FORM 2
THE PATENTS ACT 1970
(39 OF 1970)
COMPLETE SPECIFICATION (SECTION 10)
"LEADER SEQUENCE FOR HIGHER EXPRESSION OF RECOMBINANT PROTEINS"
UNICHEM LABORATORIES LIMITED,
A COMPANY REGISTERED UNDER THE INDIAN COMPANY ACT, 1956,
HAVING ITS REGISTERED OFFICE LOCATED AT
UNICHEM BHAVAN, PRABHAT ESTATE,
S.V. ROAD, JOGESHWARI (WEST),
MUMBAI - 100102, MAHARASHTRA, INDIA
The following specification particularly describes the invention and the manner in
which it is to be performed.

FIELD OF INVENTION
The invention relates to novel leader sequence for expression of recombinant proteins. The present invention also relates to the method of improving the expression of recombinant protein using leader sequence.
BACKGROUND OF THE INVENTION
The application of recombinant DNA technology has made a number of recombinant therapeutic proteins available for biopharmaceutical use. Both prokaryotic and eukaryotic expression systems are generally used for the recombinant protein production.
Among all expression systems, Escherichia coli (E. coli) remains the most advantageous host for producing recombinant proteins, because of its faster, inexpensive and high yielding protein production. The well-known genetics and availability of variety of molecular tools also greatly boosted the application of E. coli in biopharmaceutical industry. Availability of variety of promoters, leader partners and mutant strains added great advantage to E. coli to become one of the most widely used methods for recombinant protein production, both at the laboratory and industrial levels.
Along with lot of advantages, the E. coli has, however, limitations at expressing more complex proteins due to lack of sophisticated machinery to perform post translational modifications, such as glycosylation and refolding, in order to exhibit activity.
On the other hand, many mammalian proteins and other proteins cannot be expressed successfully in E. coli, which explore expression in a wide range of other organisms like Baculovirus expression system, Gram positive organisms, Pseudomonas expression systems. Higher protein production in E. coli is a major bottleneck in the process of producing recombinant proteins and many attempts have been made to overcome and resolve the issues. In some cases, researchers have explored usage of strong promoters, addition of sucrose and betaine to growth

medium, use of rich medium with phosphate buffer and use of leader sequences to increase expression. Apart from lower expression, proteolytic degradation of recombinant proteins is major problem in expression host.
Additional factors to obtain high yields of protein includes gene of interest, expression vector, gene dosage, transcriptional regulation, codon usage, translation regulation, host design, growth media and culture condition or fermentation conditions available for manipulating the expression conditions, specific activity or biological activity of the protein of interest, protein targeting, fusion proteins, molecular chaperons and protein degradation.
One of the best method to increase expression and stability of expressed protein is N- or C-terminal fusions with leader sequence. Formation of strong secondary structures in transcribed mRNA reduces expression of heterologous genes. The strong secondary structure interferes with the binding of ribosomes with mRNA, thereby prevent efficient translation initiation. Leader sequence determinant at both N- and C-termini of protein can influence the recombinant protein expression and stability towards protease degradation.
Leader sequences are highly efficient tools for protein expression. Not only expression, leader sequences also have impact on solubility and even the folding of their fusion partners They allow the purification of virtually any protein without any requirement of any prior knowledge of its biochemical properties.
US 10000544 describes a process for production of insulin or insulin analogues by expression of insulin or insulin analogues through an expression construct in a host cell. An expression construct is having leader peptide for insulin in a host cell, particularly in bacterial cell.
US6841361 describes use of the DNA for the preparation of insulin from the fusion protein, which is obtained by the expression of the DNA, through the action of thrombin and carboxypeptidase B.
JP-B-7-121226 and JP2553326 describes the method for expressing miniproinsulin comprising a B chain and an A chain linked via two basic amino acid residues, in

yeast; and then treating the miniproinsulin with trypsin in vitro, thereby producing insulin.
However, no single leader sequence is optimal with respect to all of these parameters; each has its advantages and disadvantages. Multiple leader sequences can be added together in different combination for a particular protein to get better result with respect to expression, solubility and purification.
OBJECT OF THE INVENTION
The main object of the invention is to provide an efficient, novel leader sequence used to express insulin, specifically recombinant human insulin and insulin analogues with ease and efficiency.
Another object of the invention is to provide a fused protein comprising the leader sequence and proinsulin or proinsulin analogues. Further the objective is to provide a process to prepare the said fused protein.
Yet another object of the invention is to provide an easy, highly efficient and industrially scalable process to prepare insulin using the leader sequence.
Yet another object of the invention is to device a highly efficient process to prepare insulin or insulin analogues from pre-proinsulin comprising leader sequence.
SUMMARY OF INVENTION
The present invention relates to:
1. A leader peptide sequence selected from:
a) the peptide having amino acid sequence of SEQ ID 1;
b) the peptide having amino acid sequence of SEQ ID 2;
c) a peptide comprising amino acid sequence of: MSRIVINAYAKATQP;
d) a peptide comprising amino acid sequence of: MEKHTKDQIIEAPHM; or
e) a peptide having at least 80% homology to a), b), c), or d).

2. A nucleotide sequence encoding leader peptide sequence of (1).
3. The nucleotide sequence according to (2), wherein the sequence is selected from: SEQ ID 9 or SEQ ID 10.
4. A pre-proinsulin polypeptide comprising the leader peptide sequence of (1), which is operably linked to the precursor of insulin or insulin analogues.
5. The pre-proinsulin polypeptide according to (4), wherein the pre-proinsulin is of Formula 1: R1-X1-X2-X3, wherein X1 is a 'B' chain of insulin or insulin analogues, X2 is a dipeptide selected RR or KR or RK or KK, X3 is an 'A' chain of insulin or insulin analogues and R1 is the leader peptide according to (1).
6. The pre-proinsulin polypeptide according to (4), wherein the precursor of insulin or insulin analogues is a proinsulin of Formula 2: X1-X2-X3, wherein X1 is a 'B' chain of insulin or insulin analogues, X2 is a dipeptide selected RR or KR or RK or KK and X3 is the 'A' chain of insulin or insulin analogues.
7. The pre-proinsulin polypeptide according to (4), wherein the leader peptide directs the expression of the insulin and insulin analogues into the prokaryotic host cell.
8. The pre-proinsulin polypeptide according to (7), wherein the prokaryotic host cell is selected from Pseudomonas cell or Escherichia coli cell.
9. A proinsulin prepared using pre-proinsulin of Formula 1: R1-X1-X2-X3, wherein X1 is a 'B' chain of insulin or insulin analogues, X2 is a dipeptide selected RR or KR or RK or KK, X3 is an 'A' chain of insulin or insulin analogues and Rl is the leader peptide according to (1).
10. A process to prepare proinsulin from pre-proinsulin, wherein the pre-proinsulin comprises the leader peptide of (1).
11. The process according to (10), wherein the pre-proinsulin is of Formula 1: R1-X1-X2-X3 and proinsulin is of formula X1-X2-X3, wherein R1 is the leader peptide, X1 is a 'B' chain of insulin or insulin analogues, X2 is a dipeptide selected RR or KR or RK or KK and X3 is an 'A' chain of insulin or insulin analogues.

