Variant of L-threonine excreting protein and L-threonine production method using same
technical field
[1]
The present application relates to a variant of L-threonine excreting protein and a method for producing L-threonine using the same.
[2]
background
[3]
L-Threonine (L-Thr) is one of the essential amino acids and has been widely used as a feed additive, and has also been widely used as a raw material for pharmaceuticals such as infusions and as a material for health food.
[4]
Currently, direct fermentation using microorganisms is mainly used for L-threonine production. Microorganisms used for L-threonine production were initially selected from strains that showed analog resistance through chemical or physical mutation. Recombinant strains using manipulation techniques are mainly used.
[5]
On the other hand, the expression of a specific amino acid excretion gene has caused improvement in the productivity of the corresponding amino acid in microorganisms. Enhancement of expression of L-lysine excretion gene (lysE) in microorganisms of the genus Corynebacterium improved the productivity of lysine (WO9723597A2). In addition, L-glutamic acid, L-lysine, L-threonine, L-alanine, L-histidine, L-proline by enhancing the yahN gene, yeaS gene, yfiK gene and yggA gene, which are genes whose function is unknown in E. coli. , L- arginine, L- valine, and L-isoleucine improved productivity is disclosed in the patent (EP1016710B1).
[6]
DETAILED DESCRIPTION OF THE INVENTION
technical challenge
[7]
The present inventors completed the present application by selecting mutant rhtC to improve the excretion ability of L-threonine excreting protein (RhtC) encoded by rhtC and confirming that L-threonine production is remarkably improved through this. .
[8]
means of solving the problem
[9]
One object of the present application includes a substitution with another amino acid at a position corresponding to position 53 or 62 of SEQ ID NO: 1, and at least 80% or more and less than 100% sequence homology with the amino acid sequence of SEQ ID NO: 1 It is to provide a variant of the L- threonine excreting protein, which has L-threonine excretion activity.
[10]
Another object of the present application is to provide a polynucleotide encoding a variant of the L-threonine excretion protein.
[11]
Another object of the present application is to provide a vector comprising the polynucleotide.
[12]
Another object of the present application is to produce L-threonine comprising any one or more of a variant of the L-threonine excretion protein, a polynucleotide encoding the variant of the protein, and a vector including the polynucleotide. to provide microbes.
[13]
Another object of the present application is to provide a method for producing L-threonine, comprising the step of culturing the microorganism in a medium.
[14]
Effects of the Invention
[15]
When culturing a microorganism that produces L-threonine using the variant of the L-threonine excreting protein of the present application, it is possible to produce L-threonine in a higher yield than a microorganism having an existing unmodified protein. Do.
[16]
Best mode for carrying out the invention
[17]
This will be described in detail as follows. Meanwhile, each description and embodiment disclosed in the present application may be applied to each other description and embodiment. That is, all combinations of the various elements disclosed in the present application fall within the scope of the present application. In addition, it cannot be seen that the scope of the present application is limited by the detailed description described below.
[18]
[19]
One aspect of the present application for achieving the above object provides a variant of the L-threonine excretion protein comprising one or more amino acid substitutions in the amino acid sequence of SEQ ID NO: 1.
[20]
Specifically, the present application provides a variant of the protein in which i) the 53rd amino acid is substituted with another amino acid, and/or ii) the 62nd amino acid is substituted with another amino acid in the amino acid sequence of SEQ ID NO: 1. The amino acid substitution is i) the 53rd amino acid is substituted with threonine, or ii) the 62nd amino acid is serine, arginine, alanine, aspartic acid, lysine, proline, cysteine, glycine, threonine, isoleucine, tyrosine, valine, It may include substitution with an amino acid selected from histidine, phenylalanine, methionine, glutamine, asparagine, glutamic acid or tryptophan.
[21]
[22]
As used herein, the term "Threonine (Thr)" is one of the essential amino acids that are not synthesized in the body and can only be supplied as food, and constitutes mucine, a substance that protects the intestinal epithelium. may cause a decrease. Threonine is widely used as a raw material for pharmaceuticals such as feed additives and infusions, and as a material for health food. Like other amino acids, threonine also has D-type and L-type stereoisomers, and most naturally occurring threonine exists as L-threonine (L-Thr), which is an L-type stereoisomer. do. In the present invention, threonine (Threonine, Thr) may be used in combination with L-threonine (L-Thr).
[23]
As used herein, the term "L-threonine exporter (L-threonine efflux protein)" refers to a protein mediating the release of L-threonine out of cells, and has five transmembrane domains. ) is known as an inner membrane protein with Experimental topology analysis suggests that its C-terminus is present in the cytoplasm (Daley DO et al., Global topology analysis of the Escherichia coli inner membrane proteome, Science. 2005 May 27; 308(5726):1321 -3.). The L-threonine excretion protein may be, for example, a protein comprising the amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 113, or SEQ ID NO: 115. The protein comprising the amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 113 or SEQ ID NO: 115 is a protein having the amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 113 or SEQ ID NO: 115, SEQ ID NO: 1, SEQ ID NO: 113 or SEQ ID NO: 115 It may be used in combination with a protein composed of an amino acid sequence. In the present application, the L-threonine excretion protein may be used in combination with RhtC protein or RhtC.
[24]
In the present application, SEQ ID NO: 1, SEQ ID NO: 113, or SEQ ID NO: 115 refers to an amino acid sequence having L-threonine excretion activity. Specifically, SEQ ID NO: 1, SEQ ID NO: 113 or SEQ ID NO: 115 is a protein sequence having L-threonine excretion activity encoded by the rhtC gene. The amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 113 or SEQ ID NO: 115 can be obtained from GenBank of NCBI, a known database. For example, SEQ ID NO: 1 is E. coli ( Escherichia coli , E. coli ), SEQ ID NO: 113 is Shigella flexneri ( Shegella flexneri ), SEQ ID NO: 115 is Escherichia fergusonii ( Escherichia fergusonii ) It may be derived from , but is not limited thereto, and may be included without limitation as long as it is an amino acid sequence of a protein having the same activity as a protein comprising the amino acid sequence. The SEQ ID NO: 113 or SEQ ID NO: 115 may each have 99% homology with SEQ ID NO: 1, but is not limited thereto.
[25]
In addition, although the protein having L-threonine excretion activity in the present application is defined as a protein comprising the amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 113 or SEQ ID NO: 115, SEQ ID NO: 1, SEQ ID NO: 113 or SEQ ID NO: A protein comprising the amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 113 or SEQ ID NO: 115, which does not exclude the addition of meaningless sequences before and after the amino acid sequence of 115 or a mutation that may occur naturally or a silent mutation thereof It is apparent to those skilled in the art that if it has the same or corresponding activity with each other, it corresponds to the protein having the L-threonine excretion activity of the present application. As a specific example, the protein having L- threonine excretion activity of the present application is an amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 113 or SEQ ID NO: 115 or 80%, 85%, 90%, 95%, 96% thereof, It may be a protein consisting of an amino acid sequence having at least 97%, 98%, or 99% homology or identity. In addition, as long as it is an amino acid sequence having such homology or identity and exhibiting efficacy corresponding to the protein, a protein having an amino acid sequence in which some sequence is deleted, modified, substituted or added is also included within the scope of the protein subject to mutation of the present application. is self-evident
[26]
That is, even if it is described as 'a protein or polypeptide having an amino acid sequence set forth in a specific SEQ ID NO:' or 'a protein or polypeptide comprising an amino acid sequence set forth in a specific SEQ ID NO:' in the present application, a polypeptide consisting of the amino acid sequence of the SEQ ID NO: It is apparent that a protein having an amino acid sequence in which some sequences have been deleted, modified, substituted or added may also be used in the present application, provided that it has the same or corresponding activity to . For example, the 'polypeptide consisting of the amino acid sequence of SEQ ID NO: 1' is a sequence corresponding to SEQ ID NO: 1, or if it is a sequence having the same or corresponding activity, it is added to the 'polypeptide consisting of the amino acid sequence of SEQ ID NO: 1' It is self-evident that it can belong to
[27]
[28]
As used herein, the term "variant" means that one or more amino acids differ from the recited sequence in conservative substitution and/or modification, but the function of the protein ( Functions) or properties (properties) are maintained. A variant differs from an identified sequence by several amino acid substitutions, deletions or additions. Such variants can generally be identified by modifying one or more amino acids in the amino acid sequence of the protein and evaluating the properties of the modified protein. That is, the ability of the variant may be increased, unchanged, or decreased compared to the native protein. In addition, some variants may include variants in which one or more portions, such as an N-terminal leader sequence or a transmembrane domain, are removed. Other variants may include variants in which a portion is removed from the N- and/or C-terminus of the mature protein. The term "variant" may include terms such as mutant, modified, mutated protein, mutant polypeptide, and mutant (in English, modified, modified protein, modified polypeptide, mutant, mutein, divergent, variant, etc.) may be used, If it is a term used in a mutated meaning, it is not limited thereto. For the purposes of this application,
[29]
As used herein, the term “conservative substitution” means substituting an amino acid for another amino acid having similar structural and/or chemical properties. Such variants may have, for example, one or more conservative substitutions while still retaining one or more biological activities. Such amino acid substitutions may generally occur based on similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity and/or amphipathic nature of the residues. For example, among amino acids with electrically charged amino acids, positively charged (basic) amino acids are arginine, lysine, and histidine, and negatively charged (acidic) amino acids are glutamic acid and arpartate. acid; Among amino acids having an uncharged amino acid, nonpolar amino acids include glycine, alanine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan and proline, and include polar or hydrophilic ( hydrophilic) amino acids include serine, threonine, cysteine, tyrosine, asparagine and glutamine, and among the non-polar amino acids, aromatic amino acids include phenylalanine, tryptophan and tyrosine.
[30]
In addition, variants may contain deletions or additions of amino acids that have minimal effect on the secondary structure and properties of the polypeptide. For example, the polypeptide can be conjugated with a signal (or leader) sequence at the N-terminus of the protein involved in the transfer of the protein either co-translationally or post-translationally. The polypeptide may also be conjugated with other sequences or linkers to enable identification, purification, or synthesis of the polypeptide.
[31]
[32]
The 'substitution with another amino acid' is not limited as long as it is an amino acid different from the amino acid before the substitution. That is, if alanine, the 53rd amino acid of the amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 113, or SEQ ID NO: 115, is substituted with an amino acid residue other than alanine, or the 62nd amino acid, leucine, is substituted with an amino acid residue other than leucine. does not On the other hand, in the present application, when it is expressed that 'a specific amino acid has been substituted', it is obvious that the amino acid is substituted with an amino acid different from the amino acid before the substitution, even if it is not separately indicated that it is substituted with another amino acid.
[33]
The variant may be one in which at least one amino acid of the 53rd or 62nd amino acid in the amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 113 or SEQ ID NO: 115 is substituted with an amino acid different from the amino acid before the substitution. Alternatively, the variant may be a variant, which has an uncharged amino acid, and is substituted with an amino acid different from the amino acid before the substitution, but is not limited thereto.
[34]
Specifically, the variant may be a variant in which i) the 53rd amino acid is substituted with another amino acid, or ii) the 62nd amino acid is substituted with another amino acid in the amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 113 or SEQ ID NO: 115. The substitution with another amino acid may be i) the 53rd amino acid is threonine, or ii) the 62nd amino acid is serine, arginine, alanine, aspartic acid, lysine, proline, cysteine, glycine, threonine, isoleucine, tyrosine , may be substituted with an amino acid selected from valine, histidine, phenylalanine, methionine, glutamine, asparagine, glutamic acid or tryptophan. More specifically, in the amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 113 or SEQ ID NO: 115, i) the 53rd amino acid is substituted with threonine, or ii) the 62nd amino acid is serine, arginine, alanine, aspartic acid, It may be a variant substituted with an amino acid selected from lysine, proline, cysteine, glycine, threonine, isoleucine, tyrosine, valine, histidine, phenylalanine, methionine, glutamine, asparagine, glutamic acid or tryptophan.
[35]
[36]
In the variant of the L-threonine excretion protein provided in the present application, amino acids at a specific position among the proteins having the L-threonine excretion ability described above are substituted, so that the L-threonine excretion ability is lower than that of the protein before the mutation. may mean increased variants.
[37]
[38]
In the amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 113 or SEQ ID NO: 115, i) the 53rd amino acid is substituted with threonine, or ii) the 62nd amino acid is substituted with another amino acid, and SEQ ID NOs: 93 to 112, 114 and It may include the amino acid sequence of any one of 116, specifically, it may consist essentially of the amino acid sequence of any one of SEQ ID NOs: 93 to 112, 114 and 116, and more specifically It may consist of the amino acid sequence of any one of SEQ ID NOs: 93 to 112, 114 and 116, but is not limited thereto.
