Sign In to Follow Application
View All Documents & Correspondence

Integrated Purification And Measurement Of Dna Methylation And Co Measurement Of Mutations And/Or Mrna Expression Levels In An Automated Reaction Cartridge

Abstract: Methods of determining methylation of DNA are provided. In one illustrative, but non-limiting embodiment the method comprises i) contacting a biological sample comprising a nucleic acid to a first matrix material comprising a first column or filter where said matrix material binds and/or filters nucleic acids in said sample and thereby purifies the DNA; ii) eluting the bound DNA from the first matrix material and denaturing the DNA to produce eluted denatured DNA; iii) heating the eluted DNA in the presence of bi sulfite ions to produce a deaminated nucleic acid; iv) contacting said deaminated nucleic acid to a second matrix material comprising a second column to bind said deaminated nucleic acid to said second matrix material; v) desulphonating the bound deaminated nucleic acid and/or simultaneously eluting and desulphonating the nucleic acid by contacting the deaminated nucleic acid with an alkaline solution to produce a bi sulfite converted nucleic acid; vi) eluting said bi sulfite converted nucleic acid from said second matrix material; and vii) performing methylation specific PCR and/or nucleic acid sequencing, and/or high resolution melting analysis (HRM) on said bisulfite-converted nucleic acid to determine the methylation of said nucleic acid, wherein at least steps iv) through vi) are performed in a single reaction cartridge.

Get Free WhatsApp Updates!
Notices, Deadlines & Correspondence

Patent Information

Application #
Filing Date
07 June 2019
Publication Number
30/2019
Publication Type
INA
Invention Field
BIO-CHEMISTRY
Status
Email
PATENTS@DPAHAUJA.COM
Parent Application
Patent Number
Legal Status
Grant Date
2023-12-12
Renewal Date

Applicants

CEPHEID
904 Caribbean Drive Sunnyvale, California 94089

Inventors

1. LAI, Edwin Wei-Lung
904 Caribbean Drive Sunnyvale, California 94089
2. KOHLWAY, Andrew
904 Caribbean Drive Sunnyvale, California 94089
3. VAN ATTA, Reuel
904 Caribbean Drive Sunnyvale, California 94089
4. HIGUCHI, Russell
904 Caribbean Drive Sunnyvale, California 94089
5. GALL, Alexander A.
904 Caribbean Drive Sunnyvale, California 94089
6. KOCMOND, Kriszten
904 Caribbean Drive Sunnyvale, California 94089

Specification

CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit of prior U.S. provisional application no. 62/433, 165, filed December 12, 2016, which is hereby incorporated by reference in its entirety.
BACKGROUND
[0002] The genomes of higher eukaryotes contain the modified nucleoside 5-methyl cytosine (5-meC). This modification is usually found as part of the dinucleotide CpG in which cytosine is converted to 5 -methyl cytosine in a reaction that involves flipping a target cytosine out of an intact double helix and transfer of a methyl group from S-adenosylmethionine by a methyltransf erase enzyme (see, e.g., Klimasauskas et al. (1994) Cell 76: 357-369). This enzymatic conversion is the primary epigenetic modification of

DNA known to exist in vertebrates and is essential for normal embryonic development {see, e.g., Bird (1992) Cell 70: 5-8; Laird and Jaenisch (1994) Human Mol. Genet. 3 : 1487-1495; and Li et al. (1992) Cell 69: 915-926).

[0003] In eukaryotes, DNA methylation regulates normal cellular processes such as genomic imprinting, chromosomal instability, and X-chromosome inactivation. Typically, DNA methylation occurs at the fifth carbon position of cytosine at dinucleotide 5'-CpG-3' sites in or near gene promoters termed CpG islands or shores. Methylation controls gene expression by down-regulating transcription either by directly inhibiting transcriptional machinery or indirectly through the recruitment of chromatin remodeling proteins.

Chromosomal methylation patterns change dynamically during embryonic development, and the correct methylation patterns have to be maintained throughout an individual's lifetime. Changes in methylation patterns are linked to aging, and errors in DNA

methylation are among the earliest changes that occur during oncogenesis. Thus, the detection of methylation at gene promoters is important, inter alia, for diagnosing and/or monitoring patients with cancer.

[0004] Epigenetic alterations, including DNA methylation, interrupt the DNA-RNA-protein axis which describes how genetic information is transcribed into messenger RNAs (mRNAs). The correlation between genomic DNA variation, mRNA copy numbers and protein levels may be described by DNA methylation levels. Thus co-measurement of DNA methylation levels and corresponding down-stream mRNA levels can be important to understanding the mechanism of epigenetic cellular regulation.

[0005] Several methods have been developed to detect and quantify methylation efficiently and accurately. The most common technique is the bisulfite conversion method which converts unmethylated cytosines to uracil. Once converted, the methylation profile of DNA can be determined by standard PCR techniques, sequencing methods, and the like.

[0006] There are several DNA Methylation kits suitable for bisulfite conversion and

DNA cleanup (e.g., EZ DNA METHYLATION™ kits from Zymo Research). Most kits involve several steps, reagents, and incubation times and often require purified DNA before conversion although some kits can utilize tissue or plasma/serum as starting material.

[0007] Typically the bisulfite conversion process requires at least four steps: 1)

DNA Denaturation; 2) Bisulfite Incubation; 3) DNA Purification; and 4) Desulphonation. The final desulphonation step can be completed on-column or in solution followed by an ethanol precipitation. There are currently no methylation kits that allow a user to complete the entire process- DNA purification, bisulfite incubation, desulphonation, second DNA purification, and methylation-specific PCR all in one step.

SUMMARY

[0008] Various embodiments contemplated herein may comprise, but need not be limited to, one or more of the following:

[0009] Various embodiments contemplated herein may include, but need not be limited to, one or more of the following:

[0010] Embodiment 1 : A method of determining the methylation state of a nucleic acid, said method comprising:

[0011] i) contacting a biological sample comprising a nucleic acid to a first matrix material comprising a first column or filter where said matrix material binds and/or filters nucleic acids in said sample and thereby purifies the DNA;

[0012] ii) eluting the bound DNA from the first matrix material and denaturing the

DNA to produce eluted denatured DNA;

[0013] iii) heating the eluted DNA in the presence of a bisulfite reagent to produce a deaminated nucleic acid;

[0014] iv) contacting said deaminated nucleic acid to a second matrix material comprising a second column to bind said deaminated nucleic acid to said second matrix material;

[0015] v) desulphonating the bound deaminated nucleic acid and/or simultaneously eluting and desulphonating the nucleic acid by contacting the deaminated nucleic acid with an alkaline solution to produce a converted (e.g., bisulfite converted) nucleic acid;

[0016] vi) eluting said bisulfite converted nucleic acid from said second matrix material; and

[0017] vii) performing methylation specific PCR and/or nucleic acid sequencing, and/or high resolution melting analysis (HRM) on said converted nucleic acid to determine the methylation of said nucleic acid, wherein at least steps iv) through vi) are performed in a single reaction cartridge.

[0018] Embodiment 2: The method of embodiment 1, wherein at least steps iv) through vi) are performed in a single reaction cartridge.

[0019] Embodiment 3 : The method of embodiment 1, wherein at least steps iii) through vi) are performed in a single reaction cartridge.

[0020] Embodiment 4: The method of embodiment 1, wherein at least steps ii) through vi) are performed in a single reaction cartridge.

[0021] Embodiment 5 : The method of embodiment 1, wherein at least steps i) through vi) are performed in a single reaction cartridge.

[0022] Embodiment 6: The method according to any one of embodiments 1-5, wherein step vii is performed in the same reaction cartridge.

[0023] Embodiment 7: The method according to any one of embodiments 1-6, wherein said first matrix material and said second matrix material are the same material forming the same column.

[0024] Embodiment 8: The method according to any one of embodiments 1-7, wherein said first matrix material and said second matrix material form different columns.

[0025] Embodiment 9: The method according to any one of embodiments of embodiment 1-8, wherein said methylation specific PCR, when performed, is performed in said cartridge.

[0026] Embodiment 10: The method according to any one of embodiments 1-9, wherein said nucleic acid sequencing, when performed, is performed in said cartridge or in a device coupled to said cartridge.

[0027] Embodiment 11 : The method according to any one of embodiments 1-10, wherein said cartridge comprises a column comprising said first matrix material, a sample receiving chamber, a temperature controlled channel or chamber, a plurality of chambers containing reagents and/or buffers, and when in use at least one of said chambers contains a desulphonation/elution buffer, and wherein said cartridge optionally comprises a second column comprising said second matrix material.

[0028] Embodiment 12: The method of embodiment 11, wherein, when in use, at least one of said chambers contains a reagent that provides bisulfite ions.

[0029] Embodiment 13 : The method according to any one of embodiments 11-12, wherein said second column is absent.

[0030] Embodiment 14: The method according to any one of embodiments 11-13, wherein said second column is present.

[0031] Embodiment 15: The method according to any one of embodiments 11-14, wherein said cartridge comprises a thermocycling channel or chamber in addition to said temperature controlled channel or chamber.

[0032] Embodiment 16: The method according to any one of embodiments 11-14, wherein said temperature controlled channel or chamber is a thermocycling channel or chamber.

[0033] Embodiment 17: The method according to any one of embodiments 11-16, wherein said cartridge comprises one or more chambers containing one or more reagents selected from the group consisting of methylation specific PCR primers, methylation specific PCR probes, PCR enzyme(s), and PCR reaction buffer.

[0034] Embodiment 18: The method of embodiment 17, wherein said cartridge comprises one or more chambers containing one or more primers and probes for detection of methylation of a forward strand of a bisulfite-converted DNA.

[0035] Embodiment 19: The method according to any one of embodiments 17-18, wherein said cartridge comprises one or more chambers containing one or more primers and probes for detection of methylation of a reverse strand of a bisulfite-converted DNA.

[0036] Embodiment 20: The method according to any one of embodiments 11-19, wherein said sample receiving chamber, said column(s), said plurality of chambers, and when present, said temperature controlled channel or chamber and/or thermocycling channel or chamber, are selectively in fluid communication.

[0037] Embodiment 21 : The method of embodiment 20, wherein said sample receiving chamber, said column(s), said plurality of chambers, and when present, said thermocycling channel or chamber, are selectively in fluid communication by microfluidic channels and valves.

[0038] Embodiment 22: The method of embodiment 20, wherein said sample receiving chamber, said column(s), said plurality of chambers, and when present, said thermocycling channel or chamber or a port into said thermocycling channel or chamber, are disposed around a central valve and selectively in fluid communication with a channel in said central valve, wherein said central valve is configured to accommodate a plunger that is capable of drawing fluid into or out of a chamber in fluid communication with said central valve.

[0039] Embodiment 23 : The method according to any one of embodiments 11-22, wherein said cartridge, when in use, comprises:

[0040] a first chamber containing a sample;

[0041] a second chamber containing a guanidinium thiocyanate-ethanol (GTC-EtOH) solution;

[0042] a third chamber containing a bisulfite reagent;

[0043] a fourth chamber containing a buffer;

[0044] a fifth chamber containing a rinse solution; and

[0045] a sixth chamber containing an elution/desulphonation reagent.

[0046] Embodiment 24: The method of embodiment 23, wherien first chamber contains said sample in a GTC-EtOH-Tween extraction/precipitation reagent.

[0047] Embodiment 25: The method according to any one of embodiments 23-24, wherein the GTC-ETOH-Tween buffer is added at or near the time the sample is placed into the cartridge.

[0048] Embodiment 26: The method according to any one of embodiments 23-25, wherein the bisulfite reagent is added to the cartridge at or near the time the sample is placed in the cartridge.

[0049] Embodiment 27: The method of embodiment 23, wherein the GTC-ETOH- Tween buffer is provided as a component of the cartridge.

[0050] Embodiment 28: The method according to any one of embodiments 23-25, wherein the bisulfite reagent is provided as a component of the cartridge.

[0051] Embodiment 29: The method according to any one of embodiments 11-28, wherein said cartridge comprises a seventh chamber containing PCR primers and/or probes and/or PCR enzymes.

[0052] Embodiment 30: The method according to any one of embodiments 11-29, wherein said cartridge comprises an eighth chamber also containing PCR primers and/or probes and/or PCR enzymes.

[0053] Embodiment 31 : The method of embodiments 29-30, wherein said PCR primers, and/or probes, and/or enzymes are provided as beads.

[0054] Embodiment 32: The method according to any one of embodiments 1-31, wherein said biological sample comprises one or more samples selected from the group consisting of a cell, a tissue, and a biological fluid containing a nucleic acid.

[0055] Embodiment 33 : The method of embodiment 32, wherein said biological sample comprises a biological fluid selected from the group consisting of whole blood, plasma, serum, saliva, mucus, urine, sputum, pancreatic juice, and cerebrospinal fluid.

[0056] Embodiment 34: The method of embodiment 32, wherein said biological sample comprises a sample selected from the group consisting of a tissue sample, a formalin fixed paraffin embedded (FFPE) tissue, fresh frozen tissue, fine needle aspirates (FNA), and a core biopsy.

[0057] Embodiment 35: The method according to any one of embodiments 1-34, wherein said method comprises contacting said biological sample with a lysis solution.

[0058] Embodiment 36: The method of embodiment 35, wherein said method comprises providing said sample in said sample receiving chamber and contacting said sample with an extraction/precipitation solution.

[0059] Embodiment 37: The method according to any one of embodiments 1-36, wherein said matrix material comprises a column material selected from the group consisting of glass or silica, an ion exchange resin, cellulose, and hydroxyapatite.

[0060] Embodiment 38: The method of embodiment 37, wherein said matrix material comprises glass.

[0061] Embodiment 39: The method according to any one of embodiments 1-38, wherein said bisulfite ion is provided as compound selected from the group consisting of ammonium bisulfite, sodium metabi sulfite, potassium bisulfite, cesium bisulfite, and DABSO.

[0062] Embodiment 40: The method of embodiment 39, wherein said bisulfite ion is provided by ammonium bisulfite.

[0063] Embodiment 41 : The method according to any one of embodiments 1-40, wherein said bisulfite is provided in a reagent mix comprising scavengers to prevent sulfite oxidation and/or catalysts.

[0064] Embodiment 42: The method of embodiment 41, wherein said bisulfite is provided in a reagent mix comprising scavengers selected from the group consisting of Trolox and hydroquinone.

[0065] Embodiment 43 : The method according to any one of embodiments 41-42, wherein said bisulfite is provided in a reagent mix comprising polyamines as catalysts.

[0066] Embodiment 44: The method according to any one of embodiments 1-43, wherein said eluting the bound DNA comprises eluting and denaturing said DNA using a low concentration of potassium hydroxide or other base.