12. A nucleotide sequence encoding pre-proinsulin polypeptide according to (4).
13. The nucleotide sequence according to (12), wherein the sequence is SEQ ID 11,SEQ ID12, SEQ ID 13,SEQ ID 14, SEQ ID 15 or SEQ ID 16.
14. A recombinant gene construct comprising nucleotide sequence selected from (12) or (13).
15. The recombinant gene construct according to (14), wherein the gene construct is selected from pET28aULLINS, pET28aULL2INS, pET28aULLlLSP, pET28aULL2LSP, pET28aULLlGR or pET28aULL2GR.
16. A process to prepare recombinant gene construct of (14) or (15).
17. An expression vector comprising gene construct selected from (14) or (15).
18. The expression vector according to (17), wherein the vector comprises the recombinant gene construct pET28aULLlINS or pET28aULL2INS for production of insulin, pET28aULLlLSP or pET28aULL2LSP for production of insulin Lispro and pET28aULLl GR or pET28aULL2GR for production of insulin glargine.
19. A prokaryotic host cell comprising an expression vector selected from (17) or (18).
20. The prokaryotic host cell according to (19) is selected from Pseudomonas cell or Escherichia coli cell.
21. A method of expressing an insulin and insulin analogue via expression of proinsulin according to any one of (9) to (11).
22. The method according to (21), wherein the method comprises fermentation of the prokaryotic host cell according to (19) or (20) in a suitable production medium.
23. The method according to 22, wherein the production medium comprises 1% yeast extract, 1 % Dextrose, 0.3% KH2PO4, 1.25% K2HPO4, 0.5% (NH4)2SO4, 0.05% NaCl, 0.1% MgSO4.7H2O, 0.1% of trace metal solution (FeSO4, ZnSO4,

CoCl2, NaMoO4, CaCl2, MnCl2, CuSO4 or H3BO3 in Hydrochloric acid) and Kanamycin (20μg/ml) per 100 ml.
24. A process to produce insulin and insulin analogues, wherein the process comprises use of leader peptide of (1).
25. A process to produce insulin and insulin analogues, wherein the process comprises use of pre-proinsulin polypeptide selected from any one of (4) to (8).
26. A process to product insulin and insulin analogues, wherein the process comprises use of proinsulin selected from any one of (9) to (11).
27. Insulin or insulin analogues prepared by the process comprising leader peptide according to (1).
28. Insulin or Insulin analogues prepared by the process comprising pre-proinsulin polypeptide selected from any one of (4) to (8).
29. Insulin or insulin analogues prepared by the process comprising proinsulin selected from any one of (9) to (11).
BRIEF DESCRIPTION OF FIGURES
Figure 1 - Expression analysis of pre-proinsulin with construct pET28aULLlINS and pET28aULL2INS in E. coli BL21 DE3.
Figure 2 - Expression analysis of pre-proinsulin-Lispro with construct pET28aULLlLSP and pET28aULL2LSP in E. coli BL21 DE3.
Figure 3 - Expression analysis of pre-proinsulin Glargine with construct pET28aULLlGLR and pET28aULL2GLR in E. coli BL21 DE3.
Figure 4 - Annotated diagram of pET28a Vector Map with ULL1INS. Figure 5 - Annotated diagram of pET28a Vector Map with ULL2INS.

DEFINITIONS
The term 'Peptide' as used herein refers to a molecule comprising an amino acid sequence connected by peptide bonds regardless of length, post-translation modification, or function.
The term "Dipeptide" as used herein refers to a molecule comprising an amino acid sequence of two (2) amino acids connected by peptide bonds.
The term "Polypeptide" as used herein refers to naturally occurring or recombinant, produced or modified chemically or by other means, which may assume the three dimensional structure of proteins that may be post-translationally processed, essentially the same way as native proteins.
The terms 'peptides', 'polypeptide' and 'protein' are used interchangeably herein.
The term "Insulin" refer to a hormone which is 51 amino acid residue polypeptide (5808 Daltons), which plays an important role in many key cellular processes. It is involved in the stimulation of cell growth and differentiation. It also exerts its regulatory function (e.g. uptake of glucose into cells) through a signalling pathway initiated by binding of hormone in its monomeric form to its dimeric, tyrosine-kinase type membrane receptor. The mature form of human insulin consists of 51 amino acids arranged into an A-chain (GlyAl-AsnA21) and a B chain (PheB1-ThrB30) of total molecular mass of 5808 Da. The molecule is stabilised by two inter (A20- B19, A7-B7) and one intra chain disulphide bonds (A6-A11). Insulins of this invention include natural, provided by synthetic, or genetically engineered (e.g., recombinant) sources, in various embodiments of the present invention, insulin can be a human insulin.
The term "insulin analogues" as used herein refers to altered form of insulin which are either a more rapid acting or more uniformly acting form of the insulin. Non-limiting examples of such analogues are Insulin Lispro, Insulin Degludec, Insulin Aspart and Insulin Glargine.