[39]
The variant comprises a substitution with another amino acid at the position corresponding to the 53rd or 62nd position of SEQ ID NO: 1, SEQ ID NO: 113 or SEQ ID NO: 115, and the amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 113 or SEQ ID NO: 115 It may have at least 80%, 90%, 95%, 96%, 97%, 98%, or 99% or more, but less than 100% sequence homology, and may have L-threonine excretion activity.
[40]
In addition, the variant has an amino acid sequence of any one of SEQ ID NOs: 93 to 112, 114 and 116 or in the amino acid sequence, at least one amino acid selected from the 53rd or 62nd amino acid is fixed, and has 80% or more homology or identity therewith It may include an amino acid sequence having, but is not limited thereto. Specifically, the variants of the present application have at least 80%, 90%, 95%, 96%, 97%, 98%, or 99% homology or identity to the amino acid sequence of any one of SEQ ID NOs: 93 to 112, 114 and 116. It may include a polypeptide having a. In addition, if an amino acid sequence having such homology or identity and exhibiting efficacy corresponding to the protein, a protein having an amino acid sequence in which some sequences are deleted, modified, substituted or added in addition to the 53rd or 62nd amino acid position is also within the scope of the present application. It is self-evident that it is included within.
[41]
[42]
In the present application, the term 'homology' or 'identity' refers to a degree related to two given amino acid sequences or base sequences, and may be expressed as a percentage. The terms homology and identity can often be used interchangeably.
[43]
Sequence homology or identity of a conserved polynucleotide or polypeptide is determined by standard alignment algorithms, with default gap penalties established by the program used may be used. Substantially, homologous or identical sequences generally have moderate or high stringency conditions along at least about 50%, 60%, 70%, 80% or 90% of the entire or full-length sequence. It can hybridize under stringent conditions. Hybridization is also contemplated for polynucleotides containing degenerate codons instead of codons in the polynucleotides.
[44]
Whether any two polynucleotide or polypeptide sequences have homology, similarity or identity can be determined, for example, by Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: 2444, using a known computer algorithm such as the “FASTA” program. or, as performed in the Needleman Program (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later) of the EMBOSS package, Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) can be used to determine (GCG program package (Devereux, J., et al, Nucleic Acids) Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop , [ED.,] Academic Press, San Diego, 1994, and [CARILLO ETA/.] (1988) SIAM J Applied Math 48: 1073).For example, BLAST of the National Center for Biotechnology Information Database, or ClustalW can be used to determine homology, similarity or identity.
[45]
Homology, similarity or identity of polynucleotides or polypeptides is described, for example, in Smith and Waterman, Adv. Appl. Math (1981) 2:482, see, for example, Needleman et al. (1970), J Mol Biol. can be determined by comparing sequence information using a GAP computer program such as 48:443. In summary, the GAP program is defined as the total number of symbols in the shorter of two sequences divided by the number of similarly aligned symbols (ie, nucleotides or amino acids). Default parameters for the GAP program are: (1) a binary comparison matrix (containing values ​​of 1 for identity and 0 for non-identity) and Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation , pp. 353-358 (1979), Gribskov et al (1986) Nucl. Acids Res. 14: weighted comparison matrix of 6745 (or EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix); (2) a penalty of 3.0 for each gap and an additional 0.10 penalty for each symbol in each gap (or a gap opening penalty of 10, a gap extension penalty of 0.5); and (3) no penalty for end gaps.
[46]
In addition, whether any two polynucleotide or polypeptide sequences have homology, similarity or identity can be confirmed by comparing the sequences by Southern hybridization experiments under defined stringent conditions, and the defined appropriate hybridization conditions are within the scope of the art and , methods well known to those skilled in the art (eg, J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; FM Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York).
[47]
[48]
As used herein, the term "variant of L-threonine excretion protein" refers to a variant polypeptide having L-threonine-producing ability, a variant polypeptide producing L-threonine, and a variant producing L-threonine. Polypeptide, mutant polypeptide having L-threonine excretion activity, L-threonine excretion activity variant, L-threonine excretion mutant, mutant RhtC, RhtC variant, mutant L-threonine excretion protein, etc. are mixed and can be used In addition, the protein may be derived from Escherichia coli , E. coli , but is not limited thereto.
[49]
The variant of the L-threonine excretion protein may include a mutation at the 53rd and / or 62nd position in the amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 113 or SEQ ID NO: 115, SEQ ID NO: 1, SEQ ID NO: 113 or Even if it is an amino acid sequence in which an amino acid is added or deleted in SEQ ID NO: 115, if the amino acid at the position corresponding to the 53 and/or 62 amino acids from the N-terminus of SEQ ID NO: 1, SEQ ID NO: 113 or SEQ ID NO: 115 is substituted, the present invention included in the scope of the application. The variant of the L-threonine excretion protein is SEQ ID NO: 1, SEQ ID NO: 113 or SEQ ID NO: 115, in which the 53rd or 62nd amino acid is substituted with another amino acid, SEQ ID NO: 1, SEQ ID NO: 113 or SEQ ID NO: It may include an amino acid sequence of 115 or a mutant L-threonine excreting protein having enhanced activity compared to a wild-type microorganism-derived pre-mutated L-threonine excreting protein. Such variants of the L-threonine excretion protein are at least 80%, 85%, 90 %, 95%, 96%, 97%, 98%, or the amino acid at the position corresponding to the 53rd or 62th position of SEQ ID NO: 1, SEQ ID NO: 113 or SEQ ID NO: 115 in amino acids having at least 99% homology or identity It means mutated.
[50]
The mutation at the 53rd or 62nd amino acid is i) the 53rd amino acid is substituted with threonine, or ii) the 62nd amino acid is serine, arginine, alanine, aspartic acid, lysine, proline, cysteine, glycine, threonine, isoleucine , tyrosine, valine, histidine, phenylalanine, methionine, glutamine, asparagine, glutamic acid or tryptophan may be substituted with an amino acid selected from the group consisting of.
[51]
Specifically, the variant of the L-threonine excretion protein is i) the 53rd amino acid is substituted with threonine in the amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 113 or SEQ ID NO: 115, or ii) the 62nd amino acid is serine, It may be substituted with an amino acid selected from arginine, alanine, aspartic acid, lysine, proline, cysteine, glycine, threonine, isoleucine, tyrosine, valine, histidine, phenylalanine, methionine, glutamine, asparagine, glutamic acid or tryptophan, SEQ ID NO: 1, SEQ ID NO: 113 or SEQ ID NO: 115 may be one having enhanced activity compared to the protein comprising the amino acid sequence or L-threonine excretion protein derived from wild-type microorganisms before mutation.
[52]
For the purpose of the present application, in the case of a microorganism including a variant of the L-threonine excreting protein, it is characterized in that the production of L-threonine is increased. This is whereas the wild-type microorganism cannot produce L-threonine or can produce a trace amount even if it does produce L-threonine, L-threonine through the variant of the L-threonine excreting protein of the present application It is meaningful that it can increase production.
[53]
[54]
Another aspect of the present application provides a polynucleotide encoding a variant of the L-threonine excretion protein.
[55]
The L-threonine, the protein having L-threonine excretion activity comprising the amino acid sequence of SEQ ID NO: 1, and variants thereof are as described above.
[56]
As used herein, the term "polynucleotide" refers to a DNA or RNA strand of a certain length or more as a polymer of nucleotides in which nucleotide monomers are linked in a long chain by covalent bonds, and more specifically, encoding the variant. polynucleotide fragments.
[57]
The polynucleotide encoding the variant of the L-threonine excretion protein of the present application may be included without limitation as long as it is a polynucleotide sequence encoding a variant polypeptide having L-threonine excretion activity of the present application. In the present application, the gene encoding the amino acid sequence of the L-threonine excretion protein is the rhtC gene, and the gene is Escherichia coli ( E. coli ), Shigella flexneri ( Shegella flexneri ) or Escherichia pergusoni ( Escherichia fergusonii ) It may be derived, but is not limited thereto. In addition, the gene may be a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 113 or SEQ ID NO: 115, and more specifically, the nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 1 is the nucleotide sequence of SEQ ID NO: 2 It may be a sequence comprising, but is not limited thereto.
[58]
Specifically, the polynucleotide of the present application contains a variety of coding regions within a range that does not change the amino acid sequence of the polypeptide due to codon degeneracy or considering codons preferred in the organism in which the polypeptide is to be expressed. Deformation can be made. Specifically, if it is a polynucleotide sequence encoding a variant of the L-threonine excretion protein in which the 53rd or 62nd amino acid is substituted with another amino acid in the amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 113 or SEQ ID NO: 115, it may include without limitation. can
[59]
In addition, the amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 113 or SEQ ID NO: 115 by hybridizing under stringent conditions with a probe that can be prepared from a known gene sequence, for example, a sequence complementary to all or part of the nucleotide sequence. Any sequence encoding a protein having L-threonine excretion activity in which the 53rd or 62nd amino acid is substituted with another amino acid may be included without limitation. The "stringent condition" means a condition that enables specific hybridization between polynucleotides. These conditions are specifically described in the literature (see Sambrook et al., supra, 9.50-9.51, 11.7-11.8). For example, 40% or more, specifically 90% or more, more specifically 95% or more, more specifically 97% or more, particularly specifically 99% or more homology between genes with high homology or identity, or Genes having the same identity are hybridized and genes having homology or identity lower than that are not hybridized, or washing conditions of normal Southern hybridization at 60 ° C., 1ХSSC, 0.1% SDS, specifically At a salt concentration and temperature equivalent to 60 °C, 0.1ХSSC, 0.1% SDS, more specifically 68 °C, 0.1ХSSC, 0.1% SDS, the conditions of washing once, specifically two to three times, can be enumerated. there is.
[60]
Hybridization requires that two nucleic acids have complementary sequences, although mismatch between bases is possible depending on the stringency of hybridization. The term "complementary" is used to describe the relationship between nucleotide bases capable of hybridizing to each other. For example, with respect to DNA, adenosine is complementary to thymine and cytosine is complementary to guanine. Accordingly, the present application may also include isolated nucleic acid fragments that are complementary to substantially similar nucleic acid sequences as well as the entire sequence.
[61]
Specifically, polynucleotides having homology or identity can be detected using hybridization conditions including a hybridization step at a Tm value of 55° C. and using the above-described conditions. In addition, the Tm value may be 60 °C, 63 °C, or 65 °C, but is not limited thereto and may be appropriately adjusted by those skilled in the art according to the purpose.
[62]
The appropriate stringency for hybridizing polynucleotides depends on the length of the polynucleotides and the degree of complementarity, and the parameters are well known in the art (eg, J. Sambrook et al., supra).
[63]
[64]
Another aspect of the present application provides a vector comprising a polynucleotide encoding a variant of the L- threonine excretion protein.
[65]
The L-threonine, the protein having L-threonine excretion activity comprising the amino acid sequence of SEQ ID NO: 1, and variants thereof are as described above.
[66]
As used herein, the term "vector" refers to a DNA preparation containing a base sequence of a polynucleotide encoding a target polypeptide operably linked to a suitable regulatory sequence so that the target polypeptide can be expressed in a suitable host. The regulatory sequences may include a promoter capable of initiating transcription, an optional operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence regulating the termination of transcription and translation. After transformation into an appropriate host cell, the vector can replicate or function independently of the host genome, and can be integrated into the genome itself.
[67]
The vector used in the present application is not particularly limited, and any vector known in the art may be used. Examples of commonly used vectors include plasmids, cosmids, viruses and bacteriophages in a natural or recombinant state. For example, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A may be used as phage vectors or cosmid vectors, and pBR-based, pUC-based, and pBluescriptII-based plasmid vectors may be used. , pGEM-based, pTZ-based, pCL-based and pET-based and the like can be used. Specifically, pDZ, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC vectors and the like can be used.
[68]
For example, a polynucleotide encoding a target polypeptide may be inserted into a chromosome through a vector for intracellular chromosome insertion. The insertion of the polynucleotide into the chromosome may be performed by any method known in the art, for example, homologous recombination, but is not limited thereto. It may further include a selection marker (selection marker) for confirming whether the chromosome is inserted. The selection marker is used to select cells transformed with the vector, that is, to determine whether a target nucleic acid molecule is inserted, and to confer a selectable phenotype such as drug resistance, auxotrophicity, resistance to cytotoxic agents, or expression of a surface polypeptide. markers may be used. In an environment treated with a selective agent, only cells expressing a selectable marker survive or exhibit other expression traits, and thus transformed cells can be selected.
[69]
[70]
As another aspect of the present application, the present application provides a microorganism for producing L-threonine, including a polynucleotide encoding the variant or L-threonine excretion protein.