[0067] Embodiment 45: The method of embodiment 44, wherein said eluting the bound DNA comprises eluting and denaturing said DNA with an alkaline solution with a pH greater than about pH 10.5.

[0068] Embodiment 46: The method of embodiment 44, wherein said eluting the bound DNA comprises eluting and denaturing said DNA with an alkaline solution with a pH greater than about pH 12.

[0069] Embodiment 47: The method of embodiments 45-46, wherein said alkaline solution is a 10-15 mM KOH solution.

[0070] Embodiment 48: The method according to any one of embodiments 1-47, wherein said incubating the eluted DNA with bisulfite ions to produce a deaminated nucleic acid comprises incubating the DNA in an ammonium bisulfite solution having a concentration that ranges from about 6M to about 7M.

[0071] Embodiment 49: The method of embodiment 48, wherein said incubating the eluted DNA with bisulfite ions to produce a deaminated nucleic acid comprises incubating the DNA in an ammonium bisulfite solution having a concentration of about 6.5M.

[0072] Embodiment 50: The method of embodiment 49, wherein said incubating comprises transferring the DNA in a concentrated bisulfite solution into a temperature controlled channel or chamber in said cartridge and heating said mixture.

[0073] Embodiment 51 : The method of embodiment 50, wherein said incubating comprises thermally cycling the concentrated bisulfite solution from a temperature of about 60°C to about 95°C.

[0074] Embodiment 52: The method according to any one of embodiments 1-51, wherein said contacting said deaminated nucleic acid to a second matrix material comprises mixing the DNA-bisulfite solution with fresh GTC-EtOH and dispensing the solution over said second matrix material.

[0075] Embodiment 53 : The method of embodiment 52, wherein said method comprises washing the DNA in said second matrix material with fresh GTC-EtOH, and then a rinse solution.

[0076] Embodiment 54: The method of embodiment 53, wherein said rinse solution comprises PEG200.

[0077] Embodiment 55 : The method according to any one of embodiments 1-54, wherein said desulphonating the bound deaminated nucleic acid comprises eluting the DNA from said second column with a high pH desulphonation buffer and incubating said solution.

[0078] Embodiment 56: The method of embodiment 55, wherein said incubating is for a period of time ranging from about 1 minute to about 1 hour, or from about 5 minutes to about 30 minutes, or from about 10 minutes to about 20 minutes, or for about 15 minutes.

[0079] Embodiment 57: The method of embodiments 55-56, wherein said high pH desulphonation/elution buffer comprises KOH.

[0080] Embodiment 58: The method according to any one of embodiments 55-57, wherein said incubation is in a chamber that previously held said high pH desulphonation buffer (e.g., chamber 10).

[0081] Embodiment 59: The method according to any one of embodiments 1-58, wherein after the incubation with bisulfite ions, a temperature controlled channel or chamber is washed with a buffer to remove the residual bisulfite and neutralize pH.

[0082] Embodiment 60: The method according to any one of embodiments 1-59, wherein high resolution melting analysis (HRM) on said bisulfite-converted nucleic acid is performed to determine the methylation of said nucleic acid.

[0083] Embodiment 61 : The method according to any one of embodiments 1-60, wherein nucleic acid sequencing of said bisulfite-converted nucleic acid is performed to determine the methylation of said nucleic acid.

[0084] Embodiment 62: The method according to any one of embodiments 1-60, wherein methylation specific PCR is performed to determine methylation of target nucleic acid sequences.

[0085] Embodiment 63 : The method of embodiment 62, wherein said methylation specific PCR (MSP) is performed using primers specific for methylated sequences and/or primers specific for unmethylated sequences.

[0086] Embodiment 64: The method of embodiment 62, wherein said methylation specific PCR comprises a MethyLight protocol.

[0087] Embodiment 65: The method of embodiment 62, wherein TaqMan PCR reactions are performed with primers specific for bisulfite-converted methylated and/or unmethylated sequences.

[0088] Embodiment 66: The method according to any one of embodiments 62-65, wherein said MSP utilizes one or more fluorescent probes that are markers for amplified methylated sequences and/or one or more fluorescent probes that are markers for amplified unmethylated sequences.

[0089] Embodiment 67: The method of embodiment 66, wherein said fluorescent probes comprise a fluorescent reporter dye and a quencher dye where the probe provides a signal upon cleavage by 5' to 3' nuclease activity of Taq DNA polymerase.

[0090] Embodiment 68: The method according to any one of embodiments 66-67, wherein a methylation signal is determined by the combined signal for a plurality of probes each specific to a different methylated region in an amplified region of interest.

[0091] Embodiment 69: The method according to any one of embodiments 66-67, wherein a methylation signal is determined by a plurality of probes specific for the same methylated region in an amplified region of interest.

[0092] Embodiment 70: The method according to any one of embodiments 66-67, wherein said plurality of probes comprise 2, 3, 4, 5, 6, 7, 8, 9, 10, or more probes.

[0093] Embodiment 71 : The method according to any one of embodiments 66-67, wherein a methylation signal is determined by a single probe in the amplified region of interest.

[0094] Embodiment 72: The method according to any one of embodiments 66-71, wherein said probes are run in simplex or multiplex.

[0095] Embodiment 73 : The method according to any one of embodiments 66-71, wherein said probes are run in a multiplex format.

[0096] Embodiment 74: The method according to any one of embodiments 66-73, wherein said probes are run as a nested PCR reaction.

[0097] Embodiment 75: The method according to any one of embodiments 66-74, wherein said PCR reaction comprises a bisulfite contamination control probe that that undergoes bisulfite-mediated cleavage during PCR if bisulfite is present in the reaction.

[0098] Embodiment 76: The method according to any one of embodiments 1-75, wherien PCR is performed for one or more mutated genes.

[0099] Embodiment 77: The method according to any one of embodiments 1-76, wherein PCR is performed for unconverted DNA as a control.

[0100] Embodiment 78: The method according to any one of embodiments 1-77, wherein PCR is performed for converted DNA as a control.

[0101] Embodiment 79: The method of embodiment 77, wherein PCR is performed for unconverted DNA where the unconverted DNA is a target for said method.

[0102] Embodiment 80: The method according to any one of embodiments 1-79, wherein a bisulfite reaction and a PCR reaction, or a desulphonation reaction and a PCR reaction, or a bisulfite reaction, a desulphonation reaction and a PCR reaction are all performed in the same reaction tube or chamber.

[0103] Embodiment 81 : The method according to any one of embodiments 1-80, wherein said contacting a biological sample comprising a nucleic acid to a first matrix material comprises contacting a sample containing RNA to said first matrix material, where said matrix material binds said RNA thereby purifies the RNA.

[0104] Embodiment 82: The method of embodiment 81, wherein said method comprises eluting said RNA from said matrix material substantially independently of the DNA.

[0105] Embodiment 83 : The method of embodiment 82, wherein the RNA is eluted from said first matrix material using a Tris buffered elution.

[0106] Embodiment 84: The method according to any one of embodiments 81-83, wherein said RNA is eluted and stored in a chamber.

[0107] Embodiment 85: The method according to any one of embodiments 81-84, wherein reverse transcription (RT) is performed on said RNA and qRT-PCR is performed to determine the level of target RNA sequences.

[0108] Embodiment 86: The method according to any one of embodiments 82-85, where the RNA fraction is used to elute the bisulfite converted nucleic acid from said second matrix material and mix with the bisulfite-converted DNA, or is mixed with eluted bisulfite-converted DNA.

[0109] Embodiment 87: The method of embodiment 86, wherein RT is performed on said RNA prior to, or after, combination with the bisulfite-converted DNA.

[0110] Embodiment 88: The method according to any one of embodiments 86-87, wherein qRT-PCR is performed for RT RNA in the mixture to determine the level of target RNA sequences and methylation specific PCR is performed on the mixture to determine methylation of target DNA sequences.

[0111] Embodiment 89: The method according to any one of embodiments 1-88, where methylation is determined for a promoter region of a gene selected from the group consisting of MGMT. RASSF1A, ADAMTS1, BNC1, HIST1H3C, HOXB4, RASGRF2, TM6SF1, and AKR1B1.

[0112] Embodiment 90: The method according to any one of embodiments 81-89, wherein the expression level of RNA is determined for a methyltransferase.

[0113] Embodiment 91 : The method of embodiment 90, wherein the expression level of RNA is determined for a methyltransferase selected from the group consisting of DNMT1, DNMT2, DNMT3A, DNMT3B, and TNMT3L.

[0114] Embodiment 92: A cartridge for determining the methylation state of a nucleic acid, said cartridge comprising: a column comprising a first matrix material, a sample receiving chamber, a temperature controlled channel or chamber, a plurality of chambers containing reagents and/or buffers, and when in use at least one of said chambers contains a bisulfite reagent, and at least one of said chambers contains a

desulphonation/elution buffer, and wherein said cartridge optionally comprises a second column comprising said second matrix material.

[0115] Embodiment 93 : The cartridge of embodiment 92, wherein said cartridge, when in use, comprises a chamber containing a reagent comprising guanidinium thiocyanate ethanol (GTC-EtOH).

[0116] Embodiment 94: The cartridge according to any one of embodiments 92-93, wherein said second column is absent.

[0117] Embodiment 95: The cartridge according to any one of embodiments 92-93, wherein said second column is present.

[0118] Embodiment 96: The cartridge according to any one of embodiments 92-95, wherein said temperature controlled channel or chamber is a thermocycling channel or chamber.

[0119] Embodiment 97: The cartridge according to any one of embodiments 92-96, wherein said cartridge further comprises a second heating channel or chamber.

[0120] Embodiment 98: The cartridge according to any one of embodiment 92-97, wherein said bisulfite reagent comprises a compound selected from the group consisting of ammonium bisulfite, sodium metabi sulfite, potassium bisulfite, cesium bisulfite, and DABSO.

[0121] Embodiment 99: The cartridge of embodiment 98, wherein said bisulfite reagent comprises ammonium bisulfite.

[0122] Embodiment 100: The cartridge according to any one of embodiments 92- 99, wherein said bisulfite is provided in a reagent mix comprising scavengers to prevent sulfite oxidation and/or catalysts.

[0123] Embodiment 101 : The cartridge of embodiment 100, wherein said bisulfite is provided in a reagent mix comprising scavengers selected from the group consisting of Trolox and hydroquinone.

[0124] Embodiment 102: The cartridge according to any one of embodiments 100- 101, wherein said bisulfite is provided in a reagent mix comprising polyamines as catalysts.

[0125] Embodiment 103 : The cartridge according to any one of embodiments 92- 102, wherein said first matrix material and/or said second matrix material, when present, comprises a material is selected from the group consisting of glass or silica, an ion exchange resin, and hydroxyapatite.

[0126] Embodiment 104: The cartridge according to any one of embodiments 92- 103, wherein said cartridge comprises one or more chambers containing one or more reagents selected from the group consisting of methylation specific PCR primers, methylation specific PCR probes, PCR enzyme(s), and PCR reaction buffer.

[0127] Embodiment 105: The cartridge of embodiment 104, wherein said cartridge contains at least two chambers containing one or more reagents selected from the group consisting of methylation specific PCR primers, methylation specific PCR probes, PCR enzyme(s), and PCR reaction buffer.

[0128] Embodiment 106: The cartridge according to any one of embodiments 92- 105, wherein said cartridge contains at least one chamber containing primers and probes for detection of methylation of a forward strand of a converted DNA.

[0129] Embodiment 107: The cartridge according to any one of embodiments 92- 106, wherein said cartridge contains at least one chamber containing primers and probes for detection of methylation of a reverse strand of a converted DNA.

[0130] Embodiment 108: The cartridge according to any of embodiments 104-107, wherein said PCR primers, and/or probes, and/or enzymes are provided as beads.

[0131] Embodiment 109: The cartridge according to any one of embodiments 92- 108, wherein said sample receiving chamber, said column(s), said plurality of chambers, and said temperature-controlled heating channel or chamber, are selectively in fluid communication.

[0132] Embodiment 110: The cartridge of embodiment 109, wherein said sample receiving chamber, said column(s), said plurality of chambers, and said temperature controlled channel or chamber, are selectively in fluid communication by microfluidic channels and valves.

[0133] Embodiment 111 : The cartridge of embodiment 109, wherein said sample receiving chamber, said column(s), said plurality of chambers, and said temperature

controlled channel or chamber or a port into said temperature controlled channel or chamber, are disposed around a central valve and selectively in fluid communication with a channel in said central valve, wherein said central valve is configured to accommodate a plunger that is capable of drawing fluid into or out of a chamber in fluid communication with said central valve.

[0134] Embodiment 112: The cartridge according to any one of embodiments 92-111, wherein said cartridge is configured so that, when in use, said cartridge comprises:

[0135] a first chamber containing a sample;

[0136] a second chamber containing a guanidinium thiosulfate-ethanol (GTC-EtOH) solution;

[0137] a third chamber containing a bisulfite reagent;

[0138] a fourth chamber containing a buffer;

[0139] a fifth chamber containing a rinse solution; and

[0140] a sixth chamber containing an elution/desulphonation reagent.

[0141] Embodiment 113 : The cartridge of embodiment 112, wherein said first chamber contains said sample in a GTC-EtOH- Tween extraction/precipitation reagent.

[0142] Embodiment 114: The cartridge according to any one of embodiments 92- 113, wherein the cartridge is configured for the bisulfite reagent to be added to the cartridge at or near the time the sample is placed in the cartridge.

[0143] Embodiment 115: The cartridge according to any one of embodiments 92- 113, wherein the bisulfite reagent is provided as a component of the cartridge.

[0144] Embodiment 116: The cartridge according to any one of embodiments 92- 115, wherein the cartridge is configured for addition of GTC-ETOH-Tween buffer at or near the time the sample is placed into the cartridge.

[0145] Embodiment 117: The cartridge according to any one of embodiments 92- 115, wherein the GTC-ETOH-Tween buffer is provided as a component of the cartridge.

[0146] Embodiment 118: The cartridge according to any one of embodiments 92- 117, wherein said cartridge comprises a seventh chamber containing PCR primers and/or probes and/or PCR enzymes.

[0147] Embodiment 119: The cartridge according to any one of embodiments 92- 118, wherein said cartridge comprises an eighth chamber also containing PCR primers and/or probes and/or PCR enzymes.

[0148] Embodiment 120: The cartridge according to any one of embodiments 92- 119, wherein said cartridge comprises one or more chambers containing primers specific for bisulfite-converted methylated and/or unmethylated sequences.