Insulin Analogue "Lispro" is identical in primary structure to human insulin, differs from human insulin by switching the lysine at position B28 and the proline at position B29. It is a short-acting insulin monomeric analogue.
Insulin Analogue "Glargine" differs from human insulin by a substitution of asparagine for glycine at A21, and the addition of two arginine residues to the C-terminus of the B-chain. Insulin glargine solution is formulated and injected at pH 4.0. These modifications increase the isoelectric point to a more neutral pH, reducing the solubility under physiologic conditions and causing glargine to precipitate at the injection site, thus slowing absorption. Glargine is an extended-action analogue that lasts 20-24 hour.
The present invention relates to a sequence having at least 80% homology to amino acid sequence of SEQ ID 1 and SEQ ID 2. The amino acid Sequences of SEQ ID 1 and SEQ ID 2 are also referred to as ULL1 and ULL2, respectively.
The term 'Pre-proinsulin' as used herein refers to a single chain polypeptide molecule comprising a leader peptide (R1), a B chain (X1) of Insulin, a C-peptide or dipeptide (X2) and A chain (X3) of Insulin, linked in the order represented by the formula "R1-X1-X2-X3".
The terms 'pre-proinsulin' or 'preproinsulin' are used interchangeably herein.
The term 'Proinsulin' as used herein refers to a single chain polypeptide molecule generated after cleavage of leader sequence from pre-proinsulin and is represented by the formula X1-X2-X3, which includes the dipeptide or "C-peptide" (X2) linking the B chain (X1) and A chain (X3) of insulin.
The term "nucleic acid sequence" or polynucleotide sequence as used herein refers to a sequence of nucleoside or nucleotide monomers consisting of naturally occurring bases, sugars and inter sugar (backbone) linkages. The term also includes modified or substituted sequences comprising non-naturally occurring monomers or portions thereof. The nucleic acid sequences of the present invention may be deoxyribonucleic acid sequences (DNA) or ribonucleic acid sequences (RNA) and may include naturally occurring bases including adenine, guanine, cytosine,

thymidine and uracil. The nucleic acid sequences encoding insulin that may be used in accordance with the methods provided herein may be any nucleic acid sequence encoding an insulin polypeptide or its precursors including proinsulin and pre-proinsulin.
The term "operably linked" as used herein refers to a configuration in which a control sequence, which herein is the leader sequence R1 is placed at an appropriate position relative to the coding sequence of the polynucleotide sequence such that the control sequence directs the expression of the coding sequence to the polypeptide.
The term "coding sequence" as used herein refers to a polynucleotide sequence that is transcribed into mRNA which is translated into a polypeptide when placed under the control of the appropriate control sequences, which herein is the leader sequence R1. The boundaries of the coding sequence are generally determined by the start codon located at the beginning of the open reading frame of the 5' end of the mRNA and a stop codon located at the 3' end of the open reading frame of the mRNA. A coding sequence may include, but is not limited to, genomic DNA, cDNA, semisynthetic, synthetic, and recombinant nucleotide. The coding sequence for example is the nucleotide sequence encoding proinsulin of formula X1-X2-X3.
The term 'pET28aULLlINS' as used herein refers to the plasmid used to encode pre-proinsulin using vector pET28a, nucleotide sequence of SEQ ID 9 and the nucleotide sequence encoding X1-X2-X3 corresponding recombinant human Insulin as defined herein before.
The term 'pET28aULLlLSP' as used herein refers to the plasmid used to encode pre-proinsulin using vector pET28a, nucleotide sequence of SEQ ID 9 and the nucleotide sequence encoding X1-X2-X3 corresponding Insulin Lispro as defined herein before.
The term 'pET28aULLlGR' as used herein refers to the plasmid used to encode pre-proinsulin using vector pET28a, nucleotide sequence of SEQ ID 9 and the

nucleotide sequence encoding X1-X2-X3 corresponding Insulin Glargine as defined herein before.
The term 'pET28aULL2INS' as used herein refers to the plasmid used to encode pre-proinsulin using vector pET28a, nucleotide sequence of SEQ ID 10 and the nucleotide sequence encoding X1-X2-X3 corresponding recombinant human Insulin as defined herein before.
The term 'pET28aULL2LSP' as used herein refers to the plasmid used to encode pre-proinsulin using vector pET28a, nucleotide sequence of SEQ ID 10 and Ihe nucleotide sequence encoding X1-X2-X3 corresponding Insulin Lispro as defined herein before.
The term 'pET28aULL2GR' as used herein refers to the plasmid used to encode pre-proinsulin using vector pET28a, nucleotide sequence of SEQ ID 10 and the nucleotide sequence encoding X1-X2-X3 corresponding Insulin Glargine as defined herein before.
The terms "leader sequence" or "Tag" as used herein refers to peptide sequence located at the amino terminal of the precursor form of a protein, which maximizes the production of protein.
BRIEF DESCRIPTION OF ACCOMPANYING SEQUENCES
SEQ ID 1: is an amino acid sequence of ULL1, which is a leader sequence (R1)
SEQ ID 2: is an amino acid sequence of ULL2, which is a leader sequence (R1)
SEQ ID 3: is an amino acid sequence of SEQ ID 1 fused to proinsulin sequence of insulin.
SEQ ID 4: is an amino acid sequence of SEQ ID 2 fused to proinsulin sequence of insulin.
SEQ ID 5: is an amino acid sequence of SEQ ID 1 fused to proinsulin sequence of insulin Lispro.

SEQ ID 6: is an amino acid sequence of SEQ ID 2 fused to proinsulin sequence of insulin Lispro.
SEQ ID 7: is an amino acid sequence of SEQ ID 1 fused to proinsulin sequence of insulin Glargine.
SEQ ID 8: is an amino acid sequence of SEQ ID 2 fused to proinsulin sequence of insulin Glargine.
SEQ ID 9: is a nucleotide sequence encoding SEQ ID 1.
SEQ ID 10: is a nucleotide sequence encoding SEQ ID 2.
SEQ ID 11: is a nucleotide sequence encoding SEQ ID 3.
SEQ ID 12: is a nucleotide sequence encoding SEQ ID 4.
SEQ ID 13: is a nucleotide sequence encoding SEQ ID 5.
SEQ ID 14: is a nucleotide sequence encoding SEQ ID 6.
SEQ ID 15: is a nucleotide sequence encoding SEQ ID 7.
SEQ ID 16: is a nucleotide sequence encoding SEQ ID 8.
DETAILED DESCRIPTION OF THE INVENTION
The present invention relates to the process to produce insulin, more specifically human insulin and insulin analogues. The invention also relates to the peptide, which is used in the said process for higher expression. The invention specifically relates to the pre-proinsulin sequences and processes for the preparation of insulin and insulin analogues from pre-proinsulin sequences via proinsulin, wherein the said pre-proinsulin (Formula 1) and proinsulin (Formula 2) are:
Formula 1: R1-X1-X2-X3 and Formula 2: X1-X2-X3.
Wherein R1 is peptide having amino acid sequence of SEQ ID 1 or peptide having amino acid sequence of SEQ ID 2.

