DESCRIPTION
ISOPROPYL ALCOHOL-PRODUCING BACTERIUM HAVING IMPROVED
PRODUCTIVITY BY GNTR DESTRUCTION
Technical Field
[0001] The present invention relates to an isopropyl alcohol-producing bacterium and a
method of producing isopropyl alcohol using the bacterium.
Background Art
[0002] Propylene is an important basic raw material for synthetic resins such as
polypropylene and for petrochemical products, and is used widely such as for automobile
bumpers, food containers, films, and medical instruments.
Isopropyl alcohol produced from plant-derived raw materials can be converted to
propylene through a dehydration process. Therefore, isopropyl alcohol is a promising
carbon-neutral raw material for propylene. Acetone is also widely used as solvents and raw
materials for plastics. Kyoto Protocol called for industrialized nations to reduce their total
carbon dioxide emissions from 1990 levels by 5 percent by 2008-2012. Therefore,
carbon-neutral propylene is currently extremely important due to its versatility, in view of the
global environment.
[0003] Bacteria that assimilate plant-derived raw materials and produce isopropyl alcohol
are already known. For example, WO 2009/008377 discloses a bacterium that is modified to
produce isopropyl alcohol using glucose as a raw material, and describes that the bacterium
has excellent properties as a biocatalyst for industrial production due to its high selectivity for
isopropyl alcohol.
[0004] In isopropyl alcohol-producing Escherichia coli, because the raw material for
isopropyl alcohol is glucose, a great number of compounds formed by glycolysis and
catabolism can all be by-products. However, these compounds are essential substances for
the growth of Escherichia coli in some cases, and, therefore, the amount of glucose consumed
by these side reactions cannot be completely eliminated. Accordingly, various studies have
been carried out with a view to minimizing the by-products and increasing the amount of
isopropyl alcohol produced.
[0005] For example, WO 2009/008377 pamphlet discloses an isopropyl alcohol-producing
bacterium to which acetoacetate decarboxylase, isopropyl alcohol dehydrogenase, CoA
transferase and thiolase genes have been introduced, and which is capable of producing
isopropyl alcohol form a plant-derived raw material. It is described that the capacity of the
1
iswopyl alcohol-producing bacterium provides a production rate of 0.6 g/L/hr and an
accumulation amount of 28.4 g/L.
[0006] WO 2009/049274 and Appl. Environ. Biotechnol, 73(24), pp.7814-7818, (2007)
disclose an Escherichia coli variant to which acetyl-CoA acetyltransferase, acetoacetyl-CoA
transferase, acetoacetate decarboxylase and secondary alcohol dehydrogenase genes have
been introduced, and which produces isopropyl alcohol. It is described that the capacity of
the bacteria provides a production rate of 0.4 g/L/hr, a yield of 43.5%, and an accumulation
amount of 4.9 g/L.
[0007] WO 2009/028582 discloses an Escherichia coli variant to which acetoacetate
decarboxylase, isopropyl alcohol dehydrogenase, acetyl CoA:acetate CoA-transferase and
acetyl-CoA acetyltransferase genes have been introduced, and which produces isopropyl
alcohol. It is described that the capacity of the bacterium provides an accumulation amount
of 9.7 g/L.
[0008] Appl. Microbiol. Biotechnol., 77(6), pp.1219-1224, (2008) discloses an Escherichia
coli variant to which thiolase, CoA-transferase, acetoacetate decarboxylase and
primary-secondary alcohol dehydrogenase genes have been introduced, and which produces
isopropyl alcohol. It is described that the capacity of the bacterium provides a production
rate of 0.6 g/L/hr, a yield of 51% and an accumulation amount of 13.6 g/L.
[0009] WO 2009/103026 discloses an Escherichia coli variant to which acetoacetate
decarboxylase, acetyl CoA:acetate CoA-transferase, acetyl-CoA acetyltransferase and
isopropyl alcohol dehydrogenase genes have been introduced, and which is capable of
producing isopropyl alcohol. It is described that the bacterium is expected to have a capacity
that provides a yield of 50%, a production rate of 0.4 g/L/hr and a final production amount of
14 g/L.
[0010] wo 2009/247217 discloses an Escherichia coli variant to which acetoacetate
decarboxylase, CoA transferase, thiolase and 2-propyl alcohol dehydrogenase genes have
been introduced, and which is capable of producing isopropyl alcohol. It is described that
the capacity of the bacterium provides a final production amount of 2 g/L.
[0011] Here, isopropyl alcohol dehydrogenase, secondary alcohol dehydrogenase,
primary-secondary alcohol dehydrogenase and 2-propyl alcohol dehydrogenase are enzymes
that have different names but catalyze the same reaction. CoA transferase, acetoacetyl-CoA
transferase, acetyl CoA:acetate CoA-transferase and CoA transferase are enzymes that have
different names but catalyze the same reaction. Acetoacetic acid decarboxylase and
acetoacetate decarboxylase are enzymes that have different names but catalyze the same
reaction. Thiolase and acetyl-CoA acetyltransferase are enzymes that have different names
2
bi||eatalyze the same reaction. Accordingly, although the productivity of the isopropyl
alcohol-producing Escherichia coli variants disclosed in these documents varies, the enzymes
utilized for producing isopropyl alcohol are equivalent to the four types of enzymes of
acetoacetate decarboxylase, isopropyl alcohol dehydrogenase, CoA transferase and thiolase,
which are described in WO 2009/008377. In a case in which it is desired to improve the
productivity or yield, these four types of enzymes have been examined thus far.
[0012] Japanese Patent Application Laid-Open (JP-A) No.5-260979 describes that, in
Bacillus suhtillis, disruption of GntR gene possessed by the Escherichia coli improves
production of D-ribose.
[0013] Further, with regard to a method for converting isopropyl alcohol into acetone, a
copper-based catalyst is used as a solid catalyst for production of acetone through
dehydrogenation of isopropyl alcohol in JP-ANo.7-53433 and JP-ANo.11-335315.
Moreover, a catalyst obtained by physical mixing of zinc oxide fine particles and zirconium
oxide fine particles is used in UK Patent No. GB665376. It is known that impurities are
generally contained when a substance is produced using a microorganism. In this regard,
none of these techniques is a production method using microorganisms, and, therefore, does
not describe that impurity-containing isopropanol is used as a raw material
[0014] Acetone can easily be converted into isopropanol by hydrogenation. A process has
been proposed (see, for example, JP-ANo.2-174737) which includes obtaining propylene
from the isopropanol via a dehydration reaction, and thereafter obtaining cumene by allowing
the propylene to react with benzene, that is, a process in which acetone is reused as a raw
material for the Cumene method by being converted into propylene via two-step reactions.
In the re-usage as described above, there is a need for establishment of an industrial
and practical method for producing propylene fi-om acetone with high selectivity. A method
is also known (see, for example. East Germany Patent No. DD84378) which includes carrying
out a hydrogenation reaction of acetone at 400 °C in the presence of a Cu (25%) - zinc oxide
(35%) - aluminum oxide (40%) catalyst to obtain propylene. However, although the reaction
temperature in this method is high (400 °C), the conversion rate of acetone is low (89%). In
addition, since a side reaction that generates propane via hydrogenation of propylene occurs
in the method, the propylene selectivity is also insufficient (89%).
SUMMARY OF INVENTION
Technical Problem
[0015] However, none of the above-described Escherichia coli variants capable of
producing isopropyl alcohol has a fully satisfactory production capacity. Improvement of
3
e^iency in production of isopropyl alcohol in isopropyl alcohol-producing Escherichia coli
has been a major target to be achieved. In addition, provision of a method for effective
utilization of isopropyl alcohol obtained has also been desired.
An object of the present invention is to provide Escherichia coli having significantly
efficiency of production of isopropyl alcohol, an isopropyl alcohol production method and an
acetone production method which use the Escherichia coli, as well as a method of producing
propylene from isopropyl alcohol which contains acetone and which is obtained using the
Escherichia coli.
Solution to Problem
[0016] The present invention was made in view of the above-described circumstances. An
isopropyl alcohol-producing Escherichia coli according to the invention, an isopropyl alcohol
production method according to the invention, and an acetone production method according to
the present invention are as described below.
[1] An isopropyl alcohol-producing Escherichia coli including an isopropyl alcohol
production system, wherein the activity of transcriptional repressor GntR is inactivated, and
the isopropyl alcohol-producing Escherichia coli includes a group of auxiliary enzymes
having an enzyme activity pattern with which isopropyl alcohol production capacity achieved
by the inactivation of the GntR activity is maintained or enhanced.
[2] The isopropyl alcohol-producing Escherichia coli according to [1], wherein the
enzyme activity pattern of the group of auxiliary enzymes is selected from the group
consisting of:
(1) maintenance of wild-type activities of glucose-6-phosphate isomerase (Pgi)
activity, glucose-6-phosphate 1-dehydrogenase (Zwf) activity and phosphogluconate
dehydrogenase (Gnd) activity;
(2) inactivation of glucose-6-phosphate isomerase (Pgi) activity and enhancement of
glucose-6-phosphate 1-dehydrogenase (Zwf) activity; and
(3) inactivation of glucose-6-phosphate isomerase (Pgi) activity, enhancement of
glucose-6-phosphate 1-dehydrogenase (Zwf) activity and inactivation of phosphogluconate
dehydrogenase (Gnd) activity.
[3] The isopropyl alcohol-producing Escherichia coli according to [2], wherein the
glucose-6-phosphate 1-dehydrogenase (Zwf) activity is derived from a gene encoding
glucose-6-phosphate 1-dehydrogenase (Zwf) derived from a bacterium of the genus
Escherichia.
[4] The isopropyl alcohol-producing Escherichia coli according to any one of [1] to [3],
wherein the isopropyl alcohol production system is constituted by enzyme genes of
4
awaacetate decarboxylase, isopropyl alcohol dehydrogenase, CoA transferase and thiolase.
[5] The isopropyl alcohol-producing Escherichia coli according to any one of [1] to [4],
wherein the isopropyl alcohol production system is constituted by enzyme genes of
acetoacetate decarboxylase, isopropyl alcohol dehydrogenase, CoA transferase and thiolase,
and each of the enzyme genes is independently derived from at least one prokaryote selected
from the group consisting of a bacterium of the genus Clostridium, a bacterium of the genus
Bacillus and a bacterium of the genus Escherichia.
[6] The isopropyl alcohol-producing Escherichia coli according to [4] or [5], wherein the
acetoacetate decarboxylase activity is derived from an enzyme-encoding gene derived from
Clostridium acetobutylicum, the isopropyl alcohol dehydrogenase activity is derived from an
enzyme-encoding gene derived from Clostridium beijerinckii, and the CoA transferase
activity and the thiolase activity are derived from enzyme-encoding genes derived from
Escherichia coli.
[7] The isopropyl alcohol-producing Escherichia coli according to [4], wherein at least
one selected from the group consisting of the isopropyl alcohol dehydrogenase activity and
the acetoacetate decarboxylase activity is derived from a gene or genes introduced as a
modified gene or modified genes.
[8] The isopropyl alcohol-producing Escherichia coli according to [7], wherein the
modified gene of the isopropyl alcohol dehydrogenase has a base sequence represented by
SEQ ID NO: 40, and the modified gene of the acetoacetate decarboxylase has a base sequence
represented by SEQ ID NO: 43.
[9] The isopropyl alcohol-producing Escherichia coli according to any one of [4] to [8],
fiirther including at least a sucrose hydrolase gene from among sucrose non-PTS genes.
[10] A method of producing isopropyl alcohol, including producing isopropyl alcohol
from a plant-derived raw material using the isopropyl alcohol-producing Escherichia coli of
any one of [1] to [9].
[11] A method of producing acetone, including:
obtaining isopropyl alcohol from a plant-derived raw material using the isopropyl
alcohol-producing Escherichia coli of any one of [1] to [9]; and
contacting the obtained isopropyl alcohol with a complex oxide as a catalyst that
includes zinc oxide and at least one oxide containing a Group 4 element, and that is prepared
by coprecipitation.
[12] A method of producing propylene, including:
contacting isopropyl alcohol that is obtained from a plant-derived raw material using
the isopropyl alcohol-producing Escherichia coli of any one of [1] to [9] and that contains
5
ahkpne, with a solid acidic substance and a Cu-containing hydrogenation catalyst as catalysts,
at a reaction temperature within a range of from 50 to 300 "C.
[13] The method of producing propylene according to [ 12], wherein the Cu-containing
hydrogenation catalyst is a catalyst that further includes at least one element selected from the
group consisting of Group 6, Group 12 and Group 13 elements.
[14] The method of producing propylene according to [12] or [13], wherein the solid
acidic substance is zeolite.
Advantageous Effect of Invention
[0017] According to the present invention, an Escherichia coli having significantly
efficiency of production of isopropyl alcohol, an isopropyl alcohol production method and an
acetone production method which use the Escherichia coli, as well as a method of producing
propylene from isopropyl alcohol which contains acetone and which is obtained using the
Escherichia coli can be provided.
DESCRIPTION OF EMBODIMENTS
[0018] An isopropyl alcohol-producing Escherichia coli of the present invention is an
isopropyl alcohol-producing Escherichia coli including an isopropyl alcohol production
system, wherein the activity of transcriptional repressor GntR is inactivated, and the isopropyl
alcohol-producing Escherichia coli includes a group of auxiliary enzymes having an enzyme
activity pattern with which isopropyl alcohol production capacity achieved by the inactivation
of the GntR activity is maintained or enhanced.
In the isopropyl alcohol-producing Escherichia coli according to the invention, the
inactivation of the GntR activity in combination with the possession of a group of auxiliary
enzymes having the specified enzyme activity pattern enables high production of isopropyl
alcohol.
[0019] That is, as a result of various studies aiming to improve the efficiency of production
of isopropyl alcohol, the invention has found that inactivation of the activity of GntR, which
is a negative regulator of gluconate metabolism, improves the efficiency of production of
isopropyl alcohol by the Escherichia coli.
In addition, it was also found that there are enzymes that affect the improved
isopropyl alcohol production capacity achieved by the inactivation of GntR activity. The
improved isopropyl alcohol production capacity achieved by the inactivation of GntR is
maintained or enhanced, depending on the activity pattern of these enzymes.
[0020] As used in the invention, the term "group of auxiliary enzymes" refers to one enzyme,
or two or more enzymes, which affect(s) isopropyl alcohol production capacity. Further, the
6
aik^ity of enzymes included in the group of auxiliary enzymes is inactivated, activated or
enhanced, and the phrase "enzyme activity pattern of the group of auxiliary enzymes" as used
in the invention refers to an enzyme activity pattern of the enzymes that is capable of
maintaining or increasing the improved isopropyl alcohol production amount achieved by
inactivation of the GntR activity alone, and encompasses one enzyme or a combination of two
or more enzymes.
[0021 ] The group of auxiliary enzymes may be a group of enzymes composed only of native
enzymes except that an isopropyl alcohol production system is provided, and that the GntR
activity is inactivated (in the invention, factors that exhibit no enzyme activity by themselves
are also included in the scope of "enzymes", vinless specifically indicated to be excluded).
The scope of the isopropyl alcohol-producing Escherichia coli described above
encompasses, for example:
isopropyl alcohol-producing Escherichia coli to which no artificial alteration is made
except that an isopropyl alcohol production system exerting the predetermined isopropyl
alcohol production capacity is provided, and that GntR was inactivated by gene recombination
technology; and
isopropyl alcohol-producing Escherichia coli to which no artificial alteration is made
except that an isopropyl alcohol production system modified to improve isopropyl alcohol
production capacity is provided, and that GntR is inactivated by gene recombination
technology.
[0022] Examples of preferable enzyme activity patterns of the group of auxiliary enzymes
include the following patterns:
(1) maintenance of the wild-type activities of glucose-6-phosphate isomerase
(Pgi) activity, glucose-6-phosphate 1 -dehydrogenase (Zwf) activity and phosphogluconate
dehydrogenase (Gnd) activity;
(2) inactivation of glucose-6-phosphate isomerase (Pgi) activity and
enhancement of glucose-6-phosphate 1-dehydrogenase (Zwf) activity; and
(3) inactivation of glucose-6-phosphate isomerase (Pgi) activity, enhancement
of glucose-6-phosphate 1-dehydrogenase (Zwf) activity and inactivation of phosphogluconate
dehydrogenase (Gnd) activity.
Among them, the enzyme activity pattern of the group of auxiliary enzymes
described in the item (3) is more preferable from the viewpoint of isopropyl alcohol
production capacity.
[0023] The group of auxiliary enzymes according to the invention and the enzyme activity
pattern thereof are not limited to the those described above. Any group of auxiliary enzymes
7
ajfeenzyme activity pattern thereof which include inactivation of the GntR activity, and with
which the amount of isopropyl alcohol production amount in the isopropyl alcohol-producing
Escherichia coli can be increased, are within the scope of the invention. Further, the group
of auxiliary enzymes is not necessarily constituted by plural enzymes, and may be constituted
by one enzyme.
[0024] As used in the invention, the term "inactivation" refers to a condition in which the
activity of the factor or enzyme as measured by any existing measurement system is not
higher than 1/10 of the activity in the Escherichia coli before inactivation, assuming that the
activity in the Escherichia coli before inactivation is 100.
As used in the invention, the phrase "by gene recombination technology"
encompasses any alteration to the base sequence caused by insertion of another DNA into a
the base sequence of a native gene, substitution or deletion of a certain site of a gene, or a
combination thereof For example, the alteration may result from a mutation.
[0025] In the invention, Escherichia coli in which the activity of a factor or enzyme is
inactivated refers to a bacterium in which the native activity is impaired by some method
applied from outside the bacterial cell to the inside of the bacterial cell. The bacterium can
be generated by, for example, disrupting a gene encoding the protein or enzyme (gene
disruption).
[0026] Examples of the gene disruption in the invention include addition of a mutation to the
base sequence of a gene, insertion of another DNA into the base sequence, and deletion of a
certain part of a gene, which are carried out with a view to preventing the fianction of the gene
from being performed. As a result of the gene disruption, for example, the gene becomes
unable to be transcribed into mRNA, and the structural gene ceases to be translated.
Alternatively, due to incompleteness of transcribed mRNA, mutation or deletion appears in
the amino acid sequence of the translated structural protein, and thus the intrinsic functions of
the structural protein becomes unable to be performed.
[0027] Any method may be employed for the preparation of a gene disruptant as long as a
disruptant in which the enzyme or protein is not expressed is obtained thereby. Various gene
disruption methods (natural breeding, addition of a mutagenic agent, ultraviolet irradiation,
exposure to radiation, random mutagenesis, transposon, site-directed gene disruption) have
been reported. Gene disruption by homologous recombination is preferable due to its
capability of disruption of only a specified gene. Techniques by homologous recombination
are described in J. Bacteriol., 161, 1219-1221 (1985), J. Bacteriol., 177, 1511-1519 (1995)
and Proc. Natl. Acad. Sci. U.S.A, 97,6640-6645 (2000), and those skilled in the art can readily
carry out the gene disruption using these methods and applications thereof.
8
|f||28] In the invention, the "enhancement" of "activity" broadly means that an enzyme
activity in isopropyl alcohol-producing Escherichia coli becomes higher after enhancement as
compared to the enzyme activity before enhancement.
Methods for the enhancement are not particularly restricted as long as the activity of
an enzyme possessed by isopropyl alcohol-producing Escherichia coli is enhanced.
Examples thereof include enhancement by an enzyme gene introduced from outside the
bacterial cell, enhancement by augmented expression of an enzyme gene inside the bacterial
cell, and a combination thereof
[0029] Examples of enhancement by an enzyme gene introduced from outside the bacterial
cell include, specifically: introducing a gene encoding an enzyme having higher activity than
the enzyme of the host from outside the bacterial cell of the host bacterium into inside the
bacterial cell, thereby adding the enzyme activity of the introduced enzyme gene; substituting
the introduced enzyme activity for an intrinsic enzyme activity that the host originally
possess; increasing the copy number of an enzyme gene of the host or an enzyme gene
introduced from outside the bacterial cell to 2 or more; and any combination thereof
[0030] Examples of enhancement by augmented expression of an enzyme gene inside the
bacterial cell include, specifically: introducing a base sequence that enhances the expression
of an enzyme gene from outside the bacterial cell of the host bacterium into inside the
bacterial cell; substituting another promoter for the promoter of an enzyme gene that the host
bacterium possesses on its genome, thereby enhancing the expression of the enzyme gene;
and any combination thereof.
In the invention, the term "host" means Escherichia coli that will become the
isopropyl alcohol-producing Escherichia coli according to the invention as a result of the
introduction of one or more genes from outside the cell thereof
The invention is described below.
[0031 ] GntR in the invention refers to a transcription factor that negatively regulates an
operon participating in gluconate metabolism via the Entner-Doudoroflf pathway, and is a
generic name for GntR transcriptional repressor that suppresses the fimctions of two gene
groups (GntI and Gntll), which are responsible for the uptake and metabolism of gluconic
acid.
Glucose-6-phosphate isomerase (Pgi) in the invention refers to a generic name of
enzymes which are classified as enzyme code number 5.3.1.9 based on the report of the
Enzyme Commission of the International Union of Biochemistry (I.U.B), and which catalyze
a reaction of producing D-fructose-6-phosphate from D-glucose-6-phosphate.
[0032] Glucose-6-phosphate 1 -dehydrogenase (Zwf) in the invention refers to a generic
9
i l ^ e of enzymes which are classified as enzyme code number 1.1.1.49 based on the report of
the Enzyme Commission of the International Union of Biochemistry (I.U.B), and which
catalyze a reaction of producing D-glucono-l,5-lactone 6-phosphate from
D-glucose-6-phosphate.
Examples of such enzymes include those derived from bacteria of the genus
Deinococcus such as Deinococcus radiophilus, bacteria of the genus Aspergillus such as
Aspergillus niger and Aspergillus aculeatus, bacteria of the gQmxs Acetobacter such as
Acetobacter hansenii, bacteria of the genus Thermotoga such as Thermotoga maritima,
bacteria of the genus Cryptococcus such as Cryptococcus neoformans, bacteria of the genus
Dictyostelium such as Dictyostelium discoideum, the genus Pseudomonas such as
Pseudomonas fluorescens and Pseudomonas aeruginosa, the genus Saccharomyces such as
Saccharomyces cerevisiae, bacteria of the genus Bacillus such as Bacillus megaterium, and
bacteria of the genus Escherichia such as Escherichia coli.
[0033] As glucose-6-phosphate 1-dehydrogenase (Zwf) gene used in the invention, a DNA
having the base sequence of a gene encoding a thiolase obtained from any of the
enzyme-origin organisms described above, or a synthetic DNA sequence that is synthesized
based on a known base sequence of the gene, may be utilized. Preferable examples include a
DNA having the base sequence of a gene derived from a bacterium of the genus Deinococcus
such as Deinococcus radiophilus, a bacterium of the genus Aspergillus such as Aspergillus
niger or Aspergillus aculeatus, a bacterium of the genus Acetobacter such as Acetobacter
hansenii, a bacterium of the genus Thermotoga such as Thermotoga maritima, a bacterium of
the genus Cryptococcus such as Cryptococcus neoformans, a bacterium of the genus
Dictyostelium such as Dictyostelium discoideum, the genus Pseudomonas such as
Pseudomonas fluorescens or Pseudomonas aeruginosa, the genus Saccharomyces such as
Saccharomyces cerevisiae, a bacterium of the genus Bacillus such as Bacillus megaterium, or
a bacterium of the genus Escherichia such as Escherichia coli. A DNA having the base
sequence of a gene derived from a prokaryote such as a bacterium of the genus Deinococcus,
a bacterium of the genus Aspergillus , a bacterium of the genus Acetobacter, a bacterium of
the genus Thermotoga, a bacterium of the genus Pseudomonas, a bacterium of the genus
Bacillus or a bacterium of the genus Escherichia is more preferable, and a DNA having the
base sequence of a gene derived from Escherichia coli is particular preferable.
[0034] Phosphogluconate dehydrogenase (Gnd) in the invention refers to a generic name of
enzymes which are classified as enzyme code number 1.1.1.44 based on the report of the
Enzyme Commission of the International Union of Biochemistry (I.U.B), and which catalyze
a reaction of producing D-ribulose-5-phosphate and CO2 from 6-phospho-D-gluconate.
10
[%85] The isopropyl alcohol-producing Escherichia coli according to the invention is
Escherichia coli having an isopropyl alcohol production system, and has isopropyl alcohol
production capacity that is introduced or altered by a gene recombination technology. The
isopropyl alcohol production system may be any system that enables the target Escherichia
coli to produce isopropyl alcohol.
A preferable example is enhancement of an enzyme activity involved in isopropyl
alcohol production. In the isopropyl alcohol-producing Escherichia coli according to the
invention, four types of enzyme activities of acetoacetate decarboxylase activity, isopropyl
alcohol dehydrogenase activity, CoA transferase activity and the above-described thiolase
activity are imparted from outside the bacterial cell, or expression of the activities are
enhanced in the bacterial cell, or, more preferably, both the impartment and the enhancement
are carried out.
[0036] In the invention, thiolase refers to a generic name of enzymes which are classified as
enzyme code nvmiber: 2.3.1.9 based on the report of the Enzyme Commission of the
International Union of Biochemistry (I.U.B), and which catalyze a reaction of producing
acetoacetyl CoA from acetyl CoA.
Examples of the enzyme include those derived from bacteria of the genus
Clostridium such as Clostridium acetobutylicum and Clostridium beijerinckii, bacteria of the
genus Escherichia such as Escherichia coli, bacteria of the species Halobacterium, bacteria of
the genus Zoogloea such as Zoogloea ramigera, bacteria of the species Rhizobium, bacteria of
the genus of Bradyrhizobium such as Bradyrhizobium japonicum, bacteria of the genus
Candida such as Candida tropicalis, bacteria of the genus Caulobacter such as Caulobacter
crescentus, bacteria of the genus Streptomyces such as Streptomyces collinus, and bacteria of
the genus Enterococcus such as Enterococcus faecalis.
[0037] As a gene of the thiolase to be used in the invention, a DNA having the base
sequence of a gene encoding a thiolase obtained from any of the above-listed enzyme origin
organisms, or a synthesized DNA sequence that is synthesized based on a known base
sequence of the gene, may be used. Preferable examples include a DNA having the base
sequence of a gene derived from a bacterium of the genus Clostridium such as Clostridium
acetobutylicum or Clostridium beijerinckii, a bacterium of the genus Escherichia such as
Escherichia coli, a bacterium of the species Halobacterium, a bacterium of the genus
Zoogloea such as Zoogloea ramigera, a bacterium of the species Rhizobium, a bacterium of
the genus Bradyrhizobium such as Bradyrhizobium japonicum, a bacterium of the genus
Candida such as Candida tropicalis, a bacterium of the genus Caulobacter such as
Caulobacter crescentus, a bacterium of the genus Streptomyces such as Streptomyces collinus,
11
o^bacterium of the genus Enterococcus such as Enterococcus faecalis. More preferable
examples include a DNA having the base sequence of a gene derived from a procaryote such
as a bacterium of the genus Clostridium or a bacterium of the genus Escherichia, and a DNA
having the base sequence of a gene derived from Clostridium acetobutylicum or Escherichia
coll is particularly preferable.
[0038] In the invention, acetoacetate decarboxylase refers to a generic name of enzymes
which are classified as enzyme code number: 4.1.1.4 based on the report of the Enzyme
Commission of the International Union of Biochemistry (I.U.B), and which catalyze a
reaction of producing acetone from acetoacetate.
Examples of the enzymes include those derived from bacteria of the genus
Clostridium, such as Clostridium acetobutylicum and Clostridium beijerinckii, and bacteria of
the genus Bacillus such as Bacillus polymyxa.
[0039] As a gene of the acetoacetate decarboxylase to be introduced into the host bacterium
in the invention, a DNA having the base sequence of a gene encoding an acetoacetate
decarboxylase obtained from any of the above-listed enzyme origin organisms, or a synthetic
DNA sequence that is synthesized based on a known base sequence of the gene, may be used.
Preferable examples include those derived from bacteria of the genus Clostridium or bacteria
of the genus Bacillus. An example is a DNA having the base sequence of a gene derived
from Clostridium acetobutylicum or Bacillus polymyxa. A DNA having the base sequence of
a gene derived from Clostridium acetobutylicum is particularly preferable.
[0040] In the invention, isopropyl alcohol dehydrogenase refers to a generic name of
enzymes which are classified as enzyme code number: 1.1.1.80 based on the report of the
Enzyme Commission of the International Union of Biochemistry (I.U.B), and which catalyze
a reaction of producing isopropyl alcohol from acetone. Examples of the enzyme include
those derived from bacteria of the genus Clostridium, such as Clostridium beijerinckii.
[0041] As a gene of the isopropyl alcohol dehydrogenase to be introduced into the host
bacterium in the invention, a DNA having the base sequence of a gene encoding an isopropyl
alcohol dehydrogenase obtained from any of the above-listed enzyme origin organisms, or a
synthetic DNA sequence that is synthesized based on a known base sequence of the gene, may
be used. Preferable examples include those derived from bacteria of the genus Clostridium,
such as a DNA having the base sequence of a gene derived from Clostridium beijerinckii.
[0042] In the invention, CoA transferase refers to a generic name of enzymes which are
classified as enzyme code number: 2.8.3.8 based on the report of the Enzyme Commission of
the Intemational Union of Biochemistry (I.U.B), and which catalyze a reaction of producing
acetoacetate from acetoacetyl CoA.
12
^ Examples of the enzyme include those derived from bacteria of the genus
Clostridium, such as Clostridium acetobutylicum and Clostridium beijerinckii, bacteria of the
genus Roseburia, such as Roseburia intestinalis, bacteria of the genus Faecalibacterium such
as Faecalibacterium prausnitzii, bacteria of the genus Coprococcus, Trypanosoma such as
Trypanosoma brucei, and bacteria of the genus Escherichia such as Escherichia coli.
[0043] As a gene of the Co A transferase to be used in the invention, a DNA having the base
sequence of a gene encoding a Co A transferase obtained from any of the above-listed enzyme
origin organisms, or a synthetic DNA sequence that is synthesized based on a known base
sequence of the gene, may be used. Preferable examples include a DNA having the base
sequence of a gene derived from a bacterium of the genus Clostridium such as Clostridium
acetobutylicum, a bacterium of the genus Roseburia such as Roseburia intestinalis, a
bacterium of the genus Faecalibacterium such as Faecalibacterium prausnitzii, a bacterium
of the genus Coprococcus, Trypanosoma such as Trypanosoma brucei, or a bacterium of the
genus Escherichia such as Escherichia coli. More preferable examples include those
derived from a bacterium of the genus Clostridium or a bacterium of the genus Escherichia,
and a DNA having the base sequence of a gene derived from Clostridium acetobutylicum or
Escherichia coli is particularly preferable.
[0044] From the viewpoint of enzyme activity, it is preferable that each of the four kinds of
enzyme is an enzyme derived from at least one selected from the group consisting of a
bacterium of the genus Clostridium, a bacterium of the genus Bacillus, and a bacterium of the
genus Escherichia. In particular, a case in which the acetoacetate decarboxylase and the
isopropyl alcohol dehydrogenase are derived from a bacterium or bacteria of the genus
Clostridium, and in which the CoA transferase activity and the thiolase activity are derived
from a bacterium or bacteria of the genus Escherichia, is more preferable.
[0045] In particular, from the viewpoint of the enzyme activity, it is preferable that each of
the four kinds of enzyme in the invention comes from any of Clostridium acetobutylicum,
Clostridium beijerinckii, or Escherichia coli. A case in which the acetoacetate
decarboxylase is an enzyme derived from Clostridium acetobutylicum, and in which each of
the CoA transferase and the thiolase is an enzyme derived from Clostridium acetobutylicum or
Escherichia coli, and in which the isopropyl alcohol dehydrogenase is an enzyme derived
from Clostridium beijerinckii, is more preferable. In regard to the four kinds of enzyme, a
case in which the acetoacetate decarboxylase activity is derived from Clostridium
acetobutylicum, and in which the isopropyl alcohol dehydrogenase activity is derived from
Clostridium beijerinckii, and in which the CoA transferase activity and the thiolase activity
are derived from Escherichia coli, is particularly preferable from the viewpoint of the enzyme
13
a^ity.
[0046] Each of the activities of these enzymes in the invention may be an activity introduced
from outside the bacterial ceil into inside the bacterial cell, or an activity obtained by high
expression of the enzyme gene that the host bacterium possesses on its genome via
enhancement of the promoter activity for the enzyme gene or replacement of the promoter
with another promoter.
Introduction of the enzyme activity can be carried out by, for example, introducing a
gene encoding the enzyme from outside the bacterial cell of the host bacterium into inside the
bacterial cell using a gene recombination technology. Here, the enzyme gene to be
introduced may be derived from either the same species as that of the host cell or a different
species from that of the host cell. Methods for preparation of a genomic DNA necessary to
introduce a gene from outside the bacterial cell into inside the bacterial cell, cutting and
ligation of DNA, transformation, PCR (Polymerase Chain Reaction), the design and synthesis
of oligonucleotides to be used as primers, etc. may be carried out by usual methods well
known to those skilled in the art. These methods are described in Sambrook, J., et al.,
"Molecular Cloning A Laboratory Manual, Second Edition", Cold Spring Harbor Laboratory
Press,( 1989) etc.
[0047] In the invention, Escherichia coli in which an enzyme activity is enhanced refers to
Escherichia coli in which the enzyme activity is enhanced by some method. Such
Escherichia coli can be prepared using, for example, a method in which a gene encoding the
enzyme or protein is introduced from outside the bacterial cell to inside the bacterial cell
using a plasmid and a gene recombination technology similar to those described above, a
method in which high expression of an enzyme gene that the host Escherichia coli possesses
on its genome is achieved by enhancement of the promoter activity for the enzyme gene or
replacement of the promoter with another promoter.
[0048] The gene promoter in the invention may be any promoter that is capable of
controlling the expression of any of the genes described above. The gene promoter is
preferably a powerful promoter which constitutively works in the microorganism, and which
is not susceptible to repression of expression even in the presence of glucose. Specific
examples thereof include the promoter of glyceraldehyde-3-phosphate dehydrogenase
(hereinafter sometimes referred to as "GAPDH") or the promoter of serine hydroxymethyl
transferase.
The promoter in the present invention means a region to which an RNA polymerase
having a sigma factor binds to start transcription. For example, a GAPDH promoter derived
from Escherichia coli is described at Base Nos. 397-440 in the base sequence information of
14
G^jfeank accession number X02662.
[0049] CoA transferase genes (atoD and atoA) and a thiolase gene (atoB), each of which is
derived from Escherichia coli, form an operon on the genome of Escherichia coli in the order
of atoD, atoA, and atoB (Journal of Baceteriology Vol. 169 pp 42-52 Lauren Sallus Jenkins, et
al.) Therefore, the expression of the CoA transferase genes and the thiolase gene can be
simultaneously controlled by modifying the promoter of atoD.
In view of the above, when the CoA transferase activity and the thiolase activity are
obtained from the genomic genes of the host Escherichia coli, it is preferable to enhance the
expression of both enzyme genes by, for example, replacing the promoter responsible for the
expression of both enzyme genes by another promoter, from the viewpoint of obtaining
sufficient isopropyl alcohol production ability. Examples of the promoter to be used in order
to enhance the expression of the Co A transferase activity and the thiolase activity include the
above-described Escherichia co//-derived GAPDH promoter.
[0050] In the present invention, examples of isopropyl alcohol-producing Escherichia coli
having an isopropyl alcohol production system include the pIPA/B variant or the plaaa/B
variant described in WO 2009/008377. The scope of such Escherichia coli includes a
variant in which, from among enzymes involved in the production of isopropyl alcohol,
enhancement of CoA transferase activity and thiolase activity is carried out by enhancement
of the expression of the respective genes on the genome of the Escherichia coli, and in which
enhancement of isopropyl alcohol dehydrogenase activity and acetoacetate decarboxylase
activity is carried out by enhanced expression of the respective genes using a plasmid or
plasmids (sometimes referred to as "pla/B::atoDAB variant").
[0051] In the invention, inactivated GntR activity is preferably included from the viewpoint
of more effectively improving the efficiency of isopropyl alcohol production. It is more
preferable that inactivated glucose-6-phosphate isomerase (Pgi) activity and enhanced
glucose-6-phosphate 1-dehydrogenase (Zwf) activity are included in addition to the
inactivated GntR. It is most preferable that inactivated GntR activity, inactivated
glucose-6-phosphate isomerase (Pgi) activity, inactivated phosphogluconate dehydrogenase
(Gnd) activity and enhanced glucose-6-phosphate 1-dehydrogenase (Zwf) activity are
included. These combinations enable drastic improvement of the efficiency of isopropyl
alcohol production, as compared with other combinations of factors or enzymes.
[0052] A preferable aspect of the isopropyl alcohol-producing Escherichia coli according to
the invention is a variant obtained by inactivating the GntR activity of the pIPA/B variant, the
plaaa/B variant or the pIa/B::atoDAB variant.
A more preferable aspect thereof is a variant obtained by inactivating the GntR
15
a^l^'ity and the glucose-6-phosphate isomerase (Pgi) activity of the pIPA/B variant, the
plaaa/B variant or the pIa/B::atoDAB variant, and enhancing the glucose-6-phosphate
1-dehydrogenase (Zwf) activity thereof.
[0053] A particularly preferable aspect is a variant obtained by inactivating the GntR activity,
the glucose-6-phosphate isomerase (Pgi) activity, and the phosphogluconate dehydrogenase
(Gnd) activity of the pIPA/B variant, the plaaa/B variant or the pIa/B::atoDAB variant, and
enhancing the glucose-6-phosphate 1-dehydrogenase (Zwf) activity thereof
[0054] Further, genes encoding sucrose assimilation enzymes may be introduced into the
isopropyl alcohol-producing Escherichia coli according to the invention. The introduction
of such genes enables production of isopropyl alcohol from sucrose.
The genes encoding sucrose assimilation enzymes include genes encoding enzymes
involved in the PTS system and the non-PTS system among sucrose assimilation pathways of
microorganisms.
Specifically, examples of genes encoding enzymes involved in the sucrose PTS
include genes encoding ScrA (which incorporates sucrose), ScrY (which phosphorylates
sucrose), ScrB (which degrades sucrose inside the microorganism), ScrR (which regulates the
expression of genes encoding ScrA, Y, and B), and ScrK (which phosphorylates fiaictose).
[0055] Further, a group of sucrose non-PTS genes that encodes the enzymes involved in the
sucrose non-PTS is, specifically, a group of genes composed of genes encoding CscB (sucrose
permease, which incorporates sucrose), CscA (sucrose hydrolase , which degrades sucrose
inside the microorganism), CscK (finctokinase, which phosphorylates fructose), and CscR
(repressor protein, which regulates the expression of genes encoding CscB, A, and K).
[0056] Among them, examples of a sucrose assimilation enzyme gene to be introduced into
the isopropyl alcohol-producing Escherichia coli according to the invention include genes
encoding enzymes involved in the non-PTS system, and, especially, genes encoding a
combination of one or more enzymes including at least CscA. Examples thereof include
cscA alone, a combination of cscA and cscK, a combination of cscA and cscB, a combination
of cscA and cscR, a combination of cscA, cscR and cscK, and a combination of cscA, cscR
and cscB. In particular, it is possible to choose to introduce only a CscA-encoding gene
fi-om the viewpoint of efficient production of isopropyl alcohol.
[0057] As a gene of the sucrose hydrolase (invertase, CscA), a DNA having the base
sequence of a gene encoding a sucrose hydrolase (invertase, CscA) obtained from an
organism possessing the enzyme, or a synthetic DNA sequence that is synthesized based on a
known base sequence of the gene, may be used. Preferable examples include those derived
from bacteria of the genus Erwinia, bacteria of the genus Proteus, bacteria of the genus Vibrio,
16
bpteria of the genus Agrobacterium, bacteria of the genus Rhizobium, bacteria of the genus
Staphylococcus, bacteria of the genus Bifidobacterium, and bacteria of the genus Escherichia.
An example is a DNA having the base sequence of a gene derived from an Escherichia coli
0157 strain. A DNA having the base sequence of a gene derived from an Escherichia coli
0157 strain is particularly preferable. It is preferable that a signal sequence for transferring
cscA to the periplasm of the bacterial cell has been added to cscA.
[0058] As a gene of the repressor protein (CscR), a DNA having the base sequence of a gene
encoding a repressor protein (CscR) obtained from an organism possessing the enzyme, or a
synthetic DNA sequence that is synthesized based on a known base sequence of the gene, may ;
be used. Preferable examples include those derived from bacteria of the genus Erwinia, i
bacteria of the genus Proteus, bacteria of the genus Vibrio, bacteria of the genus |
Agrobacterium, bacteria of the genus Rhizobium, bacteria of the genus Staphylococcus,
bacteria of the genus Bifidobacterium, and bacteria of the genus Escherichia. An example is
a DNA having the base sequence of a gene derived from an Escherichia coli 0157 strain.
The DNA having the base sequence of a gene derived from an Escherichia coli 0157 strain is
particularly preferable.
[0059] As a gene of the fructokinase (CscK), a DNA having the base sequence of a gene
encoding a fructokinase (CscK) obtained from an organism possessing the enzyme, or a
synthetic DNA sequence that is synthesized based on a known base sequence of the gene, may
be used. Preferable examples include those derived from bacteria of the genus Erwinia,
bacteria of the genus Proteus, bacteria of the genus Vibrio, bacteria of the genus
Agrobacterium, bacteria of the genus Rhizobium, bacteria of the genus Staphylococcus,
bacteria of the genus Bifidobacterium, and bacteria of the genus Escherichia. An example is
a DNA having the base sequence of a gene derived from an Escherichia coli 0157 strain.
The DNA having the base sequence of a gene derived from an Escherichia coli 0157 strain is
particularly preferable.
[0060] As a gene of the sucrose permease (CscB), a DNA having the base sequence of a
gene encoding a sucrose permease (CscB) obtained from an organism possessing the enzyme,
or a synthetic DNA sequence that is synthesized based on a known base sequence of the gene,
may be used. Preferable examples include those derived from bacteria of the genus Erwinia,
bacteria of the genus Proteus, bacteria of the genus Vibrio, bacteria of the genus
Agrobacterium, bacteria of the genus Rhizobium, bacteria of the genus Staphylococcus,
bacteria of the genus Bifidobacterium, and bacteria of the genus Escherichia. An example is
a DNA having the base sequence of a gene derived from an Escherichia coli 0157 strain.
The DNA having the base sequence of a gene derived from an Escherichia coli 0157 strain is
17
p^^cularly preferable.
[0061] In the isopropyl alcohol-producing Escherichia coli according to the invention, the
activity of an enzyme of the isopropyl alcohol production system, preferably the activity of at
least one of isopropyl alcohol dehydrogenase or acetoacetate dehydrogenase among the
enzymes of the isopropyl alcohol production system, may be derived from a gene introduced
as a modified gene.
As used in the invention, the phrase "modified gene" encompasses any product
obtained by subjecting the base sequence of the enzyme gene to modification, such as deletion,
substitution or addition. Specifically, examples thereof include a product in which
modification is made only to codons of the base sequence of the enzyme gene and in which
the amino acid sequence synthesized based on the base sequence modified only for codons is
not changed, and a product in which modification is made only to the promoter region of an
enzyme gene and in which the amino acid sequence synthesized based on the base sequence
modified only at the promoter region is not changed.
The enzyme gene to be modified may be an innate gene of the host or an enzyme
gene derived from a microorganism of a different species.
Further, only an enzyme gene encoding isopropyl alcohol dehydrogenase or only an
acetoacetate dehydrogenase enzyme gene may be genetically modified, or both genes may be
genetically modified at the same time.
[0062] The modified gene may have any modification as long as the gene modification to
any of the enzyme genes described above results in enhancement of the capacity to produce a
target substance through provision of the enzyme activity of a corresponding enzyme to a host
or through enhancement of the enzyme activity.
The modified gene is preferably a modified gene of which the employed codons have
been modified in accordance with the frequency of the usage of the codons in Escherichia coli.
Such a modified gene enables an increase in the efficiency of isopropyl alcohol production.
[0063] As used in the invention, the phrase "modify the employed codons" means
modification to codons, which are sequences of base triplets corresponding to respective
amino acids, on the base sequence encoding and defining an amino acid sequence. As used
in the invention, the expression "codon modification" means modification to only the base
sequence without alteration to the amino acid sequence.
[0064] The modified gene of isopropyl alcohol dehydrogenase preferably has a base
sequence represented by SEQ ID NO: 40. The modified gene of acetoacetate dehydrogenase
preferably has a base sequence represented by SEQ ID NO: 43. The activity of each of
isopropyl alcohol dehydrogenase and acetoacetate dehydrogenase can preferably be enhanced
18
bitesing the modified genes.
[0065] In the present invention, Escherichia coli means Escherichia coli that can be made to
have the abihty to produce isopropyl alcohol from a plant-derived raw material by using a
certain means, regardless of whether or not the Escherichia coli originally has the ability to
produce isopropyl alcohol from a plant-derived raw material.
[0066] Here, the Escherichia coli which is to be subjected to genetic recombination may be
Escherichia coli that does not have isopropyl alcohol production capacity, and may be any
Escherichia coli that allows the introduction or modification of the respective genes.
The Escherichia coli may more preferably be Escherichia coli to which isopropyl
alcohol production ability has been imparted in advance. By using such Escherichia coli,
isopropyl alcohol can more efficiently be produced.
[0067] An example of such isopropyl alcohol-producing Escherichia coli is an isopropyl
alcohol-producing Escherichia coli to which acetoacetate decarboxylase activity, isopropyl
alcohol dehydrogenase activity, CoA transferase activity, and thiolase activity have been
imparted so as to be capable of producing isopropyl alcohol from a plant-derived raw material,
and which is described in, for example, WO 2009/008377 pamphlet.
[0068] A method of producing isopropyl alcohol according to the invention includes
producing isopropyl alcohol from a plant-derived raw material using the above-described
isopropyl alcohol-producing Escherichia coli, and specifically includes culturing the
isopropyl alcohol-producing Escherichia coli in a state in which the isopropyl
alcohol-producing Escherichia coli contacts with a plant-derived raw material (hereinafter,
culture process), and collecting isopropyl alcohol obtained by the contact (hereinafter,
collection process).
[0069] The plant-derived raw material to be used in the method of producing isopropyl
alcohol is a carbon source obtained from a plant, and is not restricted as long as it is a
plant-derived raw material. In the invention, the plant-derived raw material refers to organs
such as roots, stalks, stems, branches, leaves, flowers, and seeds, plant bodies including the
plant organs, and decomposition products of the plant organs, and fiirther encompasses carbon
sources that can be used as carbon sources by microorganisms during cultivation from among
carbon sources obtained from the plant bodies, the plant organs and decomposition products
thereof
[0070] The carbon sources included in such plant-derived raw materials generally include
sugars such as starch, sucrose, glucose, fructose, xylose, and arabinose, or herbaceous and
ligneous plant decomposition products or cellulose hydrolysates, each of which contains the |
above ingredients in large amounts, and combinations thereof The carbon sources in the j
!
j
iljltntion may further include vegetable oil-derived glycerin and fatty acids.
[0071] Preferable examples of the plant-derived raw material in the invention include
agricultural products such as grain, com, rice, wheat, soybean, sugarcane, beet, cotton, and the
like, or combinations thereof The form thereof as the raw material is not specifically
I
limited, and may be a crude product, squeezed juice, a crushed product, or the like. i
Alternatively, the plant-derived raw material may be in a form that consists only of the carbon
source described above.
[0072] In the culture process, the contact between the isopropyl alcohol-producing
Escherichia coli and a plant-derived raw material is generally made by culturing the isopropyl
alcohol-producing Escherichia coli in a culture medium containing the plant-derived raw
material.
[0073] The density of contact between the plant-derived raw material and the isopropyl
alcohol-producing Escherichia coli may be varied depending on the activity of the isopropyl
alcohol-producing Escherichia coli. In general, the concentration of the plant-derived raw
material in the culture medium may be such that the initial sugar concentration in terms of
glucose may be set to be 20% by mass or lower relative to the total mass of the mixture.
From the viewpoint of sugar tolerance oi Escherichia coli, the initial sugar concentration is
preferably set to be 15% by mass or lower. Other components may be added in usual
addition amounts for microorganism culture media, without particular limitation.
[0074] The content of the isopropyl alcohol-producing Escherichia coli in the culture
medium may be varied with the kind and activity of the Escherichia coli, and the amount of a
preculture bacterial liquid (OD 660 nm = 4 to 8) to be added when starting cultivation may
generally be set to be from 0.1% by mass to 30% by mass relative to the culture liquid, and is
preferably set to be from 1% by mass to 10% by mass relative to the culture liquid from the
viewpoint of controlling culture conditions.
[0075] The culture medium to be used for culture of the isopropyl alcohol-producing
Escherichia coli may be any usually-employed culture medium that includes a carbon source,
a nitrogen source, inorganic ions, and organic trace elements, nucleic acids, vitamins, etc.
required by microorganisms to produce lactic acid, without particular limitation.
[0076] Culture conditions for culturing in the invention are not particularly restricted, and
culturing may be carried out, for example, under aerobic conditions at an appropriately
controlled pH and temperature within a range of from pH 4 to 9, preferably from pH 6 to 8,
and within a range of from 20 °C to 50 °C, preferably from 25 °C to 42 °C.
[0077] The aeration volume of gas into the mixture described above is not particularly
restricted. When air alone is used as the gas, the aeration volume is generally from 0.02 wm
20
I
1
t|p.O wm (wm; aeration volume [mL]/liquid volume [mL]/time [min]), and, from the
viewpoint of suppressing physical damages to Escherichia coli, the aeration is preferably
carried out at 0.1 wm to 1.5 wm.
[0078] The culture process may be continued from the beginning of culturing until the
plant-derived raw material in the mixture is exhausted, or until the activity of the isopropyl |
alcohol-producing Escherichia coli disappears. The duration of the culture process may be
varied with the number and activity of the isopropyl alcohol-producing Escherichia coli in the
mixture and the amount of the plant-derived raw material. In general, the duration may be at
least one hour, and preferably at least four hours. The duration of culturing may be
unlimitedly continued by anew addition of the plant-derived raw material or the isopropyl
alcohol-producing Escherichia coli. However, from the viewpoint of process efficiency, the
duration may generally be set to 5 days or less, preferably 72 hours or less. With regard to
other conditions, conditions employed for usual cultivation may be applied as they are.
[0079] Methods for collecting isopropyl alcohol accumulated in the culture medium are not
particularly restricted. For example, a method may be employed which includes removing
bacterial cells from the culture liquid by, for example, centrifugal separation, and thereafter
separating isopropyl alcohol using a usual separation method such as distillation or membrane
separation.
[0080] The method of producing isopropyl alcohol according to the invention may further
include a preculture process before the culture process for producing isopropyl alcohol, with a
view to achieving an appropriate cell number or appropriate activated state of the isopropyl
alcohol-producing Escherichia coli to be used. The preculture process may be any
cultivation conducted under usually-employed culture conditions suitable for the type of
isopropyl alcohol-producing bacterium employed.
[0081] The method of producing isopropyl alcohol according to the invention preferably
includes a culture process in which the isopropyl alcohol-producing Escherichia coli is
cultured while gas is supplied into the mixture containing the isopropyl alcohol-producing
bacterium and the plant-derived raw material; and a collection process in which isopropyl
alcohol produced by the culturing is separated and collected from the mixture.
[0082] According to this method, the productive Escherichia coli is cultured while gas is
supplied into the mixture (aeration culture). In this aeration culture, isopropyl alcohol
produced is released into the mixture, and evaporated from the mixture. As a resuh, the
isopropyl alcohol produced can be easily separated from the mixture. Further, since the
isopropyl alcohol produced is continuously separated from the mixture, an increase in the
concentration of isopropyl alcohol in the mixture can be regulated. Therefore, it is not
21
dl^ssary to pay particular attention to the tolerance of the isopropyl alcohol-producing
Escherichia coli against isopropyl alcohol.
The mixture in this method may be mainly composed of a basic medium generally |
used in culture of Escherichia coli. With regard to culture conditions, those described above |
shall apply as they are. i
[0083] In the collection process, isopropyl alcohol produced in the culture process and
separated from the mixture is collected. The collection method may be any method capable
of collecting isopropyl alcohol in the gaseous or droplet state evaporated from the mixture by
usual cultivation. Examples of such a method include a method of collecting into a
collection member such as a commonly-employed airtight container. In particular, the
method preferably includes contacting a trap solution for trapping isopropyl alcohol with
isopropyl alcohol separated from the mixture, from the viewpoint of collecting only isopropyl
alcohol with high purity.
[0084] In the present method, isopropyl alcohol can be collected in a state in which
isopropyl alcohol is dissolved in a trap solution or the mixture. Examples of such a collation
method include a method described in WO 2009/008377 pamphlet. The isopropyl alcohol
collected can be confirmed using a usual detection means such as HPLC. The isopropyl
alcohol collected may be fiuther purified, if necessary. Examples of the purification method
include distillation, etc.
In a case in which the isopropyl alcohol collected is in the state of aqueous solution,
the present isopropyl alcohol production method may fiirther include a dehydration process in
addition to the collection process. The dehydration of isopropyl alcohol can be carried out
using an ordinary method.
[0085] An example of apparatuses applicable to the isopropyl alcohol production method in
which isopropyl alcohol can be collected in the state of being dissolved in the trap solution or
the mixture is the production apparatus shown in Fig. 1 of WO 2009/008377 pamphlet.
In the production apparatus, an injection pipe for injecting a gas from outside the
apparatus is connected to a culture tank that contains a culture medium including an isopropyl
alcohol-producing bacterium and a plant-derived raw material, thereby enabling aeration to
the culture medium.
A trap tank that contains a trap solution as the trap solution is connected to the
culture tank via a cormection pipe. A gas or liquid that has moved to the trap tank contacts
the trap solution, and bubbling occurs.
As a result, isopropyl alcohol, which has been produced in the culture tank by
cultivation under aeration, is evaporated due to aeration, and thus easily separated from the
22
(^pure medium, and is trapped in the trap solution in the trap tank. As a resuU, isopropyl
alcohol can be produced in a more purified state in a simple and continuous manner.
[0086] The isopropyl alcohol production method according to the invention enables high
production of isopropyl alcohol, and the production amount usually obtained by employing
the method according to the invention is greater than the production amounts usually obtained
by employing similar methods to which the invention is not applied. Although the
productivity varies with the conditions of the production method and the state of isopropyl
alcohol-producing Escherichia coli to be used, a productivity of from 50 to 100 g/L/72 hr,
preferably from 55 to 80 g/L/72 hr, can be achieved.
[0087] As explained above, the isopropyl alcohol-producing Escherichia coli according to
the invention is capable of high production of isopropyl alcohol. Therefore, for example, 75
g/L or more isopropyl alcohol can be accumulated after culturing for 72 hours in the case of
isopropyl alcohol production using the Escherichia coli catalyst according to the invention,
whereby much higher productivity than that achieved by conventional catalysts can be
obtained.
[0088] In the isopropyl alcohol-producing Escherichia coli according to the invention,
acetone, which is a precursor of isopropyl alcohol, is produced at the same time. The
acetone obtained is preferably converted into isopropyl alcohol by using a known method (for
example, a method described in Japanese Patent Publication No. 2786272) after purification
thereof using a known method. This fiirther increases the efficiency of conversion from
sugar as a raw material to isopropyl alcohol.
[0089] The acetone production method according to the invention is an acetone production
method including:
obtaining isopropyl alcohol from a plant-derived raw material using the isopropyl
alcohol-producing Escherichia coli (hereinafter, refer to as isopropyl alcohol production
process); and
contacting the obtained isopropyl alcohol with a complex oxide as a catalyst that
includes zinc oxide and at least one oxide containing a Group 4 element, and that is prepared
by coprecipitation (hereinafter refer to as acetone production process).
The isopropyl alcohol obtained using the isopropyl alcohol-producing Escherichia
coli is brought into contact with the complex oxide prepared by coprecipitation, whereby a
dehydrogenation reaction occurs, and acetone is produced from isopropyl alcohol. In this
manner, isopropyl alcohol produced using the isopropyl alcohol-producing Escherichia coli
can be effectively utilized to realize efficient substance production. j
[0090] With regard to the isopropyl alcohol-producing Escherichia coli, the plant-derived I
rilUmaterial, the conditions of isopropyl alcohol production, etc. employed in the isopropyl
alcohol production process, those described above for the production of isopropyl alcohol
shall apply as they are.
[0091] In the acetone production process, a complex oxide that includes zinc oxide and at
least one oxide containing a Group 4 element, and that is prepared by coprecipitation is used
as a catalyst.
A Group 4 element means an element of Group 4 of the periodic table, and examples
thereof include titanium, zirconium, hafnium, etc. Zirconium is preferable from the
viewpoint of highly selective acetone production.
[0092] Examples of complex oxides that can be used as a catalyst include ZnOiZrOi,
ZnO:Ti02, CuOiZnOrAbOa, etc. ZnO:Zr02 is preferable in terms of catalytic activity and
acetone selectivity.
The ratio of zinc oxide to the at least one oxide containing a Group 4 element is not
particularly restricted, and is preferably from 50:50 to 99:1 from the viewpoint of catalytic
activity and acetone selectivity, and more preferably from 65:35 to 95:5. When the
proportion of zinc oxide is 50 or higher, a higher catalytic activity can be exhibited. When
the proportion of zinc oxide is 99 or lower, a higher acetone selectivity can be exhibited.
Therefore, a ratio within the above range is preferable.
[0093] The complex oxide is prepared by coprecipitation. Since the complex oxide that
can be used as a catalyst is prepared by coprecipitation, the complex oxide has an advantage
such as uniformity of the catalyst composition or ease of control over the preparation of
catalyst.
Coprecipitation is a preparation method commonly employed as a method for the
production of a multicomponent complex oxide, and addition of a precipitant such as an
alkaline aqueous solution to a mixed aqueous solution of two or more types of metal salts
allows uniform precipitation of the complex oxide as a solid.
[0094] In a specific method for preparing the catalyst, an aqueous solution of a
water-soluble zinc salt such as zinc nitrate and an aqueous solution of a water-soluble
zirconium salt such as zirconium nitrate are mixed so as to attain a desired metal oxide
composition. This aqueous solution is dropwise added onto an alkaline aqueous solution
such as sodium carbonate for alkalification, so as to precipitate a solid in the form of a
hydroxide. The generated precipitate is filtered, washed with water and dried, and thereafter
calcinated, as a result of which the catalyst is produced.
[0095] The amount of catalyst used when practicing the invention is not particularly
restricted. For example, when a reaction is carried out using a fixed bed flow reactor, the
24
v ^ e obtained by dividing the amount (mass) of the raw material (isopropyl alcohol) supplied
per hour by the mass of the catalyst, — WHSV — is preferably in a range of from 0.01 to
200/h, and more preferably in a range of from 0.02 to 100/h.
[0096] The dehydrogenation reaction in the invention may be carried out in a reaction
manner such as a batch manner or a continuous manner. In the case of the continuous
manner, raw materials are, for example, flowed through a tubular reactor filled with a catalyst,
and reaction products coming out of the reactor are collected.
The reaction temperature for carrying out the dehydrogenation reaction may usually
be from 100 °C to 500 °C, preferably from 150 °C to 450 °C, and further preferably from 200
°C to 400 °C. There are a relationship of equilibrium between acetone, isopropyl alcohol and
hydrogen. A higher reaction temperature results in a higher acetone composition at
equilibrium. Therefore, a reaction temperature of 100 °C or higher is preferable since
isopropyl alcohol does not remain in a large amount at such a temperature. A reaction
temperature of 500 °C or lower is preferable since undesired side reactions do not increase at
such a temperat\are. The reaction pressure is not particularly restricted. Although the
reaction pressure depends on the reaction temperature, the reaction pressure is preferably set
to be from 0.1 MPa to 1.0 MPa.
After the reaction product is collected, purification, etc. may additionally be carried
out, as appropriate, in accordance with the necessity. With regard to the acetone purification
method, etc., purification methods known or well-known in the art may be applied.
[0097] The propylene production method according to the invention includes:
obtaining acetone-containing isopropyl alcohol from a plant-derived raw material
using the isopropyl alcohol-producing Escherichia coli (hereinafter referred to as "isopropyl
alcohol production process"); and
allowing acetone and hydrogen to react with each other in the presence of, as
catalysts, a Cu-containing hydrogenation catalyst and a solid acidic substance in a reaction
temperature range of from 50 to 300 °C using the obtained acetone-containing isopropyl
alcohol (hereinafter referred to as "catalytic reaction process"). In the present specification,
the Cu-containing hydrogenation catalyst is hereinafter also referred to simply as
"hydrogenation catalyst."
In the propylene production method, the isopropyl alcohol obtained by the isopropyl
alcohol-producing Escherichia coli is dehydrated by the solid acidic substance to yield
propylene and water. |
[0098] With regard to the isopropyl alcohol-producing Escherichia coli, the plant-derived I
raw material, the conditions of isopropyl alcohol production, etc., employed in the isopropyl j
25 I
I
a||^hol production process, those described above for the production of isopropyl alcohol can
be applied as they are.
In the catalytic reaction process, acetone and hydrogen are reacted under
predetermined conditions using the acetone-containing isopropyl alcohol obtained in the
isopropyl alcohol production process as a raw material and using a Cu-containing
hydrogenation catalyst and a solid acidic substance.
[0099] The hydrogen to be used in the catalytic reaction process may be molecular hydrogen
gas, or may be hydrogen derived from a hydrocarbon, such as cyclohexane, that generates
hydrogen, depending on the reaction conditions. The amoimt of hydrogen may be, in
principle, any amount that is not less than an amount equimolar to acetone. From the view
of separation and collection, the molar amount of hydrogen is preferably from 1 to 10 times
that of acetone, and more preferably from 1 to 5 times that of acetone. For example, the
amount of hydrogen supplied per unit time relative to the amount of acetone supplied per unit
time may be set to be within the range described above. In a case in which a conversion rate
of acetone of 100% or lower is desired, the conversion ratio can be achieved by reducing the
amount of hydrogen from the amount equimolar to acetone.
[0100] In the catalytic reaction process, the supplied hydrogen binds to the oxygen atom of
acetone to form water, which can be discharged from a reactor outlet. Further, hydrogen in
excess of the amount equimolar to acetone will not essentially be consumed imless
unexpected side reactions proceed.
The supply of hydrogen gas to the reactor is usually carried out by continuous supply,
but is not particularly limited thereto. With regard to the manner of hydrogen supply, the
supply may be intermittent supply which includes supplying hydrogen gas at the initiation of
the reaction, thereafter stopping the supply during the reaction, and restarting the supply after
a certain period of time. In the case of a liquid phase reaction, hydrogen gas may be
supplied by being dissolved in a solvent.
[0101] Further, hydrogen can be recovered from the reactor and reused. The recycle
process for hydrogen may include, for example: separating the reaction solution and the
reaction gas fi-om each other in the posterior part of the reactor using a gas-liquid separator;
separating hydrogen gas from the reaction gas using a separation membrane, etc.; and
re-supplying the hydrogen gas to the inlet of the reactor. In the case of this recycle process,
hydrogen gas collected from the overhead together with low-boiling fraction can be supplied
to the reactor. The pressure of hydrogen to be supplied is generally equal to the pressure of
the reactor, but may be changed, as appropriate, in accordance with the hydrogen supply
method.
26
[ ^ 2 ] When the invention is practiced, the reaction may be carried out in a diluted state
obtained by supplying a solvent or gas that is inert to catalysts and starting materials (acetone,
isopropyl alcohol and hydrogen) into the reaction system.
The reaction temperature applied in the catalytic reaction process is from 50 °C to
300 °C. With a reaction temperature below 50 °C, sufficient conversion ratio of acetone or
isopropyl alcohol is not obtained. With a reaction temperature above 300 °C, unexpected
side reactions, polymerization of propylene, etc. occur, as a result of which a sufficient
selection ratio for propylene cannot be maintained. From the viewpoint of economic
efficiency, the reaction temperature is preferably in a range of from 150 °C to 250 °C, and
more preferably in a range of from 150 to 200 °C.
[0103] In a case in which the reaction is carried out, other methods and conditions are not
particularly restricted, and, for example, the conditions and methods mentioned below may be
employed. The contact of acetone and isopropyl alcohol, which are starting materials, with
hydrogen, and the hydrogen supply method, may be any of gas-liquid countercurrent flow or
gas-liquid cocurrent flow. The flow directions of liquid and gas may be any of: descending
liquid - ascending gas; ascending liquid - descending gas; ascending liquid - ascending gas;
and descending liquid - descending gas. Further, the pressure applied is preferably from 0.1
atm to 500 atm and further preferably from 0.5 atm to 100 atm.
[0104] Examples of the solid acidic substance include metal oxides such as zeolite, silica,
alumina, silica alumina, y-aliomina, titanium oxide, zinc oxide, and zirconium oxide, which
are ordinary solid acids. Among these, zeolite is preferable from the viewpoint of high
catalytic activity and high selectivity for propylene.
[0105] A zeolite that is favorable in view of the molecular sizes of isopropyl alcohol, which
is thought to be present as a raw material and an intermediate in the reaction described above,
and propylene, which is the target substance, may be chosen as the zeolite to be used.
Zeolites having 10-ring to 12-ring pores are preferable because their molecular sizes
are similar to the molecular sizes of isopropyl alcohol and propylene. Examples of zeolites
having 10-ring to 12-ring pores include ferrierite, heulandite, ZSM-5, ZSM-11, ZSM-12,
NU-87, theta-1, weinebeneite, zeolite-X, zeolite-Y, USY zeolite, mordenite, dealuminated
mordenite, P-zeolite, MCM-22, MCM-56, etc. Of these, P-zeolite is preferable.
[0106] The composition ratio of silicon to aluminum (silicon/aluminum) in zeolite is
preferably in a range of from 2/1 to 200/1 in order to obtain high activity, and particularly i
preferably in a range of from 5/1 to 100/1 from the viewpoints of activity and heat stability. I
Further, a so-called isomorphous-substituted zeolite may be used in which aluminum |
contained in the zeolite framework is replaced by a metal, other than aluminum, such as Ga, I
T ^ e , Mn or B. The zeolite to be used may also be a zeolite modified with metal ions.
[0107] The shape of the solid acidic substance is not particularly restricted, and may be any
of spherical, cylindrical, extruded and crushed shapes. The particle size thereof is not
particularly restricted, either, and the solid acidic substance may be selected from those
having sizes in a range of from 0.01 mm to 100 mm, in accordance with the size of the reactor.
One solid acidic substance may be used singly, or two or more solid acidic substances may be
used.
[0108] Examples of the Cu-containing hydrogenation catalyst include those containing
metallic Cu, and those containing Cu in the form of metal compounds, etc. Examples of the
metal compounds include metal oxide such as CuO and CuaO, metal chlorides such as CuCl2,
etc. The catalyst may be retained on a carrier.
[0109] It is preferable that the Cu-containing hydrogenation catalyst fiirther includes at least
one element selected from the group consisting of Group 6, Group 12 and Group 13 elements
in the periodic table from the viewpoint of obtaining higher selectivity or longer catalyst life.
Preferable elements of Group 6 include Cr, Mo, etc., preferable elements of Group 12 include
Zn, etc., and preferable elements of Group 13 include Al, In, etc. Examples of such a
hydrogenation catalyst include a copper-based catalyst such as copper-chrome, Raney copper,
and copper-zinc.
A metal salt such as PbS04, FeCb or SnCb, an alkali metal such as K or Na or an
alkali metal salt, BaS04, or the like may be added to the Cu-containing hydrogenation catalyst.
There are cases in which the addition improves the activity of the Cu-containing
hydrogenation catalyst and the selection ratio for propylene. The amount of the metal salt,
alkali metal or alkali metal salt to be added to the hydrogenation catalyst is not particularly
restricted, and is preferably from 0.01% by mass to 10.00% by mass, mainly from the
viewpoint of selectivity.
Examples of commercially available Cu-containing hydrogenation catalysts include
CuO-ZnO-AbOs, CuO-CriOs-BaO, etc.
[0110] The shape of the hydrogenation catalyst is not particularly restricted, and may be any
of spherical, cylindrical, extruded and crushed shapes. The particle size thereof is not
particularly restricted, either, and the hydrogenation catalyst may be chosen usually from
those having sizes in a range of from 0.01 mm to 100 mm in accordance with the size of the
reactor.
[0111] In the propylene production method according to the invention, the acetone and
hydrogen may be supplied into a reactor filled with the hydrogenation catalyst and the solid
acidic substance, and the acetone and hydrogen are allowed to react with each other. The
28
t ^ l amount of the hydrogenation catalyst and the solid acidic substance filled into the reactor
(hereinafter also referred to as "catalyst amount") is not particularly restricted. For example,
in a case in which the reaction is carried out using a fixed bed flow device equipped with a
fixed bed reactor, the value obtained by dividing the amount (mass) of acetone (starting
material) supplied per unit of time by the catalyst amount (weight), which is WHSV, is
preferably in a range of from 0.1 to 200/h, and fiirther preferably in a range of from 0.2 to
100/h.
The quantitative ratio of the solid acidic substance to the hydrogenation catalyst is
not particularly restricted, and, it is preferable that the ratio, solid acidic substance :
hydrogenation catalyst (mass ratio), is usually from 1:0.01 to 1:100, and preferably from
1:0.05 to 1:50. There is a tendency that a quantitative ratio of solid acidic substance :
hydrogenation catalyst of 1 :(0.01 or more) provides a sufficient acetone conversion ratio.
There is also a tendency that a quantitative ratio of solid acidic substance : hydrogenation
catalyst of 1 :(100 or less) allows the dehydration reaction to adequately proceed to afford a
sufficient propylene yield.
[0112] In a case in which the activity of the catalysts decreases after the reaction is
continued for a certain period of time, regeneration may be carried out using known methods,
thereby recovering the activity of the hydrogenation catalyst and the solid acidic substance.
In the invention, the two components — the solid acidic substance and the
hydrogenation catalyst — may be used as catalysts. Manners of usage of the catalysts are
not particularly restricted. For example, the solid acidic substance, which is an acidic
catalyst component, and the hydrogenation catalyst may be physically mixed on the level of
centimeter-sized catalyst particles, or the solid acidic substance and the hydrogenation catalyst
may be finely divided, mixed, and thereafter re-formed into centimeter-sized catalyst particles,
or the hydrogenation catalyst may be retained on the solid acidic substance serving as a carrier,
or the solid acidic substance may be retained on the hydrogenation catalyst serving as a carrier.
Alternatively, the hydrogenation catalyst and the solid acidic substance may be individually
used without being, for example, mixed with each other. i
[0113] In particular, from the viewpoint of high activity, high selectivity and industrial |
availability, it is preferable to use the hydrogenation catalyst and to use P-zeolite as the zeolite
for constituting the solid acidic substance. For example, the hydrogenation catalyst may be
retained on zeolite. Examples of preparation methods therefor include: a method including impregnating zeolite with an aqueous solution of a nitrate salt of Cu and calcinating the
resultant; a method including adding a complex in which organic molecules called ligand are |
attached to Cu for the purpose of providing the Cu with solubility in an organic solvem, to an |
29 I
%
^fanic solvent so as to prepare a solution, impregnating zeolite with the solution, and i
calcinating the resultant; a method including allowing the complex to be retained on zeolite by, |
for example, vapor deposition, in consideration of the fact that some complexes can be vaporized under vacuum; etc.
[0114] The hydrogenation catalyst may be retained on a carrier other than zeolite.
Examples of carriers capable of retaining the hydrogenation catalyst include silica, alumina,
silica-alumina, titania, magnesia, silica-magnesia, zirconia, zinc oxide , carbon (activated
carbon), acid clay, diatomaceous earth, etc. Of these, it is preferable to select at least one
selected from the group consisting of silica, alumina, silica-alumina, titania, magnesia,
silica-magnesia, zirconia, zinc oxide and carbon (activated carbon), from the viewpoint of
higher activity and higher selectivity,
[0115] Examples of the reactor used in the invention include a fixed bed reactor, a fluidized
bed reactor, etc. The fixed bed reactor is preferable from the viewpoint of preventing the
wearing and disintegration of catalysts.
In the invention, methods for adding the hydrogenation catalyst and the solid acidic
substance into the reactor is not particular restricted. When a fixed bed reactor is used as the
reactor, the method for adding the hydrogenation catalyst and the solid acidic substance may
significantly affect the reaction performance. As described above, it is surmised that
hydrogenation and a dehydration reaction occur stepwise in the invention. Therefore, a
method including sequentially adding catalyst species appropriate for the respective stages of
the reaction into the reactor is a preferable filling method, in terms of efficient usage of the
catalysts and suppression of undesired side reactions.
[0116] It is a behavior frequently observed in general chemical reactions that unexpected
side reactions not observed at low hydrogen pressure or low reaction temperature occur
particularly in the case of increasing the hydrogen pressure or the reaction temperature in
order to increase the reaction rate. In such a case, the method for filling the catalysts, in
particular, has a possibility of significantly affecting the reaction performance.
[0117] Accordingly, catalyst species appropriate for the respective stages of the reaction
may be sequentially added into the reactor, or the hydrogenation catalyst and the solid acidic
substance may be added into the reactor such that the mixing ratio of the hydrogenation
catalyst and the solid acidic substance forms a gradient. Examples of methods for adding the
hydrogenation catalyst and the solid acidic substance into the reactor include (1) a method in
which the hydrogenation catalyst and the solid acidic substance are mixed and added into the
reactor; (2) a method in which the addition into the reactor is carried out so as to form a layer
formed by the hydrogenation catalyst (at the upstream side, i.e., the inlet side) and a layer
30
4i?ned by the solid acidic substance (at the downstream side, i.e., the outlet side); (3) a
method in which a solid acidic substance on which the hydrogenation catalyst is retained is |
added into the reactor; (4) a method in which the addition into the reactor is carried out so as
to form a layer formed by the hydrogenation catalyst (at the upstream side, i.e., the inlet side)
and a layer formed by the solid acidic substance and the hydrogenation catalyst (at the
downstream side, i.e., the outlet side); (5) a method in which the addition into the reactor is
carried out so as to form a layer formed by the hydrogenation catalyst (at the upstream side,
i.e., the inlet side) and a layer formed by a solid acidic substance on which the hydrogenation
catalyst is retained (at the downstream side, i.e., the outlet side); (6) a method in which the
addition into the reactor is carried out so as to form a layer formed by the hydrogenation
catalyst and the solid acidic substance (at the upstream side, i.e., the inlet side) and a layer
formed by the solid acidic substance (at the downstream side, i.e., the outlet side); and (7) a
method in which the addition into the reactor is carried out so as to form a layer formed by a
solid acidic substance on which the hydrogenation catalyst is retained (at the upstream side,
i.e., the inlet side) and a layer formed by the solid acidic substance (at the downstream side,
i.e., the outlet side). The upstream side refers to the inlet side of the reactor, i.e., a layer
through which the starting materials pass in the former stage of the reaction, and the
downstream side refers to the outlet side of the reactor, i.e., a layer through which the starting
materials, intermediates, and reaction products pass in the latter stage of the reaction. The
starting materials mean acetone and hydrogen. In a case in which acetone and hydrogen are
supplied into the reactor by gas-liquid countercurrent flow, the upstream side (inlet side)
means a layer through which acetone passes in the former stage of the reaction.
[0118] In order to maintain the propylene production amount, a merry-go-round method
may be adopted in which two or three reactors are arranged in parallel, and, while the
regeneration of catalysts is carried out in one of the reactors, reaction is carried out in the
remaining one or two reactors. Further, in a case in which there are three reactors, a method
may be used in which the remaining two reactors are cormected in series, thereby reducing the
variation in the production amount. In a case in which the invention is carried out using a
fluidized bed flow reaction system or a moving bed reaction system, a constant activity can be
maintained by continuously or intermittently removing a part or all of the catalysts from the
reactor and replenishing an equivalent amount of the catalysts.
EXAMPLES
[0119] Examples of the invention are described below. However, the invention is by no
means limited to these examples. As used herein,"%" is based on mass unless otherwise
31
^P^ified.
(Preparation of Isopropyl Alcohol Producing Variant)
Lists of the Escherichia coli variants and the plasmids used in the present examples are shown
in Table 1 and Table 2.
Table 1
Plasmid Feature Origin or Referenced Description
pBRgapP pBR322, containing GADPH promoter Example 2
pla pBRgapP-lPAdh-adc Example 2
plaz pBRgapP-lPAdh-adc-zwf Example 2
plaaa pBRgapP-lPAdh-adc-atoB-atoD-atoA Example 4
pTHlScsl Temperature-sensitive plasmid GenBankAB019610
32
I
|
The entire base sequence of the genomic DNA oi Escherichia coli MG1655 strain is
known (GenBank accession number U00096), and the base sequence of a gene encoding CoA
transferase a subunit (hereinafter sometimes abbreviated to "atoD") of Escherichia coli
MG1655 strain has also been reported. That is, atoD is described in 2321469 to 2322131 of
the Escherichia coli MG1655 strain genomic sequence, which is described in GenBank
accession number U00096.
[0122] The promoter sequence of glyceraldehyde 3-phosphate dehydrogenase (hereinafter
sometimes referred to as "GAPDH") from Escherichia coli, which is described in 397 to 440
33
i
afSie base sequence information with a GenBank accession number X02662, can be used as
the base sequence of a promoter necessary to express the above-mentioned gene. In order to
obtain the GAPDH promoter, amplification by a PCR method was carried out using the
genomic DNA of Escherichia coli MG1655 strain as a template and using
cgctcaattgcaatgattgacacgattccg (SEQ ID NO: 1) and acagaattcgctatttgttagtgaataaaagg (SEQ
ID NO: 2), and the DNA fragment obtained was digested with restriction enzymes Mfel and
EcoRI, thereby obtaining a DNA fragment of about 100 bp encoding the GAPDH promoter.
The obtained DNA fragment and a fragment obtained by digesting plasmid pUC19 (GenBank
accession number X02514) with a restriction enzyme EcoRI followed by alkaline phosphatase
treatment were mixed, and the mixed fragments were ligated using a ligase. Thereafter,
competent cells of Escherichia coli DH5a strain (Toyobo Co., Ltd. DNA-903) were
transformed with the ligation product, and transformants that grew on an LB agar plate
containing 50 |xg/ml ampicillin were obtained. Ten of the colonies obtained were
individually cultured at 37 °C overnight in an LB liquid medium containing 50 ^ig/ml
ampicillin, and plasmids were recovered, and plasmids from which the GAPDH promoter was
not cut out when digested with restriction enzymes EcoRI and Kpnl were selected. Further,
the DNA sequence thereof was checked, and a plasmid in which the GAPDH promoter was
properly inserted was named pUCgapP. The pUCgapP obtained was digested with
restriction enzymes EcoRI and Kpnl.
[0123] Furthermore, in order to obtain atoD, amplification by a PCR method was carried out
using the genomic DNA of Escherichia coli MG1655 strain as a template and using
cgaattcgctggtggaacatatgaaaacaaaattgatgacattacaagac (SEQ ID NO: 3) and
gcggtaccttatttgctctcctgtgaaacg (SEQ ID NO: 4), and the DNA fragment obtained was digested
with restriction enzymes EcoRI and Kpnl, thereby obtaining an atoD fragment of about 690
bp. This DNA fragment was mixed with pUCgapP that had previously been digested with
restriction enzymes EcoRI and Kpnl. The mixed fragments were ligated using a ligase.
Thereafter, competent cells of Escherichia coli DH5a strain (Toyobo Co., Ltd. DNA-903)
were transformed with the ligation product, and transformants that grew on an LB agar plate
containing 50 |ig/ml ampicillin were obtained. A plasmid was recovered from the bacterial
cells obtained, and it was confirmed that atoD was properly inserted. The plasmid obtained
was named pGAPatoD.
Here, Escherichia coli MG1655 strain is available from American Type Culture
Collection.
[0124] As described above, the base sequence of atoD in the genomic DNA of Escherichia
coli MGl 655 strain has also been reported. PCR was carried out using the genomic DNA of
34
^herichia coli MG1655 strain as a template and using gctctagatgctgaaatccactagtcttgtc (SEQ
ID NO: 5) and tactgcagcgttccagcaccttatcaacc (SEQ ID NO: 6), which were prepared based on
the gene information of the 5' flanking region of atoD oi Escherichia coli MG1655 strain, as a
result of which a DNA fragment of about 1.1 kbp was amplified.
[0125] In addition, PCR was carried out using the expression vector pGAPatoD prepared
above as a template and using ggtctagagcaatgattgacacgattccg (SEQ ID NO: 7) prepared based
on the sequence information of the GAPDH promoter oi Escherichia coli MG1655 strain and
a primer of SEQ ID NO: 4 prepared based on the sequence information of atoD of I
Escherichia coli MGl 655 strain, as a result of which a DNA fi-agment of about 790 bp having
the GAPDH promoter and atoD was obtained.
[0126] The fragments obtained from the above were digested with restriction enzymes PstI I
and Xbal, and Xbal and Kpnl, respectively, and the resultant fragments were mixed with a I
fragment obtained by digesting a temperature-sensitive plasmid pTHl 8csl (GenBank I
accession number ABO 19610) [Hashimoto-Gotoh, T., Gene, 241,185-191 (2000)] with PstI
and Kpnl, and the mixed fragments were ligated using a ligase. Thereafter, DH5a strain was
transformed with the ligation product, and transformants that grew on an LB agar plate
containing 10 (J.g/ml chloramphenicol at 30 °C were obtained. The colonies obtained were
cultured at 30 °C overnight in an LB liquid medium containing 10 |a,g/ml chloramphenicol,
and a plasmid was recovered from the bacterial cells obtained. Escherichia coli B strain
(ATCC11303) was transformed with the plasmid, and was cultured at 30 °C overnight on an
LB agar plate containing 10 |ig/ml chloramphenicol, as a result of which transformants were
obtained. The transformants obtained were inoculated into an LB liquid medium containing
10 ng/ml chloramphenicol, and cultured at 30 °C overnight. The cultured bacterial cells
obtained were applied to an LB agar plate containing 10 ^g/ml chloramphenicol, and cultured
at 42 °C, as a result of which colonies were obtained. The colonies obtained were cultured at
30 °C for 2 hours in an antibiotic-free LB liquid medium, and applied to a antibiotic-free LB
agar plate, as a result of which colonies that grew at 42 °C were obtained.
[0127] From the colonies that appeared, 100 colonies were randomly picked up, and each
individually grown on an antibiotic-free LB agar plate and an LB agar plate containing 10
^g/ml chloramphenicol, and chloramphenicol-sensitive clones were selected. Furthermore, a
fragment of about 790 bp that contained the GAPDH promoter and atoD was amplified, by
PCR, from the chromosomal DNA of these clones, and a variant in which an atoD promoter
region was replaced by the GAPDH promoter was selected. Then, a clone satisfying the
above conditions was named Escherichia coli B::atoDAB.
Here, Escherichia coli B strain (ATCCl 1303) is available from the American Type
35
^ t u r e Collection, which is a bank of cells, microorganisms, and genes.
[0128] [Example 2]

