LEUKOTRIENE B4 ANTAGONIST COMPOUND
Leukotriene B4 (LTB4) is an eicosanoid proinflammatory lipid mediator
generated by a pathway downstream of the enzymes 5-lipoxygenase and leukotriene A4
hydrolase. LTB4 activates multiple leukocyte subsets leading to cell recruitment,
production of reactive oxygen species, and induction of gene expression. LTB4 signals
primarily through its high-affinity G protein-coupled receptor, BLT1, and, to a lesser
extent, its low-affinity BLT2 receptor. The BLTi receptor is highly expressed in specific
subsets of circulating peripheral blood leukocytes, as well as on nonleukocytes including
endothelial cells and smooth muscle cells. LTB4 is involved in the vascular pathology of
several inflammatory conditions including abdominal aortic aneurysm (AAA) and
atherosclerosis.
A degenerative disorder, AAA is characterized by continuous progression of
inflammation of the aortic wall, uncontrolled local production of destructive proteases,
destruction of structural proteins, and depletion of medial smooth muscle cells. The early
or acute phase begins with recruitment of inflammatory cells. Injury results when local
reactive oxygen, leukotrienes, chemokines and matrix degradation products act in concert
to activate various protease systems. The extracellular matrix of the abdominal aorta may
also be weakened by the excess degradation leading to a condition known as AAA.
The role of lipid deposition in the formation of atherosclerotic plaque in the intima
of arteries is well established. Another major factor in atherogenesis is inflammatory cell
recruitment to intimal lesions. Plaques that have both a high lipid and inflammatory cell
content are vulnerable to rupture and subsequent events including myocardial infarction
and cereberal ischemia.
Currently, AAA is the tenth leading cause of death in men greater than 55 years
old. There is no known approved pharmaceutical treatment indicated for AAA. Also,
despite the availability of pharmaceutical treatments that deal with high cholesterol levels
and high blood pressure, atherosclerosis remains an area of further medical need. Further,
despite the promise of leukotriene antagonists such as those in US Patent 5,462,954 and
WO 98/42346, no LTB4 antagonist has been approved for inflammatory indications.
LTB4 antagonist compounds have been shown to also be ligands of peroxisome
proliferator activated receptors (PPAR) which is believed to limit their development as
anti-inflammatory agents. Antagonism of LTB4, with no meaningful PPAR binding,
provides an option for addressing the medical needs for treating AAA, atherosclerosis,
both.
The present invention provides a compound of Formula (I):
or a pharmaceutically acceptable salt thereof. The compound of formula (I) is named, 4-
[[3-[3-[2-Ethyl-4-(4-fluorophenyl)-5-hydroxy-phenoxy]propoxy]-2 -propylphenyl]
amino]-2,2-dimethyl-4-oxo-butanoic acid according to the IUPAC naming feature
in Symyx® Draw version 3.2.NET.
A second aspect of the present invention provides a sodium salt of a compound of
Formula 1which is Sodium 4-[[3-[3-[2-ethyl-4-(4-fluorophenyl)-5-hydroxyphenoxy]
propoxy]-2-propyl-phenyl]amino]-2,2-dimethyl-4-oxo-butanoate.
A third aspect of the present invention provides a pharmaceutical composition
comprising a compound of Formula (I) or a pharmaceutically acceptable salt thereof and
a pharmaceutically acceptable carrier.
A fourth aspect of the present invention provides a pharmaceutical composition
comprising Sodium 4-[[3-[3 -[2-ethyl-4-(4-fluorophenyl)-5-hydroxy-phenoxy]propoxy] -2-
propyl-phenyl]amino]-2,2-dimethyl-4-oxo-butanoate and a pharmaceutically acceptable
carrier.
A fifth aspect of the present invention provides a method for treating AAA,
atherosclerosis, or both in a patient in need thereof, comprising administering a
therapeutically effective amount of a compound of Formula (I), or a pharmaceutically
acceptable salt thereof, or a pharmaceutical composition comprising a pharmaceutically
acceptable carrier and a therapeutically effective amount of a compound of Formula (I),
or a pharmaceutically acceptable salt thereof, to said patient.
A sixth aspect of the present invention provides a method for treating AAA,
atherosclerosis, or both in a patient in need thereof, comprising administering a
therapeutically effective amount of a compound Sodium 4-[[3-[3-[2-ethyl-4-(4-
fluorophenyl)-5-hydroxy-phenoxy]propoxy]-2-propyl-phenyl]amino]-2,2-dimethyl-4-
oxo-butanoate or a pharmaceutical composition comprising a pharmaceutically acceptable
carrier and a therapeutically effective amount of a compound Sodium 4-[[3-[3-[2-ethyl-4-
(4-fluorophenyl)-5-hydroxy-phenoxy]propoxy]-2-propyl-phenyl]amino]-2,2-dimethyl-4-
oxo-butanoate to said patient.
