotide sequence GTGATGGAGGAGGTTTAGTAAGTT (SEQ ID NO: 103);
an external reverse primer (103) comprising the nucleotide sequence CCAATAAAACCTACTCCTCCCTTAA (SEQ ID NO: 104);
an internal forward primer (148) comprising the nucleotide sequence GGTTTAGTAAGTTTTTTGGATTGTG (SEQ ID NO: 149);
an internal reverse primer (149) comprising the nucleotide sequence CCTTAAAAATTACAAAAACCACAAC (SEQ ID NO: 150); and
a probe (178) comprising the nucleotide sequence fluor-CCACCACCCAACACA(N*)CAA(T*)AACAAACAC-blocker (SEQ ID NO: 179).
128. A method of determining the methylation of MGMT using methylation specific PCR said method comprising:
providing a converted {e.g., bisulfite converted) DNA containing a promoter region of the MGMT gene;
performing methylation specific PCR for MGMT methylation using a nested PCR reaction comprising the following primers and probes
an external forward primer comprising the nucleotide sequence GTTTT(T*)AGAAYG(T*)TTTGYGTTT (SEQ ID NO:263);
an external reverse primer comprising the nucleotide sequence AAAAAAC(T*)CCRCACTCTTCC(SEQ ID NO:265);
an internal forward primer comprising the nucleotide sequence TTTCGACGTTCGTAGGTTTTCGC(SEQ ID NO:266);
an internal reverse primer comprising the nucleotide sequence
GCACTCTTCCGAAAACGAAACG(SEQ ID NO:267); and
a probe comprising the nucleotide sequence fluor-CCAAACAC(T*)CACCAAATC(N*)CAAAC-blocker (SEQ ID NO: 268); and
detecting and/or quantifying the PCR amplification product to provide determine methylation of said MGMT gene; and
optionally providing a converted {e.g., bisulfite converted) DNA containing a promoter region of the ACTB gene (e.g., as a control);
performing methylation specific PCR for ACTB methylation using a nested PCR reaction comprising the following primers and probes
an external forward primer comprising the nucleotide sequence GTGATGGAGGAGGTTTAGTAAGTT (SEQ ID NO: 103);
an external reverse primer comprising the nucleotide sequence CC AATAAAACCT ACTCCTCCCTTAA (SEQ ID NO : 104);
an internal forward primer comprising the nucleotide sequence GGTTTAGTAAGTTTTTTGGATTGTG (SEQ ID NO: 149);
an internal reverse primer comprising the nucleotide sequence CCTTAAAAATTACAAAAACCACAAC (SEQ ID NO: 150); and
a probe comprising the nucleotide sequence fluor-CCACCACCCAACACA(N*)CAA(T*)AACAAACAC-blocker (SEQ ID NO: 179); and detecting and/or quantifying the PCR amplification product to provide determine methylation of said ACTB gene.
| # | Name | Date |
|---|---|---|
| 1 | 201817001016-TRANSLATIOIN OF PRIOIRTY DOCUMENTS ETC. [09-01-2018(online)].pdf | 2018-01-09 |
| 2 | 201817001016-STATEMENT OF UNDERTAKING (FORM 3) [09-01-2018(online)].pdf | 2018-01-09 |
| 3 | 201817001016-FORM 1 [09-01-2018(online)].pdf | 2018-01-09 |
| 4 | 201817001016-DRAWINGS [09-01-2018(online)].pdf | 2018-01-09 |
| 5 | 201817001016-DECLARATION OF INVENTORSHIP (FORM 5) [09-01-2018(online)].pdf | 2018-01-09 |
| 6 | 201817001016-COMPLETE SPECIFICATION [09-01-2018(online)].pdf | 2018-01-09 |
| 7 | abstract.jpg | 2018-02-15 |
| 8 | 201817001016.pdf | 2018-03-23 |
| 9 | 201817001016-FORM-26 [03-04-2018(online)].pdf | 2018-04-03 |
| 10 | 201817001016-Power of Attorney-060418.pdf | 2018-04-16 |
| 11 | 201817001016-Correspondence-060418.pdf | 2018-04-16 |
| 12 | 201817001016-Proof of Right (MANDATORY) [30-06-2018(online)].pdf | 2018-06-30 |
| 13 | 201817001016-FORM 3 [30-06-2018(online)].pdf | 2018-06-30 |
| 14 | 201817001016-OTHERS-040718.pdf | 2018-07-09 |
| 15 | 201817001016-Correspondence-040718.pdf | 2018-07-09 |
| 16 | 201817001016-FORM 3 [10-08-2018(online)].pdf | 2018-08-10 |
| 17 | 201817001016-FORM 18 [10-06-2019(online)].pdf | 2019-06-10 |
| 18 | 201817001016-FORM 3 [22-01-2021(online)].pdf | 2021-01-22 |
| 19 | 201817001016-FORM 3 [22-07-2021(online)].pdf | 2021-07-22 |
| 20 | 201817001016-FER.pdf | 2021-12-10 |
| 21 | 201817001016-FORM 4(ii) [02-06-2022(online)].pdf | 2022-06-02 |
| 22 | 201817001016-FORM 3 [26-07-2022(online)].pdf | 2022-07-26 |
| 23 | 201817001016-OTHERS [09-09-2022(online)].pdf | 2022-09-09 |
| 24 | 201817001016-FER_SER_REPLY [09-09-2022(online)].pdf | 2022-09-09 |
| 25 | 201817001016-CORRESPONDENCE [09-09-2022(online)].pdf | 2022-09-09 |
| 26 | 201817001016-CLAIMS [09-09-2022(online)].pdf | 2022-09-09 |
| 27 | 201817001016-ABSTRACT [09-09-2022(online)].pdf | 2022-09-09 |
| 28 | 201817001016-FORM 3 [13-01-2023(online)].pdf | 2023-01-13 |
| 29 | 201817001016-FORM 3 [05-09-2023(online)].pdf | 2023-09-05 |
| 30 | 201817001016-US(14)-HearingNotice-(HearingDate-10-01-2024).pdf | 2023-12-13 |
| 31 | 201817001016-REQUEST FOR ADJOURNMENT OF HEARING UNDER RULE 129A [27-12-2023(online)].pdf | 2023-12-27 |
| 32 | 201817001016-US(14)-ExtendedHearingNotice-(HearingDate-12-02-2024).pdf | 2024-01-08 |
| 33 | 201817001016-Correspondence to notify the Controller [06-02-2024(online)].pdf | 2024-02-06 |
| 34 | 201817001016-Written submissions and relevant documents [22-02-2024(online)].pdf | 2024-02-22 |
| 35 | 201817001016-PatentCertificate23-02-2024.pdf | 2024-02-23 |
| 36 | 201817001016-IntimationOfGrant23-02-2024.pdf | 2024-02-23 |
| 1 | SearchHistory(46)E_09-12-2021.pdf |