X1 is 'B' chain of insulin and insulin analogues, X2 is dipeptide comprising RR or KR or RK or KK and X3 is 'A' chain of insulin and insulin analogues.
Another embodiment of the invention is the peptide having amino acid sequence of SEQ ID 1 and peptide having amino acid sequence of SEQ ID 2. To the person skilled in the art the two sequence are also called as a leader sequence or a Tag. The expression of low molecular weight proteins in bacterial host cell is difficult due the unstable messenger RNA and rapid degradation of these proteins. Inefficient translation of the underlying coding sequences also leads to lower expression of low molecular weight proteins. The novel sequences disclosed in the present invention cause higher expression of such proteins and therefore leads to higher yields of proteins of interest.
Another embodiment of the invention is a peptide having at least 80% homology to the sequence of amino acids from 1 to 15 of SEQ ID 1 or SEQ ID 2.
Designing of Peptide sequences of SEQ ID 1 or SEQ ID 2
The leader sequences of SEQ ID 1 and SEQ ID 2 were designed by considering the important factors for the higher expression of recombinant protein. The factors which affect the recombinant protein expression in bacterial host cell are: size of the protein, GC content of the coding DNA sequence, mRNA secondary structure, translation initiation rate and codon usage of bacterial host cell. The factors considered were GC content of the coding DNA sequence, mRNA secondary structure, translation initiation rate and codon usage of bacterial host cell. The preferred host cell being E. coli, more preferably E. coli Gold BL 21 DE3.
Construction of pET28aULLHNS plasmid
The gene encoding the proinsulin along with nucleotide sequence encoding SEQ ID 9 was designed, codon optimized and chemically synthesized and cloned in pUC57 by Genscript® to prepare pUC57ULLlINS. Restriction digestion of pUC57ULLlINS plasmid and pET28a vector was done by using Ndel and BamH1

restriction enzymes. Gene fragment, ULL1INS was purified by gel elution kit (Qiagen®) and was ligated to pET28a vector to prepare pET28aULLHNS. Further it was transformed into propagation host, E. coli Top 10 cells to propagate pET28aULLlINS, ligated plasmid. Such plasmid was isolated and transformed into E. coli Gold BL 21 DE3 cells to check the expression of protein.
Construction of pET28aULL2INS plasmid
The gene encoding the proinsulin along with nucleotide sequence encoding SEQ ID 10 was designed, codon optimized and chemically synthesized and cloned in pUC57 by Genscript® to prepare pUC57UTL2INS. Restriction digestion of pUC57UTL2INS plasmid and pET28a vector was done by using Ncol and BamH1 restriction enzymes. Gene fragment, ULL2INS was purified by gel elution kit (Qiagen®) and was ligated to pET28a vector to prepare pET28aULL2INS. Further it was transformed into propagation host, E. coli Top 10 cells to propagate pET28aULL2INS, ligated plasmid. Such plasmid was isolated and transformed into E. coli Gold BL 21 DE3 cells to check the expression of protein.
Similarly, gene constructs for the preparation of Insulin analogues such as insulin Glargine and insulin Lispro were obtained. The Insulin fragment used in this work has 159 bp in length and corresponds to the nucleotide sequence of the insulin protein with the small C-chain (2 amino acids) thereof.
The preparation of insulin and insulin analogues
The preparation of insulin from pre-proinsulin sequence involves following steps.
Fermentation process: E. coli cells transformed with pET28aULLHNS or pET28aULL2INS is grown in production medium, induced with IPTG and cell mass is obtained at the end of fermentation process.
Cell lysis: The cells containing inclusion bodies of pre-proinsulin were resuspended in Tris-NaCl buffer and lysed by high pressure with Mini-DeBEE homogenizer.

Inclusion bodies preparation: Inclusion bodies enriched with pre-proinsulin were washed with Tris-NaCL buffer containing reducing agent such as (3-mercaptoethanol.
Solubilization of inclusion bodies: Inclusion bodies were dissolved in 6M guanidine hydrochloride in basic buffer. The dissolved inclusion bodies suspension was subjected to sulfitolysis by adding sodium sulfite and sodium tetrathionate.
Cleavage of leader peptide to obtain proinsulin: The pH of the solubilized inclusion bodies suspension was adjusted to 1 -2. Cyanogen bromide was added to the solution and incubated at 8°C overnight. The protein was then precipitated by adding excess purified water and then pellet obtained after centrifugation is washed with glycine buffer and dissolved in 8M urea.
Anion exchange chromatography: The protein dissolved in 8M urea was subjected to anion exchange chromatography. The protein was loaded on anion exchange resin and eluted with 8M urea buffer containing sodium chloride. The proinsulin was obtained in concentrated form.
Refolding: proinsulin was then subjected to refolding by dilution in glycine buffer. The pH of the solution was maintained at 9.5 and protein concentration was in the range of 0.5 to 1 mg/ml. The refolding reaction was allowed at 25°C for 2-3 hours. The reaction was stopped by addition of acetic acid so as to bring the pH to ~4.0.
Hydrophobic interaction chromatography (HIC): The refolded solution was subjected to hydrophobic interaction chromatography. The conductivity of the solution was increased by addition of sodium chloride and then protein was loaded onto hydrophobic interaction resin. The proinsulin was eluted with the increasing gradient of sodium chloride in glycine buffer.
Enzymatic cleavage by trypsin: protein eluted from HIC was digested with 1:5000 ratio of protein to trypsin. The trypsin used can be in the powder form or immobilized. When immobilized trypsin is used reaction is stopped by separating the beads containing trypsin by filtration. When powder form of trypsin is used, the reaction is quenched by addition of acetic acid.