A seventh aspect of the present invention provides a compound of Formula (I) or a
pharmaceutically acceptable salt thereof, for use in therapy.
An eighth aspect of the present invention provides a compound Sodium 4-[[3-[3-
[2-ethyl-4-(4-fluorophenyl)-5-hydroxy-phenoxy]propoxy]-2-propyl-phenyl]amino]-2,2-
dimethyl-4-oxo-butanoate for use in therapy.
A ninth aspect of the present invention provides a compound of Formula (I), or a
pharmaceutically acceptable salt thereof, for use in the treatment of AAA, atherosclerosis,
or both.
A tenth aspect of the present invention provides a compound Sodium 4-[[3-[3-[2-
ethyl-4-(4-fluorophenyl)-5-hydroxy-phenoxy]propoxy]-2-propyl-phenyl]amino]-2,2-
dimethyl-4-oxo-butanoate for use in the treatment of AAA, atherosclerosis, or both.
An eleventh aspect of the present invention is the use of a compound of Formula
(I), or a pharmaceutically acceptable salt thereof, for the manufacture of a medicament for
the treatment of AAA, atherosclerosis, or both.
A twelfth aspect of the present invention is the use of a compound Sodium 4-[[3-
[3-[2-ethyl-4-(4-fluorophenyl)-5-hydroxy-phenoxy]propoxy]-2-propyl-phenyl]amino]-
2,2-dimethyl-4-oxo-butanoate for the manufacture of a medicament for the treatment of
AAA, atherosclerosis, or both.
Another aspect of the present invention provides a pharmaceutical composition
comprising a compound of Formula (I), or pharmaceutically acceptable salt thereof, in
combination with a pharmaceutically acceptable carrier, and optionally one or more other
therapeutic agents.
A further aspect of the present invention provides a pharmaceutical composition
comprising a compound Sodium 4-[[3-[3-[2-ethyl-4-(4-fluorophenyl)-5-hydroxyphenoxy]
propoxy]-2-propyl-phenyl]amino]-2,2-dimethyl-4-oxo-butanoate in combination
with a pharmaceutically acceptable carrier, and optionally one or more other therapeutic
agents.
Yet another aspect of the present invention provides a compound of Formula (I),
or a pharmaceutically acceptable salt thereof, for use in the treatment of AAA, or
atherosclerosis, or both.
A further aspect of the present invention provides a compound Sodium 4-[[3-[3-
[2-ethyl-4-(4-fluorophenyl)-5-hydroxy-phenoxy]propoxy]-2-propyl-phenyl]amino]-2,2-
dimethyl-4-oxo-butanoate for use in the treatment of AAA or atherosclerosis, or both.
Yet another aspect of the present invention provides the use of a compound of
Formula (I), or a pharmaceutically acceptable salt thereof, for the manufacture of a
medicament for the treatment of AAA or atherosclerosis, or both.
A still further aspect of the present invention provides the use of a compound
Sodium 4-[[3-[3-[2-ethyl-4-(4-fluorophenyl)-5-hydroxy-phenoxy]propoxy]-2-propylphenyl]
amino]-2,2-dimethyl-4-oxo-butanoate for the manufacture of a medicament for
the treatment of AAA or atherosclerosis, or both.
As used above and throughout the specification of the invention, the following
terms, unless otherwise indicated will have the following meaning:
The term "abdominal aortic aneurysm" (or "AAA") as used herein shall mean a
localized dilation or bulge of the abdominal aorta, generally understood to be that portion
of the aorta below the diaphragm, in a mammal causing the size of at least a segment of
the abdominal aorta to exceed the size of an otherwise considered normal state of 2 cm.
The abdominal aorta may be measured and compared in terms of any measurement
dimension including but not limited to outer diameter, luminal diameter, luminal
perimeter, and luminal area. The means for measurement and diagnosis may be through
the use of ultrasound, CT scan, or other imaging techniques. For example, AAA is
present in a human when the outer aortic diameter is greater than 3 cm. If the outer aortic
diameter is however more than 5 cm, then immediate surgical or endovascular repair
(stent or graft) is the standard of care to prevent rupture and potential fatality. If however
such treatment is unavailable or not an option due to any reason, e.g., age, then this
population may also be treated using the present invention.
The term "atherosclerosis" as used herein shall mean a lipid-rich plaque or lesion
in the intima of arteries.