[71]
As used herein, the term "microorganism comprising a variant polypeptide", "or "microorganism comprising a variant of L-threonine excretion protein" refers to a microorganism or L- It refers to a microorganism that is endowed with L-threonine-producing ability to the parent strain without threonine-producing ability. Specifically, the microorganism comprises one or more amino acid mutations in the amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 113 or SEQ ID NO: 115 As a microorganism expressing a variant of the L-threonine excretion protein, the amino acid mutation may include a substitution of another amino acid in the 53rd or 62nd amino acid from the N-terminus. , in which the 53rd or 62nd amino acid in the amino acid sequence of SEQ ID NO: 113 or SEQ ID NO: 115 is substituted with another amino acid, and has L-threonine excretion activity, may be a microorganism expressing a variant polypeptide, but is not limited thereto.
[72]
The L-threonine, the protein having L-threonine excretion activity comprising the amino acid sequence of SEQ ID NO: 1, and variants thereof are as described above.
[73]
As used herein, the term, "to be expressed / being" a protein refers to a state in which a target protein is introduced into a microorganism or modified to be expressed in the microorganism. When the target protein is a protein present in a microorganism, it refers to a state in which the activity is enhanced compared to before intrinsic or modified. For the purposes of the present application, the "target protein" may be a variant of the protein having the aforementioned L-threonine excretion ability.
[74]
Specifically, "introduction of a protein" means that the activity of a specific protein that the microorganism did not originally have or exhibited an improved activity compared to the intrinsic activity or activity before modification of the protein. For example, a polynucleotide encoding a specific protein may be introduced into a chromosome in a microorganism, or a vector including a polynucleotide encoding a specific protein may be introduced into the microorganism to exhibit its activity. In addition, "enhancement of activity" means that the activity is improved compared to the intrinsic activity or activity before modification of a specific protein possessed by the microorganism. The "intrinsic activity" refers to the activity of a specific protein originally possessed by the parent strain before the transformation when the trait of a microorganism is changed due to genetic variation caused by natural or artificial factors.
[75]
Specifically, the activity enhancement of the present application increases the intracellular copy number of the gene encoding the protein variant, a method of introducing a mutation into the expression control sequence of the gene encoding the protein variant, and the L-threonine excretion activity. A method of replacing a gene expression control sequence encoding a protein variant having a strong activity with a sequence, a method of replacing a gene encoding a native protein having L-threonine excretion activity on a chromosome with a gene encoding the protein variant Any one or more selected from the group consisting of a method for additionally introducing a mutation into a gene encoding a protein having L-threonine excretion activity to enhance the activity of the protein variant, and a method for introducing a protein variant into a microorganism method, but is not limited thereto.
[76]
In the above, the increase in the copy number of the gene is not particularly limited thereto, but may be performed in a form operably linked to a vector or inserted into a chromosome in a host cell. Specifically, a vector capable of replicating and functioning independently of a host to which a polynucleotide encoding the protein of the present application is operably linked may be introduced into a host cell. Alternatively, a vector capable of inserting the polynucleotide into a chromosome in the host cell, to which the polynucleotide is operably linked, may be introduced into the chromosome of the host cell. Insertion of the polynucleotide into a chromosome may be accomplished by any method known in the art, for example, by homologous recombination.
[77]
Next, modifying the expression control sequence to increase the expression of the polynucleotide, but is not particularly limited thereto, to further enhance the activity of the expression control sequence, deletion, insertion, non-conservative or conservative substitution of the nucleic acid sequence, or their It can be carried out by inducing a mutation in the sequence in combination, or by replacing it with a nucleic acid sequence having a stronger activity. The expression control sequence is not particularly limited thereto, but may include a promoter, an operator sequence, a sequence encoding a ribosome binding site, a sequence for regulating the termination of transcription and translation, and the like.
[78]
A strong promoter may be linked to the upper portion of the polynucleotide expression unit instead of the original promoter, but is not limited thereto. Examples of known strong promoters include cj1 to cj7 promoter (Korean Patent No. 10-0620092), lac promoter, trp promoter, trc promoter, tac promoter, lambda phage PR promoter, PL promoter, tet promoter, gapA promoter, SPL7 promoter , SPL13(sm3) promoter (Korean Patent No. 10-1783170), O2 promoter (Korean Patent No. 10-1632642), tkt promoter, and yccA promoter, but are not limited thereto.
[79]
In addition, the modification of the polynucleotide sequence on the chromosome is not particularly limited thereto, but a mutation in the expression control sequence by deletion, insertion, non-conservative or conservative substitution of a nucleic acid sequence or a combination thereof to further enhance the activity of the polynucleotide sequence. It can be carried out by inducing or replacing the polynucleotide sequence improved to have stronger activity.
[80]
Incorporation and enhancement of such protein activity is generally performed such that the activity or concentration of the corresponding protein is at least 1%, 10%, 25%, 50%, based on the activity or concentration of the protein in the wild-type or unmodified microbial strain; It may be increased by 75%, 100%, 150%, 200%, 300%, 400% or 500%, up to 1000% or 2000%, but is not limited thereto.
[81]
In the present application, the term "unmodified microorganism" does not exclude a strain containing a mutation that can occur naturally in a microorganism, it is a native strain itself, or a microorganism that does not include a variant of the L-threonine excreting protein, Or it refers to a microorganism that is not transformed with a vector containing a polynucleotide encoding a variant of the L-threonine excretion protein.
[82]
[83]
In the present application, the microorganism containing the L-threonine excretion protein variant or the polynucleotide encoding it may be a recombinant microorganism prepared by transformation with a vector containing the polynucleotide, but is not limited thereto. does not
[84]
As used herein, the term “transformation” refers to introducing a vector including a polynucleotide encoding a target protein into a host cell so that the protein encoded by the polynucleotide can be expressed in the host cell. The transformed polynucleotide may include all of them regardless of whether they are inserted into the chromosome of the host cell or located outside the chromosome, as long as they can be expressed in the host cell. In addition, the polynucleotide includes DNA and RNA encoding a target protein. The polynucleotide may be introduced into a host cell and expressed in any form, as long as it can be expressed. For example, the polynucleotide may be introduced into a host cell in the form of an expression cassette, which is a gene construct including all elements necessary for self-expression. The expression cassette may include a promoter, a transcription termination signal, a ribosome binding site, and a translation termination signal, which are usually operably linked to the polynucleotide. The expression cassette may be in the form of an expression vector capable of self-replication. In addition, the polynucleotide may be introduced into a host cell in its own form and operably linked to a sequence required for expression in the host cell, but is not limited thereto.
[85]
In addition, the term "operably linked" as used herein means that a promoter sequence that initiates and mediates transcription of a polynucleotide encoding a target polypeptide of the present application and the gene sequence are functionally linked.
[86]
[87]
As used herein, the term "microorganism that produces L-threonine" includes all microorganisms in which genetic modification has occurred, either naturally or artificially, and causes such as insertion of an external gene or enhanced or inactivated activity of an intrinsic gene. As a result, a specific mechanism is weakened or strengthened, and it may be a microorganism in which genetic mutation or activity is enhanced for the desired production of L-threonine. For the purpose of the present application, the microorganism producing the L-threonine includes the variant of the L-threonine excretion protein, and compares the desired L-threonine from a carbon source in the medium with a wild-type or unmodified microorganism. It may mean a microorganism that can produce in excess. In the present application, the "microorganism that produces L-threonine" may be used interchangeably with "a microorganism having L-threonine-producing ability" or "a microorganism that produces L-threonine".
[88]
The microorganism producing the L-threonine may be a recombinant microorganism. The recombinant microorganism is as described above.
[89]
The type of microorganism producing the L-threonine is not particularly limited as long as it can produce L-threonine, but specifically, Corynebacterium genus, Escherichia genus, Enterobacter ( Enterbacter ) genus, Erwinia genus, Serratia genus, Providencia genus , and Brevibacterium genus may be microorganisms belonging to the genus, more specifically, Corynebacterium ( It may be a microorganism belonging to the genus Corynebacterium or the genus Escherichia.
[90]
More specifically, Escherichia genus ( Escherichia ) The microorganism may be Escherichia coli , Corynebacterium , the genus microorganism is Corynebacterium glutamicum ( Corynebacterium glutamicum ), Corynebacterium Ammonia Genes ( Corynebacterium ammoniagenes ), Corynebacterium crudilactis ( Corynebacterium crudilactis ), Corynebacterium deserti ( Corynebacterium deserti ), Corynebacterium efficiens ( Corynebacterium efficiens ), Corynebacterium caluna ( Corynebacterium callunae ), Corynebacterium stationis ( Corynebacterium stationis ), Corynebacterium singulare ( Corynebacterium singulare ), Corynebacterium halotolerans (Corynebacterium halotolerans ), Corynebacterium striatum ), Corynebacterium pollutisoli , Corynebacterium imitans Cxorynebacterium imitans ), Corynebacterium testudinoris ) or Corynebacterium testudinoris ( Corynebacterium testudinoris ) Corynebacterium flavescens ( Corynebacterium flavescens ) and the like, may be Corynebacterium glutamicum ( Corynebacterium glutamicum ). Microorganisms belonging to the genus Corynebacterium or the genus Escherichia whose production can be increased may be included without limitation.
[91]
In the present application, the parent strain of a microorganism producing L-threonine modified to express the protein having the L-threonine excretion activity or the protein variant is not particularly limited as long as it is a microorganism that produces L-threonine. . In order to increase the production of L-threonine, the microorganism producing L-threonine enhances the biosynthesis pathway of L-threonine, releases feedback inhibition for L-threonine, or It may be a microorganism that inactivates a gene that weakens the biosynthetic pathway of L-threonine, increases the activity of the L-threonine operon, and/or confer resistance to an L-threonine analog.
[92]
Specifically, in order to enhance the biosynthetic pathway of L-threonine, for example, thrC encoding threonine synthetase, ppc gene encoding phosphoenol pyruvate carboxylase, glucose influx galP gene involved, lysC gene encoding lysine-sensitive aspartokinase 3, hom gene encoding homoserine dehydrogenase, or oxaloacetate pool increase The expression of the pyc gene and the like can be enhanced or increased in the microorganism.
[93]
In order to release the feedback inhibition for the L-threonine, for example, a lysC gene, a hom gene, or a thrA gene having a dual function of aspartokinase and homoserine dehydrogenase 1 (Bifunctional aspartokinase / homoserine dehydrogenase 1) Genetic mutations may be introduced into microorganisms, etc.
[94]
In order to inactivate a gene that weakens the biosynthetic pathway of L-threonine, for example, oxaloacetate (OAA), which is an intermediate for L-threonine biosynthesis, is converted to phosphoenol pyruvate (PEP) Expression of the pckA gene involved in lysC gene, the tyrR gene that suppresses the lysC gene, the galR gene that suppresses the expression of the galP gene involved in glucose uptake, or the mcbR gene that is a DNA-binding transcriptional dual regulator It can be weakened or inactivated within these microorganisms.
[95]
In order to increase the activity of the L-threonine operon, aspartokinase (aspartokinase), homoserine dehydrogenase (homoserine dehydrogenase), homoserine kinase (homoserine kinase) and threonine synthase (threonine synthase) By introducing a plasmid containing a threonine operon (Japanese Patent Laid-Open No. 2005-227977) composed of a gene encoding a threonine operon derived from E. coli or the like into a microorganism (TURBA E, et al, Agric. Biol. Chem) 53:2269~2271, 1989), may increase the expression of the threonine operon in microorganisms.
[96]
In addition, the microorganism may be resistant to α-amino-β-hydroxy valeric acid or D,L-threonine hydroxamate, which are L-threonine analogs.
[97]
However, the present invention is not limited thereto, and L-threonine production ability can be enhanced by a method for regulating gene expression known in the art.
[98]
In the present application, the term “enhancement/increase” is a concept that includes all those in which activity is increased compared to intrinsic activity.
[99]
This enhancement or increase in gene activity can be achieved by application of various methods well known in the art. Examples of the method include increasing the intracellular copy number of a gene; a method of introducing a mutation into an expression control sequence of a gene; a method of replacing a gene expression control sequence with a sequence with strong activity; a method of additionally introducing a mutation into the gene to enhance the activity of the gene; And it may consist of any one or more methods selected from the group consisting of a method of introducing a foreign gene into a microorganism, and may be achieved by a combination thereof, but is not particularly limited by the above example.
[100]
In the present application, the term "inactivation" is a concept that includes all of the activity is weakened or no activity compared to the intrinsic activity.