[0149] Embodiment 121 : The cartridge according to any one of embodiments 92-120, wherein said cartridge comprises one or more chambers containing reagents for TaqMan PCR reactions.

[0150] Embodiment 122: The cartridge according to any one of embodiments 92- 121, wherein said cartridge comprises one or more chambers containing one or more fluorescent probes that are markers for amplified methylated sequences and/or one or more fluorescent probes that are markers for amplified unmethylated sequences.

[0151] Embodiment 123 : The cartridge of embodiment 122, wherein said probes comprise a fluorescent reporter dye and a quencher dye, where the probes provides a signal upon cleavage by the 5' to 3' nuclease activity of Taq DNA polymerase.

[0152] Embodiment 124: The cartridge according to any one of embodiments 122-123, wherein said cartridge comprises a plurality of probes each specific to a different methylated region in an amplified region of interest.

[0153] Embodiment 125: The cartridge according to any one of embodiments 122- 123, wherein said cartridge comprises a single probe specific to a methylated region in an amplified region of interest.

[0154] Embodiment 126: The cartridge according to any one of embodiments 122- 123, wherein said cartridge comprises a plurality of probes each specific to the same methylated region in an amplified region of interest.

[0155] Embodiment 127: The cartridge according to any one of embodiments 92- 126, wherein said cartridge contains primers and/or probes to determine methylation of a promoter region of a gene selected from the group consisting of MGMT, RASSF1A, ADAMTS1, BNC1, HIST1H3C, HOXB4, RASGRF2, TM6SF1, and AKR1B1.

[0156] Embodiment 128: The cartridge according to any one of embodiments 92- 126, wherein said cartridge contains one or more primers shown in Tables 5, 9, or 10, and/or one or more probes shown in Tables 5, 9, or 10.

[0157] Embodiment 129: The cartridge of embodiment 128, wherein said cartridge contains the following probes and primers for determining methylation of MGMT using a nested PCR reaction:

[0158] an external forward primer (248b) comprising the nucleotide sequence

GTTTT(T*)AGAAYG(T*)TTTGYGTTT (SEQ ID NO:263);

[0159] an external reverse primer (249b) comprising the nucleotide sequence:

AAAAAAC(T*)CCRCACTCTTCC (SEQ ID NO:265);

[0160] an internal forward primer (250) comprising the nucleotide sequence

TTTCGACGTTCGTAGGTTTTCGC (SEQ ID NO:266);

[0161] an internal reverse primer (251) comprising the nucleotide sequence

GCACTCTTCCGAAAACGAAACG (SEQ ID NO:267); and

[0162] a probe (252a) comprising the nucleotide sequence fluor-CCAAACAC(T*)CACCAAATC(N*)CAAAC-blocker (SEQ ID NO: 268).

[0163] Embodiment 130: The cartridge according to any one of embodiments 128- 129, wherein said cartridge contains the following probes and primers for determining methylation of ACTB (e.g., as a control) using a nested PCR reaction:

[0164] an external forward primer (102) comprising the nucleotide sequence:

GTGATGGAGGAGGTTTAGTAAGTT (SEQ ID NO: 103);

[0165] an external reverse primer (103) comprising the nucleotide sequence:

CCAATAAAACCTACTCCTCCCTTAA (SEQ ID NO: 104);

[0166] an internal forward primer (148) comprising the nucleotide sequence:

GGTTTAGTAAGTTTTTTGGATTGTG (SEQ ID NO: 149);

[0167] an internal reverse primer (149) comprising the nucleotide sequence:

CCTTAAAAATTACAAAAACCACAAC (SEQ ID NO: 150); and

[0168] a probe (178) comprising the nucleotide sequence: fluor- CCACCACCCAACACA(N*)CAA(T*)AACAAACAC-blocker (SEQ ID NO: 179).

[0169] Embodiment 131 : The cartridge according to any one of embodiments 92-130, wherein the cartridge is configured for determination of the expression level of RNA for a methyltransferase.

[0170] Embodiment 132: The cartridge of embodiment 131, wherein said methyltransferases is selected from the group consisting of DNMTl, DNMT2, DNMT3A, DNMT3B, and TNMT3L.

[0171] Embodiment 133 : A system for determining the methylation of a nucleic acid in a biological sample, said system comprising: an enclosure configured to contain one or more sample processing modules, each sample processing module configured to hold a removable cartridge according to any one of embodiments 92-132; where said system is

configured to operate the sample processing modules to perform sample processing to determine methylation of one or more target nucleic acids and optionally to determine the level of one or more target DNA sequences within a corresponding removable sample cartridge, wherein said processing on a sample within the corresponding removable sample cartridge performs a method according to any one of embodiments 1-91.

[0172] Embodiment 134: The system of embodiment 133, wherein said system is configured to contain one sample processing module.

[0173] Embodiment 135 : The system of embodiment 133, wherein said system is configured to contain at least two sample processing modules, or at least 4 sample processing modules, or at least 8 sample processing modules, or at least 12 sample processing modules, or at least 16 sample processing modules, or at least 20 sample processing modules, or at least 24 sample processing modules, or at least 28 sample processing modules, or at least 32 sample processing modules, or at least 64 sample processing modules, or at least 128 sample processing modules.

[0174] Embodiment 136: The system according to any one of embodiments 133- 135, wherein said modules comprise one or more heating plates to heat a temperature controlled chamber or channel in said cartridge.

[0175] Embodiment 137: The system according to any one of embodiments 133- 136, wherein said modules comprise a fan configured to cool a temperature controlled channel or chamber in said cartridge.

[0176] Embodiment 138: The system according to any one of embodiments 133- 137, wherein said modules comprise circuitry to pass information (e.g., optical information) to a computer for analysis.

[0177] Embodiment 139: The system according to any one of embodiments 133-138, wherein said modules comprise optical blocks to provide excitation and/or detection of one or more optical signals produced by reactions in said cartridge.

[0178] Embodiment 140: The system according to any one of embodiments 133- 139, wherein said system is configured to operate said cartridge to perform a method according to any one of embodiments 1-91.

[0179] Embodiment 141 : The system according to any one of embodiments 133- 139, wherein said system is configured to operate said cartridge to: bind a sample to a column; elute DNA from the column and combine said DNA with a conversion reagent;

heat the DN A/conversion reagent solution in a reaction chamber or tube to produce converted DNA; bind the converted DNA to a column; desulphonate and elute the DNA from the column; and perform PCR on the eluted desulphonated DNA in a reaction chamber or tube.

[0180] Embodiment 142: The system of embodiment 141, wherein said PCR is performed in the same reaction chamber or tube where the DN A/conversion reagent solution was previously heated.

[0181] Embodiment 143 : A cartridge for sample preparation, said cartridge comprising: a channel or chamber comprising an affinity matrix that binds DNA, a plurality of chambers disposed around a central valve assembly and selectively in fluid

communication with said central valve assembly where said central valve assembly is configured to accommodate a plunger that is capable of drawing fluid into or out of a chamber in fluid communication with said central valve wherein said plurality of chambers comprises: a chamber configured to receive up to about 5 ml or up to about 4 ml of sample solution; a chamber containing PEG; a chamber containing GTC-EtOH; a chamber containing an alkaline solution; and a chamber containing a buffer.

[0182] Embodiment 144: The cartridge of embodiment 143, wherein said plurality of chambers further comprises a chamber containing a bisulfite reagent.

[0183] Embodiment 145: The cartridge according to any one of embodiments 143-144, wherein said plurality of chambers comprises a chamber containing a GTC-ethanol wash solution.

[0184] Embodiment 146: The cartridge of embodiment 145, wherein said GTC-ethanol wash solution comprises 1.25M guanidinium thiocyanate, 25 mM Tris pH 7.0, and 50% ethanol.

[0185] Embodiment 147: The cartridge according to any one of embodiments 143- 146, wherein said PEG comprises PEG200.

[0186] Embodiment 148: The cartridge according to any one of embodiments 143- 147, wherein said alkaline solution comprises KOH.

[0187] Embodiment 149: The cartridge according to any one of embodiments 143-148, wherein said buffer comprises Tris.

[0188] Embodiment 150: The cartridge according to any one of embodiments 143- 149. wherein said plurality of chambers comprises a chamber containing beads comprising one or more PCR primers and/or probes.

[0189] Embodiment 151 : The cartridge according to any one of embodiments 143-150, wherein said chamber containing PEG contains about 1 ml of PEG.

[0190] Embodiment 152. The cartridge according to any one of embodiments

143-151, wherein said chamber containing an alkaline solution contains about 500 μΙ_, of solution.

[0191] Embodiment 153 : The cartridge according to any one of embodiments 143-152, wherein said chamber containing GTC-EtOH contains about 2 ml GTC-EtOH.

[0192] Embodiment 154: The cartridge according to any one of embodiments 143- 153, wherein said chamber containing a buffer contains about 2 mL of buffer.

[0193] Embodiment 155: A high volume sample preparation (HVSP), said cartridge comprising: a channel or chamber comprising an affinity matrix that binds DNA, a plurality of chambers disposed around a central valve assembly and selectively in fluid

communication with said central valve assembly where said central valve assembly is configured to accommodate a plunger that is capable of drawing fluid into or out of a chamber in fluid communication with said central valve wherein said plurality of chambers comprises: at least two different chambers each configured to receive up to about 4.5 ml of sample solution; a chamber containing PEG; a chamber containing an alkaline solution; and a chamber containing a buffer.

[0194] Embodiment 156: The cartridge of embodiment 155, wherein said plurality of chambers comprises at least three different chambers each configured to receive up to 4 ml of sample solution.

[0195] Embodiment 157: The cartridge according to any one of embodiments 155- 156, wherein said PEG comprises PEG200.

[0196] Embodiment 158: The cartridge according to any one of embodiments 155- 157, wherein said basic solution comprises KOH.

[0197] Embodiment 159: The cartridge according to any one of embodiments 155-158, wherein said buffer comprises Tris.

[0198] Embodiment 160: The cartridge according to any one of embodiments 155- 159, wherein said plurality of chambers comprises a chamber containing a wash solution.

[0199] Embodiment 161 : The cartridge of embodiment 160, wherein said wash solution comprise 1.25M guanidinium thiocyanate, 25 mM Tris pH 7.0, and 50% ethanol.

[0200] Embodiment 162: The cartridge according to any one of embodiments 155- 161, wherein said cartridge comprises a chamber configured for removal of a processed sample.

[0201] Embodiment 163 : The cartridge according to any one of embodiments 155- 162, wherein said sample chambers, when in use contain sample solution, GTC and isopropanol.

[0202] Embodiment 164: The cartridge of embodiment 163, wherein said sample chambers, when in use contain sample solution, GTC and isopropanol in substantially equal volumes.

[0203] Embodiment 165: The cartridge according to any one of embodiments 155-164 wherein said cartridge, when in use, comprises 4 ml of sample solution disposed in each of said chambers configured to receive a sample.

[0204] Embodiment 166: The cartridge according to any one of embodiments 155- 165, wherein said cartridge provides DNA or RNA recovery that is substantially linear with respect to the sample volume between 0.5 ml and about 4 ml of sample.

[0205] Embodiment 167: The cartridge according to any one of embodiments 155- 166, wherein said cartridge contains or is configured to receive a conversion reagent.

[0206] Embodiment 168: The cartridge of embodiment 167, wherein said cartridge, when in use, performs a bisulfite conversion of DNA.

[0207] Embodiment 169: A lysis solution for preparation of a DNA sample from serum or plasma, said lysis solution comprising: GTC, a buffer, a detergent, and optionally an anti-foaming agent.

[0208] Embodiment 170: The lysis solution of embodiment 169, wherein said lysis solution for serum or plasma comprises GTC, Tris pH 7.0, Tween 20, and antifoam SE15.

[0209] Embodiment 171 : The lysis solution of embodiment 170, wherein said lysis solution for serum or plasma comprises about 4.5M GTC, about 45mM Tris pH 7.0, about 1% Tween20, and about 0.01% Antifoam SE15.

[0210] Embodiment 172: A lysis solution for preparation of a DNA sample from an

FFPE sample.

[0211] Embodiment 173 : The lysis solution of embodiment 172, wherein said lysis solution for FFPE samples comprises a buffer, a detergent, NaCl, MgCl2, a chelating agent, antifoam SE15, and sodium azide.

[0212] Embodiment 174: The lysis solution of embodiment 173, wherein said lysis solution for FFPE samples comprises about 1% Tween20, about 400mM NaCl, about 25mM EDTA, about lOmM MgCl2, about 50mM HEPES pH 7.2, about 0.01% antifoam SE15, and about 0.01% sodium azide.

[0213] Embodiment 175: A kit for the determination of DNA methylati on, said kit comprising: a container containing a cartridge for determining the methylation state of a nucleic acid according to any one of embodiments 92-136.

[0214] Embodiment 176: The kit of embodiment 175, wherein said kit further comprises a container containing a lysis solution.

[0215] Embodiment 177: The kit of embodiment 176, wherein said lysis solution is a lysis solution for serum or plasma according to any one of embodiments 169-171.

[0216] Embodiment 178: The kit of embodimentx 176, wherein said lysis solution is a lysis solution for an FFPE sample according to any one of embodiments 172-174.

[0217] Embodiment 179: The kit according to any one of embodiments 175-178, wherein said kit comprises a container containing proteinase K.

[0218] Embodiment 180: The kit according to any one of embodiments 175-179, wherein said kit comprises a conversion reagent in said cartridge or in a container separate from the cartridge.

[0219] Embodiment 181 : The kit of embodiment 180, wherein said kit comprises said conversion reagent in a container separate from the cartridge.

[0220] Embodiment 182: The kit of embodiment 180, wherein said kit comprises said conversion reagent is provided in a chamber of the cartridge.

[0221] Embodiment 183 : The according to any one of embodiments 180-182, wherein said conversion reagent comprises a compound selected from the group consisting of sodium metabi sulfite, potassium bisulfite, cesium bisulfite, ammonium bisulfite, and DABSO.

[0222] Embodiment 184: The kit of embodiment 183, wherein said conversion reagent comprises ammonium bisulfite.

[0223] Embodiment 185: The kit according to any one of embodiments 175-184, wherein said kit comprises a container containing a sample processing reagent.

[0224] Embodiment 186: The kit of embodiment 185, wherein said sample processing reagent comprises guanidium thiocyanate.

[0225] Embodiment 187: The kit according to any one of embodiments 185-186, wherein said sample processing reagent comprise ethanol.

[0226] Embodiment 188: The kit according to any one of embodiments 175-187, wherein said kit comprises a container containing a cartridge for sample preparation according to any one of embodiments 155-166.