The term "in need thereof as used herein shall mean having or being diagnosed
with a condition, AAA or atherosclerosis, that requires treatment.
The term "patient" as used herein shall mean a mammal such as a dog, cat, horse,
cow, sheep, pig, or human.
The term "pharmaceutically acceptable salt thereof refers to salts of the
compounds of the present invention. Examples and methods for their preparation are well
within the knowledge of those skilled in the art. See, for example, Stahl et ah,
"Handbook of Pharmaceutical Salts: Properties, Selection and Use," VCHA/Wiley-VCH,
2002; and S.M. Berge, et ah, "Pharmaceutical Salts, "Journal of Pharmaceutical
Sciences, Vol. 66, No. 1, January 1977, pages 1-19. Particular pharmaceutically
acceptable salts include sodium, potassium, calcium and magnesium. A preferred
pharmaceutically acceptable salt of the present invention is sodium.
The term "therapeutically effective amount" refers to the amount or dose of a
compound of Formula (I), or a pharmaceutically acceptable salt thereof, or composition
comprising a compound of Formula (I) or a pharmaceutically acceptable salt thereof, to
achieve treatment. Anticipated dosages of a compound of Formula (I), or a
pharmaceutically acceptable salt thereof, are in the range of 60 to 1000 mg/patient/day.
Preferred dosages are anticipated to be in the range of 100 to 800 mg/patient/day. Most
preferred dosages are anticipated to be in the range of 130 to 650 mg/patient/day. A
therapeutically effective amount can be readily determined by the attending physician, as
one skilled in the art, by considering a number of factors known to a person skilled in the
art such as, for example, weight, height, age, general health of the patient, severity of the
condition, mode of administration, dosing regimen, etc. Although expressed as dosage on
a per day basis, the dosing regimen may be adjusted to provide a more optimal
therapeutic benefit to a patient. In addition to daily dosing, dosing twice a day (BID) or
three times a day may be appropriate. A dosing regimen of BID is presently
contemplated as preferred.
The term "treatment" as used herein shall mean slowing the rate or progression of
a disease state. It may also include halting the disease state. The term may further
include not only halting the disease, but also reducing any disease state that already has
occurred. For example, in the context of AAA, the term "treatment" may mean slowing
of the expansion rate of an abdominal aortic aneurysm. It may also include stopping the
expansion of the abdominal aortic aneurysm. Furthermore, it may include reducing any
expansion that has already occurred. In the context of atherosclerosis, the term
"treatment" may mean slowing or stopping the progression of atherosclerotic plaque. It
may also include reducing existing plaque.
The compound of the present invention is preferably formulated as a
pharmaceutical composition and administered by a variety of routes. Preferably, such
compositions are for oral administration. Examples and methods for their preparation are
well within the knowledge of those skilled in the art. See, for example, Remington: The
Science and Practice of Pharmacy (A. Gennaro, et al, eds. 19th ed., Mack Publishing Co.,
1995).
The compound of the present invention, and pharmaceutically acceptable salts
thereof, may be prepared by a variety of procedures known in the art as well as those
described in the Schemes, Preparations, and Examples below. However, the following
discussion is not intended to be limiting to the scope of the present invention in any way.
For example, the specific synthetic steps for each of the routes described may be
combined in different ways, or in conjunction with steps from different Schemes, to
prepare the compound, and pharmaceutically acceptable salts, of the present invention.
Scheme 2 illustrates an alternate process for synthesizing the compound of the present
invention.
The following Preparations and Examples further illustrate the invention and
represent typical synthesis of the compound of Formula (I), including any novel
intermediate compounds. The reagents and starting materials are readily available to one
of ordinary skill in the art or may be made by procedures which are selected from
standard techniques of organic and heterocyclic chemistry, techniques which are
analogous to the syntheses of known structurally similar compounds, and the procedures
described in the Examples below, including any novel procedures.
Examples of known procedures and methods include those described in general
reference texts such as Comprehensive Organic Transformations, VCH Publishers Inc,
1989; Compendium of Organic Synthetic Methods, Volumes 1-10, 1974-2002, Wiley
Interscience; Advanced Organic Chemistry, Reactions Mechanisms, and Structure, 5th
Edition, Michael B. Smith and Jerry March, Wiley Interscience, 2001; Advanced Organic
Chemistry, 4th Edition, Part B, Reactions and Synthesis, Francis A. Carey and Richard J .
Sundberg, Kluwer Academic / Plenum Publishers, 2000, etc., and references cited therein.