[101]
Inactivation of such gene activity can be achieved by application of various methods well known in the art. Examples of the method include a method of deleting all or part of a gene on a chromosome, including when the activity of the gene is removed; a method of replacing a gene encoding the protein on a chromosome with a gene mutated to reduce the activity of the protein; a method of introducing a mutation into an expression control sequence of a gene on a chromosome encoding the protein; a method of replacing the expression control sequence of the gene encoding the protein with a sequence with weak or no activity (eg, a method of replacing the promoter of the gene with a promoter weaker than the endogenous promoter); a method of deleting all or part of a gene on a chromosome encoding the protein; a method of introducing an antisense oligonucleotide (eg, antisense RNA) that complementarily binds to the transcriptome of a gene on the chromosome and inhibits translation from the mRNA into a protein; A method for making the attachment of ribosomes impossible by artificially adding a sequence complementary to the SD sequence to the front end of the SD sequence of the gene encoding the protein to form a secondary structure and ORF (open reading frame) of the sequence There is a reverse transcription engineering (RTE) method of adding a promoter so as to be reverse transcribed at the 3' end, and the like, which can also be achieved by a combination thereof, but is not particularly limited by the above example.
[102]
[103]
As another aspect of the present application, there is provided a method for producing L-threonine, comprising the step of culturing the microorganism producing the L-threonine in a medium.
[104]
The L-threonine, a protein having L-threonine excretion activity comprising the amino acid sequence of SEQ ID NO: 1, variants thereof, protein expression, and microorganisms are as described above.
[105]
As used herein, the term "cultivation" means growing the microorganism in an appropriately controlled environmental condition. The culture process of the present application may be made according to a suitable medium and culture conditions known in the art. Such a culturing process can be easily adjusted and used by those skilled in the art according to the selected strain. Specifically, the culture may be batch, continuous, and fed-batch, but is not limited thereto.
[106]
As used herein, the term "medium" refers to a material in which nutrients required for culturing the microorganism are mixed as a main component, and supplies nutrients and growth factors, including water, which are essential for survival and growth. Specifically, the medium and other culture conditions used for culturing the microorganism of the present application may be used without any particular limitation as long as it is a medium used for culturing conventional microorganisms. It can be cultured while controlling temperature, pH, etc. under aerobic conditions in a conventional medium containing compounds, amino acids and/or vitamins.
[107]
As the carbon source in the present application, carbohydrates such as glucose, fructose, sucrose, maltose; sugar alcohols such as mannitol and sorbitol; organic acids such as pyruvic acid, lactic acid, citric acid and the like; Amino acids such as glutamic acid, methionine, lysine, and the like may be included. In addition, natural organic nutrient sources such as starch hydrolyzate, molasses, blackstrap molasses, rice winter, cassava, sugar cane offal and corn steep liquor can be used, specifically glucose and sterilized pre-treated molasses (i.e., converted to reducing sugar). molasses) may be used, and other suitable carbon sources may be variously used without limitation. These carbon sources may be used alone or in combination of two or more, but is not limited thereto.
[108]
Examples of the nitrogen source include inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, anmonium carbonate, and ammonium nitrate; Amino acids such as glutamic acid, methionine, glutamine, and organic nitrogen sources such as peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquor, casein hydrolyzate, fish or its degradation products, defatted soybean cake or its degradation products can be used These nitrogen sources may be used alone or in combination of two or more, but is not limited thereto.
[109]
The phosphorus may include potassium first potassium phosphate, second potassium phosphate, or a sodium-containing salt corresponding thereto. As the inorganic compound, sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, calcium carbonate, etc. may be used, and in addition, amino acids, vitamins and/or suitable precursors may be included. These components or precursors may be added to the medium either batchwise or continuously. However, the present invention is not limited thereto.
[110]
In the present application, a compound such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, sulfuric acid and the like may be added to the medium in an appropriate manner during culturing of the microorganism to adjust the pH of the medium. In addition, during culturing, an antifoaming agent such as fatty acid polyglycol ester may be used to suppress bubble formation. In addition, in order to maintain the aerobic state of the medium, oxygen or oxygen-containing gas may be injected into the medium, or nitrogen, hydrogen or carbon dioxide gas may be injected without or without gas to maintain anaerobic and microaerobic conditions, and the present invention is limited thereto. it is not
[111]
The temperature of the medium may be 20 °C to 50 °C, specifically 30 °C to 37 °C, but is not limited thereto. The incubation period may be continued until a desired production amount of the useful substance is obtained, and specifically, it may be 10 hours to 100 hours, but is not limited thereto.
[112]
L-threonine produced by the culture may be discharged into the medium or may remain in the cell without being discharged.
[113]
The method for producing L-threonine may include recovering L-threonine from the cultured microorganism or medium.
[114]
The method for recovering L-threonine produced in the culturing step of the present application may be to collect the desired L-threonine from the culture medium using a suitable method known in the art according to the culture method. . For example, centrifugation, filtration, anion exchange chromatography, crystallization, HPLC, etc. may be used, and a desired L-threonine may be recovered from a medium or a microorganism using a suitable method known in the art.
[115]
In addition, the recovery step may include a purification process, and may be performed using a suitable method known in the art. Accordingly, the recovered L-threonine may be in a purified form or a microbial fermentation broth containing L-threonine (Introduction to Biotechnology and Genetic Engineering, AJ Nair., 2008).
[116]
Modes for carrying out the invention
[117]
Hereinafter, the present application will be described in more detail through examples. However, these examples are for illustrative purposes only, and the scope of the present application is not limited to these examples.
[118]
[119]
Example 1: L-threonine excretion protein mutation library and plasmid construction
[120]
[121]
In order to prepare a template for use in error-prone PCR, Escherichia coli W3110 genomic DNA was subjected to PCR with SEQ ID NO: 43 and SEQ ID NO: 44 to obtain a nucleotide sequence fragment.
[122]
[123]
SEQ ID NO: 43 (rhtC F)
[124]
GTCGACTCTAGAGGATCCCCGCTGATTCGTGCGCATGTTG
[125]
SEQ ID NO: 44 (rhtC R)
[126]
TGAATTCGAGCTCGGTACCCTCACCGCGAAATAATCAAAT
[127]
[128]
And pCL1920 (Nucleic Acids Rersearch, 18, (1990) 4631) digested with SmaI restriction enzyme and the obtained DNA fragment were cloned using the Gibson assembly method to obtain pCL1920-Pn_rhtC as a recombinant plasmid. Cloning was performed by mixing the Gibson assembly reagent and each gene fragment with the calculated mole number and then storing at 50° C. for 1 hour.
[129]
Error-prone PCR was performed for a random mutagenesis induction system on wild-type rhtC encoding an L-threonine excretion protein, and a diversify PCR random mutagenesis kit (Takara) was used for error-prone PCR. did. In order to select a mutation rate condition, error-inducing PCR was performed under the following two conditions according to the MnSO 4 concentration. The above-mentioned pCL1920-Pn_rhtC was used as a DNA template to introduce mutations. The composition of the composition for performing error-inducing PCR was shown in Table 1 below. Conditions were: denaturation at 95 °C for 30 seconds, denaturation at 95 °C for 30 seconds, annealing at 55 °C for 30 seconds, and polymerization at 68 °C for 30 seconds were repeated 25 times, followed by polymerization at 68 °C for 60 seconds. SEQ ID NOs: 43 and 44 were used as primers.
[130]
[131]
[Table 1]
case # 1 (ul) 2 (ul)
10X Titanium taq Buffer 5 5
MnSO4(8mM) 1 2
dGTP (2mM) 1 1
50 X dNTP Mix 1 1
Titanium Taq Polymerase 1 1
Forward primer(5pmol) 2 2
Reverse primer(5pmol) 2 2
Template DNA 1 1
dH 2 O 36 35
Total 50 50
[132]
[133]
A recombinant mutant plasmid library was obtained using the Gibson assembly method with DNA from which the template plasmid was removed by treatment with DpnI to the error-inducing PCR product performed under the conditions of Table 1 and pCL1920 digested with SmaI restriction enzyme. The mutant library obtained by the above method, pCL1920-Pn_rhtC and pCL1920, was transformed into Escherichia coli K12 cells, and plated on an LB plate medium containing 50 ug/L spectinomycin. 50 colonies were selected from K12 transformed with the mutation library and sequencing was performed to determine the mutation rate and the presence or absence of mutations at various locations. As a result of sequencing, the rate of occurrence of mutation in case #1 condition was 1.2 kb -1 , and in case #2 condition, 2.0 kb -1it was Cases #1 and #2 were judged to satisfy the mutation rate suitable for securing a mutant library, and thus effective mutation selection was performed using the library prepared under the above conditions. After dispensing 300 ul of M9 minimal media containing 60 g/L of L-Threonine in a 96 deep-well plate, the previously transformed K12/pCL1920-Pn_rhtC , K12/pCL1920, K12/mutant library colonies were inoculated. And after incubation at 1200 rpm/15 hr/37 ℃ condition, the OD was measured with a wavelength of 600 nm. Since the wild-type E. coli K12 strain generally shows growth inhibition around 30 g/L, which is the L-threonine MIC (Minimal Inhibition Concentration) concentration in the M9 medium, if the strain has dramatically improved threonine excretion ability, the L-threonine It was determined that it could grow at a concentration of 60 g/L of nin. In most mutant strain libraries, little growth was observed like the control strains (K12/pCL1920, K12/pCL1920-Pn_rhtC) in the deep well plate. In contrast, 4 strains in which growth was observed were selected and the OD was recorded.
[134]
[135]
[Table 2]
strain name FROM
K12 / pCL1920 0.15
K12/pCL1920-Pn_rhtC 0.16
K12/pCL1920-Pn_rhtC mutation library (3-1 C5) 1.41
K12/pCL1920-Pn_rhtC mutation library (3-2 D11) 2.60
K12/pCL1920-Pn_rhtC mutation library (3-4 E3) 2.46
K12/pCL1920-Pn_rhtC mutation library (3-4 G2) 2.57
[136]
[137]
After extracting the pCL1920-Pn_rhtC mutant plasmid from the four selected mutant strains, sequencing was performed to confirm the mutation, and it was confirmed that the mutation occurred in the coding sequence (CDS), not the promoter region. And the variant plasmids mentioned in Table 2 were named as pCL1920-Pn_rhtC(m1), pCL1920-Pn_rhtC(m2), pCL1920-Pn_rhtC(m3), and pCL1920-Pn_rhtC(m4) from above.
[138]
In order to compare and evaluate the activity of mutant rhtC in the Coryne strain, a plasmid for insertion was prepared by the following method.
[139]
For homologous recombination, the upstream and downstream regions of Ncgl2533 were amplified to SEQ ID NO: 45 and SEQ ID NO: 46, and SEQ ID NO: 51 and SEQ ID NO: 52, respectively. And in order to utilize the gapA promoter as a promoter of the mutant rhtC, PCR was performed using the genomic DNA of Corynebacterium glutamicum ATCC13032 as a template and the primers of SEQ ID NO: 47 and SEQ ID NO: 48. And in order to secure the fragment of the mutant rhtC selected in Table 2, each of rhtC, rhtC(m1), rhtC(m2), rhtC(m3), rhtC(m4) using the primers of SEQ ID NO: 49 and SEQ ID NO: 50 Fragments were obtained.
[140]
[141]
SEQ ID NO: 45 (Ncgl2533 up F)
[142]
TCGAGCTCGGTACCCCAGCAAGATCTAGTCATCAA
[143]
SEQ ID NO: 46 (Ncgl2533 up R)
[144]
GTCGTTTTTAGGCTTCCGCTGGAAAACATTTTGCA
[145]
SEQ ID NO: 47 (PgapA F)
[146]
AATGTTTTCCAGCGGAAGCCTAAAAACGACCGAGC
[147]
SEQ ID NO: 48 (PgapAR)
[148]
AAATAACATCAACATGTTGTGTCTCCTCTAAAGAT
[149]
SEQ ID NO: 49 (rhtC_m F)
[150]
TAGAGGAGACACAACATGTTGATGTTATTTCTCAC
[151]
SEQ ID NO: 50 (rhtC_m R)
[152]
TAAGCAGGTTGATTTTCACCGCGAAATAATCAAAT
[153]
SEQ ID NO: 51 (Ncgl2533 dn F)
[154]
ATTATTTCGCGGTGAAAATCAACCTGCTTAGGCGT
[155]
SEQ ID NO: 52 (Ncgl2533 dn R)
[156]
CTCTAGAGGATCCCCTATAGCTACCATCTGGGTGG
[157]
[158]
The PCR fragments obtained in the above process and the vector pDZ for chromosome transformation cut with SmaI restriction enzyme were cloned using the Gibson assembly method to obtain 5 wild-type and mutant rhtC recombinant plasmids. Cloning was performed by mixing the Gibson assembly reagent and each gene fragment with the calculated mole number and then storing at 50° C. for 1 hour. The constructed plasmids were named pDZ-PgapA_rhtC, pDZ-PgapA_rhtC(m1), pDZ-PgapA_rhtC(m2), pDZ-PgapA_rhtC(m3), and pDZ-PgapA_rhtC(m4), respectively.