Anion/Cation exchange chromatography: based on the form of trypsin used (powder or immobilized) for cleavage the protein can be subjected to either cation or anion exchange chromatography. The protein can be eluted by increasing gradient of sodium chloride.
Enzymatic cleavage by carboxypeptidase: protein from above step is then digested with carboxypeptidase to remove C-terminal arginine from B-chain.
Reverse phase chromatography: active insulin is purified from digested sample by reverse phase chromatography. The protein is loaded to achieve final binding in the range of 10-15 mg/ml of resin. The insulin is eluted using increasing gradient of acetonitrile.
EXAMPLES:
The examples given below are strictly for the illustration purpose only, they do not limit the invention in any manner. Various modifications of the disclosed embodiments, as well as alternate embodiments of the said invention, will become apparent to the person skilled in the art. It is therefore contemplated that such modifications can be made without departing from the true spirit or scope of the present invention as exemplified here.
Example 1: Construction of plasmid pET28aULLHNS
Gene encoding proinsulin along with nucleotide sequence of SEQ ID 9 coding for peptide ULL1INS, was designed, codon optimized and chemically synthesized and cloned in pUC57 by Genescript® to prepare pUC57ULLlINS. Gene fragment was cloned into pET28a vector. Restriction digestion of pUC57ULLlINS plasmid was done by setting up reaction mix having 10 μl plasmid, 1 ul Ndel, 1 ul BamHI, 2 μl 10X NEB buffer and 6 ul sterile water. pET28a vector subjected to restriction digestion by enzymes Ndel and BamHI to produce sticky ends. Reaction mix contained 10 μl pET28a vector, 1μl Ndel, 1μl BamHI, 2 ul 10X NEB buffer and 6 ul sterile water. Both reactions were incubated at 37°C for 2 hours. Gene fragment

was purified by gel elution kit (Qiagen®) and was ligated to pET28a vector. Further it was transformed into propagation host, E. coli Top 10 cells to propagate ligated plasmids. Such plasmid was isolated and transformed into E. coli Gold BL 21 DE3 cells to check the expression of protein.
Example 2: Construction of plasmid pET28aULL2INS
The gene encoding the proinsulin along with nucleotide sequence of SEQ ID 10 coding for peptide ULL2INS was designed, codon optimized and chemically synthesized and cloned in pUC57 by Genscript® to prepare pUC57ULL2INS. Gene fragment was cloned into pET28a vector. Restriction digestion of pUC57ULL2INS plasmid was done by seting up reaction mix having 10 ul plasmid, 1μl Ncol , 1μl BamHI, 2 μl 10X NEB buffer and 6 ul sterile water pET28a vector subjected to restriction digestion by enzymes Ncol and BamHI to produce sticky ends. Reaction mix contained 10 ul pET28a vector, lμl Ncol, lμl BamHI, 2 ul 10X NEB buffer and 6 μl sterile water. Both reactions were incubated at 37°C for 2 hours. Gene fragment was purified by gel elution kit (Qiagen®) and was ligated to pET28a vector Further it was transformed into propagation host, E. coli Top 10 cells to propagate ligated plasmids. Such plasmid was isolated and transformed into E. coli Gold BL 21 DE3 cells to check the expression of protein.
Example 3: Construction of plasmid pET28aULLlLSP
To obtain construct pET28aULLlLSP, PCR based Site Directed Mutagenesis was done in plasmid pET28aULLHNS. Site directed mutagenesis would bring change at B28 and B29 position of B chain from PK to KP. Following pair of mutagenesis primers was used
Forward: 5'GTG GTT TCT TTT ATA CCA A AC CGA CCA AAC GTG GCA TTG T 3'
Reverse: 5'ACA ATG CCA CGT TTG GTC GGT TTG GTA TAA AAG AAA CCA C 3'

PCR reaction mix consisted of 300 μM dNTP mix, 1 X PFu buffer. 10 pm each primer, 1 ul template plasmid and 41 μl sterile water. PCR condition used were: 94°C-8 mins, 94°C-40 sec, 55°C-40 sec, 68°C-3 mins (20 cycles) and 68°C for 10 mins. Site directed mutagenesis product was subjected to Dpnl digestion and then transformed into propagation host, E. coli Top 10 cells for propagation. Plasmid was isolated using Fermentas miniprep kit and then transformed into E. coli Gold BL 21 DE3 cells for expression of protein.
Example 4: Construction of plasmid pET28aULL2LSP
To obtain construct pET28aULL2LSP, PCR based Site Directed Mutagenesis was done in plasmid pET28aULL2INS. Site directed mutagenesis would bring change at B28 and B29 position of B chain from PK to KP. Following pair of mutagenesis primers was used
Forward: 5'GTG GTT TCT TTT ATA CCA AAC CGA CCA AAC GTG
GCA TTG T 3'
Reverse: 5'ACA ATG CCA CGT TTG GTC GGT TTG GTA TAA AAG
AAA CCA C 3'
PCR reaction mix consisted of 300 μM dNTP mix, 1 X PFu buffer, 10 pm each primer, 1 ul template plasmid and 41μl sterile water. PCR programme was kept as follows: 94°C for 8 mins, 94°C for 40 sec, 55°C for 40 sec, 68°C for 3 mins (20 cycles) and final extension at 68°C at 10 mins. Site directed mutagenesis product was subjected to Dpnl digestion and then transformed into propagation host, E. coli Top 10 cells for propagation. Plasmid was isolated using Fermentas® miniprep kit and then transformed into E. coli Gold BL 21 DE3 cells for expression of protein.
Example 5: Construction of plasmid pET28aULLlGR
To obtain the construct pET28aULLlGR a site directed mutagenesis in plasmid pET28aULLHNS was done. Site directed mutagenesis primers would introduce

additional Arg (R) at the end of B chain and replace Aspargine (N) with Glycine (G) in A chain. This would convert Insulin sequence into Glargine sequence. This was done in two step site directed mutagenesis PCR. In first SDM PCR following primers were used
Forward: 5'AAACCGACCAAACGTCGTGGCATTGTGGAACA 3' Reverse: 5' TGTTCCACAATGCCACGACGTTTGGTCGGTTT 3' PCR reaction mix consisted of 300 uM dNTP mix, 1 X PFu buffer, 10 pm each primer, 1 ul template plasmid and 41 μl sterile water. Thermal cycler conditions used for amplification were: 94°C for 8 mins, 94°C for 40 sec, 55°C for 40 sec, 68°C for 3 mins (20 cycles) and 68°C for 10 mins. Site directed mutagenesis product was subjected to Dpnl digestion and then transformed into propagation host, E. coli Top 10 cells for propagation. Plasmid was isolated using from these colonies using fermentas minprep kit. This plasmid was used as template for second SDM PCR
Further following pair of mutagenesis primers was used for second step SDM PCR.
Forward: 5' CTGGAAAACTATTGCGGCTAATAAGGATCCGAA 3'
Reverse: 5' TTCGGATCCTTATTAGCCGCAATAGTTTTCCAG 3'
PCR reaction mix consisted of 300 μM dNTP mix, 1 X PFu buffer, 10 pm each primer, 1 μl template plasmid and 41 μl sterile water. PCR program was kept as follows: 94°C for 8 mins, 94°C for 40 sec, 55°C for 40 sec, 68°C for 3 mins (20 cycles) and 68°C for 10 mins. Site directed mutagenesis product was subjected to Dpnl digestion and then transformed into propagation host, E. coli Top 10 cells for propagation. Plasmid was isolated using Fermentas miniprep kit and then transformed into E. coli Gold BL 21 DE3 cells for expression of protein.
Example 6: Construction of plasmid pET28aULL2GR
To obtain the construct pKT28aULL2GR a site directed mutagenesis in plasmid pET28aULL2INS was done. Site directed mutagenesis primer would introduce