[0227] Embodiment 189: The kit according to any one of embodiments 175-188, wherein said kit contains instructional materials teaching the use of said cartridge for the determination of DNA methylation.

[0228] Embodiment 190: A cartridge for the detection of methylation markers of a cancer, said cartridge comprising: a plurality of chambers and a thermocycling channel or chamber, wherein said plurality of chambers and a port into said thermocycling channel or chamber are disposed around a central valve assembly and selectively in fluid

communication with said central valve assembly where said central valve assembly is configured to accommodate a plunger that is capable of drawing fluid into or out of a chamber or port in fluid communication with said central valve wherein said plurality of chambers comprises: a sample receiving chamber; a chamber containing or configured to receive a bisulfite reagent; a chamber containing a wash solution;_a chamber containing a Tris buffer; a chamber containing an alkaline solution comprising KOH; a chamber containing beads that provide a PCR master mix; and a chamber containing beads that provide PCR primers and probes to detect methylation of one or more gene promoters whose methylation state is a marker for a cancer.

[0229] Embodiment 191 : The cartridge of embodiment 190, wherein said plurality of chambers comprises a chamber disposed to receive waste solutions.

[0230] Embodiment 192: The cartridge according to any of embodiments 190-191, wherein said bisulfite reagent comprises a compound selected from the group consisting of sodium metabi sulfite, potassium bisulfite, cesium bisulfite, ammonium bisulfite, and DABSO.

[0231] Embodiment 193 : The cartridge of embodiment 192, wherein said bisulfite reagent comprises ammonium bisulfite.

[0232] Embodiment 194: The cartridge according to any of embodiments 190- 193, wherein said wash solution comprises 1.25M GTC, 25 mM Tris pH 7.0, and 50% ethanol.

[0233] Embodiment 195: The cartridge according to any of embodiments 190-194, wherein said chamber containing beads that provide PCR primers and probes to detect methylation of one or more gene promoters comprises beads that provide PCR primers and probes to detect methylation of one or more gene promoters whose methylation state is a marker for a cancer selected from the group consisting of breast cancer, pancreatic cancer, prostate cancer, brain cancer, and lung cancer.

[0234] Embodiment 196: The cartridge of embodiment 195, wherein said chamber containing beads that provide PCR primers and probes to detect methylation of one or more gene promoters comprises beads that provide PCR primers and probes for a nested PCR reaction.

[0235] Embodiment 197: The cartridge of embodiment 196, wherein said nested

PCR comprises a first PCR reaction specific for converted DNA and a second PCR reaction specific for methylated CpGs.

[0236] Embodiment 198: The cartridge according to any one of embodiments 190- 197, wherein said chamber containing beads that provide PCR primers and probes chamber contains beads that provide PCR primers and probes to detect methylation of a forward strand of converted DNA.

[0237] Embodiment 199: The cartridge according to any one of embodiments 190-198, wherein said chamber containing beads that provide PCR primers and probes chamber contains beads that provide PCR primers and probes to detect methylation of a reverse strand of converted DNA.

[0238] Embodiment 200: The cartridge according to any of embodiments 190-199, wherein said chamber containing beads that provide PCR primers and probes to detect methylation of one or more gene promoters comprises beads that provide PCR primers and probes to detect methylation of the promoters of one or more genes selected from the group consisting ofRASSFIA, AKR1B1, HOXB4, HIST1H3C, RASGRF2, M6SF1, BRCA1, BNC1, ADAMTSl, CDOl, SOX17, TAC1, HOXA 7, and MGMT.

[0239] Embodiment 201 : The cartridge according to any of embodiments 190-200, wherein said chamber containing beads that provide PCR primers and probes to detect methylation of one or more gene promoters comprises beads that provide PCR primers and probes to detect methylation of one or more gene promoters whose methylation state is a marker for pancreatic cancer.

[0240] Embodiment 202: The cartridge of embodiment 201, wherein said chamber containing beads that provide PCR primers and probes to detect methylation of one or more gene promoters comprises beads that provide PCR primers and probes to detect methylation of the promoters of ADAMTSl, and/or BNC1.

[0241] Embodiment 203 : The cartridge of embodiment 202, wherein said chamber containing beads that provide PCR primers and probes to detect methylation of one or more gene promoters comprises beads that provide PCR primers and probes to detect methylation of the promoter of ADAMTSl.

[0242] Embodiment 204: The cartridge according to any one of embodiments 202- 203, wherein said chamber containing beads that provide PCR primers and probes to detect methylation of one or more gene promoters comprises beads that provide PCR primers and probes to detect methylation of the promoter of BNC1.

[0243] Embodiment 205: The cartridge of embodiment 202, wherein said chamber containing beads that provide PCR primers and probes to detect methylation of one or more gene promoters comprises beads that provide one or more PCR primers and/or probes for ADAMTSl and/or BNC1 shown in Tables 5, or 10.

[0244] Embodiment 206: The cartridge according to any of embodiments 190-200, wherein said chamber containing beads that provide PCR primers and probes to detect methylation of one or more gene promoters comprises beads that provide PCR primers and probes to detect methylation of one or more gene promoters whose methylation state is a marker for breast cancer.

[0245] Embodiment 207: The cartridge of embodiment 206, wherein said chamber containing beads that provide PCR primers and probes to detect methylation of one or more gene promoters comprises beads that provide PCR primers and probes to detect methylation of the promoters of one, two, three, four, five, or all genes selected from the group consisting oiBRCAl, RASSF1A, AKR1B1, HOXB4, HIST1H3C, RASGRF2, and TM6SF1.

[0246] Embodiment 208: The cartridge of embodiment 207, wherein said chamber containing beads that provide PCR primers and probes to detect methylation of one or more gene promoters comprises beads that provide PCR primers and probes to detect methylation of the promoter of BRCA1.

[0247] Embodiment 209: The cartridge according to any one of embodiments 207- 208, wherein said chamber containing beads that provide PCR primers and probes to detect methylation of one or more gene promoters comprises beads that provide PCR primers and probes to detect methylation of the promoter of RASSF1A.

[0248] Embodiment 210: The cartridge according to any one of embodiments 207- 209, wherein said chamber containing beads that provide PCR primers and probes to detect methylation of one or more gene promoters comprises beads that provide PCR primers and probes to detect methylation of the promoter of AKR1B1.

[0249] Embodiment 211 : The cartridge according to any one of embodiments 207- 210, wherein said chamber containing beads that provide PCR primers and probes to detect methylation of one or more gene promoters comprises beads that provide PCR primers and probes to detect methylation of the promoter of HOXB4.

[0250] Embodiment 212: The cartridge according to any one of embodiments 207-211, wherein said chamber containing beads that provide PCR primers and probes to detect methylation of one or more gene promoters comprises beads that provide PCR primers and probes to detect methylation of the promoter of HIST1H3C.

[0251] Embodiment 213 : The cartridge according to any one of embodiments 207- 212, wherein said chamber containing beads that provide PCR primers and probes to detect methylation of one or more gene promoters comprises beads that provide PCR primers and probes to detect methylation of the promoter of RASGRF2.

[0252] Embodiment 214: The cartridge according to any one of embodiments 207- 213, wherein said chamber containing beads that provide PCR primers and probes to detect methylation of one or more gene promoters comprises beads that provide PCR primers and probes to detect methylation of the promoter of TM6SF1.

[0253] Embodiment 215: The cartridge according to any one of embodiments 207- 214, wherein said chamber containing beads that provide PCR primers and probes to detect methylation of one or more gene promoters comprises beads that provide one or more PCR primers and/or one or more PCR probes shown in Tables 5, or 9.

[0254] Embodiment 216: The cartridge of embodiment 206, wherein said chamber containing beads that provide PCR primers and probes to detect methylation of one or more gene promoters comprises beads that provide PCR primers and probes to detect methylation of the promoters of BRCA1.

[0255] Embodiment 217: The cartridge according to any of embodiments 190-200, wherein said chamber containing beads that provide PCR primers and probes to detect methylation of one or more gene promoters comprises beads that provide PCR primers and probes to detect methylation of one or more gene promoters whose methylation state is a marker for lung cancer.

[0256] Embodiment 218: The cartridge of embodiment 217, wherein said chamber containing beads that provide PCR primers and probes to detect methylation of one or more gene promoters comprises beads that provide PCR primers and probes to detect methylation of the promoters of one, two, three, or all genes selected from the group consisting of CDOl, SOX17, TAC1, and HOXA7.

[0257] Embodiment 219: The cartridge of embodiment 218, wherein said chamber containing beads that provide PCR primers and probes to detect methylation of one or more gene promoters comprises beads that provide PCR primers and probes to detect methylation of the promoter of CDOl .

[0258] Embodiment 220: The cartridge according to any one of embodiments 218- 219, wherein said chamber containing beads that provide PCR primers and probes to detect methylation of one or more gene promoters comprises beads that provide PCR primers and probes to detect methylation of the promoter of SOX17.

[0259] Embodiment 221 : The cartridge according to any one of embodiments 218- 220, wherein said chamber containing beads that provide PCR primers and probes to detect methylation of one or more gene promoters comprises beads that provide PCR primers and probes to detect methylation of the promoter of TAC1.

[0260] Embodiment 222: The cartridge according to any one of embodiments 218-221, wherein said chamber containing beads that provide PCR primers and probes to detect methylation of one or more gene promoters comprises beads that provide PCR primers and probes to detect methylation of the promoter of HOXA 7.

[0261] Embodiment 223 : The cartridge according to any of embodiments 190-200, wherein said chamber containing beads that provide PCR primers and probes to detect methylation of one or more gene promoters comprises beads that provide PCR primers and probes to detect methylation of one or more gene promoters whose methylation state is a marker for brain cancer.

[0262] Embodiment 224: The cartridge of embodiment 223, wherein said chamber containing beads that provide PCR primers and probes to detect methylation of one or more gene promoters comprises beads that provide PCR primers and probes to detect methylation of the promoter of MGMT.

[0263] Embodiment 225: The cartridge of embodiment 224, wherein said chamber containing beads that provide PCR primers and probes to detect methylation of one or more gene promoters comprises beads that provide one or more PCR primers and/or probes for MGMT shown in Tables 5, or 10.

[0264] Embodiment 226: The cartridge of embodiment 225, wherein said cartridge contains the following probes and primers for determining methylation of MGMT using a nested PCR reaction:

[0265] an external forward primer (248b) comprising the nucleotide sequence

GTTTT(T*)AGAAYG(T*)TTTGYGTTT (SEQ ID NO:263);

[0266] an external reverse primer (249b) comprising the nucleotide sequence AAAAAAC(T*)CCRCACTCTTCC (SEQ ID NO:265);

[0267] an internal forward primer (250) comprising the nucleotide sequence

TTTCGACGTTCGTAGGTTTTCGC (SEQ ID NO:266);

[0268] an internal reverse primer (251) comprising the nucleotide sequence

GCACTCTTCCGAAAACGAAACG (SEQ ID NO:267); and

[0269] a probe (252a) comprising the nucleotide sequence fluor- CCAAACAC(T*)CACCAAATC(N*)CAAAC -blocker (SEQ ID NO: 268).

[0270] Embodiment 227: The cartridge according to any one of embodiments 225- 226, wherein said cartridge contains the following probes and primers for determining methylation of ACTB {e.g., as a control) using a nested PCR reaction:

[0271] an external forward primer (102) comprising the nucleotide sequence

GTGATGGAGGAGGTTTAGTAAGTT (SEQ ID NO: 103);

[0272] an external reverse primer (103) comprising the nucleotide sequence

CCAATAAAACCTACTCCTCCCTTAA (SEQ ID NO: 104);

[0273] an internal forward primer (148) comprising the nucleotide sequence

GGTTTAGTAAGTTTTTTGGATTGTG (SEQ ID NO: 149);

[0274] an internal reverse primer (149) comprising the nucleotide sequence

CCTTAAAAATTACAAAAACCACAAC (SEQ ID NO: 150); and

[0275] a probe (178) comprising the nucleotide sequence fluor- CCACCACCCAACACA(N*)CAA(T*)AACAAACAC-blocker (SEQ ID NO: 179).

[0276] Embodiment 228: A method of preparing a sample of cfDNA from serum or plasma, said method comprising:

[0277] combining a proteinase K treated sample of serum or plasma with a lysis solution according to any one of embodiments 169-171, and an alcohol to form a sample solution;

[0278] loading said sample solution into a sample receiving chamber in a cartridge according to any one of embodiments 143-154, or into a sample receiving chamber in a cartridge according to any one of embodiments 155-168; and

[0279] operating said cartridge to bind DNA in said sample to said affinity matrix and then to wash and release said DNA from said matrix.

[0280] Embodiment 229: The method of embodiment 228, wherein said combining a proteinase K treated sample of serum or plasma comprises combining said sample, lysis solution and alcohol in proportions corresponding to about 1.3 ml proteinase K treated serum or plasma, 2.2 mL lysis solution; and about 1.5 ml alcohol.

[0281] Embodiment 230: The method according to any one of embodiments 228- 229, wherein said alcohol comprises isopropanol.

[0282] Embodiment 231 : The method according to any one of embodiments 228- 230, wherein said sample comprises serum.

[0283] Embodiment 232: The method according to any one of embodiments 228- 231, wherein said sample comprises plasma.

[0284] Embodiment 233 : The method according to any one of embodiments 228- 232, wherein said sample comprises serum.

[0285] Embodiment 234: The method according to any one of embodiments 228-233, wherein operating said cartridge comprises introducing said cartridge into a sample processing module in a system according to any one of embodiments 133-139.

[0286] Embodiment 235: The method according to any one of embodiments 228- 234, wherein said method further comprises operating said cartridge to convert said DNA for methylation detection.

[0287] Embodiment 236: The method according to any one of embodiments 228-235, wherein said method further comprises operating said cartridge to perform one or more PCR reactions using said DNA or converted DNA a template.

[0288] Embodiment 237: The method according to any one of embodiments 228- 234, wherein said loading comprises loading said sample solution into one or more sample receiving chambers in a cartridge according to any one of embodiments 155-165.

[0289] Embodiment 238: The method of embodiment 237, wherein said method further comprises transferring the released DNA to a second cartridge for methylation detection and/or PCR.

[0290] Embodiment 239: The method of embodiment 238, wherein said second cartridge is a cartridge according to any one of embodiments 92-132.

[0291] Embodiment 240: The method according to any one of embodiments 238- 239, wherein said method further comprises operating said second cartridge to convert said DNA for methylation detection.

[0292] Embodiment 241 : The method according to any one of embodiments 238- 240, wherein said method further comprises operating said second cartridge to perform one or more PCR reactions using said DNA or converted DNA as a template.