[159]
[160]
Example 2: Production of L-threonine-producing strain
[161]
[162]
2-1: mutant lysine-sensitive aspartokinase 3 (LysC) transformation
[163]
Mutations to enhance expression of lysC gene, which is lysine-sensitive aspartokinase 3, and to cancel feedback inhibition for L-lysine and L-threonine ( L377K) trait (Korean Patent Application Laid-Open No. 10-2019-0003019) was introduced. Specifically, the upstream region of the lysC promoter where homologous recombination occurs on the chromosome and the 377 mutation downstream region of lysC were obtained, and Corynebacterium glutamicum ATCC13032 Using the genomic DNA of SEQ ID NO: 3 and SEQ ID NO: 4 using the primers of the lysC promoter upstream region, and using the primers of SEQ ID NO: 9 and SEQ ID NO: 10, the 377 mutation downstream of lysC (Downstream) Gene fragments of the region were obtained by PCR.
[164]
[165]
SEQ ID NO: 3 (lysC promoter Up 1)
[166]
TCGAGCTCGGTACCCGACAGGACAAGCACTGGTTG
[167]
SEQ ID NO: 4 (lysC promoter Up 2)
[168]
AGTAGCGCTGGGATGTTTCTCTTTGTGCACCTTTC
[169]
SEQ ID NO: 9 (lysC Down 1)
[170]
GAACATCGAAAAGATTTCCACCTCTGAGAT
[171]
SEQ ID NO: 10 (lysC Down 2)
[172]
CTCTAGAGGATCCCCGTTCACCTCAGAGACGATTA
[173]
[174]
And using the pECCG117-Pcj7-GFP (Korean Patent Registration No. 10-0620092) plasmid as a template, a Pcj7 promoter fragment was obtained by PCR using the primers of SEQ ID NO: 5 and SEQ ID NO: 6.
[175]
[176]
SEQ ID NO: 5 (Pcj7 1)
[177]
GAAAGGTGCACAAAGAGAAACATCCCAGCGCTACT
[178]
SEQ ID NO: 6 (Pcj7 2)
[179]
TACGACCAGGGCCATGAGTGTTTCCTTTCGTTGGG
[180]
[181]
Corynebacterium glutamicum ( Corynebacterium glutamicum ) Using the genomic DNA of ATCC13032 as a template and primers of SEQ ID NO: 7 and SEQ ID NO: 8, a gene fragment of the lysC L377K mutation upstream region was obtained by PCR.
[182]
[183]
SEQ ID NO: 7 (lysC 1)
[184]
CGAAAGGAAACACTCATGGCCCTGGTCGTACAGAA
[185]
SEQ ID NO: 8 (lysC 2)
[186]
GGTGGAAATCTTTTCGATGTTCACGTTGAC
[187]
[188]
For the PCR reaction, the polymerase SolgTM Pfu-X DNA polymerase was used and the conditions were: denaturation at 95°C for 5 minutes, denaturation at 95°C for 30 seconds, annealing at 60°C for 30 seconds, and polymerization at 72°C for 60 seconds 30 times. After repeating, polymerization was performed at 72° C. for 5 minutes.
[189]
The four PCR fragments obtained by the above process and the vector pDZ for chromosomal transformation cut with SmaI restriction enzyme (Korean Patent No. 10-1126041) were prepared by Gibson assembly (DG Gibson et al., NATURE METHODS, VOL.6 NO). .5, MAY 2009, NEBuilder HiFi DNA Assembly Master Mix) was obtained by cloning using the method, a recombinant plasmid was obtained, and named pDZ-Pcj7_lysC L377K. Cloning was performed by mixing the Gibson assembly reagent and each gene fragment with the calculated mole number and then storing at 50° C. for 1 hour.
[190]
After transforming the prepared pDZ-Pcj7_lysC L377K vector into the wild-type Corynebacterium glutamicum ATCC13032 strain by electroporation (Appl. Microbiol. Biotechnol. (1999) 52:541-545), the chromosomes undergo a secondary crossover process. A strain in which the wild-type lysC gene was replaced with the mutant Pcj7_lysC L377K gene was obtained. The genetic manipulation was confirmed by PCR and genome sequencing using the primers of SEQ ID NO: 11 and SEQ ID NO: 12 that can amplify the external regions of the upstream region and the downstream region of the homologous recombination into which the gene is inserted, respectively.
[191]
[192]
SEQ ID NO: 11 (confirm lysC1)
[193]
ACATTCCACCCATTACTGCA
[194]
SEQ ID NO: 12 (confirm lysC 2)
[195]
TCTTCATCGGTTTCGAAGGT
[196]
[197]
The obtained transformed strain was named Cgl-TH-1.
[198]
[199]
2-2: Transformation of mutant homoserine dehydrogenase (Hom)
[200]
In order to release the regulation of mcbR, a DNA-binding transcriptional dual regulator, and increase the expression level of hom, a homoserine dehydrogenase, the hom promoter was replaced with the Pcj7 promoter. Additionally, mutations (G378E, R398Q) for canceling feedback inhibition of hom for L-threonine were applied to Cgl-TH-1 to increase L-threonine production. For the above mutant hom transformation, pDZ-Pcj7_hom (G378E, R398Q) was prepared. To replace the Pcj7 promoter with the hom promoter, a region upstream of the hom promoter in which homologous recombination occurs was obtained. Specifically, using the genomic DNA of Corynebacterium glutamicum ATCC13032 as a template and primers of SEQ ID NO: 14 and SEQ ID NO: 55, a fragment of the upstream region of the hom promoter was obtained by PCR.
[201]
[202]
SEQ ID NO: 14 (up F)
[203]
TCGAGCTCGGTACCCTGTCTCCGTATGCAGTGAGC
[204]
SEQ ID NO: 55 (up R)
[205]
GGATGTTTCTTTGGAGCTTCGCTCAATCAT
[206]
[207]
A Pcj7 promoter fragment was obtained by PCR using the primers of SEQ ID NO: 13 and SEQ ID NO: 56 using the pECCG117-Pcj7-GFP (Korean Patent Registration No. 10-0620092) plasmid as a template.
[208]
[209]
SEQ ID NO: 13 (cj7 F)
[210]
GAAGCTCCAAAGAAACATCCCAGCGCTACT
[211]
SEQ ID NO: 56 (cj7 R)
[212]
AGATGCTGAGGTCATGATTGTTCTCCTATAATCGC
[213]
[214]
And in order to apply hom mutations (G378E, R398Q), the top sequence of the hom amino acids 1 to 378 coding sequence and the sequence including the G378E/R398Q mutation and the bottom sequence of R398Q were obtained by the following method.
[215]
Specifically, PCR was performed using the primers of SEQ ID NO: 17 and SEQ ID NO: 18 using the genomic DNA of Corynebacterium glutamicum ATCC13032 as a template, and a fragment of the hom amino acid 1 to 378 coding sequence was obtained. . In the same way, PCR was performed using the genomic DNA of Corynebacterium glutamicum ATCC13032 as a template and primers of SEQ ID NO: 15 and SEQ ID NO: 20 to obtain a sequence fragment including hom G378E/R398Q mutation. Then, PCR was performed using the primers of SEQ ID NO: 19 and SEQ ID NO: 21 using the genomic DNA of Corynebacterium glutamicum ATCC13032 as a template, and the lower sequence fragment of hom R398Q in which homologous recombination occurred was obtained.
[216]
[217]
SEQ ID NO: 17 (hom F)
[218]
TATAGGAGAACAATCATGACCTCAGCATCTGCCCC
[219]
SEQ ID NO: 18 (G378E R)
[220]
GCCAAAACCTCCACGCGATCTT
[221]
SEQ ID NO: 15 (G378E F)
[222]
AAGATCGCGTGGAGGTTTTGGC
[223]
SEQ ID NO: 20 (R398Q R)
[224]
GCGCTCTTCCTGTTGGATTGTACGC
[225]
SEQ ID NO: 19 (R398Q F)
[226]
GCGTACAATCCAACAGGAAGAGCGC
[227]
SEQ ID NO: 21 (hom R)
[228]
CTCTAGAGGATCCCCGACTGCGGAATGTTGTTGTG
[229]
[230]
A recombinant plasmid was obtained by cloning the 5 PCR fragments obtained through the above process and the vector pDZ for chromosome transformation cut with SmaI restriction enzyme using the Gibson assembly method, and it was named pDZ-Pcj7_hom (G378E, R398Q). Cloning was performed by mixing the Gibson assembly reagent and each gene fragment with the calculated mole number and then storing at 50° C. for 1 hour.
[231]
After transforming the prepared pDZ-Pcj7_hom (G378E, R398Q) vector into the Cgl-TH-1 strain by electroporation, the wild-type hom gene is replaced with the mutant Pcj7_hom (G378E, R398Q) gene on the chromosome through a secondary crossover process strains were obtained. The genetic manipulation was confirmed through PCR and genome sequencing using the primers of SEQ ID NO: 22 and SEQ ID NO: 23 that can amplify the external regions of the upstream region and the downstream region of the homologous recombination into which the gene is inserted, respectively.
[232]
[233]
SEQ ID NO: 22 (hom conf F)
[234]
TGGGTAGGTCGAGTTGTTAA
[235]
SEQ ID NO:23 (hom conf R)
[236]
CAGCGCAGTCGCACGAATAT
[237]
[238]
The obtained transformed strain was named Cgl-TH-2.
[239]
[240]
2-3: Application of mutations to enhance expression of pyruvate carboxylase (Pyc)
[241]
To enhance L-threonine production by increasing the oxaloacetate pool, it was attempted to increase the expression of the pyc gene, a pyruvate carboxylase. To enhance pyc expression, the promoter of the pyc gene was replaced with the Pcj7 promoter. A Pcj7 promoter fragment was obtained by PCR using the primers of SEQ ID NO: 24 and SEQ ID NO: 16 using the pECCG117-Pcj7-GFP (Korean Patent Registration No. 10-0620092) plasmid as a template.
[242]
[243]
SEQ ID NO: 24 (CJ7 F)
[244]
CAACCTTTGCAAGGTGAAAAAGAAACATCCCAGCGCTACT
[245]
SEQ ID NO: 16 (CJ7 R)
[246]
TGTGTGAGTCGACATGAGTGTTTCCTTTCGTTGGG
[247]
[248]
A region upstream of the pyc promoter in which homologous recombination occurs to replace the Pcj7 promoter with the pyc promoter was obtained. Specifically, using the genomic DNA of Corynebacterium glutamicum ATCC13032 as a template and primers of SEQ ID NO: 25 and SEQ ID NO: 26, a fragment of the pyc promoter upstream region was obtained by PCR.
[249]
[250]
SEQ ID NO: 25 (upstream F)
[251]
TCGAGCTCGGTACCCTGACAGTTGCTGATCTGGCT
[252]
SEQ ID NO: 26 (upstream R)
[253]
AGTAGCGCTGGGATGTTTCTTTTTCACCTTGCAAAGGTTG
[254]
[255]
In order to obtain the N-terminal (N-term) of the pyc coding sequence to be used as a homologous region below the Pcj7 promoter, Corynebacterium glutamicum genomic DNA of ATCC13032 was used as a template with SEQ ID NO: 27 and the sequence PCR was performed using the primer of No. 28 and a fragment at the bottom of the pyc promoter was obtained.
[256]
[257]
SEQ ID NO: 27 (pyc F)
[258]
GGAATAATTACTCTAATGTCGACTCACACATCTTC
[259]
SEQ ID NO: 28 (pyc R)
[260]
CTCTAGAGGATCCCCGGCATTTTCAGACAGGAAGC
[261]
[262]
A recombinant plasmid was obtained by cloning the three kinds of PCR fragments obtained through the above process and the vector pDZ for chromosome transformation cut with SmaI restriction enzyme using the Gibson assembly method, and was named pDZ-Pcj7_pyc. Cloning was performed by mixing the Gibson assembly reagent and each gene fragment with the calculated mole number and then storing at 50° C. for 1 hour.
[263]
After transforming the prepared pDZ-Pcj7_pyc vector into the Cgl-TH-2 strain by electroporation, a strain in which the wild-type pyc promoter was replaced with the mutant Pcj7_pyc gene on the chromosome was obtained through a secondary crossover process. The genetic manipulation was confirmed through PCR and genome sequencing using the primers of SEQ ID NO: 29 and SEQ ID NO: 30 that can amplify the external regions of the upstream region and the downstream region of the homologous recombination into which the gene is inserted, respectively.
[264]
[265]
SEQ ID NO: 29 (pyc conf F)
[266]
ACGCACTCGGTGAAGGCGTG
[267]
SEQ ID NO: 30 (pyc conf R)
[268]
CGCTTCAGCTTCACGAGATG
[269]
[270]
The obtained transformed strain was named Cgl-TH-3.