additional Arg (R) at the end of B chain and replace Asparagine (N) with Glycine (G) in A chain. This would convert Insulin sequence into Glargine sequence. This was done in two step site directed mutagenesis PCR. In first SDM PCR following primers were used
Forward: 5'AAACCGACCAAACGTCGTGGCATTGTGGAACA 3'
Reverse: 5' TGTTCCACAATGCCACGACGTTTGGTCGGTTT 3'
PCR reaction mix consisted of 300 uM dNTP mix, 1 X PFu buffer, 10 pm each primer, 1 ul template plasmid and 41 μl sterile water. PCR program used for amplification was: 94°C for 8 mins, 94°C for 40 sec, 55°C for 40 sec, 68°C for 3 mins (20 cycles) and final extension at 68°C for 10 mins. Site directed mutagenesis product was subjected to Dpnl digestion and then transformed into propagation host, E. coli. Top 10 cells for propagation. Plasmid was isolated using from these colonies using fermentas minprep kit. This plasmid was used as template for second SDM PCR.
Further following pair of mutagenesis primers was used for second step SDM PCR.
Forward: 5' CTGGAAAACTATTGCGGCTAATAAGGATCCGAA 3'
Reverse: 5' TTCGGATCCTTATTAGCCGCAATAGTTTTCCAG 3'
PCR reaction mix consisted of 300 uM dNTP mix, 1 X PFu buffer, 10 pm each primer, 1 ul template plasmid and 41 μl sterile water. PCR program used for amplification was: 94°C for 8 mins, 94°C for 40 sec, 55°C for 40 sec, 68°C for 3 mins (20 cycles) and 68°C for 10 mins. Site directed mutagenesis product was subjected to Dpnl digestion and then transformed into propagation host, E. coli. Top 10 cells for propagation. Plasmid was isolated using Fermentas miniprep kit and then transformed into E. coli Gold BL 21 DE3 cells for expression of protein.
Construct sequencing: All the constructs prepared in this work were confirmed by sequencing.

Example 7: Expression analysis of insulin using construct pET28aULLlINS.
The E. coli cells containing vector pET28aULLHNS was grown in 50 ml of Hiveg Luria broth containing 20 ug/ml kanamycin at 37°C, 160 rpm for overnight. The 2% culture was then transferred to 150 ml of production medium containing 1% yeast extract , 1 % Dextrose, 0.3% KH2PO4, 1.25% K2HPO4, 0.5% (NH4)2SO4, 0.05% NaCl, 0.1% MgS04.7H2O and 0.1% of trace metal solution (FeS04, ZnSO4, CoCl2, NaMoO4, CaCl2, MnCl2, CuSO4 or H3BO3 in Hydrochloric acid). Kanamycin was added to a final concentration of 20μg/ml. The culture was incubated at 37°C, 140 rpm. The culture was induced with 1 mM IPTG when cell density reached to 1-1.2 (OD600nm). The culture was further incubated for 4 hours. The expression of pre-proinsulin was analyzed by SDS-PAGE analysis. The expression was pre-proinsulin was -25% of total cellular protein.
Example 8: Expression analysis of insulin using construct pET28aULL2INS.
The E. coli cells containing vector pET28aULL2INS was grown in 50 ml of Hiveg Luria broth containing 20 μg/ml kanamycin at 37°C, 160 rpm for overnight. The 2% culture was then transferred to 150 ml of production medium containing 1% yeast extract , 1 % Dextrose, 0.3% KH2PO4, 1.25% K2HPO4, 0.5% (NH4)2SO4, 0.05% NaCl, 0.1% MgSO4.7H2O and 0.1% of trace metal solution (FeSO4, ZnSO4, CoCl2, NaMoO4, CaCl2, MnCl2, CuSO4 or H3BO3 in Hydrochloric acid). Kanamycin was added to a final concentration of 20ug/ml. The culture was incubated at 37°C, 140 rpm. The culture was induced with 1 mM IPTG when cell density reached to 1 -1.2 (OD600nm). The culture was further incubated for 4 hours. The expression of pre-proinsulin was analyzed by SDS-PAGE analysis. The expression was pre-proinsulin was -40% of total cellular protein.
Example 9: Preparation of Human insulin using the construct pET28aULLHNS
Fermentation process - E. coli cells transformed with pET28aULLHNS were grown in production medium, induced with IPTG and cell mass is obtained at the end of fermentation process.

Cell lysis - The cells containing inclusion bodies of pre-proinsulin were re-suspended in Tris-NaCl buffer and lysed by high pressure with Mini-DeBEE homogenizer.
Inclusion bodies preparation - Inclusion bodies enriched with pre-proinsulin were washed with Tris-NaCl buffer containing reducing agent such as β-mercaptoethanol.
Solubilization of inclusion bodies - Inclusion bodies were dissolved in 6M guanidine hydrochloride in basic buffer. The dissolved inclusion bodies suspension was subjected to sulfitolysis by adding sodium sulfite and sodium tetrathionate.
Cleavage of leader peptide to obtain proinsulin - The pH of the solubilized inclusion bodies suspension was adjusted to 1-2. Cyanogen bromide was added to the solution and incubated at 8°C overnight. The protein was then precipitated by adding excess purified water and then pellet obtained after centrifugation is washed with glycine buffer and dissolved in 8M urea.
Anion exchange chromatography - The protein dissolved in 8M urea was subjected to anion exchange chromatography. The protein was loaded on anion exchange resin and eluted with 8M urea buffer containing sodium chloride. The proinsulin was obtained in concentrated form.
Refolding - The proinsulin was then subjected to refolding by dilution in glycine buffer. The pH of the solution was maintained at 9.5 and protein concentration was in the range of 0.5 to 1 mg/ml. The refolding reaction was allowed at 25°C for 2-3 hours. The reaction was stopped by addition of acetic acid so as to bring the pH to -4.0.
Hydrophobic interaction chromatography (HIC) - The refolded solution was subjected to hydrophobic interaction chromatography. The conductivity of the solution was increased by addition of sodium chloride and then protein was loaded onto hydrophobic interaction resin. The proinsulin was eluted with the increasing gradient of sodium chloride in glycin buffer.