Acetoacetate decarboxylase of bacteria of the genus Clostridium is described in GenBank accession number M55392, and isopropyl alcohol dehydrogenase of the genus
Clostridium is described in GenBank accession number AFl57307.
The promoter sequence of glyceraldehyde 3-phosphate dehydrogenase (hereinafter
sometimes referred to as "GAPDH") from Escherichia coli, which is described in 397 to 440
in the base sequence information with a GenBank accession number X02662, can be used as
the base sequence of a promoter necessary to express the above-mentioned gene group.
[0129] In order to obtain the GAPDH promoter, amplification by a PCR method was carried
out using the genomic DNA oi Escherichia coli MG1655 strain as a template and using
cgagctacatatgcaatgattgacacgattccg (SEQ ID NO: 18) and cgcgcgcatgctatttgttagtgaataaaagg
(SEQ ID NO: 19), and the DNA fragment obtained was digested with restriction enzymes
Ndel and SphI, as a result of which a DNA fragment of about 110 bp corresponding to the
GAPDH promoter was obtained. The DNA fragment obtained was mixed with a fragment
obtained by digesting plasmid pBR322 (GenBank accession number JO 1749) with restriction
enzymes Ndel and SphI, and the mixed fragments were ligated using a ligase. Thereafter,
competent cells oiEscherichia coli DH5a strain (Toyobo Co., Ltd. DNA-903) were
transformed with the ligation product, and transformants that grew on an LB agar plate
containing 50 |xg/ml ampicillin were obtained. The colonies obtained were cultured at 37 °C
overnight in an LB liquid medium containing 50 ^ig/ml ampicillin, and plasmid pBRgapP was
recovered from the bacterial cells obtained.
[0130] In order to obtain isopropyl alcohol dehydrogenase gene, amplification by a PCR
I method was carried out using the genomic DNA of Clostridium beijerinckii NRRL B-593 as a
template and using aatatgcatgctggtggaacatatgaaaggttttgcaatgctagg (SEQ ID NO: 8) and
gcggatccttataatataactactgctttaattaagtc (SEQ ID NO: 9), and the DNA fragment obtained was
digested with restriction enzymes SphI and BamHI, as a result of which an isopropyl alcohol
dehydrogenase fi-agment of about 1.1 kbp was obtained. The DNA fragment obtained was
mixed with a fragment obtained by digesting plasmid pBRgapP with restriction enzymes SphI
and BamHI, and the mixed fragments were ligated using a ligase. Thereafter, competent
I cells of Escherichia coli DH5a strain (Toyobo Co., Ltd. DNA-903) were transformed with the
ligation product, and transformants that grew on an LB agar plate containing 50 ^g/ml
ampicillin were obtained. The colonies obtained were cultured at 37 °C overnight in an LB
i
liquid medium containing 50 |xg/ml ampicillin, and plasmids were recovered from the
36 \ \ I
r
ll||Rterial cells obtained, and it was confirmed that IPAdh was properly inserted. The plasmid
obtained was named pGAP-IPAdh.
[0131] In order to obtain acetoacetate decarboxylase gene, amplification by a PCR method
was carried out using the genomic DNA of Clostridium acetobutylicum ATCC824 as a
template and using caggatccgctggtggaacatatgttaaaggatgaagtaattaaacaaattagc (SEQ ID NO: 10)
and ggaattcggtaccttacttaagataatcatatataacttcagc (SEQ ID NO: 11), and the DNA fi-agment
obtained was digested with restriction enzymes BamHI and EcoRI, as a result of which an
acetoacetate decarboxylase fragment of about 700 bp was obtained. The DNA fragment
obtained was mixed with a fragment obtained by digesting the plasmid pGAP-IPAdh prepared
above with restriction enzymes BamHI and EcoRI, and the mixed fragments were ligated
using a ligase. Thereafter, competent cells of Escherichia coli DH5a strain (Toyobo Co., Ltd.
DNA-903) were transformed with the ligation product, and transformants that grew on an LB
agar plate containing 50 ^ig/ml ampicillin were obtained. The colonies obtained were
cultured at 37 °C overnight in an LB liquid medium containing 50 |xg/ml ampicillin, and
plasmids were recovered from the bacterial cells obtained, and it was confirmed that adc was
properly inserted. The plasmid obtained was named pla.
[0132] In order to obtain glucose-6-phosphate 1-dehydrogenase gene (zwf), amplification by
a PCR method was carried out using the genomic DNA of Escherichia coli B strain (GenBank
accession N0.CPOOO819) as a template and using
i caggatcccggagaaagtcttatggcggtaacgcaaacagcccagg (SEQ ID NO: 12) and
cgtctagattactcaaactcattccaggaacgac (SEQ ID NO: 13), and the DNA fragment obtained was
digested with restriction enzymes BamHI and Xbal, as a result of which a
glucose-6-phosphate 1-dehydrogenase fragment of about 1500 bp was obtained. The DNA
fragment obtained was mixed with a fragment obtained by digesting the plasmid pla prepared
above with restriction enzymes BamHI and Xbal, and the mixed fragments were ligated using
i
a ligase. Thereafter, competent cells of Escherichia coli DH5a strain (Toyobo Co., Ltd.
DNA-903) were transformed with the ligation product, and transformants that grew on an LB
agar plate containing 50 |ig/ml ampicillin were obtained. The colonies obtained were
I cultured at 37 °C overnight in an LB liquid medium containing 50 ^ig/ml ampicillin, and this
i
plasmid was named plaz.
[0133] Competent cells of Escherichia coli B::atoDAB prepared in Example 1 were
transformed with the plasmid plaz, and was cultured at 37 °C overnight on an LB Broth,
\ Miller agar plate containing 50 ^ig/ml ampicillin, as a result of which Escherichia coli
pIaz/B::atoDAB was obtained.
[0134] [Example 3]
37
<4pteparation of Escherichia coli B strain Apgi variant>
The entire base sequence of the genomic DNA of Escherichia coli MG1655 strain is
known (GenBank accession number U00096), and the base sequence of a gene encoding
phosphoglucose isomerase (hereinafter sometimes referred to as "pgi") of Escherichia coli has
also been reported (GenBank accession number XI5196). In order to clone a region
flanking to the base sequence of the gene encoding pgi (1,650 bp), four types of
oligonucleotide primers represented by caggaattcgctatatctggctctgcacg (SEQ ID NO: 14),
cagtctagagcaatactcttctgattttgag (SEQ ID NO: 15), cagtctagatcatcgtcgatatgtaggcc (SEQ ID NO:
16) and gacctgcagatcatccgtcagctgtacgc (SEQ ID NO: 17) were synthesized. The primer of
SEQ ID NO: 14 has an EcoRI recognition site in the 5'-terminal side thereof, each of the
primers of SEQ ID NOs: 15 and 16 has an Xbal recognition site in the 5'-terminal side thereof,
and the primer of SEQ ID NO: 17 has a PstI recognition site in the 5'-terminal side thereof.
[0135] The genomic DNA of Escherichia coli MG1655 strain (ATCC700926) was prepared,
and PCR was carried out using the obtained genomic DNA as a template and using a primer
pair of SEQ ID NO: 14 and SEQ ID NO: 15, as a resuh of which a DNA fragment of about
1.0 kb (hereinafter sometimes referred to as "pgi-L fragment") was amplified. In addition,
PCR was also carried out using a primer pair of SEQ ID NO: 16 and SEQ ID NO: 17, as a
result of which a DNA fragment of about 1.0 kb (hereinafter sometimes referred to as "pgi-R
fragment") was amplified. These DNA fragments were separated by agarose electrophoresis,
and collected. The pgi-L fragment was digested with EcoRI and Xbal, and the pgi-R
fragment was digested with Xbal and PstI. The two types of digested fragments and a
fragment obtained by digesting a temperature-sensitive plasmid pTHlScsl (GenBank
accession number ABO 19610) with EcoRI and PstI were mixed, and allowed to react using T4
DNA ligase. Thereafter, competent cells of Escherichia coli DH5a (manufactured by
Toyobo Co., Ltd.) were transformed with the ligation product, and transformants that grew on
an LB agar plate containing 10 ^ig/ml chloramphenicol at 30 °C were obtained. Plasmids
were recovered from the transformants obtained, and it was confirmed that the two fragments
— a 5'-upstream flanking region fragment and a 3'-downstream flanking region fragment of
the gene encoding pgi — were properly inserted in pTHl 8csl. The plasmid obtained was
digested with Xbal, and then subjected to blunting treatment with T4 DNA polymerase. The
resultant DNA fragment was mixed with a DNA fragment obtained by digesting pUC4K
plasmid (GenBank accession number X06404) (Pharmacia) with EcoRI and fiuther subjecting
the obtained kanamycin-resistant gene to blunting treatment with a T4 DNA polymerase, and
the mixed fragments were ligated using T4 DNA ligase. Subsequently, competent cells of
Escherichia coli DH5a were transformed with the ligation product, and transformants that
38
^Piv on an LB agar plate containing 10 |ig/ml chloramphenicol and 50 ^g/ml kanamycin at
30 °C were obtained. Plasmids were recovered from the transformants obtained, and it was
confirmed that the kanamycin-resistant gene was properly inserted between the 5'-upstream
flanking region fragment and the 3'-downstream flanking region fragment of the pgi-encoding
gene. The plasmid obtained was named pTH 18cs 1 -pgi.
[0136] Escherichia coli B strain (ATCC11303) was transformed with the thus-obtained
plasmid pTH18csl-pgi, and was cultured at 30 °C overnight on an LB agar plate containing
10 ng/ml chloramphenicol and 50 |xg/ml kanamycin, as a result of which transformants were
obtained. The transformants obtained were inoculated into an LB liquid medium containing
50 ^ig/ml kanamycin, and cultured at 30 °C overnight. Next, part of this culture liquid was
applied to an LB agar plate containing 50 [ig/ml kanamycin, as a result of which colonies that
grew at 42 °C were obtained. The colonies obtained were cultured at 30 °C for 24 hours in
an LB liquid medium containing 50 fig/ml kanamycin, and was applied to an LB agar plate
containing 50 |j.g/ml kanamycin, as a result of which colonies that grew at 42 °C were
obtained.
[0137] From the colonies that appeared, 100 colonies were randomly picked up, and each
individually grown on an LB agar plate containing 50 |J.g/ml kanamycin and an LB agar plate
containing 10 (xg/ml chloramphenicol, and chloramphenicol-sensitive clones that grew only
on the LB agar plate containing kanamycin were selected. Furthermore, the chromosomal
DNAs of these target clones were amplified by PCR, and a variant from which a fragment of
about 3.3 kbp indicating replacement of the pgi gene with the kanamycin-resistant gene could
be amplified was selected. The variant obtained was named B strain pgi gene deletion
variant (hereinafter sometimes abbreviated to "BApgi variant").
[0138] Here, Escherichia coli MG1655 strain and Escherichia coli B strain are available
from American Type Culture Collection.
[0139] [Examples 4]