[271]
[272]
2-4: mutant L-threonine operon, Ncgl0179 deletion and 1 copy insertion of aspartokinase and homoserine dehydrogenase 1 protein (ThrA(S352P)BC) 1 copy
[273]
To enhance L-threonine biosynthesis, E. coli-derived L-threonine operon was intended to be applied. In particular, the thrA gene having a dual function of aspartokinase and homoserine dehydrogenase 1 (Bifunctional aspartokinase / homoserine dehydrogenase 1) is thrA(S352P) (J Bacteriol. 1993 Feb. ;175(4):959-65) mutation was applied. And it was attempted to increase the expression of the L-threonine operon using the SPL7 promoter (Korean Patent Registration No. 10-1783170).
[274]
And in order to insert the SPL7_thrA(S352P)BC into the Ncgl0179 position, the genomic DNA of Corynebacterium glutamicum ATCC13032 was used as a template, and Ncgl0179 upper and lower homologous region fragments were respectively SEQ ID NO: 31 and The nucleotide sequences were amplified with SEQ ID NO: 32, SEQ ID NO: 37 and SEQ ID NO: 38. Then, SPL7 was amplified with SEQ ID NO: 33 and SEQ ID NO: 34 using the synthesized SPL7 promoter as a template.
[275]
The nucleotide sequence at the top of the thrA (S352P) amino acid 352 coordinate sequence was SEQ ID NO: 35 and SEQ ID NO: 36, and thrA (S352P) amino acid bottom 352 and thrBC were amplified with SEQ ID NO: 39 and SEQ ID NO: 40.
[276]
[277]
SEQ ID NO: 31 (Ncgl0179 UP F)
[278]
TCGAGCTCGGTACCCTTTTGAGTAATTGGTAATAC
[279]
SEQ ID NO: 32 (Ncgl0179 UP R)
[280]
TGAAGCGCCGGTACCCGCTTAAACGGGCGATTAT
[281]
SEQ ID NO: 37 (Ncgl0179 DOWN F)
[282]
ATGAATCATCAGTAATTAATGGCCCTCGATTTGGC
[283]
SEQ ID NO: 38 (Ncgl0179 DOWN R)
[284]
TCTAGAGGATCCCCTGGAATAATCAGACTCTGGA
[285]
SEQ ID NO: 33 (SPL7 F)
[286]
ATCGCCCGTTTAAGCGGGTACCGGCGCTTCATGT
[287]
SEQ ID NO: 34 (SPL7 R)
[288]
CTTCAACACTCGCATGATATCTGTTTTGATCTCCT
[289]
SEQ ID NO: 35 (S352P UP F)
[290]
ATCAAAACAGATATCATGCGAGTGTTGAAGTTCGG
[291]
SEQ ID NO: 36 (S352P UP R)
[292]
TACTGTATTCGGAAGATGGTTGCGTAATCAGCACCAC
[293]
SEQ ID NO: 39 (S352P DOWN F)
[294]
GTGGTGCTGATTACGCAACCATCTTCCGAATACAGTA
[295]
SEQ ID NO: 40 (S352P DOWN R)
[296]
AAATCGAGGGCCATTAATTACTGATGATTCATCATC
[297]
[298]
A recombinant plasmid was obtained by cloning the 5 PCR fragments obtained through the above process and the vector pDZ for chromosome transformation cut with SmaI restriction enzyme using the Gibson assembly method, and it was named pDZ-SPL7_thrA(S352P)BC. Cloning was performed by mixing the Gibson assembly reagent and each gene fragment with the calculated mole number and then storing at 50° C. for 1 hour.
[299]
The prepared pDZ-SPL7_thrA(S352P)BC vector was transformed into the Cgl-TH-3 strain by electroporation, and then a strain in which the SPL7_thrA(S352P)BC operon was inserted on the chromosome was obtained through a secondary crossover process. The genetic manipulation was confirmed through PCR and genome sequencing using primers of SEQ ID NO: 41 and SEQ ID NO: 42 that can amplify the external regions of the upstream region and the downstream region of the homologous recombination into which the gene is inserted, respectively.
[300]
[301]
SEQ ID NO: 41 (thr conf F)
[302]
GATTCACATCACCAATGTC
[303]
SEQ ID NO: 42 (thr conf R)
[304]
GACACCATCGCAGCCCGAC
[305]
[306]
The obtained transformant strain was named Cgl-TH-4.
[307]
[308]
The strain, Cgl-TH-4, was named CJ09-5010, and as of May 31, 2019, it was internationally deposited with the Korea Center for Conservation of Microorganisms (KCCM), an international depository under the Budapest Treaty, and was given an accession number as KCCM12537P.
[309]
[310]
2-5: L-threonine production of Corynebacterium strain introduced with variant L-threonine excretion protein (RhtC)
[311]
The pDZ-PgapA_rhtC, pDZ-PgapA_rhtC(m1), pDZ-PgapA_rhtC(m2), pDZ-PgapA_rhtC(m3), pDZ-PgapA_rhtC(m4) vectors constructed in Example 1 were applied to the Cgl-TH-4 strain, respectively. After transformation into , each strain in which four wild-type rhtC and mutant rhtC genes were inserted on the chromosome was obtained through a secondary crossover process. The genetic manipulation was confirmed through PCR and genome sequencing using the primers of SEQ ID NO: 53 and SEQ ID NO: 54 that can amplify the external regions of the upstream region and the downstream region of the homologous recombination into which the gene is inserted, respectively.
[312]
[313]
SEQ ID NO: 53 (HR outside F)
[314]
AAGGAATATCCCGGAGAACC
[315]
SEQ ID NO: 54 (HR outside R)
[316]
TTGCGTTTGAAAAGCCCTCG
[317]
[318]
The obtained transformed strains were named Cgl-TH-5, Cgl-TH-5(m1), Cgl-TH-5(m2), Cgl-TH-5(m3), and Cgl-TH-5(m4), respectively. did.
[319]
[320]
Additionally, in order to confirm the effect of introducing the mutant rhtC in the Corynebacterium strain, the prepared Cgl-TH-5, Cgl-TH-5(m1), Cgl-TH-5(m2), Cgl-TH-5( m3) and Cgl-TH-5(m4) strains were cultured in the following way to compare the production of L-threonine. Seed medium (glucose 20 g, peptone 10 g, yeast extract 5 g, urea 1.5 g, KH 2 PO 4 4 g, K 2 HPO 4 8 g, MgSO 4 7H 2 O 0.5 g, biotin 100 ug, thiamine HCl 1000 ug, Each strain was inoculated into a 250 ml corner-baffle flask containing 25 ml of calcium-pantothenic acid 2000 ug, nicotinamide 2000 ug, pH 7.0 (based on 1 liter of distilled water), and cultured with shaking at 30 ° C. for 20 hours at 200 rpm. did Then, production medium (glucose 70 g, (NH 4 )2SO 4 15 g, MgSO 4 7H 2 O 1.2 g, KH 2 PO 41 g, yeast extract 5 g, biotin 900 ug, thiamine hydrochloride 4500 ug, calcium-pantothenic acid 4500 ug, CaCO 3 30 g, pH 7.0 (based on 1 liter of distilled water)) 25 ml in a 250 ml corner-baffle flask ml of the seed culture medium was inoculated and cultured with shaking at 30 °C for 24 hours at 200 rpm. After completion of the culture, the production of L-threonine was measured by HPLC, and the results are shown in Table 3.
[321]
[322]
[Table 3]
strain name L-threonine production (g/L) L-threonine yield (*100 g/g, %)
Cgl-TH-4 11.1 15.9
Cgl-TH-5 14.0 20.0
Cgl-TH-5(m1) 17.9 25.6
Cgl-TH-5(m2) 24.0 34.3
Cgl-TH-5(m3) 21.8 31.1
Cgl-TH-5(m4) 17.9 25.6
[323]
[324]
As shown in Table 3, Cgl-TH-4 prepared by the method of Example 2-4 showed an L-threonine production result of 11.1 g/L, and Cgl-TH-5 into which the PgapA_rhtC wild-type trait was inserted was 14.0 g/L of L-threonine was produced. And 17.9 g of Cgl-TH-5(m1), Cgl-TH-5(m2), Cgl-TH-5(m3), and Cgl-TH-5(m4) inserted with the PgapA_rhtC(m) mutant trait, respectively. /L, 24.0 g/L, 21.8 g/L, and 17.9 g/L of L-threonine were produced. As for the yield of L-threonine fermentation, Cgl-TH-5 increased by 4.1%p compared to Cgl-TH-4, whereas Cgl-TH-5(m1), Cgl-TH-5(m2), Cgl-TH-5(m2), Cgl-TH-5(m3) and Cgl-TH-5(m4) strains showed 9.7%p, 18.4%p, 15.3%p, and 9.7%p increases compared to Cgl-TH-4, respectively. In particular, Cgl-TH-5(m2) and Cgl-TH-5(m3) showed about 4 times greater yield increase than that of Cgl-TH-5. The mutant RhtC applied to Cgl-TH-5 (m2) had the amino acid sequence of SEQ ID NO: 94 and specifically included a mutation (L62S) in which leucine (Leu) at amino acid position 62 was changed to serine (Ser). . And the mutant RhtC applied to Cgl-TH-5(m3) has the amino acid sequence of SEQ ID NO: 93, specifically, a mutation (A53T) in which alanine (Ala) at amino acid position 53 is transformed into threonine (Thr). was included
[325]
The two strains, Cgl-TH-5(m2) and Cgl-TH-5(m3), were named CA09-5012 and CA09-5036, respectively. After making an international deposit to the Center (KCCM), they were given deposit numbers as KCCM12538P and KCCM12539P.
[326]
[327]
Example 3: L-threonine production of E. coli strain introduced with mutant L-threonine excretion protein
[328]
[329]
Transformation of pCL1920-Pn_rhtC prepared in Example 1, four selected mutant plasmids and empty vector pCL1920, respectively, into TF4076 (KFCC10718, Korean Patent Application No. 90-22965), an E. coli strain having L-threonine-producing ability. Conversion to construct TF4076/pCL1920, TF4076/pCL1920-Pn_rhtC, TF4076/pCL1920-Pn_rhtC(m1), TF4076/pCL1920-Pn_rhtC(m2), TF4076/pCL1920-Pn_rhtC(m3), TF4076/pCL1920-Pn_rhtC(m3), TF4076 strains did. Flask evaluation was performed to compare the production of L-threonine of the produced strains. In the flask test, each strain was streaked on an LB plate to which 50 ug/ml of spectinomycin was added, and incubated for 16 hours in an incubator at 33 ° C., a single colony was inoculated into 2 ml of LB medium. Then, it was incubated for 12 hours in an incubator at 200 rpm/33 °C. Then, 25 ml of an L-threonine production flask medium having a composition according to Table 4 was put into a 250 ml flask, and 500 ul of the previously cultured medium was added. Thereafter, the flask was cultured for 48 hours at 200 rpm/33° C. in an incubator, and the amount of L-threonine obtained from each strain was compared using HPLC, and the results are shown in Table 5.
[330]
[331]
[Table 4]
Furtherance Content (per liter)
glucose 70 g
Ammonium sulfate 25 g
KH 2 PO 4 1 g
MgSO 4 7H 2 O 0.5 g
FeSO47H2O 5 mg
MnSO48H2O 5 mg
ZnSO 4 5 mg
calcium carbonate 30 g
yeast extract 2 g
methionine 0.15 g
pH 6.8
[332]
[Table 5]
strain name L-threonine production L-threonine yield
(g/L) (*100 g/g, %)
TF4076 25.7 36.7
TF4076/pCL1920 25.9 37.0
TF4076/pCL1920-Pn_rhtC 29.9 42.6
TF4076/pCL1920-Pn_rhtC(m1) 33.4 47.7
TF4076/pCL1920-Pn_rhtC(m2) 40.4 57.7
TF4076/pCL1920-Pn_rhtC(m3) 38.8 55.4
TF4076/pCL1920-Pn_rhtC(m4) 33.8 48.3
[333]
[334]
As shown in Table 5, when the mutant rhtC plasmid was introduced into an E. coli strain having L-threonine-producing ability, the yield of L-threonine was significantly increased. In particular, when pCL1920-Pn_rhtC(m2) and pCL1920-Pn_rhtC(m3) were applied, the L-threonine yield was significantly increased.
[335]
[336]
Example 4: Saturated mutagenesis of leucine, amino acid 62 of L-threonine excretion protein
[337]
[338]
As mentioned in Tables 3 and 5, the mutant form of rhtC(L62S) showed a higher yield synergistic effect than the wild type, and mutated leucine, the 62nd amino acid of RhtC, into another amino acid to improve the release of L-threonine at position 62 It was intended to verify the validity. In order to mutate leucine into 19 amino acids other than leucine, site-directed mutagenesis was performed using the pDZ-PgapA_rhtC prepared in Example 1 as a template as follows.