The naming of the following Preparations and Examples is generally done using the
IUPAC naming feature in Symyx® Draw version 3.2.NET. Alternative names using
different naming methodologies may be used to unambiguously identify the Preparations
and the compound of Formula (I).
As used herein, the following terms have the meanings indicated: "Bn" refers to
benzyl; "DBU" refers to l,8-diazabicyclo[5.4.0]undec-7-ene; "DMF" refers to
dimethylformamide; "DMSO" refers to dimethyl sulfoxide; "EtOAc" refers to ethyl
acetate; "EtOH" refers to ethanol; "MeOH" refers to methanol; "NBS" refers to Nbromosuccinimide;
and "THF" refers to tetrahydrofuran.
Scheme 1
In Scheme 1 is depicted formation of an intermediate 2-propyl aniline (6).
In Step 1, methyl 3-hydroxy-2-propyl-benzoate (2) is alkylated with 1-benzyloxy-
5-(3-chloropropoxy)-4-ethyl-2-(4-fluorophenyl)benzene (1) (prepared according to Org.
Process Res. Dev. (2009), 13: 268-275) to provide a methyl propoxy benzoate (3). The
skilled artisan will recognize that there are various reaction conditions which will effect
such an alkylation. For example, the reaction can be performed in an inert solvent, such
as DMSO, in the presence of N,N-dimethylpyridin-4-amine with potassium carbonate as
base for 2 to 4 days at about 50 to 90 °C. Alternatively the reaction can be performed in
DMF, in the presence of potassium iodide, with an inorganic base, such as potassium
carbonate or preferably cesium carbonate. The reaction is performed at a temperature of
50 to 110 °C for 8 to 24 h. Other bases that can be used include, for example, sodium
hydride.
In Step 2, the methyl benzoate (3) is hydrolyzed to the benzoic acid (not shown)
using KOH in N-methylpyrrolidone at a temperature of 90 to 140 °C. This is followed, in
Step 3, by treatment with thionyl chloride to make the acyl halide and reaction with
ammonium hydroxide to obtain the benzamide (4).
In Step 4, the benzamide (4) undergoes a Hofmann rearrangement to give the
isocyanate, which in the presence of MeOH as solvent, provides the carbamate (5). The
reaction takes place in the presence of a base, such as DBU and a brominating agent, such
as NBS. The solvent used is MeOH and the reaction proceeds at a temperature of -10 to
10 °C for a period of 12 to 30 h.
In Step 5, the carbamate (5) is hydrolyzed to the 2-propyl aniline (6) using solid
potassium hydroxide in an inert solvent, such as N-methylpyrrolidone at a temperature of
90 to 140 °C for 1 to 8 h.
Methyl 3-hydroxy-2-propyl-benzoate (2) is prepared from 2,3-dimethoxybenzoic
acid. The benzoic acid is converted to tert-butyl 2,3-dimethoxybenzoate through the acyl
halide. Treatment with a Grignard reagent, propylmagnesium chloride, results in
substitution of the ortho methoxy group to provide tert-butyl 3-methoxy-2-propybenzoate.
Deprotection with BBr yields 3-hydroxy-2-propyl-benzoic acid which is then
esterified to provide methyl 3-hydroxy-2-propyl benzoate (6). An alternate synthesis is
available in the literature starting with 3-benzyloxybenzaldehyde (Bioorg. Med. Chem.
1998, 6, 595-604).
Scheme 2
In Scheme 2 is depicted formation of an intermediate 2-allyl aniline (10).
In Step 1, N-3(-allyloxyphenyl)acetamide (7) undergoes a Claisen rearrangement
to provide N-(2-allyl-3-hydroxy-phenyl)acetamide (8). The reaction is performed in a
high boiling inert solvent, such as dimethylaniline, at the reflux temperature of the solvent
for 12 to 24 h.
In Step 2, N-(2-allyl-3-hydroxy-phenyl)acetamide (8) is alkylated with benzyloxy-
5-(3-chloropropoxy)-4-ethyl-2-(4-fluorophenyl)benzene (1) to provide the phenoxy
acetamide (9), using conditions previously described for Scheme 1, Step 1.
In Step 3, the phenoxy acetamide (9) is hydrolyzed to give the 2-allyl aniline (10).
The reaction proceeds in a solvent mixture of 6 N HCl/ethanol at a temperature of 50 °C
to the reflux temperature of the solvent for about 1 to 12 h.
N-3(-allyloxyphenyl)acetamide (7) is prepared by alkylation of acetamidophenol
with 3-iodopropene.
Scheme 3
In Scheme 3 is depicted the synthesis of the compound of the invention (13).