The amino acid sequences and the base sequences of genes of thiolase and Co A
transferase of Escherichia coli have already been reported. That is, the gene encoding
thiolase is described in 2324131 to 2325315 of the Escherichia coli MG1655 strain genomic
sequence described in GenBank accession number U00096. In addition, the gene encoding
CoA transferase is described in 2321469 to 2322781 of the above-mentioned Escherichia coli
MG1655 strain genomic sequence. Expression of these genes together with the
later-described acetoacetate decarboxylase gene and isopropyl alcohol dehydrogenase gene
from bacteria of the genus Clostridium enables production of isopropyl alcohol.
39
[^p^O] In order to obtain isopropyl alcohol dehydrogenase gene, amplification by a PCR
method was carried out using the genomic DNA of Clostridium beijerinckii NRRL B-593 as a
template and using aatatgcatgctggtggaacatatgaaaggttttgcaatgctagg (SEQ ID NO: 20) and
gcggatccggtaccttataatataactactgctttaattaagtc (SEQ ID NO: 21), and the DNA fragment
obtained was digested with restriction enzymes SphI and BamHI, as a result of which an
isopropyl alcohol dehydrogenase fragment of about 1.1 kbp was obtained. The DNA
fragment obtained was mixed with a fragment obtained by digesting plasmid pBRgapP
prepared in Example 2 with restriction enzymes SphI and BamHI, and the mixed fragments
were ligated using a ligase. Thereafter, competent cells oi Escherichia coli DH5a strain
(Toyobo Co., Ltd. DNA-903) were transformed with the ligation product, and transformants
that grew on an LB agar plate containing 50 ^g/ml ampicillin were obtained. The colonies
obtained were cultured at 37 °C overnight in an LB liquid medium containing 50 |j.g/ml
ampicillin, and plasmid pGAP-IPAdh was recovered from the bacterial cells obtained.
[0141] In order to obtain thiolase gene from Escherichia coli, amplification by a PCR
method was carried out using the genomic DNA of Escherichia coli MG1655 strain as a
template and using atggatccgctggtggaacatatgaaaaattgtgtcatcgtcag (SEQ ID NO: 22) and
gcagaagcttgtctagattaattcaaccgttcaatcaccatc (SEQ ID NO: 23), and the DNA fragment obtained
was digested with restriction enzymes BamHI and Hindlll, as a result of which a thiolase
fragment of about 1.2 kbp was obtained. The DNA fragment obtained was mixed with a
fragment obtained by digesting the plasmid pGAP-IPAdh prepared above with restriction
enzymes BamHI and Hindlll, and the mixed fragments were ligated using a ligase.
Thereafter, competent cells of Escherichia coli DH5a strain (Toyobo Co., Ltd. DNA-903)
were transformed with the ligation product, and transformants that grew on an LB agar plate
containing 50 (ig/ml ampicillin were obtained. The colonies obtained were cultured at 37 °C
overnight in an LB liquid medium containing 50 |xg/ml ampicillin, and plasmid
pGAP-IPAdh-atoB was recovered from the bacterial cells obtained.
[0142] In order to obtain CoA transferase gene from Escherichia coli, amplification by a
PCR method was carried out using the genomic DNA of Escherichia coli MG1655 strain as a
template and using gctctagagctggtggaacatatgaaaacaaaattgatgacattacaagac (SEQ ID NO: 24)
and tagcaagcttctactcgagttatttgctctcctgtgaaacg (SEQ ID NO: 25), and the DNA fragment
obtained was digested with restriction enzymes Xbal and Hindlll, as a resuk of which a CoA
transferase a subunit fragment of about 600 bp was obtained. The DNA fragment obtained
was mixed with a fragment obtained by digesting the plasmid pGAP-IPAdh-atoB prepared
above with restriction enzymes Xbal and Hindlll, and the mixed fragments were ligated using
a ligase. Thereafter, competent cells of Escherichia coli DH5a strain (Toyobo Co., Ltd.
40
I
IJkIA-903) were transformed with the Ugation product, and transformants that grew on an LB
agar plate containing 50 \ig/ml ampiciUin were obtained. The colonies obtained were
cultured at 37 °C overnight in an LB liquid medium containing 50 ng/ml ampicillin, and
plasmid pGAP-IPAdh-atoB-atoD was recovered from the bacterial cells obtained. I
[0143] Amplification by a PCR method was carried out using the genomic DNA of I
Escherichia coli MGl 655 strain as a template and using |
aagtctcgagctggtggaacatatggatgcgaaacaacgtattg (SEQ ID NO: 26) and
ggccaagcttcataaatcaccccgttgc (SEQ ID NO: 27), and the DNA fragment obtained was digested
with restriction enzymes Xhol and Hindlll, as a result of which a Co A transferase p subunit
fragment of about 600 bp was obtained. The DNA fragment obtained was mixed with a
fragment obtained by digesting the plasmid pGAP-IPAdh-atoB-atoD prepared above with
restriction enzymes Xhol and Hindlll, and the mixed fragments were ligated using a ligase.
Thereafter, competent cells oiEscherichia coli DH5a strain (Toyobo Co., Ltd. DNA-903)
were transformed with the ligation product, and transformants that grew on an LB agar plate
containing 50 |xg/ml ampicillin were obtained. The colonies obtained were cultured at 37 °C
ovemight in an LB liquid medium containing 50 |a,g/ml ampicillin, and plasmid
pGAP-IPAdh-atoB-atoD-atoA was recovered from the bacterial cells obtained.
[0144] In order to obtain acetoacetate decarboxylase gene, amplification by a PCR method
was carried out using the genomic DNA oi Clostridium acetobutylicum ATCC824 as a
template and using caggtaccgctggtggaacatatgttaaaggatgaagtaattaaacaaattagc (SEQ ID NO: 28)
and gcggatccttacttaagataatcatatataacttcagc (SEQ ID NO: 29), and the DNA fragment obtained
was digested with restriction enzymes Kpnl and BamHI, as a result of which an acetoacetate
decarboxylase fragment of about 700 bp was obtained. The DNA fragment obtained was
mixed with a fragment obtained by digesting the plasmid pGAP-IPAdh-atoB-atoD-atoA
prepared above with restriction enzymes Kpnl and BamHI, and the mixed fragments were
ligated using a ligase. Thereafter, competent cells oi Escherichia coli DH5a strain (Toyobo
Co., Ltd. DNA-903) were transformed with the ligation product, and transformants that grew
on an LB agar plate containing 50 jig/ml ampicillin were obtained. The colonies obtained
were cultured at 37 °C ovemight in an LB liquid medium containing 50 p,g/ml ampicillin, and
plasmid pGAP-IPAdh-Adc-atoB-atoD-atoA was recovered from the obtained bacterial cell,
and was named plaaa.
[0145] Competent cells of Escherichia coli BApgi prepared in Example 3 were transformed
with the plasmid plaaa, and was cultured at 37 °C ovemight on an LB Broth, Miller agar plate |
containing 50 ^ig/ml ampicillin, as a result of which Escherichia coli plaaa/BApgi variant was I
obtained.
41
(146] [Examples]