Enzymatic cleavage by trypsin - The protein eluted from HIC was digested with 1:8000 ratio of protein to trypsin at 4°C. The reaction was monitored by HPLC and was at the completion reaction was stopped by separating the immobilized trypsin with filtration.
Anion exchange chromatography - The digested protein was further purified by anion exchange chromatography. The protein was loaded onto anion exchange chromatography and eluted with buffer containing sodium chloride. The Insulin was eluted by using increasing gradient of sodium chloride.
Enzymatic cleavage by carboxypeptidase - The protein from above step is then digested with carboxypeptidase to remove C-terminal arginine from B-chain.
Reverse phase chromatography - The active insulin is purified from digested sample by reverse phase chromatography. The protein is loaded to achieve final binding in the range of 10-15 mg/ml of resin. The insulin is eluted using increasing gradient of acetonitrile.
Example 10: Preparation of Human insulin using the construct pET28aULL2GLR
This example demonstrates the utility of the invention to produce the higher quantity of human insulin from the gene construct pET28aULL2GLR.
The process followed for preparation of human insulin glargine using construct pET28aULL2INS as described below.
Fermentation process - E. coli cells transformed with pET28aULL 1 INS were grown in production medium, induced with IPTG and cell mass is obtained at the end of fermentation process.
Cell lysis - The cells containing inclusion bodies of pre-proinsulin were re-suspended in Tris-NaCl buffer and lysed by high pressure with Mini-DeBEE homogenizer.

Inclusion bodies preparation - Inclusion bodies enriched with pre-proinsulin were washed with Tris-NaCl buffer containing reducing agent such as (3-mercaptoethanol.
Solubilization of inclusion bodies - Inclusion bodies were dissolved in 6M guanidine hydrochloride in basic buffer. The dissolved inclusion bodies suspension was subjected to sulfitolysis by adding sodium sulfite and sodium tetrathionate.
Cleavage of leader peptide to obtain proinsulin - The pH of the solubilized inclusion bodies suspension was adjusted to 1 -2. Cyanogen bromide was added to the solution and incubated at 8°C overnight. The protein was then precipitated by adding excess purified water and then pellet obtained after centrifugation is washed with glycine buffer and dissolved in 8M urea.
Anion exchange chromatography - The protein dissolved in 8M urea was subjected to anion exchange chromatography. The protein was loaded on anion exchange resin and eluted with 8M urea buffer containing sodium chloride. The proinsulin was obtained in concentrated form.
Refolding - The proinsulin was then subjected to refolding by dilution in glycine buffer. The pH of the solution was maintained at 9.5 and protein concentration was in the range of 0.5 to 1 mg/ml. The refolding reaction was allowed at 25°C for 2-3 hours. The reaction was stopped by addition of acetic acid so as to bring the pH to -4.0.
Hydrophobic interaction chromatography (HIC) - The refolded solution was subjected to hydrophobic interaction chromatography. The conductivity of the solution was increased by addition of sodium chloride and then protein was loaded onto hydrophobic interaction resin. The proinsulin was eluted with the increasing gradient of sodium chloride in glycine buffer.
Enzymatic cleavage by trypsin - The protein eluted from HIC was digested with 1:5000 ratio of protein to trypsin. The reaction was carried out at 4°C and pH 11.2. The reaction was monitored by HPLC analysis. After complete digestion, reaction was quenched by addition of acetic acid.

Cation exchange chromatography - The digested protein was further purified by cation exchange chromatography. The protein was loaded onto cation exchange chromatography and eluted with buffer containing Sodium Chloride. The Insulin glargine was eluted by using increasing gradient of Sodium Chloride.
Reverse phase chromatography - The active insulin is purified from digested sample by reverse phase chromatography. The protein is loaded to achieve final binding in the range of 10-15 mg/ml of resin. The insulin is eluted using increasing gradient of acetonitrile.

Claims
We Claim,
1. A process to produce insulin and insulin analogues, wherein the process
comprises pre-proinsulin of Formula 1:
R1-X1-X2-X3 Formula 1
as an intermediate, wherein X1 is a 'B' chain of insulin or insulin analogues,
X2 is a dipeptide selected from RR or KR or RK or KK, X3 is an 'A' chain of
insulin or insulin analogues and R1 is a leader peptide sequence.
2. The process as claimed in claim 1, wherein the process comprises leader
peptide selected from:
a) the peptide having amino acid sequence of SEQ ID 1,
b) the peptide having amino acid sequence of SEQ ID 2,
c) a peptide comprising amino acid sequence of: MSRIVINAYAKATQP;
d) a peptide comprising amino acid sequence of: MEKHTKDQIIEAPHM; or
e) a peptide having at least 80% homology to a), b), c), or d).

3. The process as claimed in claim 1, wherein the process comprises preparation proinsulin of Formula 2: X1-X2-X3 from pre-proinsulin, wherein X1 is a 'B' chain of insulin or insulin analogues, X2 is a dipeptide selected from RR or KR or RK or KK, X3 is an 'A' chain of insulin or insulin analogues.
4. The process as claimed in claim 3, wherein the process comprises expression of proinsulin, by culturing prokaryotic cells comprising a nucleic acid encoding proinsulin operably linked to the leader peptide in a production medium.
5. The process as claimed in claim 4, wherein prokaryotic host cell is selected from Pseudomonas cell or Escherichia coli cell.
6. The process as claimed in claim 4, wherein the production medium comprises 1% yeast extract, 1 % Dextrose, 0.3% KH2PO4, 1.25% K2HPO4, 0.5% (NH4)2SO4, 0.05% NaCl, 0.1% MgSO4.7H2O and 0.1% of trace metal solution

(FeSO4, ZnSO4, CoCl2, NaMoO4, CaCl2, MnCl2, CuSO4 or H3BO3 in Hydrochloric acid), Kanamycin (20μg/ml) per 100 ml.
7. A polypeptide comprising the leader peptide operably linked to the precursor
of insulin or insulin analogues, wherein the leader peptide is selected from:
a) the peptide having amino acid sequence of SEQ ID 1,
b) the peptide having amino acid sequence of SEQ ID 2,
c) a peptide comprising amino acid sequence of: MSRIVINAYAKATQP;
d) a peptide comprising amino acid sequence of: MEKHTKDQIIEAPHM; or
e) a peptide having at least 80% homology to a), b), c), or d).