[0293] Embodiment 242: The method according to any one of embodiments 238- 241, wherein said operating said second cartridge comprises introducing said second cartridge into a sample processing module in a system according to any one of embodiments 133-139.

[0294] Embodiment 243 : A method of preparing a DNA from an FFPE sample, said method comprising:

[0295] combining a formalin-fixed paraffin embedded sample with a lysis solution according to any one of embodiments 172-174;

[0296] heating said lysis solution containing said sample; adding an alcohol to said sample to form a sample solution; loading said sample solution into a sample receiving chamber in a cartridge according to any one of embodiments 143-154, or into a sample receiving chamber in a cartridge according to any one of embodiments 155-168; and

[0297] operating said cartridge to bind DNA in said sample to said affinity matrix and then to wash and release said DNA from said matrix.

[0298] Embodiment 244: The method of embodiment 243, wherein said heating comprises adding proteinase K to said sample and heating said sample.

[0299] Embodiment 245: The method of embodiment 244, wherein said heating comprises adding about 50 μΙ_, proteinase K to about 1.2 mL of FFPE lysis solution containing a FFPE sample.

[0300] Embodiment 246: The method according to any one of embodiments 243- 245, wherein said heating comprises heating said lysis solution to a temperature ranging from about 50°C to about 60°C.

[0301] Embodiment 247: The method of embodiment 246, wherein said heating comprises heating said lysis solution to a temperature of about 56°C.

[0302] Embodiment 248: The method according to any one of embodiments 243- 247, wherein said heating is for a period of time ranging up to about 4 hours, or up to about 5 hours, or up to about 6 hours.

[0303] Embodiment 249: The method of embodiment 248, wherein said heating is for about 4 hours.

[0304] Embodiment 250: The method according to any one of embodiments 243- 249, wherein said alcohol comprises ethanol.

[0305] Embodiment 251 : The method according to any one of embodiments 243- 250, wherein said method comprises adding alcohol to said lysis solution in a volume ratio of about 1 : 1 lysis solution: alcohol.

[0306] Embodiment 252: The method according to any one of embodiments 243- 251, wherein operating said cartridge comprises introducing said cartridge into a sample processing module in a system according to any one of embodiments 133-139.

[0307] Embodiment 253 : The method according to any one of embodiments 243- 252, wherein said method further comprises operating said cartridge to convert said DNA for methylation detection.

[0308] Embodiment 254: The method according to any one of embodiments 243-253, wherein said method further comprises operating said cartridge to perform one or more PCR reactions using said DNA or converted DNA as a template.

[0309] Embodiment 255: The method according to any one of embodiments 243- 251, wherein said loading comprise loading said sample solution into one or more sample receiving chambers in a cartridge according to any one of embodiments 155-165.

[0310] Embodiment 256: The method of embodiment 255, wherein said method further comprises transferring the released DNA to a second cartridge for methylation detection and/or PCR.

[0311] Embodiment 257: The method of embodiment 256, wherein said second cartridge is a cartridge according to any one of embodiments 92-132.

[0312] Embodiment 258: The method according to any one of embodiments 256-257, wherein said method further comprises operating said second cartridge to convert said DNA for methylation detection.

[0313] Embodiment 259: The method according to any one of embodiments 256- 258, wherein said method further comprises operating said second cartridge to perform one or more PCR reactions using said DNA or converted DNA as a template.

[0314] Embodiment 260: The method according to any one of embodiments 256- 259, wherein said operating said second cartridge comprises introducing said second cartridge into a sample processing module in a system according to any one of embodiments 133-139.

[0315] Embodiment 261 : A method of detecting a cancer, and/or staging a cancer, and/or detecting the predisposition to a cancer in a subject, said method comprising:

[0316] providing a biological sample from said subject, wherein said biological sample comprises a DNA;

[0317] utilizing a cartridge according to any one of claims 190-225 to detect methylation of one or more gene promoters in said DNA whose methylation state is a marker for a cancer, where an increase in methylation of said one or more gene promoters is indicative of the presence of a cancer or a predisposition to a cancer or a stage of a cancer or precancer.

[0318] Embodiment 262: The method of embodiment 261, wherein said subject is a human.

[0319] Embodiment 263 : The method according to any one of embodiments 261- 262, wherein said cancer is a cancer selected from the group consisting of breast cancer, pancreatic cancer, prostate cancer, brain cancer, a lung cancer, a B cell lymphoma, a

bronchus cancer, a colorectal cancer, a stomach cancer, an ovarian cancer, a urinary bladder cancer, a brain or central nervous system cancer, a peripheral nervous system cancer, an esophageal cancer, a cervical cancer, a melanoma, a uterine or endometrial cancer, a cancer of the oral cavity or pharynx, a liver cancer, a kidney cancer, a biliary tract cancer, a small bowel or appendix cancer, a salivary gland cancer, a thyroid gland cancer, a adrenal gland cancer, an osteosarcoma, a chondrosarcoma, a liposarcoma, a testes cancer, and a malignant fibrous histiocytoma.

[0320] Embodiment 264: The method according to any one of embodiments 261- 262, wherein said cancer is a cancer selected from the group consisting of breast cancer, pancreatic cancer, prostate cancer, brain cancer, a lung cancer.

[0321] Embodiment 265: The method according to any one of embodiments 261- 264, wherein said sample comprise a sample from serum or plasma.

[0322] Embodiment 266: The method according to any one of embodiments 261- 264, wherein said sample comprise an FFPE sample.

[0323] Embodiment 267: The method according to any one of embodiments 261- 266, wherein said one or more gene promoters comprise the promoters of one or more genes selected from the group consisting of RASSF1A, AKR1B1, HOXB4, HIST1H3C, RASGRF2, M6SF1, BRCA1, BNC1, ADAMTSl, CDOl, SOX17, TAC1, HOXA7, and MGMT.

[0324] Embodiment 268: The method according to any one of embodiments 261-266, wherein said cancer is pancreatic cancer and said one or more gene promoters comprise the promoters of one, two, three, or four genes selected from the group consisting of ADAMTSl, and BNC1.

[0325] Embodiment 269: The method of embodiment 268, wherein said one or more gene promoters comprise the promoter of ADAMTSl.

[0326] Embodiment 270: The method according to any one of embodiments 268- 269, wherein said one or more gene promoters comprise the promoter of BNC1.

[0327] Embodiment 271 : The method according to any one of embodiments 261- 266, wherein said cancer is breast cancer and said one or more gene promoters comprise the promoters of one, two, three, four, five, or all genes selected from the group consisting of BRCA1, RASSF1A, AKR1B1, HOXB4, HIST1H3C, RASGRF2, and TM6SF1.

[0328] Embodiment 272: The method of embodiment 271, wherein said one or more gene promoters comprise the promoter of BRCA1.

[0329] Embodiment 273 : The method according to any one of embodiments 271- 272, wherein said one or more gene promoters comprise the promoter of RASSFIA.

[0330] Embodiment 274: The method according to any one of embodiments 271- 273, wherein said one or more gene promoters comprise the promoter of AKR1B1.

[0331] Embodiment 275: The method according to any one of embodiments 271- 274, wherein said one or more gene promoters comprise the promoter of HOXB4.

[0332] Embodiment 276: The method according to any one of embodiments 271- 275, wherein said one or more gene promoters comprise the promoter of HIST1H3C.

[0333] Embodiment 277: The method according to any one of embodiments 271-276, wherein said one or more gene promoters comprise the promoter of RASGRF2.

[0334] Embodiment 278: The method according to any one of embodiments 271- 277, wherein said one or more gene promoters comprise the promoter of TM6SF1.

[0335] Embodiment 279: The method according to any one of embodiments 261- 266, wherein said cancer is breast cancer and said one or more gene promoters comprise the promoter of BRCA1.

[0336] Embodiment 280: The method according to any one of embodiments 261- 266, wherein said cancer is lung cancer and said one or more gene promoters comprise the promoters of one, two, three, for all genes selected from the group consisting of CDOl, SOX17, TAC1, and HOXA7.

[0337] Embodiment 281 : The method of embodiment 280, wherein said one or more gene promoters comprise the promoter of CDOl.

[0338] Embodiment 282: The method according to any one of embodiments 280- 281, wherein said one or more gene promoters comprise the promoter of SOX17.

[0339] Embodiment 283 : The method according to any one of embodiments 280-282, wherein said one or more gene promoters comprise the promoter of TAC1.

[0340] Embodiment 284: The method according to any one of embodiments 280- 283, wherein said one or more gene promoters comprise the promoter of HOXA 7.

[0341] Embodiment 285: The method according to any one of embodiments 261- 266, wherein said cancer is brain cancer and said one or more gene promoters comprise the promoter oiMGMT.

[0342] Embodiment 286: A method of converting cytosine residues in a DNA to uracil, while leaving 5 -methyl cytosine residues substantially unaffected, said method comprising:

[0343] contacting a sample comprising DNA with DABSO to convert said DNA;

[0344] desulphonating the converted DNA, to produce a DNA in which cytosine residues are converted to uracil, but 5-methylcytosine residues substantially unaffected.

[0345] Embodiment 287: The method of embodiment 286, wherein said contacting comprises contacting said DNA with DABSO at a concentration ranging from about 2 M up to about 5 M.

[0346] Embodiment 288: The method of embodiment 286, wherein said contacting comprises contacting said DNA with DABSO at a concentration of about 2.5 M.

[0347] Embodiment 289: The method according to any one of embodiments 286- 288, wherein said DABSO is dissolved in an alkaline aqueous solution.

[0348] Embodiment 290: The method of embodiment 289, wherein said DABSO is dissolved in a solution comprising KOH.

[0349] Embodiment 291 : The method according to any one of embodiments 286- 290, wherein said contacting comprises heating the DABSO/DNA solution to a temperature ranging from about 55°C to about 90°C.

[0350] Embodiment 292: The method according to any one of embodiments 286-291, wherein said DABSO is reacted with the DNA for a period of time ranging from about 15 minutes up to about 90 minutes.

[0351] Embodiment 293 : The method according to any one of embodiments 286- 292, wherein said desulphonating comprises contacting said converted DNA with an alkaline reagent.

[0352] Embodiment 294: The method of embodiment 293, wherein said alkaline reagent comprises KOH.

[0353] Embodiment 295: The method according to any one of embodiments 286- 294, wherein said conversion and/or desulphonation is performed on the DNA bound to a column.

[0354] Embodiment 296: The method according to any one of embodiments 286- 294, wherein said conversion and/or desulphonation is performed on the DNA in solution. [0355] Embodiment 297: A method of analyzing DNA methylation, said method comprising:

[0356] providing a DNA sample;

[0357] converting DNA in said sample according to the method of any one of embodiments 286-296; and

[0358] performing methylation specific PCR and/or nucleic acid sequencing, and/or high resolution melting analysis (HRM) on the converted nucleic acid to determine the methylation of said nucleic acid.

[0359] Embodiment 298: The method of embodiment 297, wherein said providing a DNA sample comprises preparing a sample according to any one of embodiments 228-234 or according to any one of embodiments 243-252.

[0360] Embodiment 299: A kit for detection of methylation state of a DNA, said kit comprising:

[0361] a container containing a conversion reagent comprising DABSO; and

[0362] a container containing a desulphonati on reagent.

[0363] Embodiment 300: The kit of embodiment 299, wherein said kit comprises a column comprising an affinity matrix.

[0364] Embodiment 301 : The kit according to any one of embodiments 299-300, wherein said kit comprises a container containing a binding buffer.

[0365] Embodiment 302: The kit according to any one of embodiments 299-301, wherein said kit comprises a container containing an elution buffer.

[0366] Embodiment 303 : The kit according to any one of embodiments 299-302, wherein said kit comprises a container containing a wash buffer.

[0367] Embodiment 304: The kit according to any one of embodiments 299-303, wherein said kit comprises a container containing a lysis solution according to any one of embodiments 169-171, and/or a container containing a lysis solution according to any one of embodiments 172-174.

[0368] Embodiment 305: The kit according to any one of embodiments 299-304, wherein said kit comprises a cartridge according to any one of embodiments 143-155 and/or a cartridge according to any one of embodiments 155-166.

[0369] Embodiment 306: The kit according to any one of embodiments 299-305, said kit comprising instructional materials teaching the use of said kit to convert a nuclei acid for determination of the methylation state of said nucleic acid.

[0370] Embodiment 307: A set of primers and probes for the determination of methylation of MGMT using a nested PCR reaction, said set comprising the following primers and probes:

[0371] an external forward primer comprising the nucleotide sequence

GTTTT(T*)AGAAYG(T*)TTTGYGTTT (SEQ ID NO:263);

[0372] an external reverse primer comprising the nucleotide sequence

AAAAAAC(T*)CCRCACTCTTCC (SEQ ID NO:265);

[0373] an internal forward primer comprising the nucleotide sequence

TTTCGACGTTCGTAGGTTTTCGC (SEQ ID NO: 266);

[0374] an internal reverse primer comprising the nucleotide sequence

GCACTCTTCCGAAAACGAAACG (SEQ ID NO:267); and

[0375] a probe comprising the nucleotide sequence fluor- CCAAACAC(T*)CACCAAATC(N*)CAAAC -blocker (SEQ ID NO: 268).

[0376] Embodiment 308: A set of primers and probes for the determination of methylation of ACTB {e.g., as a control) using a nested PCR reaction, said set comprising the following primers and probes:

[0377] an external forward primer (102) comprising the nucleotide sequence

GTGATGGAGGAGGTTTAGTAAGTT (SEQ ID NO: 103);

[0378] an external reverse primer (103) comprising the nucleotide sequence

CCAATAAAACCTACTCCTCCCTTAA (SEQ ID NO: 104);

[0379] an internal forward primer (148) comprising the nucleotide sequence GGTTTAGTAAGTTTTTTGGATTGTG (SEQ ID NO: 149);

[0380] an internal reverse primer (149) comprising the nucleotide sequence

CCTTAAAAATTACAAAAACCACAAC (SEQ ID NO: 150); and

[0381] a probe (178) comprising the nucleotide sequence fluor- CCACCACCCAACACA(N*)CAA(T*)AACAAACAC-blocker (SEQ ID NO: 179).

[0382] Embodiment 309: A set of primers and probes for the determination of methylation of MGMT using a nested PCR reaction with determination of the methylation of ACTB as a control, comprising the primers and probes of embodiment 307 and the primers and probes of embodiment 308.