B::atoDAB prepared in Example 1 was transformed with pTH18csl-pgi prepared in
Example 3, and cultured at 30 °C overnight on an LB agar plate containing 10 \ig/ml
chloramphenicol and 50 fig/ml kanamycin, as a resuh of which transformants were obtained.
The transformants obtained were inoculated into an LB liquid medium containing 50 ng/ml
kanamycin, and cultured at 30 °C overnight. Next, part of this culture liquid was applied to
an LB agar plate containing 50 ng/ml kanamycin, as a result of which colonies that grew at 42
°C were obtained. The colonies obtained were cultured at 30 °C for 24 hours in an LB liquid
medium containing 50 |xg/ml kanamycin, and was applied to an LB agar plate containing 50
Hg/ml kanamycin, as a result of which colonies that grew at 42 °C were obtained.
[0147] From the colonies that appeared, 100 colonies were randomly picked up, and each
individually grown on an LB agar plate containing 50 |a,g/ml kanamycin and an LB agar plate
containing 10 |xg/ml chloramphenicol, and chloramphenicol-sensitive clones that grew only
on the LB agar plate containing kanamycin were selected. Furthermore, the chromosomal
DNAs of these target clones were amplified by PCR, and a variant from which a fragment of
about 3.3 kbp indicating replacement of the pgi gene with the kanamycin-resistant gene could
be amplified was selected. The variant obtained was named B strain atoD genome enhanced
- pgi gene deletion variant (hereinafter sometimes abbreviated to "B::atoDABApgi variant").
[0148] Here, Escherichia coli MG1655 strain and Escherichia coli B strain are available
from American Type Culture Collection.
[0149] [Example 6]