In Step 1, an aniline of formula ( 11) (Y = allyl or propyl) is acylated with 3,3-
dimethyltetrahydrofuran-2,5-dione to provide the amide (12). The reaction is performed
in an inert solvent such as dichloromethane or THF. An organic base, such as Nmethylmorpholine
or diisopropylethylamine, may be added. The reaction proceeds at a
temperature of 10 to 40 °C for 6 to 72 h.
In Step 2, the benzyl protecting group of compound (12) is removed using
hydrogenation to provide the compound of the invention (13). The reaction proceeds
under a hydrogen atmosphere using 5 or 10% palladium on carbon in a solvent or mixture
of solvents such as THF, EtOH/THF, EtOH, MeOH, or EtOAc/MeOH. If Y = allyl, then
the ally group is reduced to the propyl group under the reaction conditions. If desired, the
product can be converted to the sodium carboxylate salt using aqueous NaOH ( 1 eq) and
concentrating under vacuum.
Preparation 1
te rt -But l 2,3-dimethoxybenzoate
Add thionyl chloride (67.6 mL, 928 mmol) dropwise to a solution of 2,3-
dimethoxybenzoic acid (132 g, 714 mmol) and DMF (1.32 mL) in toluene (528 mL)
maintained at 40 °C. Stir the solution for 1 h at 40 °C after the addition is complete.
Concentrate the mixture in vacuo and dissolve the residue in dichloromethane (528 mL).
Warm the mixture to reflux and add tert-butyl alcohol (203.4 mL). Add pyridine (86.6
mL) dropwise over 5 min followed by addition of N,N-dimethylpyridin-4-amine (4.36 g,
35.7 mmol) and stir the mixture 1 h while cooling to ambient temperature. Dilute the
mixture with water (200 mL) and acidify the mixture (pH = 2) with 2 N hydrochloric
acid. Separate the phases and wash the organic phase with 0.5 N hydrochloric acid (2
30 mL). Wash the organic phase with 15% potassium carbonate, water, and brine.
Concentrate the organic phase in vacuo to yield the title compound (141.2 g, 83%) as a
white solid. ES/MS m/z 165 [M-(C4H90)] +.
Preparation 2
-Butyl 3-methoxy-2-propyl-benzoate
To a chilled solution (-34 °C) of tert-butyl 2,3-dimethoxybenzoate (171 g, 718
mmol) in THF (855 niL) add 2 M propylmagnesium chloride in ether (448.5 mL, 897
mmol) dropwise at a rate sufficient to keep the internal temperature below -10 °C. Stir
the mixture 3.5 h maintaining the temperature near -12 °C. Add acetic acid (5 1.4 mL)
dropwise to the mixture while maintaining the temperature below -10 °C and then dilute
with water (340 mL). Separate the phases and extract the aqueous phase with methyl-
-butylether (3 x 100 mL). Wash the combined organic extracts with brine and
concentrate the organic phase in vacuo to yield the title compound (190 g, quantitative) as
a colorless oil containing traces of THF and methyl-tert-butylether. 1H NMR (300 MHz,
CDC13) d 7.24-7.14 (m, 2H), 6.93 (dd, J= 1.4, 8.0 Hz, 1H), 3.82 (s, 3H), 2.84-2.79 (m,
2H), 1.59 (m, 11H), 0.97 (t, J= 7.4 Hz, 3H).
Preparation 3
3-Hydrox -2-propyl-benzoic acid
Add boron tribromide (305.6 mL, 305.6 mmol) dropwise while maintaining the
temperature below 0 °C to a solution of tert-butyl 3-methoxy-2-propyl-benzoate (61.2 g,
244 mmol) in toluene (428 mL) which has been cooled to -25 °C. Stir at -5 °C for 3 h.
Add water (100 mL) dropwise, raising the temperature to 7 °C, and stir 30 min.
Concentrate the mixture in vacuo and then suspend the semisolid in water (200 mL). Stir
1 h and filter the suspension through a glass frit. Wash the collected solid with water and
dry the solid to yield the title compound (43. 1 g, 98%). ¾ NMR (300 MHz, CDC13) d
7.58 (d, J = 8.0 Hz, 1H); 7.16 (t, J = 8.0 Hz, 1H); 6.99 (d, J =7.7 Hz, 1H); 5.0 (bs, 2 H);
2.98 (t, J = 7.7 Hz, 2H), 1.64 (m, 2H); 1.02 (t, J = 7.4 Hz, 3H).