[339]
[340]
[Table 6]
Furtherance content (ul)
10X pfu-X Buffer 5
10mM dNTP Mix 1
pfu-X Polymerase 1
Mutagenic forward primer(5pmol) 2
Mutagenic reverse primer(5pmol) 2
pDZ-PgapA_rhtC(template DNA, 200 ng/ul) 1
dH 2 O 38
Total 50
[341]
[Table 7]
number of cycles temperature time
1 time 95℃ 5 min
Episode 18 95℃ 30 sec
60℃ 1 min
68℃ 10 min
[342]
[343]
In order to replace RhtC No. 62 leucine (L) with another amino acid, a PCR composition as shown in Table 6 was prepared and PCR was performed under the conditions of Table 7. When PCR was performed, the mutagenic primer set of Table 8 was used. After PCR was completed, 1 ul of DpnI restriction enzyme was added, and then treated at 37 °C for 1 hour. 3ul of DpnI-treated DNA was transformed into DH5a competent cells to obtain a pDZ-PgapA_rhtC mutant plasmid, and it was confirmed through sequencing that it was replaced with each mutation shown in Table 8.
[344]
[345]
[Table 8]
variant rhtC plasmid SEQ ID NO # base sequence
pDZ-PgapA_rhtC L62R SEQ ID NO: 57 GCGCTGCTTGGCCTGCATCGTATTATCGAAAAAATGGCC
SEQ ID NO: 58 GGCCATTTTTTCGATAATACGATGCAGGCCAAGCAGCGC
pDZ-PgapA_rhtC L62A SEQ ID NO: 59 GCGCTGCTTGGCCTGCATGCGATTATCGAAAAAATGGCC
SEQ ID NO: 60 GGCCATTTTTTCGATAATCGCATGCAGGCCAAGCAGCGC
pDZ-PgapA_rhtC L62D SEQ ID NO: 61 GCGCTGCTTGGCCTGCATGACATTATCGAAAAAATGGCC
SEQ ID NO: 62 GGCCATTTTTTCGATAATGTCATGCAGGCCAAGCAGCGC
pDZ-PgapA_rhtC L62K SEQ ID NO: 63 GCGCTGCTTGGCCTGCATAAAATTATCGAAAAAATGGCC
SEQ ID NO: 64 GGCCATTTTTTCGATAATTTTATGCAGGCCAAGCAGCGC
pDZ-PgapA_rhtC L62P SEQ ID NO: 65 GCGCTGCTTGGCCTGCATCCGATTATCGAAAAAATGGCC
SEQ ID NO: 66 GGCCATTTTTTCGATAATCGGATGCAGGCCAAGCAGCGC
pDZ-PgapA_rhtC L62C SEQ ID NO: 67 GCGCTGCTTGGCCTGCATTGCATTATCGAAAAAATGGCC
SEQ ID NO: 68 GGCCATTTTTTCGATAATGCAATGCAGGCCAAGCAGCGC
pDZ-PgapA_rhtC L62G SEQ ID NO: 69 GCGCTGCTTGGCCTGCATGGCATTATCGAAAAAATGGCC
SEQ ID NO: 70 GGCCATTTTTTCGATAATGCCATGCAGGCCAAGCAGCGC
pDZ-PgapA_rhtC L62T SEQ ID NO: 71 GCGCTGCTTGGCCTGCATACGATTATCGAAAAAATGGCC
SEQ ID NO: 72 GGCCATTTTTTCGATAATCGTATGCAGGCCAAGCAGCGC
pDZ-PgapA_rhtC L62I SEQ ID NO: 73 GCGCTGCTTGGCCTGCATATTATTATCGAAAAAATGGCC
SEQ ID NO: 74 GGCCATTTTTTCGATAATATATGCAGGCCAAGCAGCGC
pDZ-PgapA_rhtC L62Y SEQ ID NO: 75 GCGCTGCTTGGCCTGCATTATATTATCGAAAAAATGGCC
SEQ ID NO: 76 GGCCATTTTTTCGATAATATAATGCAGGCCAAGCAGCGC
pDZ-PgapA_rhtC L62V SEQ ID NO: 77 GCGCTGCTTGGCCTGCATGTGATTATCGAAAAAATGGCC
SEQ ID NO: 78 GGCCATTTTTTCGATAATCACATGCAGGCCAAGCAGCGC
pDZ-PgapA_rhtC L62H SEQ ID NO: 79 GCGCTGCTTGGCCTGCATCATATTATCGAAAAAATGGCC
SEQ ID NO: 80 GGCCATTTTTTCGATAATATGATGCAGGCCAAGCAGCGC
pDZ-PgapA_rhtC L62F SEQ ID NO: 81 GCGCTGCTTGGCCTGCATTTCATTATCGAAAAAATGGCC
SEQ ID NO: 82 GGCCATTTTTTCGATAATGAAATGCAGGCCAAGCAGCGC
pDZ-PgapA_rhtC L62M SEQ ID NO:83 GCGCTGCTTGGCCTGCATATGATTATCGAAAAAATGGCC
SEQ ID NO: 84 GGCCATTTTTTCGATAATCATATGCAGGCCAAGCAGCGC
pDZ-PgapA_rhtC L62Q SEQ ID NO: 85 GCGCTGCTTGGCCTGCATCAGATTATCGAAAAAATGGCC
SEQ ID NO: 86 GGCCATTTTTTCGATAATCTGATGCAGGCCAAGCAGCGC
pDZ-PgapA_rhtC L62N SEQ ID NO: 87 GCGCTGCTTGGCCTGCATAACATTATCGAAAAAATGGCC
SEQ ID NO: 88 GGCCATTTTTTCGATAATGTTATGCAGGCCAAGCAGCGC
pDZ-PgapA_rhtC L62E SEQ ID NO: 89 GCGCTGCTTGGCCTGCATGAAATTATCGAAAAAATGGCC
SEQ ID NO: 90 GGCCATTTTTTCGATAATTTCATGCAGGCCAAGCAGCGC
pDZ-PgapA_rhtC L62W SEQ ID NO: 91 GCGCTGCTTGGCCTGCATTGGATTATCGAAAAAATGGCC
SEQ ID NO: 92 GGCCATTTTTTCGATAATCCAATGCAGGCCAAGCAGCGC
[346]
[347]
The pDZ-PgapA_rhtC L62R, pDZ-PgapA_rhtC L62A, pDZ-PgapA_rhtC L62D, pDZ-PgapA_rhtC L62K, pDZ-PgapA_rhtC L62P, pDZ-PgapA_rhtC L62P, pDZ-PgapA_rhtC L62A, pDZ-PgapA_rhtC L62I, pDZ-PgapA_rhtC L62Y, pDZ-PgapA_rhtC L62V, pDZ-PgapA_rhtC L62H, pDZ-PgapA_rhtC L62F, pDZ-PgapA_rhtC L62M, pDZ-PgapA_rhtC L62Q, pDZ-PgapA_rhtC L62N, pDZ-PgapA_rhtC L62E, pDZ-PgapA_rhtC L62W 벡터를 실시예 After transformation of each Cgl-TH-4 strain by electroporation in the method of 2-5, 19 strains in which the mutant rhtC gene was inserted into the chromosome were obtained through a secondary crossover process. The genetic manipulation was confirmed through PCR and genome sequencing using the primers of SEQ ID NO: 53 and SEQ ID NO: 54 that can amplify the external regions of the upstream region and the downstream region of the homologous recombination into which the gene is inserted, respectively.
[348]
[349]
SEQ ID NO: 53 (HR outside F)
[350]
AAGGAATATCCCGGAGAACC
[351]
SEQ ID NO: 54 (HR outside R)
[352]
TTGCGTTTGAAAAGCCCTCG
[353]
[354]
The obtained transformed strains were respectively Cgl-TH-5 (L62R), Cgl-TH-5 (L62A), Cgl-TH-5 (L62D), Cgl-TH-5 (L62K), Cgl-TH-5 (L62P). ), Cgl-TH-5 (L62C), Cgl-TH-5 (L62G), Cgl-TH-5 (L62T), Cgl-TH-5 (L62I), Cgl-TH-5 (L62Y), Cgl-TH -5 (L62V), Cgl-TH-5 (L62H), Cgl-TH-5 (L62F), Cgl-TH-5 (L62M), Cgl-TH-5 (L62Q), Cgl-TH-5 (L62N) , Cgl-TH-5 (L62E) and Cgl-TH-5 (L62W) were named.
[355]
[356]
The 18 strains prepared by the above method and the previously prepared Cgl-TH-4, Cgl-TH-5, Cgl-TH-5(m2) strains were used in the L-threonine production flask medium of Example 2-5. and culture method, and after the culture was completed, the production of L-threonine was measured by HPLC and shown in Table 9.
[357]
[358]
[Table 9]
strain name rhtC form L-threonine production (g/L) L-threonine yield (g/g, %) Improved yield compared to wild-type rhtC (Δ,%p)
Cgl-TH-4 - 11.3 16.1 -
Cgl-TH-5 rhtC wild type 14.0 20.0 -
Cgl-TH-5(m2) rhtC L62S 24.0 34.3 14.3
Cgl-TH-5(L62R) rhtC L62R 24.9 35.6 15.6
Cgl-TH-5(L62A) rhtC L62A 23.5 33.5 13.5
Cgl-TH-5(L62D) rhtC L62D 17.5 24.9 4.9
Cgl-TH-5(L62K) rhtC L62K 24.0 34.3 14.3
Cgl-TH-5(L62P) rhtC L62P 23.3 33.2 13.2
Cgl-TH-5(L62C) rhtC L62C 15.8 22.6 2.6
Cgl-TH-5(L62G) rhtC L62G 19.8 28.3 8.3
Cgl-TH-5(L62T) rhtC L62T 25.8 36.9 16.9
Cgl-TH-5(L62I) rhtC L62I 17.5 24.9 4.9
Cgl-TH-5(L62Y) rhtC L62Y 16.4 23.4 3.4
Cgl-TH-5(L62V) rhtC L62V 22.5 32.2 12.2
Cgl-TH-5(L62H) rhtC L62H 23.8 34.0 14.0
Cgl-TH-5(L62F) rhtC L62F 16.5 23.6 3.6
Cgl-TH-5(L62M) rhtC L62M 19.1 27.3 7.3
Cgl-TH-5(L62Q) rhtC L62Q 20.0 28.6 8.6
Cgl-TH-5(L62N) rhtC L62N 21.8 31.2 11.2
Cgl-TH-5(L62E) rhtC L62E 18.2 26.0 6.0
Cgl-TH-5(L62W) rhtC L62W 20.7 29.6 9.6
[359]
[360]
As shown in Table 9, compared to Cgl-TH-5 in which wild-type rhtC was inserted, all 19 mutations to which the mutation of amino acid 62 of the RhtC protein was applied showed an improvement in fermentation yield of 3.4 to 16.9 %p.
[361]
[362]
Example 5: AHV-resistant strain screening through artificial mutagenesis
[363]
[364]
Corynebacterium glutamicum KFCC10881 (Korean Patent No. 0159812) was used as the parent strain to give resistance to L-threonine analog AHV (2-amino-3-hydroxy-valerate).
[365]
Mutation was induced by artificial mutagenesis using NTG (N-methyl-N'-nitro-N-nitrosoguanidine). The KFCC10881 strain cultured for 18 hours in the seed medium of Example 2-5 was again inoculated into 4 ml of the seed medium, and then cultured until OD660 reached about 1.0. The culture solution was centrifuged to recover the cells, washed twice with 50 mM Tris-malate buffer (pH 6.5), and finally suspended in 4 ml of the same buffer. NTG solution (2 mg/ml concentration in 0.05M tris-malate buffer (pH6.5)) was added to the cell suspension to a final concentration of 150 mg/l, and then left at room temperature for 20 minutes, followed by centrifugation. Cells were collected and washed twice with the same buffer to remove NTG. Finally, the washed cells were suspended in 4 ml of a 20% glycerol solution and stored at -70° C. until use. The NTG-treated strain was plated on a minimal medium containing 3 g/l of AHV, and 155 strains of mutant KFCC10881 strain with AHV resistance were obtained through the above process.