[0383] Embodiment 310: A method of determining the methylation of MGMT using methylation specific PCR said method comprising:

[0384] providing a converted {e.g., bisulfite converted) DNA containing a promoter region of the MGMT gene;

[0385] performing methylation specific PCR for MGMT methylation using a nested

PCR reaction comprising the following primers and probes:

[0386] an external forward primer comprising the nucleotide sequence GTT

TT(T*)AGAAYG(T*)TTTGYGTTT(SEQ ID NO:263);

[0387] an external reverse primer comprising the nucleotide sequence AAAAAAC(T*)CCRCACTCTTCC (SEQ ID NO:265);

[0388] an internal forward primer comprising the nucleotide sequence

TTTCGACGTTCGTAGGTTTTCGC (SEQ ID NO:266);

[0389] an internal reverse primer comprising the nucleotide sequence

GCACTCTTCCGAAAACGAAACG (SEQ ID NO:267); and

[0390] a probe comprising the nucleotide sequence fluor- CCAAACAC(T*)CACCAAATC(N*)CAAAC -blocker (SEQ ID NO: 268); and

[0391] detecting and/or quantifying the PCR amplification product to provide determine methylation of said MGMT gene.

[0392] Embodiment 311 : The method of embodiment 310, wherein said method further comprises:

[0393] providing a converted {e.g., bisulfite converted) DNA containing a promoter region of the ACTB gene {e.g., as a control);

[0394] performing methylation specific PCR for ACTB methylation using a nested

PCR reaction comprising the following primers and probes:

[0395] an external forward primer comprising the nucleotide sequence

GTGATGGAGGAGGTTTAGTAAGTT (SEQ ID NO: 103);

[0396] an external reverse primer comprising the nucleotide sequence

CCAATAAAACCTACTCCTCCCTTAA (SEQ ID NO: 104);

[0397] an internal forward primer comprising the nucleotide sequence GGTTTAGTAAGTTTTTTGGATTGTG (SEQ ID NO: 149);

[0398] an internal reverse primer comprising the nucleotide sequence

CCTTAAAAATTACAAAAACCACAAC (SEQ ID NO: 150); and

[0399] a probe comprising the nucleotide sequence fluor- CCACCACCCAACACA(N*)CAA(T*)AACAAACAC-blocker (SEQ ID NO: 179); and

[0400] detecting and/or quantifying the PCR amplification product to provide determine methylation of said ACTB gene.

[0401] Embodiment 312: The method according to any one of embodiments 310- 311, wherein said methylation specific PCR for MGMT methylation and said methylation specific PCR for ACTB methylation are performed in a single multiplex PCR reaction.

[0402] Embodiment 313 : The method according to any one of embodiments 310- 312, wherein said methylation specific PCR is performed using a cartridge according to any one of embodiments 92-132.

[0403] Embodiment 314: The method of embodiment 313, wherein: said providing a converted DNA containing a promoter region of the MGMT gene comprises introducing an unconverted DNA containing a promoter region of the MGMT gene into said cartridge and operating said cartridge to convert said DNA in said cartridge using a conversion reagent; and/or said providing a converted DNA containing a promoter region of the ACTB gene comprises introducing an unconverted DNA containing a promoter region of the ACTB gene into said cartridge and operating said cartridge to convert said DNA in said cartridge using a conversion reagent.

[0404] Embodiment 315: The method of embodiment 314, wherein said conversion reagent comprises a compound selected from the group consisting of ammonium bisulfite, sodium metabi sulfite, potassium bisulfite, cesium bisulfite, and DABSO.

[0405] Embodiment 316: The method according to any one of embodiments 313- 315, wherein said operating said cartridge comprises heating said DNA and said conversion reagent in a thermocycling channel or chamber that is later used to perform said nested PCR reaction.

[0406] Embodiment 317: A set of cartridges for determining the methylation state of a nucleic acid, said set of cartridges comprising: a first cartridge comprising:

[0407] a sample receiving chamber;

[0408] a column comprising a first matrix material;

[0409] a temperature controlled channel or chamber;

[0410] a sample removal chamber; and

[0411] a plurality of chambers containing reagents and/or buffers, wherein when in use at least one of said chambers contains a bisulfite reagent; and

[0412] a second cartridge comprising:

[0413] a sample receiving chamber;

[0414] a column comprising a second matrix material;

[0415] a temperature controlled channel or chamber; and

[0416] a plurality of chambers containing reagents and/or buffers, wherein when in use at least one of said chambers contains a desulphonation and/or elution reagent.

[0417] Embodiment 318: The set of cartridges of embodiment 317, wherein the temperature controlled channel or chamber in said first cartridge is a thermocycling channel or chamber.

[0418] Embodiment 319: The set of cartridges according to any one of

embodiments 317-318, wherein the temperature controlled channel or chamber in said second cartridge is a thermocycling channel or chamber.

[0419] Embodiment 320: The set of cartridges according to any one of

embodiments 317-319, wherein said bisulfite reagent comprises a compound selected from the group consisting of ammonium bisulfite, sodium metabi sulfite, potassium bisulfite, cesium bisulfite, and DABSO.

[0420] Embodiment 321 : The set of cartridges of embodiment 320, wherein said bisulfite reagent comprises ammonium bisulfite.

[0421] Embodiment 322: The set of cartridges according to any one of

embodiments 317-321, wherein said bisulfite is provided in a reagent mix comprising scavengers to prevent sulfite oxidation and/or catalysts.

[0422] Embodiment 323 : The set of cartridges of embodiment 322, wherein said bisulfite is provided in a reagent mix comprising scavengers selected from the group consisting of Trolox and hydroquinone.

[0423] Embodiment 324: The set of cartridges according to any one of

embodiments 322-323, wherein said bisulfite is provided in a reagent mix comprising polyamines as catalysts.

[0424] Embodiment 325: The set of cartridges according to any one of

embodiments 317-324, wherein said first cartridge is configured for the bisulfite reagent to be added to the cartridge at or near the time the sample is placed in the cartridge.

[0425] Embodiment 326: The set of cartridges according to any one of

embodiments 317-325, wherein the bisulfite reagent is provided as a component in one of said plurality of chambers in said first the cartridge.

[0426] Embodiment 327: The set of cartridges according to any one of 317-326, wherein said first matrix material and/or said second matrix material, independently comprise a material is selected from the group consisting of glass or silica, an ion exchange resin, and hydroxyapatite.

[0427] Embodiment 328: The set of cartridges of embodiment 327, wherein said first matrix material comprises glass fibers.

[0428] Embodiment 329: The set of cartridges according to any one of 327-328, wherein said second matrix material comprises glass fibers.

[0429] Embodiment 330: The set of cartridges according to any one of

embodiments 317-329, wherein said first cartridge comprises two sample receiving chambers.

[0430] Embodiment 331 : The set of cartridges according to any one of 317-330, wherein at least one chamber comprising the plurality of chambers in said second cartridge contains PCR primers, and/or PCR probes, and/or a PCR master mix.

[0431] Embodiment 332: The set of cartridges according to any one of 317-331, wherein, when said cartridge is in use, a chamber comprising the plurality of chambers in said first cartridge contains GTC-EtOH in a buffer.

[0432] Embodiment 333 : The set of cartridges according to any one of 317-332, wherein, when said cartridge is in use, a chamber comprising the plurality of chambers in said second cartridge contains GTC-EtOH in a buffer.

[0433] Embodiment 334: The set of cartridges according to any one of 332-333, wherein the first cartridge is configured for addition of GTC-ETOH in a buffer at or near the time the sample is placed into the cartridge.

[0434] Embodiment 335: The set of cartridges according to any one of 332-333, wherein the GTC-ETOH in a buffer is provided as a component in a chamber comprising the plurality of chambers of the first cartridge.

[0435] Embodiment 336: The set of cartridges according to any one of 332-335, wherein the second cartridge is configured for addition of GTC-ETOH in a buffer at or near the time the sample is placed into the cartridge.

[0436] Embodiment 337: The set of cartridges according to any one of 332-336, wherein the GTC-ETOH in a buffer is provided as a component in a chamber comprising the plurality of chambers of the second cartridge.

[0437] Embodiment 338: The set of cartridges according to any one of

embodiments 317-337, wherein said second cartridge comprises one or more chambers containing one or more reagents selected from the group consisting of methylation specific PCR primers, methylation specific PCR probes, PCR enzyme(s), and PCR reaction buffer.

[0438] Embodiment 339: The set of cartridges of embodiment 338, wherein said second cartridge contains at least two chambers containing one or more reagents selected from the group consisting of methylation specific PCR primers, methylation specific PCR probes, PCR enzyme(s), and PCR reaction buffer.

[0439] Embodiment 340: The set of cartridges according to any one of

embodiments 317-339, wherein said second cartridge contains at least one chamber containing primers and probes for detection of methylation of a forward strand of a converted DN A.

[0440] Embodiment 341 : The set of cartridges according to any one of

embodiments 317-340, wherein said second cartridge contains at least one chamber containing primers and probes for detection of methylation of a reverse strand of a converted DNA.

[0441] Embodiment 342: The set of cartridges according to any of embodiments

338-341, wherein said PCR primers, and/or probes, and/or enzymes are provided as beads.

[0442] Embodiment 343 : The set of cartridges according to any one of

embodiments 317-342, wherein:

[0443] in said first cartridge said sample receiving chamber, said column, said plurality of chambers, said sample removal chamber, and said temperature-controlled heating channel or chamber, are selectively in fluid communication; and/or

[0444] in said second cartridge said sample receiving chamber, said column, said plurality of chambers, and said temperature-controlled heating channel or chamber, are selectively in fluid communication.

[0445] Embodiment 344: The set of cartridges of embodiment 343, wherein

[0446] in said first cartridge, said sample receiving chamber, said column, said plurality of chambers, said sample removal chamber, and said temperature controlled

channel or chamber, are selectively in fluid communication by microfluidic channels and valves; and/or

[0447] in said second cartridge, said sample receiving chamber, said column, said plurality of chambers, and said temperature controlled channel or chamber, are selectively in fluid communication by microfluidic channels and valves.

[0448] Embodiment 345: The set of cartridges of embodiment 343, wherein

[0449] in said first cartridge, said sample receiving chamber, said column, said plurality of chambers, said sample removal chamber, and said temperature controlled channel or chamber or a port into said temperature controlled channel or chamber, are disposed around a central valve and selectively in fluid communication with a channel in said central valve, wherein said central valve is configured to accommodate a plunger that is capable of drawing fluid into or out of a chamber in fluid communication with said central valve; and/or

[0450] in said second cartridge, said sample receiving chamber, said column, said plurality of chambers, and said temperature controlled channel or chamber or a port into said temperature controlled channel or chamber, are disposed around a central valve and selectively in fluid communication with a channel in said central valve, wherein said central valve is configured to accommodate a plunger that is capable of drawing fluid into or out of a chamber in fluid communication with said central valve.

[0451] Embodiment 346: The set of cartridges according to any one of

embodiments 317-345, wherein said first cartridge is configured so that, when in use, said first cartridge comprises:

[0452] a first chamber containing a sample;

[0453] a second chamber containing a guanidinium thiosulfate-ethanol (GTC-EtOH) solution;

[0454] a third chamber containing a bisulfite reagent;

[0455] a fourth chamber containing a Tris buffer;

[0456] a fifth chamber polyethyleneglycol (PEG); and

[0457] a sixth chamber containing KOH.

[0458] Embodiment 347: The set of cartridges of embodiment 346, wherein said first chamber in said first cartridge contains said sample in a GTC-EtOH- Tween

extract! on/ precipitati on reagent.

[0459] Embodiment 348: The set of cartridges according to any one of

embodiments 346-347, wherein said a second chamber containing a guanidinium

thiosulfate-ethanol (GTC-EtOH) solution contains GTC-Tris (pH 7), ethanol.

[0460] Embodiment 349: The set of cartridges according to any one of

embodiments 317-336, wherein said second cartridge is configured so that, when in use, said second cartridge comprises:

[0461] a first chamber containing a sample;

[0462] a second chamber containing a guanidinium thiosulfate-ethanol (GTC-EtOH) solution;

[0463] a third chamber containing a Tris buffer;

[0464] a fourth chamber containing polyethylene glycol (PEG);

[0465] a fifth chamber containing KOH; and

[0466] a sixth chamber containing a PCR enzyme bead.

[0467] Embodiment 350: The set of cartridges of embodiment 349, wherein said second cartridge comprises a seventh chamber containing a Tris bead, and an enzyme bead.

[0468] Embodiment 351 : The set of cartridges according to any one of

embodiments 349-350, wherein said said a second chamber containing a guanidinium thiosulfate-ethanol (GTC-EtOH) solution contains GTC-Tris (pH 7), ethanol.

[0469] Embodiment 352: The set of cartridges according to any one of

embodiments 317-351, wherein said second cartridge comprises a chamber containing PCR primers and/or probes and/or PCR enzymes.

[0470] Embodiment 353 : The set of cartridges according to any one of

embodiments 317-352, wherein said second cartridge comprises an eighth chamber also containing PCR primers and/or probes and/or PCR enzymes.

[0471] Embodiment 354: The set of cartridges according to any one of

embodiments 317-353, wherein said second cartridge comprises one or more chambers containing primers specific for bisulfite-converted methylated and/or unmethylated sequences.

[0472] Embodiment 355: The set of cartridges according to any one of

embodiments 317-354, wherein said second cartridge comprises one or more chambers containing reagents for TaqMan PCR reactions.

[0473] Embodiment 356: The set of cartridges according to any one of

embodiments 317-355, wherein said second cartridge comprises one or more chambers containing one or more fluorescent probes that are markers for amplified methylated sequences and/or one or more fluorescent probes that are markers for amplified

unmethylated sequences.

[0474] Embodiment 357: The set of cartridges of embodiment 356, wherein said probes comprise a fluorescent reporter dye and a quencher dye, where the probes provides a signal upon cleavage by the 5' to 3' nuclease activity of Taq DNA polymerase.

[0475] Embodiment 358: The set of cartridges according to any one of

embodiments 356-357, wherein said second cartridge comprises a plurality of probes each specific to a different methylated region in an amplified region of interest.

[0476] Embodiment 359: The set of cartridges according to any one of

embodiments 356-357, wherein said second cartridge comprises a single probe specific to a methylated region in an amplified region of interest.

[0477] Embodiment 360: The set of cartridges according to any one of

embodiments 356-357, wherein said second cartridge comprises a plurality of probes each specific to the same methylated region in an amplified region of interest.

[0478] Embodiment 361 : The set of cartridges according to any one of

embodiments 317-360, wherein said second cartridge contains primers and/or probes to determine methylation of a promoter region of a gene selected from the group consisting of MGMT, RASSF1A, ADAMTS1, BNC1, HIST1H3C, HOXB4, RASGRF2, TM6SF1, and AKR1B1.