Preparation 4
Methyl 3-hydroxy-2-propyl-benzoate
Cool a solution of 3-hydroxy-2-propyl -benzoic acid (59.79 g, 332 mmol) in
MeOH (598 mL) to -10 °C and add thionyl chloride (36.26 mL, 497.1 mmol) using a
syringe pump over 35 min. Allow the mixture to warm to ambient temperature while
stirring over 35 h. Concentrate the mixture in vacuo and dilute the residue with methyl-
-butylether (360 mL). Concentrate the resultant mixture in vacuo to dryness to yield
the title compound (64.4 g, 87%) as a tan solid. H NMR (300 MHz, CDC13) d 7.38 (dd,
J = 8.0, 0.8 Hz, 1H); 7.10 (t, J = 8.0 Hz, 1H); 6.93 (dd, J = 8.0,0.8 Hz, 1H); 5.1 (bs, 1 H);
3.89 (s, 3H); 2.98 (m, 2H), 1.61 (m, 2H); 1.00 (t, J = 7.4 Hz, 3H).
Preparation 5
Methyl 3-[3-[5-benzyloxy-2-ethyl-4-(4-fluorophenyl)phenoxy]propoxy]-2-propylbenzoate
To a solution of methyl 3-hydroxy-2-propyl-benzoate (40.0 g, 206 mmol) and 1-
benzyloxy-5-(3-chloropropoxy)-4-ethyl-2-(4-fluorophenyl)benzene (prepared according
to Org. Process Res. Dev. (2009), 13: 268-275) (82.15 g, 206 mmol) in dimethylsulfoxide
(240 mL) add potassium carbonate (30.2 g, 219 mmol) and N,N-dimethylpyridin-4-amine
(2.0 g, 16 mmol) in succession. Stir the suspension for 87 h at 60 °C and then allow it to
cool. Dilute the mixture with water (600 mL) and with methyl- tert-butylether (100 mL)
and stir for 15 min. Separate the phases and wash the aqueous portion with methyl- -
butylether (3 x 30 mL). Wash the combined organic extracts with water and brine.
Concentrate the organic portion in vacuo to yield the title compound (123.0 g,
quantitative) as a brown oil. ES/MS m/z 557 (M+l).
Preparation 6
3-[3-[5-Benzyloxy-2-ethyl-4-(4-fluorophenyl)phenoxy]propoxy]-2-propyl-benzoic acid
To a solution of methyl 3-[3-[5-benzyloxy-2-ethyl-4-(4-
fluorophenyl)phenoxy]propoxy]-2-propyl-benzoate ( 119 g, 181 mmol) in -
methylpyrrolidone (476 mL), add potassium hydroxide (21.2 g, 378 mmol) and stir 25
min at 120 °C. Allow the mixture to cool and then dilute with water (240 mL) and
methyl-tert-butylether (100 mL). Adjust to pH = 2.5 with 12 N hydrochloric acid.
Separate the phases and wash the aqueous phase with methyl-tert-butylether (3 35
mL). Wash the combined organic extracts twice with water and once with brine.
Concentrate the organic extracts in vacuo. Recrystallize the resultant residue from
acetonitrile, filter, and dry to yield (78 g, 67%) as a white solid. H NMR (300 MHz,
CDC13) d 7.60-7.47 (m, 3H); 7.37-7.20 (m, 6H); 7.12-7.02 (m, 4H); 6.60 (s, 1 H); 5.00 (s
2H); 4.20 (m, 4H); 3.00 (m, 2H); 2.61 (q, J = 7.7 Hz, 2H); 2.33 (m, 2H); 1.59 (m, 2H);
1.18 (t, J = 7.7 Hz, 3H); 0.98 (t, J = 7.7 Hz, 3H).
Preparation 7
3-[3-[5-Benzyloxy-2-ethyl-4-(4-fluorophenyl)phenoxy]propoxy]-2-propyl-benzamide
Add thionyl chloride (8.22 mL, 113 mmol) dropwise to a solution of 3-[3-[5-
benzyloxy-2-ethyl-4-(4-fluorophenyl)phenoxy]propoxy]-2 -propyl-benzoic acid (50.0 g,
92 mmol) and DMF (2.5 mL, 32 mmol) in THF (250 mL). Stir for 1 h and then add the
reaction to a solution of ammonium hydroxide (102.5 mL, 1.52 mol) at 0-5 °C. Add
MeOH (250 mL) and water (500 mL) in a dropwise fashion. Concentrate to about one
half the volume in vacuo and stir the resulting suspension 30 min at 0-5 °C. Filter the
suspension on a glass frit and dry the resulting solids under vacuum to provide the title
compound (50.3 g, quantitative) as an off-white solid. ES/MS m/z 542 (M+l).