The entire base sequence of the genomic DNA oi Escherichia coli B strain is known
(GenBank accession No.CP000819), and the base sequence encoding GntR is described in
3509184 to 3510179 of the Escherichia coli B strain genomic sequence, which is described in
GenBank accession N0.CPOOO819. In order to clone a region flanking to a base sequence
encoding GntR(gntR), four types of oligonucleotide primers represented by
ggaattcgggtcaattttcaccctctatc (SEQ ID NO: 30), gtgggccgtcctgaaggtacaaaagagatagattctc (SEQ
ID NO: 31), ctcttttgtaccttcaggacggcccacaaatttgaag (SEQ ID NO: 32) and
ggaattcccagccccgcaaggccgatggc (SEQ ID NO: 33) were synthesized. Each of the primers of
SEQ ID NOs: 30 and 33 has an EcoRI recognition site in the 5'-terminal side thereof
[0150] The genomic DNA of Escherichia coli B strain (GenBank accession N0.CPOOO819)
was prepared, and PCR was carried out using the obtained genomic DNA as a template and
using a primer pair of SEQ ID NO: 30 and SEQ ID NO: 31, as a result of which a DNA
42
f^llment of about 1.0 kb (hereinafter sometimes referred to as "gntR-L fragment") was
amplified. In addition, PCR was carried out using a primer pair of SEQ ID NO: 32 and SEQ
ID NO: 33, as a result of which a DNA fragment of about 1.0 kb (hereinafter sometimes
referred to as "gntR-R fragment") was amplified. These DNA fragments were separated by
agarose electrophoresis, and recovered. PCR was carried out using the gntR-L and gntR-R
fragments as templates and using a primer pair of SEQ ID NO: 30 and SEQ ID NO: 33, as a
result of which a DNA fragment of about 2.0 kb (hereinafter sometimes referred to as
"gntR-LR fragment") was amplified. This gntR-LR fragment was separated by agarose
electrophoresis, recovered, digested with EcoRI, and mixed with a fragment obtained by
digesting a temperature-sensitive plasmid pTHlScsl (GenBank accession number ABO 19610)
with EcoRI. The mixed fragments were allowed to react using T4 DNA ligase. Thereafter,
competent cells of Escherichia coli DH5a (manufactured by Toyobo Co., Ltd.) were
transformed with the ligation product, and transformants that grew on an LB agar plate
containing 10 ^g/ml chloramphenicol at 30 °C were obtained. Plasmids were recovered
from the transformants obtained, and it was confirmed that the gntLR fragment was properly
inserted in pTH 18cs 1. The plasmid obtained was named pTH 18cs 1 -gntR.
[0151] Escherichia coli B::atoDAB variant prepared in Example 1 was transformed with the
thus-obtained plasmid pTH18csl-gntR, and was cultured at 30 °C overnight on an LB agar
plate containing 10 |ig/ml chloramphenicol, as a result of which transformants were obtained.
The transformants obtained were inoculated into an LB liquid medium containing 10 |xg/ml
chloramphenicol, and cultured at 30 °C overnight. Next, part of this culture liquid was
applied to an LB agar plate containing 10 p-g/ml kanamycinan chloramphenicol, as a result of
which colonies that grew at 42 °C were obtained. The colonies obtained were cultured at 30
°C for 24 hours in an LB liquid medium, and was applied to an LB agar plate, as a result of
which colonies that grew at 42 °C were obtained.
[0152] From the colonies that appeared, 100 colonies were randomly picked up, and each
individually grown on an LB agar plate and an LB agar plate containing 10 |j.g/ml
chloramphenicol, and chloramphenicol-sensitive clones were selected. Furthermore, the
chromosomal DNAs of these target clones were amplified by PCR, and a variant from which
a fi-agment of about 2.0 kbp indicating deletion of the gntR gene could be amplified was
selected. The variant obtained was named B strain atoD genome enhanced - gntR gene
deletion variant (hereinafter sometimes abbreviated to "B::atoDABAgntR variant").
[0153] [Example?]