[0479] Embodiment 362: The set of cartridges according to any one of

embodiments 317-360, wherein said second cartridge contains one or more primers shown in Tables 5, 9, or 10, and/or one or more probes shown in Tables 5, 9, or 10.

[0480] Embodiment 363 : The set of cartridges of embodiment 362, wherein said second cartridge contains the following probes and primers for determining methylation of MGMT using a nested PCR reaction:

[0481] an external forward primer (248b) comprising the nucleotide sequence GTTTT(T*)AGAAYG(T*)TTTGYGTTT (SEQ ID NO:263);

[0482] an external reverse primer (249b) comprising the nucleotide sequence:

AAAAAAC(T*)CCRCACTCTTCC (SEQ ID NO:265);

[0483] an internal forward primer (250) comprising the nucleotide sequence

TTTCGACGTTCGTAGGTTTTCGC (SEQ ID NO:266);

[0484] an internal reverse primer (251) comprising the nucleotide sequence

GCACTCTTCCGAAAACGAAACG (SEQ ID NO:267); and

[0485] a probe (252a) comprising the nucleotide sequence fluor- CCAAACAC(T*)CACCAAATC(N*)CAAAC-blocker (SEQ ID NO:268).

[0486] Embodiment 364: The set of cartridges according to any one of

embodiments 362-363, wherein said second cartridge contains the following probes and primers for determining methylation of ACTB (e.g., as a control) using a nested PCR reaction:

[0487] an external forward primer (102) comprising the nucleotide sequence

GTGATGGAGGAGGTTTAGTAAGTT (SEQ ID NO: 103);

[0488] an external reverse primer (103) comprising the nucleotide sequence

CCAATAAAACCTACTCCTCCCTTAA (SEQ ID NO: 104);

[0489] an internal forward primer (148) comprising the nucleotide sequence

GGTTTAGTAAGTTTTTTGGATTGTG (SEQ ID NO: 149);

[0490] an internal reverse primer (149) comprising the nucleotide sequence

CCTTAAAAATTACAAAAACCACAAC (SEQ ID NO: 150); and

[0491] a probe (178) comprising the nucleotide sequence fluor-CCACCACCCAACACA(N*)CAA(T*)AACAAACAC-blocker (SEQ ID NO: 179).

[0492] Embodiment 365 : The set of cartridges according to any one of

embodiments 317-360, wherein said second cartridge comprises one or more chambers containing beads that provide PCR primers and probes to detect methylation of one or more gene promoters.

[0493] Embodiment 366: The set of cartridges of embodiment 365, wherein said second cartridge comprises one or more chambers containing beads that provide PCR primers and probes to detect methylation of one or more gene promoters whose methylation state is a marker for a cancer selected from the group consisting of breast cancer, pancreatic cancer, prostate cancer, brain cancer, and lung cancer.

[0494] Embodiment 367: The set of cartridges according to any of embodiments

365-366, wherein said chamber containing beads that provide PCR primers and probes to detect methylation of one or more gene promoters comprises beads that provide PCR primers and probes to detect methylation of one or more gene promoters whose methylation state is a marker for a cancer selected from the group consisting of breast cancer, pancreatic cancer, prostate cancer, brain cancer, and lung cancer.

[0495] Embodiment 368: The set of cartridges of embodiment 367, wherein said chamber containing beads that provide PCR primers and probes to detect methylation of one or more gene promoters comprises beads that provide PCR primers and probes for a nested PCR reaction.

[0496] Embodiment 369: The set of cartridges of embodiment 368, wherein said nested PCR comprises a first PCR reaction specific for converted DNA and a second PCR reaction specific for methylated CpGs.

[0497] Embodiment 370: The set of cartridges according to any one of

embodiments 349-369, wherein said chamber containing beads that provide PCR primers and probes chamber contains beads that provide PCR primers and probes to detect methylation of a forward strand of converted DNA.

[0498] Embodiment 371 : The set of cartridges according to any one of

embodiments 349-370, wherein said chamber containing beads that provide PCR primers and probes chamber contains beads that provide PCR primers and probes to detect methylation of a reverse strand of converted DNA.

[0499] Embodiment 372: The set of cartridges according to any of embodiments

349-371, wherein said chamber containing beads that provide PCR primers and probes to detect methylation of one or more gene promoters comprises beads that provide PCR primers and probes to detect methylation of the promoters of one or more genes selected from the group consisting ofRASSFIA, AKR1B1, HOXB4, HIST1H3C, RASGRF2,

M6SF1, BRCA1, BNC1, ADAMTSl, CDOl, SOX17, TAC1, HOXA7, and MGMT.

[0500] Embodiment 373 : The set of cartridges according to any of embodiments 349-372, wherein said chamber containing beads that provide PCR primers and probes to detect methylation of one or more gene promoters comprises beads that provide PCR primers and probes to detect methylation of one or more gene promoters whose methylation state is a marker for pancreatic cancer.

[0501] Embodiment 374: The set of cartridges of embodiment 373, wherein said chamber containing beads that provide PCR primers and probes to detect methylation of one or more gene promoters comprises beads that provide PCR primers and probes to detect methylation of the promoters of ADAMTSl , and/or BNC1.

[0502] Embodiment 375: The set of cartridges of embodiment 374, wherein said chamber containing beads that provide PCR primers and probes to detect methylation of one or more gene promoters comprises beads that provide PCR primers and probes to detect methylation of the promoter of ADAMTS1.

[0503] Embodiment 376: The set of cartridges according to any one of

embodiments 374-375, wherein said chamber containing beads that provide PCR primers and probes to detect methylation of one or more gene promoters comprises beads that provide PCR primers and probes to detect methylation of the promoter of BNC1.

[0504] Embodiment 377: The set of cartridges of embodiment 374, wherein said chamber containing beads that provide PCR primers and probes to detect methylation of one or more gene promoters comprises beads that provide one or more PCR primers and/or probes for ADAMTS1 and/or BNC1 shown in Tables 5, or 10.

[0505] Embodiment 378: The set of cartridges according to any of embodiments

349-372, wherein said chamber containing beads that provide PCR primers and probes to detect methylation of one or more gene promoters comprises beads that provide PCR primers and probes to detect methylation of one or more gene promoters whose methylation state is a marker for breast cancer.

[0506] Embodiment 379: The set of cartridges of embodiment 378, wherein said chamber containing beads that provide PCR primers and probes to detect methylation of one or more gene promoters comprises beads that provide PCR primers and probes to detect methylation of the promoters of one, two, three, four, five, or all genes selected from the group consisting of BRCA1, RASSF1A, AKR1B1, HOXB4, HIST1H3C, RASGRF2, and TM6SF1.

[0507] Embodiment 380: The set of cartridges of embodiment 379, wherein said chamber containing beads that provide PCR primers and probes to detect methylation of one or more gene promoters comprises beads that provide PCR primers and probes to detect methylation of the promoter of BRCA1.

[0508] Embodiment 381 : The set of cartridges according to any one of

embodiments 379-380, wherein said chamber containing beads that provide PCR primers and probes to detect methylation of one or more gene promoters comprises beads that provide PCR primers and probes to detect methylation of the promoter of RASSF1A.

[0509] Embodiment 382: The set of cartridges according to any one of

embodiments 379-381, wherein said chamber containing beads that provide PCR primers and probes to detect methylation of one or more gene promoters comprises beads that provide PCR primers and probes to detect methylation of the promoter of AKR1B1.

[0510] Embodiment 383 : The set of cartridges according to any one of

embodiments 379-382, wherein said chamber containing beads that provide PCR primers and probes to detect methylation of one or more gene promoters comprises beads that provide PCR primers and probes to detect methylation of the promoter of HOXB4.

[0511] Embodiment 384: The set of cartridges according to any one of

embodiments 379-383, wherein said chamber containing beads that provide PCR primers and probes to detect methylation of one or more gene promoters comprises beads that provide PCR primers and probes to detect methylation of the promoter of HIST1H3C.

[0512] Embodiment 385: The set of cartridges according to any one of

embodiments 379-384, wherein said chamber containing beads that provide PCR primers and probes to detect methylation of one or more gene promoters comprises beads that provide PCR primers and probes to detect methylation of the promoter of RASGRF2.

[0513] Embodiment 386: The set of cartridges according to any one of

embodiments 379-385, wherein said chamber containing beads that provide PCR primers and probes to detect methylation of one or more gene promoters comprises beads that provide PCR primers and probes to detect methylation of the promoter of TM6SF1.

[0514] Embodiment 387: The set of cartridges according to any one of

embodiments 379-386, wherein said chamber containing beads that provide PCR primers and probes to detect methylation of one or more gene promoters comprises beads that provide one or more PCR primers and/or one or more PCR probes shown in Tables 5, or 9.

[0515] Embodiment 388: The set of cartridges of embodiment 378, wherein said chamber containing beads that provide PCR primers and probes to detect methylation of one or more gene promoters comprises beads that provide PCR primers and probes to detect methylation of the promoters of BRCA1.

[0516] Embodiment 389: The set of cartridges according to any of embodiments 349-372, wherein said chamber containing beads that provide PCR primers and probes to detect methylation of one or more gene promoters comprises beads that provide PCR

primers and probes to detect methylation of one or more gene promoters whose methylation state is a marker for lung cancer.

[0517] Embodiment 390: The set of cartridges of embodiment 389, wherein said chamber containing beads that provide PCR primers and probes to detect methylation of one or more gene promoters comprises beads that provide PCR primers and probes to detect methylation of the promoters of one, two, three, or all genes selected from the group consisting oi CDOl, SOX17, TAC1, and HOXA 7.

[0518] Embodiment 391 : The set of cartridges of embodiment 390, wherein said chamber containing beads that provide PCR primers and probes to detect methylation of one or more gene promoters comprises beads that provide PCR primers and probes to detect methylation of the promoter of CDOl.

[0519] Embodiment 392: The set of cartridges according to any one of

embodiments 390-391, wherein said chamber containing beads that provide PCR primers and probes to detect methylation of one or more gene promoters comprises beads that provide PCR primers and probes to detect methylation of the promoter of SOX17.

[0520] Embodiment 393 : The set of cartridges according to any one of

embodiments 390-392, wherein said chamber containing beads that provide PCR primers and probes to detect methylation of one or more gene promoters comprises beads that provide PCR primers and probes to detect methylation of the promoter of TAC1.

[0521] Embodiment 394: The set of cartridges according to any one of

embodiments 390-393, wherein said chamber containing beads that provide PCR primers and probes to detect methylation of one or more gene promoters comprises beads that provide PCR primers and probes to detect methylation of the promoter of HOXA 7.

[0522] Embodiment 395: The set of cartridges according to any of embodiments 349-372, wherein said chamber containing beads that provide PCR primers and probes to detect methylation of one or more gene promoters comprises beads that provide PCR primers and probes to detect methylation of one or more gene promoters whose methylation state is a marker for brain cancer.

[0523] Embodiment 396: The set of cartridges of embodiment 395, wherein said chamber containing beads that provide PCR primers and probes to detect methylation of one or more gene promoters comprises beads that provide PCR primers and probes to detect methylation of the promoter of MGMT.

[0524] Embodiment 397: The set of cartridges of embodiment 396, wherein said chamber containing beads that provide PCR primers and probes to detect methylation of one or more gene promoters comprises beads that provide one or more PCR primers and/or probes for MGMT shown in Tables 5, or 10.

[0525] Embodiment 398: The set of cartridges of embodiment 397, wherein said cartridge contains the following probes and primers for determining methylation of MGMT using a nested PCR reaction:

[0526] an external forward primer (248b) comprising the nucleotide sequence

GTTTT(T*)AGAAYG(T*)TTTGYGTTT (SEQ ID NO:263);

[0527] an external reverse primer (249b) comprising the nucleotide sequence

AAAAAAC(T*)CCRCACTCTTCC (SEQ ID NO:265);

[0528] an internal forward primer (250) comprising the nucleotide sequence

TTTCGACGTTCGTAGGTTTTCGC (SEQ ID NO:266);

[0529] an internal reverse primer (251) comprising the nucleotide sequence

GCACTCTTCCGAAAACGAAACG (SEQ ID NO:267); and

[0530] a probe (252a) comprising the nucleotide sequence fluor- CCAAACAC(T*)CACCAAATC(N*)CAAAC -blocker (SEQ ID NO: 268).

[0531] Embodiment 399: The set of cartridges according to any one of

embodiments 397-398, wherein said cartridge contains the following probes and primers for determining methylation of ACTB {e.g., as a control) using a nested PCR reaction:

[0532] an external forward primer (102) comprising the nucleotide sequence:

[0533] GTGATGGAGGAGGTTTAGTAAGTT (SEQ ID NO: 103);

[0534] an external reverse primer (103) comprising the nucleotide sequence:

[0535] CCAATAAAACCTACTCCTCCCTTAA (SEQ ID NO: 104);

[0536] an internal forward primer (148) comprising the nucleotide sequence:

[0537] GGTTTAGTAAGTTTTTTGGATTGTG (SEQ ID NO: 149);

[0538] an internal reverse primer (149) comprising the nucleotide sequence:

[0539] CCTTAAAAATTACAAAAACCACAAC (SEQ ID NO: 150); and

[0540] an probe (178) comprising the nucleotide sequence:

[0541] fluor-CCACCACCCAACACA(N*)CAA(T*)AACAAACAC-blocker (SEQ

ID NO: 179).

[0542] Embodiment 400: A system for determining the methylation of a nucleic acid in a biological sample, said system comprising:

[0543] an enclosure configured to contain one or more sample processing modules, each sample processing module configured to hold a removable cartridge first cartridge and/or second cartridge of said set of cartridges according to any one of embodiments 317- 399;

[0544] where said system is configured to:

[0545] operate the sample processing modules to perform sample processing to operate the first cartridge of said set of cartridges to perform a bisulfite conversion of a nucleic acid in a sample introduced into said first cartridge; and/or

[0546] to perform a desulphonation and to determine methylation of one or more target nucleic acids within a corresponding removable sample cartridge.

[0547] Embodiment 401 : The system of embodiment 400, wherein said system is configured to contain one sample processing module.

[0548] Embodiment 402: The system of embodiment 400, wherein said system is configured to contain at least two sample processing modules, or at least 4 sample processing modules, or at least 8 sample processing modules, or at least 12 sample processing modules, or at least 16 sample processing modules, or at least 20 sample processing modules, or at least 24 sample processing modules, or at least 28 sample processing modules, or at least 32 sample processing modules, or at least 64 sample processing modules, or at least 128 sample processing modules.