Preparation 8
Methyl N-[3-[3-[5-benzyloxy-2-ethyl-4-(4-fluorophenyl)phenoxy]propoxy]-2-propylhenyl
carbamate
Sequentially add l,8-diazabicyclo[5.4.0]undec-7-ene (51.6 mL, 345 mmol) and
N-bromosuccinimide (34.6 g, 194 mmol) to a mechanically stirred suspension of 3-[3-[5-
benzyloxy-2-ethyl-4-(4-fluorophenyl)phenoxy]propoxy]-2-propyl-benzamide (62.0 g,
114 mmol) in MeOH (620 mL) during which time the temperature raises from -4.1 °C to
-3.2 °C over 1 min. Stir the reaction at -5 °C to -10 °C for 22 h. Add a solution of
sodium bisulfite (25. 1 g, 209 mmol, in 25 mL water) dropwise with stirring. Add water
(620 mL) dropwise and stir 30 min at 10 °C. Filter the suspension on a glass frit, wash
the collected solid with water, and dry under vacuum to yield the title compound (65.8 g,
quantitative) as an off-white powder. ES/MS m/z 572 (M+l).
Preparation 9
3-[3-[5-Benzyloxy-2-ethyl-4-(4-fluorophenyl)phenoxy]propoxy]-2-propyl-aniline
h drochloride
Add potassium hydroxide (12.97 g, 23 1 mmol) to a solution of methyl N-[3-[3-[5-
benzyloxy-2-ethyl-4-(4-fluorophenyl)phenoxy]propoxy]-2-propyl-phenyl]carbamate
(65.8 g, 115 mmol) in N-methylpyrrolidone (203 mL) and stir at 110-120 °C for 2 h.
Allow the mixture to cool and then pour it into a mixture of water (450 mL) and methyl-
-butylether (180 mL). Stir the mixture 20 min and separate the phases. Extract the
aqueous phase with additional methyl-tert-butylether (3 x 50 mL). Filter the combined
organic extracts through a glass frit and wash the filtrate with 15% brine solution.
Concentrate the filtrate in vacuo and dissolve the residue in a mixture of ethyl acetate
(300 mL) and methyl-tert-butylether (300 mL). Add 4 N hydrochloric acid (43. 1 mL)
dropwise to this solution while stirring and cooling the resultant suspension with an
ice/salt bath. Collect the solid by filtration on a glass frit, wash with cold methyl- -
butylether, and dry under vacuum to yield the title compound (57.8 g, 91%) as an offwhite
solid. ES/MS m/z 514 (M+l, free base).
Preparation 10
4-[[3-[3-[5-Benzyloxy-2-ethyl-4-(4-fluorophenyl)phenoxy]propoxy]-2-propylphenyl]
amino]-2,2-dimethyl-4-oxo-butanoic acid
Add diisopropylethylamine (57 mL, 327 mmol) to a suspension of 3-[3-[5-
benzyloxy-2-ethyl-4-(4-fluorophenyl)phenoxy]propoxy]-2-propyl-aniline hydrochloride
(90 g, 175 mmol) in THF (450 mL). To this mixture, add dihydro-3,3-dimethyl-2,5-
furandione (32.1 g, 251 mmol) and stir at 35 °C until LCMS indicates 5% starting
material remaining. Concentrate the mixture in vacuo and add methyl tert-butyl ether
(100 mL) and water (75 mL). Adjust to pH = 2-3 with phosphoric acid and separate the
layers. Wash the aqueous layer with additional methyl -butyl ether (2 50 mL).
Wash the combined organic extracts with brine and concentrate in vacuo. Dissolve the
crude residue in methyl tert-butyl ether (180 mL) and add hexane (450 mL) to obtain a
suspension and stir for 30 min. Collect the suspension by filtration and dry to yield the
title compound (92.5 g, 88%) as a white solid. ES/MS m/z 642 (M+l).
Example 1
4-[[3-[3-[2-ethyl-4-(4-fluorophenyl)-5-hydroxy-phenoxy]propoxy]-2-propylphenyl]
amino]-2,2-dimethyl-4-oxo-butanoic acid
Hydrogenate a slurry of 10% palladium on charcoal, 50% wet (with water by
weight) (13 g) and 4-[[3-[3-[5-benzyloxy-2-ethyl-4-(4-fluorophenyl)phenoxy]propoxy]-2-
propyl-phenyl]amino]-2,2-dimethyl-4-oxo-butanoic acid (260 g, 405 mmol)) in THF
(1560 mL) starting at a hydrogen pressure of 900 psi. Continue the hydrogenation 20 h
while not adding additional hydrogen. Hydrogenate two additional days maintaining
hydrogen pressure of 200 psi. Filter the mixture through diatomaceous earth and
concentrate the filtrate in vacuo to yield the title compound (251 g, quantitative) as a
solid. Excess weight is due to the presence of THF. ES/MS m/z 552 (M+l).