Competent cells of Escherichia coli B::atoDABAgntR variant prepared in Example 6
43
I
i
f l ^ transformed with the plasmid pla prepared in Example 2, and cuhured at 37 °C overnight
on an LB Broth, Miller agar plate containing 50 |xg/ml ampicillin, as a result of which
Escherichia coli pIa/B::atoDABAgntR variant was obtained.
[0154] [Examples]
|
Competent cells of Escherichia coli B::atoDABAgntR variant prepared in Example 6 i
was transformed with the plasmid piaz prepared in Example 2, and cultured at 37 °C
overnight on an LB Broth, Miller agar plate containing 50 ng/ml ampicillin, as a result of
which Escherichia coli plaz/B: :atoDAB AgntR variant was obtained. i
[0155] [Example 9] I

Escherichia coli B::atoDABApgi variant prepared in Example 5 was transformed
with the plasmid pTHl 8csl-gntR prepared in Example 6, and cultured at 30 °C overnight on
an LB Broth, Miller agar plate containing 10 [ig/ml chloramphenicol, as a result of which
transformants were obtained. The transformants obtained were inoculated into an LB liquid
medium containing 10 p.g/ml chloramphenicol, and cultured at 30 °C overnight. Next, part |
of this culture liquid was applied to an LB agar plate containing 10 (xg/ml kanamycin
chloramphenicol, as a result of which colonies that grew at 42 °C were obtained. The
colonies obtained were cultured at 30 °C for 24 hours in an LB liquid medium, and was
applied to an LB agar plate, as a result of which colonies that grew at 42 °C were obtained.
[0156] From the colonies that appeared, 100 colonies were randomly picked up, and each
individually grown on an LB agar plate and an LB agar plate containing 10 |ig/ml
chloramphenicol, and chloramphenicol-sensitive clones were selected. Furthermore, the
chromosomal DNAs of these target clones were amplified by PCR, and a variant from which
a fragment of about 2.0 kbp indicating deletion of the gntR gene could be amplified was
selected. The variant obtained was named B strain atoD genome enhanced - pgi gene
deletion - gntR gene deletion variant (hereinafter sometimes abbreviated to
"B::atoDABApgiAgntR variant").
[0157] Here, Escherichia coli MG1655 strain and Escherichia coli B strain are available
from American Type Culture Collection.
[0158] [Example 10]

Competent cells of Escherichia coli B::atoDAB Apgi AgntR variant prepared in
Example 9 were transformed with the plasmid pla prepared in Example 2, and cultured at 37
°C overnight on an LB Broth, Miller agar plate containing 50 ^g/ml ampicillin, as a resuh of
44
td^ich Escherichia coli pIa/B::atoDABApgiAgntR was obtained.
[0159] [Example 11]

Competent cells oiEscherichia coli B::atoDABApgiAgntR variant prepared in
Example 9 were transformed with the plasmid piaz prepared in Example 2, and cultured at 37
°C overnight on an LB Broth, Miller agar plate containing 50 |jg/ml ampicillin, as a result of
which Escherichia coli pIaz/B::atoDABApgiAgntR variant was obtained. I
[0160] [Example 12]

In order to clone a region flanking to the base sequence of a gene encoding
phosphogluconate dehydrogenase (gnd), four types of oligonucleotide primers represented by
cgccatatgaatggcgcggcggggccggtgg (SEQ ID NO: 34), tggagctctgtttactcctgtcaggggg (SEQ ID
NO: 35), tggagctctctgatttaatcaacaataaaattg (SEQ ID NO: 36) and
cgggatccaccaccataaccaaacgacgg (SEQ ID NO: 37) were synthesized. The primer of SEQ ID
NO: 34 has an Ndel recognition site in the 5'-terminal side thereof, and each of the primers of
SEQ ID NO: 35 and SEQ ID NO: 36 has a Sad recognition site in the 5'-terminal side thereof.
Further, the primer of SEQ ID NO: 37 has a BamHI recognition site in the 5'-terminal side
thereof
[0161] The genomic DNA of Escherichia coli B strain (GenBank accession N0.CPOOO819)
was prepared, and PCR was carried out using a primer pair of SEQ ID NO: 34 and SEQ ID
NO: 35, as a result of which a DNA fragment of about 1.0 kb (hereinafter sometimes referred
to as "gnd-L fragment") was amplified. Also, PCR was carried out using a primer pair of
SEQ ID NO: 36 and SEQ ID NO: 37, as a resuh of which a DNA fragment of about 1.0 kb
(hereinafter sometimes referred to as "gnd-R fi-agment") was amplified. These DNA
fragments were separated by agarose electrophoresis, and recovered. The gnd-L fragment
was digested with Ndel and Sad, and the gnd-R fragment was digested with Sad and BamHI.
These two types of digested fragments were mixed with a fragment obtained by digesting a
temperature-sensitive plasmid pTHlScsl (GenBank accession number ABO 19610) with Ndel
and BamHI, and the mixed fi-agments were allowed to react using T4 DNA ligase.
Thereafter, competent cells of Escherichia coli DH5a (manufactured by Toyobo Co., Ltd.)
were transformed with the ligation product, and transformants that grew on an LB agar plate
containing 10 |ig/ml chloramphenicol at 30 °C were obtained. Plasmids were recovered
fi-om the transformants obtained, and it was confirmed that the two fi-agments of a 5'-upstream
flanking region fragment and a 3'-downstream flanking region fragment of the gnd-encoding
gene were properly inserted in pTH 18cs 1. The plasmid obtained was named pTH 18cs 1 -gnd.
45
§1^62] Escherichia coli B::atoDAB variant prepared in Example 1 was transformed with the
thus-obtained plasmid pTH18csl-gnd, and was cultured at 30 °C overnight on an LB agar
plate containing 10 [xg/ml chloramphenicol, as a result of which transformants were obtained.
The transformants obtained were inoculated into an LB liquid medium containing 10 ^ig/ml
chloramphenicol, and cultured at 30 °C overnight. Next, part of this culture liquid was
applied to an LB agar plate containing 10 ^g/ml kanamycinan chloramphenicol, as a result of
which colonies that grew at 42 °C were obtained. The colonies obtained were cultured at 30
°C for 24 hours in an LB liquid medium, and was applied to an LB agar plate, as a resuh of
which colonies that grew at 42 °C were obtained.
[0163] From the colonies that appeared, 100 colonies were randomly picked up, and each
individually grown on an LB agar plate and an LB agar plate containing 10 \ig/ml
chloramphenicol, and chloramphenicol-sensitive clones were selected. Furthermore, the
chromosomal DNAs of these target clones were amplified by PCR, and a variant fi"om which
a fragment of about 2.0 kbp indicating deletion of the gnd gene could be amplified was
selected. The variant obtained was named B::atoDABAgnd variant.
[0164] Here, Escherichia coli B strain are available from American Type Culture Collection.
[0165] [Example 13]