[0549] Embodiment 403 : The system according to any one of embodiments 400- 402, wherein said modules comprise one or more heating plates to heat a temperature controlled chamber or channel in said cartridge.

[0550] Embodiment 404: The system according to any one of embodiments 400- 403, wherein said modules comprise a fan configured to cool a temperature controlled channel or chamber in said cartridge.

CLAIMS
What is claimed is:
1. A set of cartridges for determining the methylation state of a nucleic acid, said set of cartridges comprising:
a first cartridge comprising:
a sample receiving chamber;

a column comprising a first matrix material;

a temperature controlled channel or chamber;

a sample removal chamber; and

a plurality of chambers containing reagents and/or buffers, wherein when in use at least one of said chambers contains a bisulfite reagent; and

a second cartridge comprising:

a sample receiving chamber;

a column comprising a second matrix material;

a temperature controlled channel or chamber; and

a plurality of chambers containing reagents and/or buffers, wherein when in use at least one of said chambers contains a desulphonation and/or elution reagent.

2. The set of cartridges of claim 1, wherein the temperature controlled channel or chamber in said first cartridge is a thermocycling channel or chamber.

3. The set of cartridges according to any one of claims 1-2, wherein the temperature controlled channel or chamber in said second cartridge is a thermocycling channel or chamber.

4. The set of cartridges according to any one of claims 1-3, wherein said bisulfite reagent comprises a compound selected from the group consisting of ammonium bisulfite, sodium metabi sulfite, potassium bisulfite, cesium bisulfite, and DABSO.

5. The set of cartridges of claim 4, wherein said bisulfite reagent comprises ammonium bisulfite.

6. The set of cartridges according to any one of claims 1-5, wherein said bisulfite is provided in a reagent mix comprising scavengers to prevent sulfite oxidation and/or catalysts.

7. The set of cartridges of claim 6, wherein said bisulfite is provided in a reagent mix comprising scavengers selected from the group consisting of Trolox and hydroquinone.

8. The set of cartridges according to any one of claims 6-7, wherein said bisulfite is provided in a reagent mix comprising polyamines as catalysts.

9. The set of cartridges according to any one of claims 1-8, wherein said first cartridge is configured for the bisulfite reagent to be added to the cartridge at or near the time the sample is placed in the cartridge.

10. The set of cartridges according to any one of claims 1-9, wherein the bisulfite reagent is provided as a component in one of said plurality of chambers in said first the cartridge.

11. The set of cartridges according to any one of 1-10, wherein at least one chamber comprising the plurality of chambers in said second cartridge contains PCR primers, and/or PCR probes, and/or a PCR master mix.

12. The set of cartridges according to any one of claims 1-11, wherein said second cartridge comprises one or more chambers containing one or more reagents selected from the group consisting of methylation specific PCR primers, methylation specific PCR probes, PCR enzyme(s), and PCR reaction buffer.

13. The set of cartridges of claim 12, wherein said second cartridge contains at least two chambers containing one or more reagents selected from the group consisting of

methylation specific PCR primers, methylation specific PCR probes, PCR enzyme(s), and PCR reaction buffer.

14. The set of cartridges according to any one of claims 1-13, wherein said second cartridge contains at least one chamber containing primers and probes for detection of methylation of a forward strand of a converted DNA.

15. The set of cartridges according to any one of claims 1-14, wherein said second cartridge contains at least one chamber containing primers and probes for detection of methylation of a reverse strand of a converted DNA.

16. The set of cartridges according to any of claims 12-15, wherein said PCR primers, and/or probes, and/or enzymes are provided as beads.

17. The set of cartridges according to any one of claims 1-16, wherein said second cartridge contains one or more primers shown in Tables 5, 11, or 12, and/or one or more probes shown in Tables 5, 11, or 12.

18. The set of cartridges of claim 17, wherein said second cartridge contains the following probes and primers for determining methylation of MGMT using a nested PCR reaction:

an external forward primer (248b) comprising the nucleotide sequence

GTTTT(T*)AGAAYG(T*)TTTGYGTTT (SEQ ID NO:263);

an external reverse primer (249b) comprising the nucleotide sequence:

AAAAAAC(T*)CCRCACTCTTCC (SEQ ID NO:265);

an internal forward primer (250) comprising the nucleotide sequence

TTTCGACGTTCGTAGGTTTTCGC (SEQ ID NO:266);

an internal reverse primer (251) comprising the nucleotide sequence

GCACTCTTCCGAAAACGAAACG (SEQ ID NO:267); and

a probe (252a) comprising the nucleotide sequence fluor- CCAAACAC(T*)CACCAAATC(N*)CAAAC-blocker (SEQ ID NO:268).

19. The set of cartridges according to any one of claims 17-18, wherein said second cartridge contains the following probes and primers for determining methylation of ACTB {e.g., as a control) using a nested PCR reaction:

an external forward primer (102) comprising the nucleotide sequence

GTGATGGAGGAGGTTTAGTAAGTT (SEQ ID NO: 103);

an external reverse primer (103) comprising the nucleotide sequence

CCAATAAAACCTACTCCTCCCTTAA (SEQ ID NO: 104);

an internal forward primer (148) comprising the nucleotide sequence

GGTTTAGTAAGTTTTTTGGATTGTG (SEQ ID NO: 149);

an internal reverse primer (149) comprising the nucleotide sequence

CCTTAAAAATTACAAAAACCACAAC (SEQ ID NO: 150); and

a probe (178) comprising the nucleotide sequence fluor- CCACCACCCAACACA(N*)CAA(T*)AACAAACAC-blocker (SEQ ID NO: 179).

20. A system for determining the methylation of a nucleic acid in a biological sample said system comprising:

an enclosure configured to contain one or more sample processing modules, each sample processing module configured to hold a removable cartridge first cartridge and/or second cartridge of said set of cartridges according to any one of claims 1-19;

where said system is configured to:

operate the sample processing modules to perform sample processing to operate the first cartridge of said set of cartridges to perform a bisulfite conversion of a nucleic acid in a sample introduced into said first cartridge and/or

to perform a desulphonation and to determine methylation of one or more target nucleic acids within a corresponding removable sample cartridge.

21. A method of determining the methylation state of a nucleic acid, said method comprising:

providing a biological sample in a sample chamber of a first cartridge in a set of cartridges according to any one of claims 1-19; and operating said first cartridge to:

bind DNA in said sample to said first matrix material;

wash the bound DNA;

elute the bound DNA off of the matrix material;

combine the eluted DNA with said bisulfite reagent;

heat the mixture of DNA and bisulfite reagent in said temperature controlled channel or chamber perform a bisulfite conversion of said DNA; and

deliver the bisulfite-converted DNA into the sample removal chamber of said first cartridge.

22. The method of claim 21, wherein said method further comprise:

providing bisulfite converted DNA in a sample chamber of a second cartridge in a set of cartridges according to any one of claims 1-19; and operating said second cartridge to: bind said bisulfite converted DNA to said second matrix material;

wash the bound bisulfite-converted DNA;

elute the washed bisulfite-converted DNA from said second matrix material; and

desulphonate the bisulfite converted DNA.

23. The method of claim 22, wherein said second cartridge is operated to elute the bisulfite-converted DNA from said second matrix material before desulphonation.

24. The method of claim 22, wherein said second cartridge is operated to elute the bisulfite-converted DNA from said second matrix material after or during desulphonation.

25. The method according to any one of claims 22-24, wherein said method comprises operating said second cartridge to perform methylation specific PCR and/or nucleic acid sequencing, and/or high resolution melting analysis (HRM) on said converted nucleic acid to determine the methylation of said nucleic acid.

26. A method of detecting a cancer or the predisposition to a cancer in a subject, said method comprising:

providing a biological sample from said subject, wherein said biological sample comprises a DNA;

utilizing a set of cartridges according to any one of claims 1-19, wherein said first cartridge of said set of cartridges is used to perform a bisulfite conversion of said DNA; and said second cartridge of said set of cartridges is used to desulphonate the converted DNA and to detect methylation of one or more gene promoters in said DNA whose methylation state is a marker for a cancer, where an increase in methylation of said one or more gene promoters is indicative of the presence of a cancer or a predisposition to a cancer or a stage of a cancer or precancer.

27. A kit for the determination of DNA methylation, said kit comprising:

a container containing a first cartridge and/or a second cartridge of set of cartridges according to any one of claims 1-19.

28. The kit according to claim 27, wherein said kit comprises a conversion reagent in said cartridge or in a container separate from the cartridge.

29. The kit of claim 28, wherein said kit comprises said conversion reagent in a container separate from the cartridge.

30. The kit of claim 28, wherein said kit comprises said conversion reagent is provided in a chamber of the cartridge.

31. The according to any one of claims 28-30, wherein said conversion reagent comprises a compound selected from the group consisting of sodium metabi sulfite, potassium bisulfite, cesium bisulfite, ammonium bisulfite, and DABSO.

Documents

Application Documents

# Name Date
1 201917022758-IntimationOfGrant12-12-2023.pdf 2023-12-12
1 201917022758-TRANSLATIOIN OF PRIOIRTY DOCUMENTS ETC. [07-06-2019(online)].pdf 2019-06-07
2 201917022758-PatentCertificate12-12-2023.pdf 2023-12-12
2 201917022758-STATEMENT OF UNDERTAKING (FORM 3) [07-06-2019(online)].pdf 2019-06-07
3 201917022758-SEQUENCE LISTING(PDF) [07-06-2019(online)].pdf 2019-06-07
3 201917022758-FORM 3 [03-07-2023(online)].pdf 2023-07-03
4 201917022758-SEQUENCE LISTING [07-06-2019(online)].txt 2019-06-07
4 201917022758-ABSTRACT [27-04-2023(online)].pdf 2023-04-27
5 201917022758-FORM 1 [07-06-2019(online)].pdf 2019-06-07
5 201917022758-CLAIMS [27-04-2023(online)].pdf 2023-04-27
6 201917022758-DRAWINGS [07-06-2019(online)].pdf 2019-06-07
6 201917022758-DRAWING [27-04-2023(online)].pdf 2023-04-27
7 201917022758-FER_SER_REPLY [27-04-2023(online)].pdf 2023-04-27
7 201917022758-DECLARATION OF INVENTORSHIP (FORM 5) [07-06-2019(online)].pdf 2019-06-07
8 201917022758-Information under section 8(2) [27-04-2023(online)]-1.pdf 2023-04-27
8 201917022758-COMPLETE SPECIFICATION [07-06-2019(online)].pdf 2019-06-07
9 201917022758-Information under section 8(2) [27-04-2023(online)].pdf 2023-04-27
9 201917022758.pdf 2019-06-09
10 201917022758-OTHERS [27-04-2023(online)].pdf 2023-04-27
10 abstract.jpg 2019-07-19
11 201917022758-FORM 4(ii) [25-01-2023(online)].pdf 2023-01-25
11 201917022758-FORM-26 [27-08-2019(online)].pdf 2019-08-27
12 201917022758-FER.pdf 2022-08-01
12 201917022758-Proof of Right (MANDATORY) [27-11-2019(online)].pdf 2019-11-27
13 201917022758-FORM 3 [02-11-2021(online)].pdf 2021-11-02
13 201917022758-FORM 3 [27-11-2019(online)].pdf 2019-11-27
14 201917022758-Certified Copy of Priority Document (MANDATORY) [03-01-2020(online)].pdf 2020-01-03
14 201917022758-FORM 18 [07-12-2020(online)].pdf 2020-12-07
15 201917022758-Certified Copy of Priority Document (MANDATORY) [03-01-2020(online)].pdf 2020-01-03
15 201917022758-FORM 18 [07-12-2020(online)].pdf 2020-12-07
16 201917022758-FORM 3 [02-11-2021(online)].pdf 2021-11-02
16 201917022758-FORM 3 [27-11-2019(online)].pdf 2019-11-27
17 201917022758-Proof of Right (MANDATORY) [27-11-2019(online)].pdf 2019-11-27
17 201917022758-FER.pdf 2022-08-01
18 201917022758-FORM 4(ii) [25-01-2023(online)].pdf 2023-01-25
18 201917022758-FORM-26 [27-08-2019(online)].pdf 2019-08-27
19 201917022758-OTHERS [27-04-2023(online)].pdf 2023-04-27
19 abstract.jpg 2019-07-19
20 201917022758-Information under section 8(2) [27-04-2023(online)].pdf 2023-04-27
20 201917022758.pdf 2019-06-09
21 201917022758-COMPLETE SPECIFICATION [07-06-2019(online)].pdf 2019-06-07
21 201917022758-Information under section 8(2) [27-04-2023(online)]-1.pdf 2023-04-27
22 201917022758-DECLARATION OF INVENTORSHIP (FORM 5) [07-06-2019(online)].pdf 2019-06-07
22 201917022758-FER_SER_REPLY [27-04-2023(online)].pdf 2023-04-27
23 201917022758-DRAWING [27-04-2023(online)].pdf 2023-04-27
23 201917022758-DRAWINGS [07-06-2019(online)].pdf 2019-06-07
24 201917022758-CLAIMS [27-04-2023(online)].pdf 2023-04-27
24 201917022758-FORM 1 [07-06-2019(online)].pdf 2019-06-07
25 201917022758-SEQUENCE LISTING [07-06-2019(online)].txt 2019-06-07
25 201917022758-ABSTRACT [27-04-2023(online)].pdf 2023-04-27
26 201917022758-SEQUENCE LISTING(PDF) [07-06-2019(online)].pdf 2019-06-07
26 201917022758-FORM 3 [03-07-2023(online)].pdf 2023-07-03
27 201917022758-STATEMENT OF UNDERTAKING (FORM 3) [07-06-2019(online)].pdf 2019-06-07
27 201917022758-PatentCertificate12-12-2023.pdf 2023-12-12
28 201917022758-TRANSLATIOIN OF PRIOIRTY DOCUMENTS ETC. [07-06-2019(online)].pdf 2019-06-07
28 201917022758-IntimationOfGrant12-12-2023.pdf 2023-12-12

Search Strategy

1 SearchHistoryE_29-07-2022.pdf

ERegister / Renewals

3rd: 08 Mar 2024

From 12/12/2019 - To 12/12/2020

4th: 08 Mar 2024

From 12/12/2020 - To 12/12/2021

5th: 08 Mar 2024

From 12/12/2021 - To 12/12/2022

6th: 08 Mar 2024

From 12/12/2022 - To 12/12/2023

7th: 08 Mar 2024

From 12/12/2023 - To 12/12/2024

8th: 29 Oct 2024

From 12/12/2024 - To 12/12/2025

9th: 14 Nov 2025

From 12/12/2025 - To 12/12/2026