8. The polypeptide as claimed in claim 7, wherein the precursor of insulin or insulin analogues is a proinsulin of Formula 2: X1-X2-X3, wherein X1 is a 'B' chain of insulin or insulin analogues, X2 is a dipepride selected RR or KR or RK or KK, X3 is an 'A' chain of insulin or insulin analogues.
9. The polypeptide as claimed in claim 7, wherein the leader peptide directs the expression of the insulin and insulin analogues in the prokaryotic host cell.
10. The polypeptide as claimed in claim 7, wherein the prokaryotic host cell is selected from Pseudomonas cell or Escherichia coli cell.
11. A leader peptide sequence selected from:

a) the peptide having amino acid sequence of SEQ ID 1,
b) the peptide having amino acid sequence of SEQ ID 2,
c) a peptide comprising amino acid sequence of: MSRIVINAYAKATQP;
d) a peptide comprising amino acid sequence of: MEKHTKDQIIEAPHM; or
e) a peptide having at least 80% homology to a), b), c), or d).
12. A proinsulin sequence of Formula 2: X1-X2-X3 prepared using pre-proinsulin
of Formula 1: R1-X1-X2-X3, wherein X1 is a 'B' chain of insulin or insulin
analogues, X2 is a dipeptide selected RR or KR or RK or KK, X3 is an 'A' chain
of insulin or insulin analogues and R1 is selected from:
a) the peptide having amino acid sequence of SEQ ID 1,
b) the peptide having amino acid sequence of SEQ ID 2,

c) a peptide comprising amino acid sequence of: MSRIVINAYAKATQP;
d) a peptide comprising amino acid sequence of: MEKHTKDQIIEAPHM; or
e) a peptide having at least 80% homology to a), b), c), or d).
13. A nucleotide sequence encoding leader peptide selected from:
a) the peptide having amino acid sequence of SEQ ID 1,
b) the peptide having amino acid sequence of SEQ ID 2,
c) a peptide comprising amino acid sequence of: MSRIVINAYAKATQP;
d) a peptide comprising amino acid sequence of: MEKHTKDQIIEAPHM; or
e) a peptide having at least 80% homology to a), b), c), or d).

14. The nucleotide sequence as claimed in claim 13, wherein the sequences are selected from SEQ ID 9 or SEQ ID 10.
15. A nucleotide sequence encoding amino acid sequence of Formula 1, R1-X1-X2-X3, wherein X1 is a 'B' chain of insulin or insulin analogues, X2 is a dipeptide selected RR or KR or RK or KK, X3 is an 'A' chain of insulin or insulin analogues and R1 is selected from:

a) the peptide having amino acid sequence of SEQ ID 1,
b) the peptide having amino acid sequence of SEQ ID 2,
c) a peptide comprising amino acid sequence of: MSRIVINAYAKATQP;
d) a peptide comprising amino acid sequence of: MEKHTKDQIIEAPHM; or
e) a peptide having at least 80% homology to a), b), c), or d).

16. The nucleotide sequence as claimed in claim 15, wherein the sequence is selected from SEQ ID 11, SEQ ID 12, SEQ ID 13, SEQ ID 14, SEQ ID 15, SEQ ID 26.
17. A recombinant gene construct comprising nucleotide sequence as claimed in claim 15.
18. The recombinant gene construct as claimed in claim 17, wherein the gene construct is selected from pET28aULLHNS, pET28aULL2INS, pET28aULLlLSP, pET28aULL2LSP, pET28aULLIGR or pET28aULL2GR.

19. An expression vector comprising gene construct having a nucleotide sequence as claimed in claim 15.
20. The expression vector as claimed in claim 19, wherein the expression vector comprises the plasmid pET28aULLlINS and/or pET28aULL2INS for production of insulin.
21. The expression vector as claimed in claim 19, wherein the expression vector comprises the plasmid pET28aULLlLSP and/or pET28aULL2LSP for production of insulin Lispro.
22. The expression vector as claimed in claim 19, wherein the expression vector comprises the plasmid pET28aULLlGR and/or pET28aULL2GR for production of insulin glargine.
23. The expression vector as claimed in claim 19, wherein the expression is carried out in prokaryotic host cell.
24. The expression vector as claimed in claim 23, wherein the prokaryotic host cell is selected from Pseudomonas cell or Escherichia coli cell.
25. A process to prepare recombinant gene construct comprising recombinant gene expression vector for expression of Formula 1: R1-X1-X2-X3 wherein X1 is a 'B' chain of insulin or insulin analogues, X2 is a dipeptide selected RR or KR or RK or KK, X3 is an 'A' chain of insulin or insulin analogues and R1 is selected from:

a) the peptide having amino acid sequence of SEQ ID 1,
b) the peptide having amino acid sequence of SEQ ID 2,
c) a peptide comprising amino acid sequence of: MSRIVINAYAKATQP;
d) a peptide comprising amino acid sequence of: MEKHTKDQIIEAPHM; or
e) a peptide having at least 80% homology to a), b), c), or d).
26. Insulin or Insulin analogues prepared by the process comprising pre-proinsulin
of Formula 1:
R1-X1-X2-X3 Formula 1

as an intermediate, wherein X1 is a 'B' chain of insulin or insulin analogues, X2 is a dipeptide selected RR or KR or RK or KK, X3 is an 'A' chain of insulin or insulin analogues and R] the leader peptide.
27. The process as claimed in claim 26, wherein the process comprises leader peptide selected from:
a) the peptide having amino acid sequence of SEQ ID 1,
b) the peptide having amino acid sequence of SEQ ID 2,
c) a peptide comprising amino acid sequence of: MSRIVINAYAKATQP;
d) a peptide comprising amino acid sequence of: MEKHTKDQIIEAPHM; or
e) a peptide having at least 80% homology to a), b), c), or d).