Competent cells of Escherichia coli B::atoDABAgnd variant prepared in Example 12
were transformed with the plasmid pla prepared in Example 2, and cultured at 37 °C overnight j
on an LB Broth, Miller agar plate containing 50 |xg/ml ampicillin, as a result of which
Escherichia coli pIa/B::atoDABAgnd variant was obtained.
[0166] [Example 14]

Competent cells of Escherichia coli B::atoDABAgnd variant prepared in Example 12
were transformed with the plasmid piaz prepared in Example 2, and cultured at 37 °C
overnight on an LB Broth, Miller agar plate containing 50 |xg/ml ampicillin, as a resuh of
which Escherichia coli pIaz/B::atoDABAgnd variant was obtained.
[0167] [Example 15]
I
Escherichia coli B::atoDABApgi variant prepared in Example 5 was transformed |
with the plasmid pTH18csl-gnd prepared in Example 12, and cultured at 30 "C overnight on
an LB agar plate containing 10 ^ig/ml chloramphenicol, as a result of which transformants
were obtained. The transformants obtained were inoculated into an LB liquid medium
containing 10 |xg/ml chloramphenicol, and cultured at 30 °C overnight. Next, part of this
46
I^ture liquid was applied to an LB agar plate containing 10 |ig/ml kanamycin
chloramphenicol, as a result of which colonies that grew at 42 °C were obtained. The
colonies obtained were cultured at 30 °C for 24 hours in an LB liquid medium, and was
applied to an LB agar plate, as a result of which colonies that grew at 42 °C were obtained.
[0168] From the colonies that appeared, 100 colonies were randomly picked up, and each
individually grown on an LB agar plate and an LB agar plate containing 10 ^g/ml
chloramphenicol, and chloramphenicol-sensitive clones were selected. Furthermore, the
chromosomal DNAs of these target clones were amplified by PCR, and a variant from which
a fragment of about 2.0 kbp indicating deletion of the gnd gene could be amplified was
selected. The variant obtained was named B: :atoDABApgiAgnd variant.
[0169] [Example 16]

Competent cells of Escherichia coli B::atoDABApgiAgnd variant prepared in
Example 15 were transformed with the plasmid pla prepared in Example 2, and cultured at 37
°C overnight on an LB Broth, Miller agar plate containing 50 ng/ml ampicillin, as a result of
which Escherichia coli pIa/B::atoDABApgiAgnd was obtained.
[0170] [Example 17]

Competent cells of Escherichia coli B::atoDABApgiAgnd variant prepared in
Example 15 were transformed with the plasmid piaz prepared in Example 2, and cultured at
37 °C overnight on an LB Broth, Miller agar plate containing 50 ^ig/ml ampicillin, as a result
of which Escherichia coli pIaz/B::atoDABApgiAgnd variant was obtained.
[0171] [Example 18]

Competent cells of Escherichia coli B::atoDABAgnd variant prepared in Example 12
were transformed with the plasmid pTH18csl-gntR prepared in Example 6, and cultured at 30
°C overnight on an LB agar plate containing 10 ^ig/ml chloramphenicol, as a result of which
transformants were obtained. The transformants obtained were inoculated into an LB liquid
medium containing 10 |ig/ml chloramphenicol, and cultured at 30 °C overnight. Next, part
of this culture liquid was applied to an LB agar plate containing 10 p.g/ml kanamycin
chloramphenicol, as a resuh of which colonies that grew at 42 °C were obtained. The
colonies obtained were cultured at 30 °C for 24 hours in an LB liquid medium, and was
applied to an LB agar plate, as a result of which colonies that grew at 42 °C were obtained.
[0172] From the colonies that appeared, 100 colonies were randomly picked up, and each
individually grown on an LB agar plate and an LB agar plate containing 10 p,g/ml
47
^oramphenicol, and chloramphenicol-sensitive clones were selected. Furthermore, the
chromosomal DNAs of these target clones were amplified by PCR, and a variant from which
a fi-agment of about 2.0 kbp indicating deletion of the gntR gene could be amplified was
selected. The variant obtained was named B::atoDABAgndAgntR variant.
[0173] [Example 19]

Competent cells of Escherichia coli B::atoDABAgndAgntR variant prepared in
Example 18 were transformed with the plasmid pla prepared in Example 2, and cultured at 37
°C overnight on an LB Broth, Miller agar plate containing 50 ^ig/ml ampicillin, as a result of
which Escherichia coli pIa/B::atoDABAgndAgntR variant was obtained.
[0174] [Example 20]

Competent cells of Escherichia coli B::atoDABAgndAgntR variant prepared in
Example 18 were transformed with the plasmid piaz prepared in Example 2, and cultured at
37 °C overnight on an LB Broth, Miller agar plate containing 50 |^g/ml ampicillin, as a result
of which Escherichia coli pIaz/B::atoDABAgndAgntR variant was obtained.
[0175] [Example 21]

Competent cells of Escherichia coli B::atoDABApgiAgnd variant prepared in
Example 15 were transformed withe the plasmid pTH18csl-gntR prepared in Example 6, and
cultured at 30 °C overnight on an LB agar plate containing 10 ^ig/ml chloramphenicol, as a
result of which transformants were obtained. The transformants obtained were inoculated
into an LB liquid medium containing 10 |xg/ml chloramphenicol, and cultured at 30 °C
overnight. Next, part of this culture liquid was applied to an LB agar plate containing 10
^g/ml kanamycin chloramphenicol, as a result of which colonies that grew at 42 °C were
obtained. The colonies obtained were cultured at 30 °C for 24 hours in an LB liquid medium,
and was applied to an LB agar plate, as a result of which colonies that grew at 42 °C were
obtained.
[0176] From the colonies that appeared, 100 colonies were randomly picked up, and each
individually grown on an LB agar plate and an LB agar plate containing 10 ^ig/ml
chloramphenicol, and chloramphenicol-sensitive clones were selected. Furthermore, the
chromosomal DNAs of these target clones were amplified by PCR, and a variant fi-om which
a fragment of about 2.0 kbp indicating deletion of the gntR gene could be amplified was
selected. The variant obtained was named B::atoDABApgiAgndAgntR variant.
[0177] [Example 22]
48
i
I^reparation of pIa/B::atoDABApgiAgndAgntR variant>
Competent cells of Escherichia coli B::atoDABApgiAgndAgntR variant the prepared
in Example 21 were transformed with the plasmid pla prepared in Example 2, and cultured at
37 "C overnight on an LB Broth, Miller agar plate containing 50 |ig/ml ampicillin, as a result
of which Escherichia coli pIa/B::atoDABApgiAgndAgntR variant was obtained.
[0178] [Example 23]

Competent cells of Escherichia coli B::atoDABApgiAgndAgntR variant prepared in
Example 21 were transformed with the plasmid piaz prepared in Example 2, and cultured at
37 °C overnight on an LB Broth, Miller agar plate containing 50 jig/ml ampicillin, as a resuh
of which Escherichia coli pIaz/B::atoDABApgiAgndAgntR variant was obtained.
[0179] [Example 24]

Competent cells of Escherichia coli B::atoDAB variant prepared in Example 1 were
transformed with the plasmid pla prepared in Example 2, and cultured at 37 °C overnight on
an LB Broth, Miller agar plate containing 50 ng/ml ampicillin, as a result of which
Escherichia coli pIa/B::atoDAB variant was obtained.
[0180] [Example 25]

Competent cells of Escherichia coli B::atoDAB variantApgi prepared in Example 5
were transformed with the plasmid pIaz prepared in Example 2, and cultured at 37 °C
overnight on an LB Broth, Miller agar plate containing 50 ^ig/ml ampicillin, as a result of
which Escherichia coli pIaz/B::atoDABApgi variant was obtained.
[0181] [Test Example 1]
(Production of Isopropyl Alcohol)
In this example, isopropyl alcohol was produced using a production apparatus shown
in Fig. 1 of the WO 2009/008377 pamphlet. The culture tank used was a tank having a
capacity of 3 L and made of glass, and the trap tanks used were tanks having a capacity of 10
L and made of polypropylene. Into the trap tanks, water as a trap solution (trap water) in an
amount of 9 L per tank was injected, and the two trap tanks were connected for use. The
culture tank was equipped with a drain pipe, and the culture liquid increased by feeding of
sugar and a neutralizer was discharged to outside the culture tank, as appropriate.
A list of variants used in the evaluation of isopropyl alcohol production is shown in
Table 3.
49
%
[0182] Tables
Variant Name Feature Referenced
Description
pIa/B::atoDAB Containing IPA production system Example 24
pIaz/B::atoDAB Containing IPA production system, high Example 2
expression of zwf
plaaa/BApgi Containing IPA production system, Apgi Example 4
pIaz/B::atoDABApgi Containing IPA production system, high Example 25
expression of zwf, Apgi
pIa/B::atoDABAgntR Containing IPA production system, AgntR Example?
;
pIaz/B::atoDABAgntR Containing IPA production system, high Example 8
expression of zwf, AgntR
pIa/B::atoDAB Apgi AgntR Containing IPA production system, Apgi, AgntR Example 10
pIaz/B::atoDAB Apgi AgntR Containing IPA production system, high Example 11
expression of zwf, Apgi, AgntR I
pIa/B::atoDABApgiAgnd Containing IPA production system, Apgi, Agnd Example 16
pIa/B::atoDABAgndAgntR Containing IPA production system, Agnd, AgntR Example 19
r
pIaz/B::atoDABAgndAgntR Containing IPA production system, high Example 20
expression of zwf, Agnd, AgntR
pIa/B::atoDABApgiAgndAgntR Containing IPA production system, Apgi, Agnd, Example 22 ;
r
AgntR
i
pIaz/B::atoDABApgiAgndAgntR Containing IPA production system, high Example 23 [
expression of zwf, Apgi, Agnd, AgntR
I IPA refers to isopropyl alcohol
[0183] As precultiire, each of the variants to be evaluated was individually inoculated into
an Erlenmeyer flask having a capacity of 500 mL and containing 50 ml of an LB Broth, Miller
culture liquid (Difco 244620) containing 50 ^g/ml ampicillin, and cultured overnight at a
culture temperature of 30 °C while stirring at 120 rpm. 45 ml of the preculture was
transferred into a culture tank (culture device BMS-PI manufactured by ABLE corporation)
having a capacity of 3L and containing 855 g of a culture medium having the following
50
disposition, and was cultivated. The cultivation was carried out at an aeration volume of
0.9 L/min, a stirring rate of 550 rpm, a culture temperature of 30 °C and a pH of 7.0 (adjusted
with NH3 aqueous solution) under atmospheric pressure. A 50 wt/wt% glucose aqueous
solution was added at a flow rate of 10 g/L/hour during the period from the initiation of the
cultivation to 8 hours after the initiation of the cultivation, and, thereafter, the 50 wt/wt%
glucose aqueous solution was added at a flow rate of 20 g/L/hour, as appropriate, such that the
amount of glucose left in the culture tank was minimized. The bacterial culture liquid was
sampled several times during the period from the initiation of the cultivation to 72 hours after
the initiation of the cultivation, and, after the bacterial cells were removed by centrifiigal
operation, the amounts of isopropyl alcohol and acetone accumulated in the culture
supematants and trap waters obtained were measured by HPLC according to an ordinary
method. Each of the measurement values is a sum of the amounts in the culture liquid and
the two trap tanks after the cultivation. The results are shown in Table 4.

Com steep liquor (manufactured by Nihon Shokuhin Kako Co., Ltd.): 20 g/L
Fe2S04-7H20: 0.1 g/L
K2HPO4: 2 g/L
KH2PO4: 2 g/L
MgS04-7H20: 2 g/L
(NH4)2S04: 2 g/L
ADEKANOL LG126 (ADEKA Corporation) 0.1 g/L
(Balance: Water)
51
[0184] Table 4
Variant Name IPA Production Amount Acetone Production Amount
(g/Lnih) (g/L/72h)
pIa/B::atoDAB (negative control) 48J 27^6
pIaz/B::atoDAB 39.4 20.2
plaaa/BApgi 0.0 0.0
pIaz/B::atoDABApgi 41.1 3.0
pIa/B::atoDABAgntR 57.3 23.7
pIaz/B::atoDABAgntR 33.3 25.0
pIa/B::atoDABApgiAgntR 9.6 0.8
pIaz/B::atoDABApgiAgntR 70.2 10.6
pIa/B::atoDABApgiAgnd 2.6 0.2
pIa/B::atoDABAgndAgntR 28.6 28.4
pIaz/B::atoDABAgndAgntR 33.9 25.3
pIa/B::atoDABApgiAgndAgntR 0.8 0.0
pIaz/B::atoDABApgiAgndAgntR 75.6 14.1
[0185] As result of the evaluation, the amount of isopropyl alcohol produced by a negative
control (pla/B::atoDAB) was 48.7 g/L/72 h, and the amount produced by a gntR disruptant
(pla/B::atoDABAgntR) was 57.3 g/L/72 h. From this result, it was found that the disruption
of gntR provides an increased productivity that is about 1.2 times that of the negative control.
In addition, the production amount achieved by a variant in which gntR and pgi were
disrupted and in which expression of zwf was enhanced (pIaz/B::atoDABApgiAgntR) was
70.2 g/L/72 h, which indicates a productivity that is about 1.4 times that of the negative
control. From this result, it was found that disruption of both gntR and pgi in combination I
with enhancement of the expression of zwf further improves the productivity as compared to
the case of disruption of gntR alone.
[0186] In the case of disruption of pgi alone (plaaa/BApgi), isopropyl alcohol was not
produced at all. In the case of enhancement of zwf alone (plaz/B: :atoDAB), the production
amount was 39.4 g/L/72 h, and the productivity was decreased rather than increased.
The production amounts in the case of disruption of gntR in combination with high
expression of zwf (pIaz/B::atoDABAgntR), in the case of disruption of pgi in combination ;
with high expression of zwf (plaz/B: :atoD AB Apgi), and in the case of disruption of both pgi
and gntR (pIa/B::atoDABApgiAgntR) were 33.3 g/L/72 h, 41.1 g/L/72 h, and 9.6 g/L/72 h,
respectively, and the efficiency of isopropyl alcohol production was decreased rather than
increased.
52
fll^ 87] Therefore, in a case in which disruption or high expression of other factors is carried
out in addition to the disruption of gntR, the effect in terms of improvement of productivity
achieved by pIaz/B::atoDABApgiAgntR variant is considered to be obtained when both of
gntR and pgi are disrupted and zwf is highly expressed.
Further, in a case in which gnd is further disrupted in pIaz/B::atoDABApgiAgntR
variant exhibiting increased productivity, i.e., in a case in which pgi, gntR, and gnd are
disrupted and zwf is highly expressed (pIaz/B::atoDABApgiAgndAgntR), the amount of
isopropyl alcohol produced was 75.6 g/L/72 h, which indicates a high productivity that is
higher than that achieved by pIaz/B::atoDABApgiAgntR variant.
[0188] In the case of disruption of gnd alone, the amount of isopropyl alcohol produced was
45.5 g/L/72 h, which is lower than that achieved by the negative control. That is, the
dirsuption of gnd alone did not exhibit an effect in terms of improvement of isopropyl alcohol
production efficiency. The production amounts in the case of disruption of gntR and gnd
(pIa/B::atoDABAgndAgntR), in the case of disruption of pgi and gnd
(pIa/B::atoDABApgiAgnd) and in the case of disruption of pgi, gntR and gnd
(pIa/B::atoDABApgiAgndAgntR) were 28.6 g/L/72 h, 2.6 g/L/72 h, and 0.8 g/L/72 h,
respectively, indicating that these variants exhibited decreased isopropyl alcohol production
efficiency rather than increased isopropyl alcohol production efficiency. The efficiency of
isopropyl alcohol production was decreased rather than increased also in a case in which gnd
was disrupted and zwf was highly expressed (pIaz/B::atoDABAgnd), in a case in which gntR
and gnd were disrupted and zwf was highly expressed (pIaz/B::atoDABAgndAgntR), and in a
case in which pgi and gnd were disrupted and zwf was highly expressed
(pIaz/B::atoDABApgiAgnd), and the productivities in such cases were 40.7 g/L/72 h, 33.9
g/L/72 h, and 34.9 g/L/72 h, respectively.
Therefore, the effect in terms of productivity improvement achieved by
pIaz/B::atoDABApgiAgndAgntR variant is considered to be obtained only in a case in which
gntR, pgi and gnd are simultaneously disrupted and in which zwf is strongly expressed.
In addition, the acetone obtained can be used as a raw material for isopropyl alcohol
production, after purification thereof
[0189] (Manufacture of Acetone)
[Example 26]