[366]
[367]
Example 6: Selection of L-threonine-producing strains from AHV-resistant KFCC10881 strains
[368]
[369]
L-threonine-producing ability test was performed on the 155 strains of AHV-resistant strains obtained in Example 5. 155 strains were inoculated into a 250 ml corner-baffle flask containing 25 ml of the seed medium of Example 2-5, and then cultured with shaking at 30° C. for 20 hours at 200 rpm. L-threonine production medium (glucose 30 g, KH 2 PO 4 2 g, urea 3 g, (NH 4 ) 2 SO 4 40 g, peptone 2.5 g, CSL (Sigma) 5 g (10 ml), MgSO 4 7H 2 O 0.5 g, 1 ml of the seed culture solution was inoculated into a 250 ml corner-baffle flask containing 24 ml of leucine 400 mg, CaCO 3 20 g, pH 7.2 (based on 1 liter of distilled water) and cultured with shaking at 30 ° C. for 48 hours at 200 rpm.
[370]
After the end of the culture, the production of various amino acids produced was measured using HPLC. Table 10 shows the concentration of amino acids in the culture medium for the top 22 strains, which were shown to have excellent L-threonine-producing ability among the 155 strains tested. 22 candidates identified through the above process were named KFCC10881-1 to KFCC10881-22, respectively.
[371]
[372]
[Table 10]
strain name FROM L-Threonine(g/L) Homoserine(g/L)
KFCC10881 58.5 0.0 0.1
KFCC10881-1 60.1 2.0 1.5
KFCC10881-2 57.1 3.0 2.2
KFCC10881-3 47.3 2.8 2.3
KFCC10881-4 51.7 3.2 2.1
KFCC10881-5 58.4 3.1 2.2
KFCC10881-6 52.6 3.4 2.5
KFCC10881-7 14.2 0.4 0.2
KFCC10881-8 55.8 3.0 2.0
KFCC10881-9 44.3 3.2 2.8
KFCC10881-10 47.5 3.7 3.0
KFCC10881-11 57.0 2.7 1.8
KFCC10881-12 51.8 3.3 3.5
KFCC10881-13 49.8 3.0 2.3
KFCC10881-14 62.7 2.4 2.1
KFCC10881-15 62.4 2.9 2.7
KFCC10881-16 59.6 2.8 2.5
KFCC10881-17 24.1 0.1 0.2
KFCC10881-18 60.5 2.6 2.5
KFCC10881-19 60.0 3.0 1.9
KFCC10881-20 65.8 2.7 2.0
KFCC10881-21 17.3 0.3 0.3
KFCC10881-22 60.1 3.5 1.9
[373]
[374]
As shown in Table 10, 22 strains with AHV resistance showed L-threonine production results that were not observed in the control group (KFCC10881). And, among the AHV-resistant strains, KFCC10881-10 was selected as the most excellent L-threonine strain.
[375]
[376]
Example 7: L-threonine production of KFCC10881-10 strain introduced with mutant L-threonine excretion protein
[377]
[378]
pDZ-PgapA_rhtC, pDZ-PgapA_rhtC(m2), pDZ-PgapA_rhtC(m3) prepared in Example 1 and pDZ-PgapA_rhtC L62R, pDZ-PgapA_rhtC L62A, pDZ-PgapA_rhtC L62A, prepared as shown in Table 8 of Example 4 -PgapA_rhtC L62K, pDZ-PgapA_rhtC L62P, pDZ-PgapA_rhtC L62C, pDZ-PgapA_rhtC L62G, pDZ-PgapA_rhtC L62T, pDZ-PgapA_rhtC L62I, pDZ-PgapA_rhtC L62Y, pDZ-PgapA_rhtC L62V, pDZ-PgapA_rhtC L62H, pDZ-PgapA_rhtC L62F, pDZ -PgapA_rhtC L62M, pDZ-PgapA_rhtC L62Q, pDZ-PgapA_rhtC L62N, pDZ-PgapA_rhtC L62E, pDZ-PgapA_rhtC L62W vectors were transfected into KFCC10881-10 strains by electroporation, respectively, through a second crossover process on the KFCC10881-10 strain, then rht chromosome transformation 22 strains into which genes were inserted were obtained. The genetic manipulation was confirmed through PCR and genome sequencing using the primers of SEQ ID NO: 53 and SEQ ID NO: 54 that can amplify the external regions of the upstream region and the downstream region of the homologous recombination into which the gene is inserted, respectively.
[379]
[380]
SEQ ID NO: 53 (HR outside F)
[381]
AAGGAATATCCCGGAGAACC
[382]
SEQ ID NO: 54 (HR outside R)
[383]
TTGCGTTTGAAAAGCCCTCG
[384]
[385]
수득한 형질전환 균주를 각각 KFCC10881-10(rhtC WT), KFCC10881-10(rhtC L62S), KFCC10881-10(rhtC A53T), KFCC10881-10(rhtC L62R), KFCC10881-10(rhtC L62A), KFCC10881-10(rhtC L62D), KFCC10881-10(rhtC L62K), KFCC10881-10(rhtC L62P), KFCC10881-10(rhtC L62C), KFCC10881-10(rhtC L62G), KFCC10881-10(rhtC L62T), KFCC10881-10(rhtC L62I), KFCC10881-10(rhtC L62Y), KFCC10881-10(rhtC L62V), KFCC10881-10(rhtC L62H), KFCC10881-10(rhtC L62F), KFCC10881-10(rhtC L62M), KFCC10881-10(rhtC L62Q), KFCC10881-10(rhtC L62N), KFCC10881-10(rhtC L62E), KFCC10881-10(rhtC L62W)로 명명하였다.
[386]
The genetic manipulation was confirmed through PCR and genome sequencing using the primers of SEQ ID NO: 53 and SEQ ID NO: 54 that can amplify the external regions of the upstream region and the downstream region of the homologous recombination into which the rhtC gene is inserted, respectively.
[387]
Then, 22 strains prepared by the above method were cultured with the L-threonine production medium and the culture method of Example 6, and after the culture was completed, the production of L-threonine was measured by HPLC and shown in Table 11.
[388]
[389]
[Table 11]
strain name L-threonine production (g/L) L-threonine yield (g/g, %) Improved yield compared to wild-type rhtC (Δ,%p)
KFCC10881-10 3.8 12.7 -
KFCC10881-10 (rhtC WT) 5.5 18.3 -
KFCC10881-10(rhtC A53T) 9.0 30.0 11.7
KFCC10881-10(rhtC L62S) 10.1 33.5 15.2
KFCC10881-10(rhtC L62R) 10.0 33.2 14.9
KFCC10881-10(rhtC L62A) 9.8 32.5 14.2
KFCC10881-10(rhtC L62D) 6.6 22.1 3.8
KFCC10881-10(rhtC L62K) 10.2 34.1 15.8
KFCC10881-10(rhtC L62P) 10.0 33.2 14.9
KFCC10881-10(rhtC L62C) 5.9 19.8 1.5
KFCC10881-10(rhtC L62G) 7.8 26.1 7.8
KFCC10881-10(rhtC L62T) 10.2 34.0 15.7
KFCC10881-10(rhtC L62I) 6.3 20.9 2.6
KFCC10881-10(rhtC L62Y) 6.8 22.5 4.2
KFCC10881-10(rhtC L62V) 9.2 30.5 12.2
KFCC10881-10(rhtC L62H) 9.8 32.8 14.5
KFCC10881-10(rhtC L62F) 6.4 21.3 3.0
KFCC10881-10(rhtC L62M) 7.3 24.2 5.9
KFCC10881-10(rhtC L62Q) 7.9 26.3 8.0
KFCC10881-10(rhtC L62N) 8.9 29.5 11.2
KFCC10881-10(rhtC L62E) 7.4 24.5 6.2
KFCC10881-10(rhtC L62W) 8.5 28.2 9.9
[390]
[391]
As shown in Table 11, when mutant RhtC was introduced into KFCC10881-10, as shown in Examples 3 and 4, a higher level of yield increase compared to wild-type RhtC could be observed.
[392]
[393]
Example 8: L-threonine production of TF4076 strain introduced with mutant L-threonine excretion protein
[394]
[395]
E. coli W3110-derived rhtC protein (SEQ ID NO: 1) and the mutation of the present application was introduced into rhtC derived from another strain with high homology to confirm the L-threonine production results.
[396]
Specifically, by performing PCR from the genomic DNA of Escherichia coli W3110, Shigella flexneri , Escherichia fergusonii in the same manner as in Example 1, each of the nucleotide sequence fragments was obtained (eco rhtC) , sfe rhtC, efe rhtC), and mutant rhtC in which L62S mutation was introduced by the method of Example 1 were prepared, respectively. Recombinant plasmids pCL1920-Pn_rhtC.eco, pCL1920-Pn_rhtC.eco L62S, pCL1920-Pn_rhtC.sfe, pCL1920-Pn_rhtC.sfe L62S, pCL1920-Pn_rhtC.sfe L62S by cloning the prepared mutant rhtC or wild-type rhtC of each strain with pCL1920 pCL1920-Pn_rhtC.efe L62S was obtained.
[397]
Each of the above-prepared plasmids was transformed into TF4076, an E. coli strain having L-threonine-producing ability, and TF4076/pCL1920, TF4076/pCL1920-Pn_rhtC.eco, TF4076/pCL1920-Pn_rhtC.eco L62S, TF4076/pCL1920- Pn_rhtC.sfe, TF4076/pCL1920-Pn_rhtC.sfe L62S, TF4076/pCL1920-Pn_rhtC.efe, TF4076/pCL1920-Pn_rhtC.efe L62S strains were prepared. Flask evaluation was performed to compare the production of L-threonine of the prepared strains, and the results are shown in Table 12.
[398]
[399]
[Table 12]
strain name L-threonine production L-threonine yield
(g/L) (*100 g/g, %)
TF4076 25.7 36.7
TF4076/pCL1920 25.9 37
TF4076/pCL1920-Pn_rhtC.eco 29.9 42.6
TF4076/pCL1920-Pn_rhtC.eco L62S 40.4 57.7
TF4076/pCL1920-Pn_rhtC.sfe 31.1 44.43
TF4076/pCL1920-Pn_rhtC.sfe L62S 41.5 59.29
TF4076/pCL1920-Pn_rhtC.efe 29.1 41.57
TF4076/pCL1920-Pn_rhtC.efe L62S 38.2 54.57
[400]
[401]
As shown in Table 12, when E. coli W3110, Shigella flexneri or Escherichia fergusoni-derived RhtC was introduced into mutant RhtC in which L62S mutation was introduced, the results shown in Examples 3, 4 and 7 As shown, a high level of yield increase was observed compared to wild-type RhtC.
[402]
[403]
Through this, it can be seen that even if the reference sequence is different, when substituted with another amino acid at the position corresponding to the 53rd or 62th position of the present invention, L-threonine excretion ability will be improved.
[404]
[405]
From the above description, those skilled in the art to which the present application pertains will be able to understand that the present application may be embodied in other specific forms without changing the technical spirit or essential characteristics thereof. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of the present application should be construed as including all changes or modifications derived from the meaning and scope of the claims described below, rather than the detailed description, and equivalent concepts thereof, to be included in the scope of the present application.

Claims
[Claim 1]
contains a substitution with another amino acid at the position corresponding to the 53rd or 62nd position of SEQ ID NO: 1, has at least 80% or more and less than 100% sequence homology with the amino acid sequence of SEQ ID NO: 1, and L-threo A variant of the L-threonine excreting protein, which has nin release activity.
[Claim 2]
The method of claim 1, wherein the other amino acids are serine, arginine, alanine, aspartic acid, lysine, proline, cysteine, glycine, threonine, isoleucine, tyrosine, valine, histidine, phenylalanine, methionine, glutamine, asparagine, glutamic acid or tryptophan. Which is selected from, a variant of the protein.
[Claim 3]
The protein variant according to claim 1, wherein the protein variant comprises any one amino acid sequence selected from SEQ ID NOs: 93 to 112.
[Claim 4]
A polynucleotide encoding a variant of the protein of any one of claims 1 to 3.
[Claim 5]
A vector comprising the polynucleotide of claim 4.
[Claim 6]
L-threo comprising a substitution with another amino acid at the position corresponding to position 53 or 62 of SEQ ID NO: 1 and having at least 80% or more and less than 100% sequence homology to the amino acid sequence of SEQ ID NO: 1 A microorganism producing L-threonine, comprising any one or more of a variant of the nin excretion protein, a polynucleotide encoding the variant, and a vector comprising the polynucleotide.
[Claim 7]
The microorganism according to claim 6, wherein the microorganism is a microorganism of the genus Corynebacterium sp. or Escherichia sp., L-threonine-producing microorganism.
[Claim 8]
L-threo comprising a substitution with another amino acid at the position corresponding to position 53 or 62 of SEQ ID NO: 1 and having at least 80% or more and less than 100% sequence homology to the amino acid sequence of SEQ ID NO: 1 A method for producing L-threonine, comprising the step of culturing in a medium any one or more of a variant of the nin release protein, a polynucleotide encoding the variant, and a vector comprising the polynucleotide.
[Claim 9]
The method of claim 8, wherein the method comprises the step of recovering L-threonine from the cultured medium or microorganism.