The trap water obtained when the culture evaluation of
pIaz/B::atoDABApgiAgndAgntR variant (Example 23) was carried out was analyzed by gas I
chromatography (GC), and, as a result, it was found that 1.2 g/L of acetone and 4.3 g/L of
53
H^propyl alcohol were contained. From the aqueous solution containing isopropyl alcohol
and acetone (trap water sampled 72 hours after the initiation of the cultivation), isopropyl
alcohol and acetone were recovered at higher concentrations by distillation.
Specifically, 2 L of the aqueous solution described above was first passed through a
column filled with 250 ml of cation exchange resin (AMBERLYST 31 WET manufactured by
Organo Corporation) at a flow rate of 500 ml/h, whereby residual ammonia etc. were removed.
The resultant solution was distilled at normal pressure. A fraction obtained at boiling points
of from 53 to 81.6 °C was sampled, and analyzed by GC, and foimd to contain 18.7% by mass
of acetone, 62.6% by mass of isopropyl alcohol, 0.2% by mass of unidentified components
and the balance water. The fi-action was used as a raw material for the following
dehydrogenation reaction.
[0190]
15.94 g (0.15 mol) of sodium carbonate and 130 ml of water were added into a 500
ml round-bottom flask equipped with stirrer blades, to form a solution. To the resultant
aqueous solution, an aqueous solution obtained by dissolving 34.36 g (0.11 mol) of zinc
nitrate hexahydrate and 1.30 g (0.05 mol) of zirconium dinitrate oxide dihydrate in 150 ml of
water was added dropwise over one and half hours. The resultant was left to stand for
maturation for 5 days, and then filtered, and washed well with water. The resultant white
matter was dried at 120 °C for 2 hours, and at 400 °C for 1 hour, and, lastly, calcinated at 600
°C for 2 hours. 9.50 g of a complex oxide catalyst, ZnOiZrOi (94:6), was obtained as white
powder.
[0191]
1.0 g of the complex oxide catalyst ZnOrZrOa (94:6) (compression-molded at 20
MPa and thereafter classified to be from 250 to 500 (xm) was added into a reactor made of
SUS having a diameter of 1 cm and a length of 40 cm, and the distillate obtained above
(acetone: 18.7% by mass, isopropyl alcohol: 62.6% by mass, unidentified components: 0.2%
by mass, the balance: water) was allowed to flow through the reactor at 350 "C at a rate of
1.50 g/hr under a nitrogen stream of 10 ml/min. An outlet port of the reactor was cooled,
thereby trapping the reaction solution and the reaction gas. The product sampled at 5 hours
after the initiation of the reaction was analyzed by gas chromatography, and, as a result, it was
found that acetone was produced at high concentration as shown in Table 5. In Table 5,
"IPA" represents isopropyl alcohol (the same shall apply hereinafter).
[0192] [Example 27]
The same procedures as in Example 26 were carried out, except that the reaction
temperature was set to 400 °C. The results are shown in Table 5. As shown in Table 5,
54
iPfctone was produced at high concentration.
[0193] [Example 28]

15.94 g (0.15 mol) of sodium carbonate and 130 ml of water were added into a 500
ml round-bottom flask equipped with stirrer blades, to form a solution. To the resultant
aqueous solution, an aqueous solution obtained by dissolving 32.86 g (0.11 mol) of zinc
nitrate hexahydrate and 2.66 g (0.10 mol) of zirconium dinitrate oxide dihydrate in 150 ml of
water was added dropwise over one and half hours. The resultant was left to stand for
maturation for 5 days, and then filtered, and washed well with water. The resultant white
matter was dried at 120 °C for 2 hours, and at 400 °C for 1 hour, and, lastly, calcinated at 600
°C for 2 hours. 9.94 g of a complex oxide catalyst, ZnO:Zr02 (88:12), was obtained as white
powder.
[0194] . rn Tf , "* ^ ^ f^
o
P.,
u
o f*^ o^ 00 p
"5 00 --I ON O VO ,
o r~- r- 00 00 m
<
d
.2
^ w 00 vo in p
c o r~-* o^ f^ ON '
O -^ 0\ ON 00 0^
o I U O O U
•^ g O O O O I
Q U o O O O r
^ g CO rf m Tt 5,
>
^ ^ • ^ ^ -^
3" 3' do 00
-M ^ 2:. 6o 6o
g N N fij t5
"i 'i o o
N N f^ f^
«^ :
—< vo r- 00 ON i
i-^ Ji Ji Ji Ji
Q, OH Cl, O1
£; x >
An acetoacetate decarboxylase gene (adc) of Clostridium bacteria is described in
GenBank accession number M55392, and an isopropyl alcohol dehydrogenase gene (IPAdh)
is described in GenBank accession number AFl57307.
The promoter sequence of glyceraldehyde 3-phosphate dehydrogenase (hereinafter
sometimes referred to as "GAPDH") from Escherichia coli, which is described in 397 to 440
in the base sequence information with a GenBank accession number X02662, can be used as
^
the base sequence of a promoter necessary to express the gene group mentioned above.
[0198] In order to obtain the GAPDH promoter, amplification by a PCR method was carried
out using the genomic DNA of Escherichia coli MG1655 strain as a template and using
cgagctacatatgcaatgattgacacgattccg (SEQ ID NO: 38) and cgcgcgcatgctatttgttagtgaataaaagg
(SEQ ID NO: 39), and the DNA fi-agment obtained was digested with restriction enzymes
Ndel and SphI, as a result of which a DNA fragment of about 110 bp corresponding to the
GAPDH promoter was obtained. The DNA fragment obtained was mixed with a fi-agment
obtained by digesting plasmid pBR322 (GenBank accession number JO 1749) with restriction
enzymes Ndel and SphI, and the mixed fragments were ligated using a ligase. Thereafter,
competent cells of Escherichia coli DH5a strain (Toyobo Co., Ltd. DNA-903) were
transformed with the ligation product, and transformants that grew on an LB agar plate
containing 50 ng/ml ampicillin were obtained. The colonies obtained were cultured at 37 °C
overnight in an LB liquid medium containing 50 |xg/ml ampicillin, and plasmid pBRgapP was r
recovered from the bacterial cells obtained. !
In order to obtain a codon-modified isopropyl alcohol dehydrogenase gene (IPAdh*),
i a codon-modified isopropyl alcohol dehydrogenase gene was designed based on the amino ^
acid sequence of the isopropyl alcohol dehydrogenase gene of Clostridium beijerinckii NRRL B-593, and the following DNA fragment (SEQ ID NO: 40) was prepared by DNA synthesis.
The sequence thereof is shown below.
ATGAAAGGTTTTGCAATGCTGGGTATTAATAAGCTGGGCTGGATCGAAAAAGAGCG
CCCGGTTGCGGGTTCGTATGATGCGATTGTGCGCCCACTGGCCGTATCTCCGTGTAC
57 ;
^CAGATATCCATACCGTTTTTGAGGGAGCTCTTGGCGACCGCAAGAATATGATTTT
AGGGCATGAAGCGGTGGGTGAAGTTGTGGAGGTAGGCAGTGAAGTGAAGGATTT
CAAACCTGGTGACCGTGTTATCGTCCCTTGCACAACCCCGGATTGGCGGTCTTTGG
AAGTTCAGGCTGGTTTTCAACAGCACTCAAACGGTATGCTCGCAGGATGGAAATTT
TCCAACTTCAAGGATGGCGTCTTTGGTGAGTATTTTCATGTGAATGATGCGGATATG
AATCTTGCGATTCTGCCTAAAGACATGCCCCTGGAAAACGCTGTTATGATCACAGA
TATGATGACTACGGGCTTCCACGGAGCCGAACTTGCAGATATTCAGATGGGTTCAA
GTGTAGTGGTCATTGGCATTGGCGCGGTTGGCCTGATGGGGATAGCCGGTGCTAAA
TTACGTGGAGCAGGTCGGATCATTGGCGTGGGGAGCCGCCCGATTTGTGTCGAGG
CTGCCAAATTTTACGGGGCCACCGACATTTTGAATTATAAAAATGGTCATATCGTTG
ATCAAGTCATGAAACTGACGAACGGAAAAGGCGTTGACCGCGTGATTATGGCAGG
CGGTGGTAGCGAAACACTGTCCCAGGCCGTATCTATGGTCAAACCAGGCGGGATC
ATTTCGAATATAAATTATCATGGAAGTGGCGATGCGTTATTGATCCCGCGTGTGGAA
TGGGGGTGCGGAATGGCTCACAAGACTATCAAAGGCGGTCTTTGTCCCGGGGGAC
GTTTGAGAGCAGAGATGCTGCGAGATATGGTAGTGTACAACCGTGTTGATCTCAGC
AAACTGGTCACGCATGTATATCATGGGTTCGATCACATCGAAGAAGCCCTGTTACT
GATGAAAGACAAGCCAAAAGACCTGATTAAAGCAGTAGTTATATTATAA
[0199] Amplification by a PCR method was carried out using the prepared DNA fragment as
I a template and using acatgcatgcatgaaaggttttgcaatgctg(SEQ ID NO: 41) and
I acgcgtcgacttataatataactactgctttaa (SEQ ID NO: 42), and the DNA fragment obtained was
digested with restriction enzymes SphI and Sail, as a result of which a codon-modified
isopropyl alcohol dehydrogenase fragment of about 1.1 kbp was obtained. The DNA
fragment obtained was mixed with a fragment obtained by digesting plasmid pUC 119 with
restriction enzymes SphI and Sail, and the mixed fragments were ligated using a ligase.
Thereafter, competent cells of Escherichia coli DH5a strain (Toyobo Co., Ltd. DNA-903)
I were transformed with the ligation product, and transformants that grew on an LB agar plate
containing 50 ng/ml ampiciUin were obtained. The colonies obtained were cultured at 37 °C I
overnight in an LB liquid medium containing 50 ^ig/ml ampiciUin, and plasmids were ;
recovered from the bacterial cells obtained, and it was confirmed that codon-modified IPAdh*
was properly inserted. The plasmid obtained was named pUC-I*. •
[0200] A IPAdh*-containing fragment obtained by digesting plasmid pUC-I* with restriction
enzymes SphI and EcoRI was mixed with a fragment obtained by digesting plasmid pBRgapP
I with restriction enzymes SphI and EcoRI, and the mixed fragments were ligated using a ligase.
Thereafter, competent cells of Escherichia coli DH5a strain (Toyobo Co., Ltd. DNA-903)
were transformed with the ligation product, and transformants that grew on an LB agar plate
58
i^taining 50 |ag/ml ampicillin were obtained. The colonies obtained were cultured at 37 °C
overnight in an LB liquid medium containing 50 )ag/ml ampicillin, and plasmids were
recovered from the bacterial cells obtained, and it was confirmed that codon-modified IPAdh*
was properly inserted. The plasmid obtained was named pGAP-I*.
[0201] In order to obtain a codon-modified acetoacetate decarboxylase gene (adc*), a
codon-modified acetoacetate decarboxylase gene was designed based on the amino acid
sequence of the acetoacetate decarboxylase gene of Clostridium acetobutylicum ATCCSIA,
and the following DNA fragment (SEQ ID NO: 43) was prepared by DNA synthesis. The
sequence thereof is shown below.
ATGCTGAAAGATGAAGTGATTAAACAGATTAGCACGCCATTAACTTCGCCTGCATT
TCCGCGCGGTCCGTATAAATTTCATAATCGTGAATATTTTAACATTGTATACCGTACC
; GATATGGACGCCCTGCGTAAAGTTGTGCCAGAGCCTCTGGAAATTGATGAGCCCTT
AGTCCGGTTCGAAATCATGGCAATGCATGATACGAGTGGCCTGGGTTGCTATACAG
AATCAGGTCAGGCTATTCCCGTGAGCTTTAATGGTGTTAAGGGCGACTACCTTCAC
ATGArGTArCTGGAJAACGAGCCGGCAATTGCCGTAGGTCGGGAAnAAGTGCAIA
I CCCIAAAAAGCTCGGGTATCCAAAGCTGTTTGTGGATTCAGACACTCTGGTGGGCA
I CGTTAGACTATGGAAAACTGCGTGTTGCGACCGCGACAATGGGGTACAAACAIAA !
AGCCCTGGATGCTAATGAAGCAAAGGATCAAATTTGTCGCCCGAACTATATGTTGA I
AAATCATCCCCAATTATGACGGCTCCCCTCGCATATGCGAGCTTATCAACGCGAAAA
TCACCGATGTTACCGlACArGAAGCTTGGACAGGACCGACTCGACTGCAGTTAITC GATCACGCTATGGCGCCACTGAATGACTTGCCGGTCAAAGAGATTGTTTCTAGCTC •
TCACATTCTTGCCGATATAATCTTGCCGCGCGCGGAAGTCATATACGATTATCTCAA |
GiAA :
[0202] Amplification by a PCR method was carried out using the prepared DNA fragment as '
a template and using acgcgtcgacgctggttggtggaacatatgctgaaagatgaagtgatta (SEQ ID NO: 44)
and gctctagattacttgagataatcgtatatga (SEQ ID NO: 45), and the DNA fragment obtained was ;
digested with restriction enzymes Sail and Xbal, as a result of which a codon-modified
I
acetoacetate decarboxylase fi-agment of about 700 bp was obtained. The DNA fragment
obtained was mixed with a fragment obtained by digesting the plasmid pGAP-I* prepared
above with restriction enzymes Sail and Xbal, and the mixed fi-agments were ligated using a
ligase. Thereafter, competent cells of Escherichia coli DH5a strain (Toyobo Co., Ltd.
DNA-903) were transformed with the ligation product, and transformants that grew on an LB
agar plate containing 50 ^ig/ml ampicillin were obtained. The colonies obtained were
I cultured at 37 °C overnight in an LB liquid medium containing 50 ^g/ml ampicillin, and
i :
I plasmids were recovered from the bacterial cells obtained, and it was confirmed that adc* was I
i 59 !
i •
I !
(p)perly inserted. The plasmid obtained was named pl*a*.
[0203] In order to obtain glucose-6-phosphate 1 -dehydrogenase gene (zwf), amplification by
a PCR method was carried out using the genomic DNA of Escherichia coli B strain (GenBank
accession No.CP000819) as a template and using
gctctagacggagaaagtcttatggcggtaacgcaaacagcccagg (SEQ ID NO: 46) and
cgggatccttactcaaactcattccaggaacgac (SEQ ID NO: 47), and the DNA fragment obtained was
digested with restriction enzymes BamHI and Xbal, as a result of which a fragment of the
glucose-6-phosphate 1-dehydrogenase of about 1500 bp was obtained. The DNA fragment
obtained was mixed with a fragment obtained by digesting the plasmid pi*a* prepared above
with restriction enzymes Xbal and BamHI, and the mixed fragments were ligated using a
ligase. Thereafter, competent cells of Escherichia coli DH5a strain (Toyobo Co., Ltd.
DNA-903) were transformed with the ligation product, and transformants that grew on an LB
agar plate containing 50 (xg/ml ampicillin were obtained. The colonies obtained were
cultured at 37 °C overnight in an LB liquid medium containing 50 ^ig/ml ampicillin, and
I plasmid pl*a*z was recovered from the bacterial cells obtained.
[0204] [Example 31] ;

Competent cells of Escherichia coli B::atoDABAgntR variant prepared in Example 6
were transformed with the plasmid pl*a* prepared in Example 30, and cultured at 37 °C ;
[
overnight on an LB Broth, Miller agar plate containing 50 |ig/ml ampicillin, as a result of which Escherichia coli pI*a*/B::atoDABAgntR variant was obtained. ;
[0205] [Example 32] i
Competent cells of Escherichia coli B::atoDABApgi

CLAIMS
1. An isopropyl alcohol-producing Escherichia coli comprising an isopropyl alcohol
production system, wherein an activity of transcriptional repressor GntR is inactivated, and
the isopropyl alcohol-producing Escherichia coli comprises a group of auxiliary enzymes
having an enzyme activity expression pattern w^ith which isopropyl alcohol production
capacity achieved by the inactivation of the GntR activity is maintained or enhanced.
2. The isopropyl alcohol-producing Escherichia coli according to claim 1, wherein the
enzyme activity expression pattern of the group of auxiliary enzymes is selected from the
group consisting of:
(1) maintenance of wild-type activities of glucose-6-phosphate isomerase (Pgi)
activity, glucose-6-phosphate 1-dehydrogenase (Zwf) activity and phosphogluconate
dehydrogenase (Gnd) activity;
(2) inactivation of glucose-6-phosphate isomerase (Pgi) activity and enhemcement of
glucose-6-phosphate 1-dehydrogenase (Zwf) activity; and
(3) inactivation of glucose-6-phosphate isomerase (Pgi) activity, enhancement of
glucose-6-phosphate 1-dehydrogenase (Zwf) activity and inactivation of phosphogluconate
dehydrogenase (Gnd) activity.
3. The isopropyl alcohol-producing Escherichia coli according to claim 2, wherein the
glucose-6-phosphate 1-dehydrogenase (Zwf) activity is derived from a gene encoding
glucose-6-phosphate 1-dehydrogenase (Zwf) derived from a bacterium of the genus
Escherichia.
4. The isopropyl alcohol-producing Escherichia coli according to any one of claims 1 to
3, wherein the isopropyl alcohol production system is constituted by enzyme genes of
acetoacetate decarboxylase, isopropyl alcohol dehydrogenase, Co A transferase and thiolase.
5. The isopropyl alcohol-producing Escherichia coli according to any one of claims 1 to
4, wherein the isopropyl alcohol production system is constituted by enzyme genes of
acetoacetate decarboxylase, isopropyl alcohol dehydrogenase, CoA transferase and thiolase,
and each of the enzyme genes is independently derived from at least one prokaryote selected
from the group consisting of a bacterium of the genus Clostridium, a bacterium of the genus
Bacillus and a bacterium of the genus Escherichia.
69
6. The isopropyl alcohol-producing Escherichia coli according to claim 4 or 5, wherein
the acetoacetate decarboxylase activity is derived from an enzyme-encoding gene derived
from Clostridium acetobutylicum, the isopropyl alcohol dehydrogenase activity is derived
from an enzyme-encoding gene derived from Clostridium beijerinckii, and the CoA
transferase activity and the thiolase activity are derived from enzyme-encoding genes derived
from Escherichia coli.
7. The isopropyl alcohol-producing Escherichia coli according to claim 4, wherein at
least one selected from the group consisting of the isopropyl alcohol dehydrogenase activity
and the acetoacetate decarboxylase activity is derived from a gene or genes introduced as a
modified gene or modified genes.
8. The isopropyl alcohol-producing Escherichia coli according to claim 7, wherein the
modified gene of the isopropyl alcohol dehydrogenase has a base sequence represented by
SEQ ID NO: 40, and the modified gene of the acetoacetate decarboxylase has a base sequence
represented by SEQ ID NO: 43.
9. The isopropyl alcohol-producing Escherichia coli according to any one of claims 4 to
8, further comprising at least a sucrose hydrolase gene from among sucrose non-PTS genes.
10. A method of producing isopropyl alcohol, comprising producing isopropyl alcohol
from a plant-derived raw material using the isopropyl alcohol-producing Escherichia coli of
any one of claims 1 to 9.
11. A method of producing acetone, comprising:
obtaining isopropyl alcohol from a plant-derived raw material using the isopropyl
alcohol-producing Escherichia coli of any one of claims 1 to 9; and
contacting the obtained isopropyl alcohol with a complex oxide as a catalyst that
includes zinc oxide and at least one oxide containing a Group 4 element, and that is prepared
by coprecipitation.
12. A method of producing propylene, comprising:
contacting isopropyl alcohol that is obtained from a plant-derived raw material using
the isopropyl alcohol-producing Escherichia coli of any one of claims 1 to 9 and that contains
70
acetone, with a solid acidic substance and a Cu-containing hydrogenation catalyst as catalysts,
at a reaction temperature within a range of from 50 to 300 °C.
13. The method of producing propylene according to claim 12, wherein the
Cu-containing hydrogenation catalyst is a catalyst that further includes at least one element
selected from the group consisting of Group 6, Group 12 and Group 13 elements.
14. The method of producing propylene according to claim 12 or 13, wherein the solid
acidic substance is zeolite.