Example 2
Sodium 4-[[3-[3 -[2-ethyl-4-(4-fluorophenyl)-5-hydroxy-phenoxy]propoxy] -2-propylphenyl]
amino]-2,2-dimethyl-4-oxo-butanoate
Add 1N sodium hydroxide (404 mL) dropwise to a solution of 4-[[3-[3-[2-ethyl-
4-(4-fluorophenyl)-5-hydroxy-phenoxy]propoxy]-2-propyl-phenyl]amino]-2,2-dimethyl-
4-oxo-butanoic acid (223 g, 404 mmol) in THF ( 1115 mL) and stir at ambient
temperature for 15 min. Reduce the volume in vacuo and add water (1300 mL). Remove
additional solvent using a membrane pump, to avoid heating the solution, to obtain a final
volume of 1250 mL. Lyophilize the remaining solution in batches to yield the title
compound (230 g, 99%) as an off-white solid. ES/MS m/z 552 (M+l, free base).
Animal studies have increasingly implicated the leukotriene synthesis pathway in
chronic inflammatory diseases, including atherosclerosis and AAA. Poeckel, et al.
Cardiovascular Research (2010), 86: 243-253. Atherosclerosis is a condition in which an
atherosclerotic plaque or lesion forms and builds in the intima of arteries. It is a chronic
inflammatory response of the walls of arteries primarily caused by the accumulation of
macrophage white blood cells and promoted by low-density lipoproteins without adequate
removal of fats and cholesterol from the macrophages by functional high density
lipoproteins. The artery becomes inflamed. LTB4 plays a proatherogenic role in
atherosclerosis because of its ability to promote the adhesion and chemotaxis of
leukocytes across the endothelium. Back, Current Atherosclerosis Reports (2008), 10:
244-251; Aiello et al. Arterioscler. Thromb. Vase. Biol. (2002) 22: 443-449; Rosenfeld,
Arterioscler. Thromb. Vase. Biol. (2002) 22: 361-363. The cholesterol plaque causes the
muscle cells to enlarge and form a hard cover over the affected area. Spanbroek et al.
PNAS, (2003), 100(3): 1238-1243.
Stable atherosclerotic plaques, which tend to be asymptomatic, are rich in
extracellular matrix and smooth muscle cells. Unstable plaques are rich in macrophages
and foam cells and the extracellular matrix separating the lesion from the arterial lumen
(fibrous cap) is typically weak and prone to rupture. Ruptures of the fibrous cap expose
thrombogenic material, such as collagen, to the circulation and eventually induce
thrombus formation in the lumen. Upon formation, intraluminal thrombi may occlude
arteries outright or may detach, move into the circulation and eventually occlude smaller
downstream arterial branches causing thromboembolism (Ross, N. Engl. J. Med. (1999),
340(2): 115-126).
A degenerative disorder, AAA is characterized by relentless progression of 1)
inflammation of the aortic wall; 2) uncontrolled local production of destructive proteases;
3) destruction of structural proteins; and 4) depletion of medial smooth muscle cells. The
early or acute phase begins with recruitment of inflammatory cells in the media and
adventitia. Intramural injury results when local reactive oxygen, leukotrienes,
chemokines and matrix degradation products act in concert to activate various protease
systems. These pathological changes in the aortic wall lead to segmental weakening,
progressive dilation, and spontaneous rupture (Nanda et al. Recent Patents on
Cardiovascular Drug Discovery (2009), 4 : 150-159).
Chronic transmural inflammation is one of the principal histologic features of
established AAA's. This inflammatory response consists of mononuclear phagocytes,
lymphocytes, and blood plasma cells. The nature of the chronic inflammation response in
AAA appears to differ from that observed in atherosclerosis. The inflammatory response
in AAA's is usually transmural in distribution, with dense infiltrates largely focused in
the outer media and adventitia. In atherosclerosis, infiltrating inflammatory cells are
primarily confined to the diseased intima, and they do not appear to become as
concentrated or extensively distributed as in AAAs. Despite the common chronic
inflammation component, the destruction of structural proteins in the outer aortic wall,
not seen in atherosclerosis, appears to be responsible for aneurysmal degeneration
(Thompson et al. Curr. Probl. Surg. (2002), 39(2): 110-230, at 115, 137 and 142).
Although there are published studies to the contrary (See, for example, Cao et al.
Prostaglandins & other Lipid Mediators, (2007) 84: 34-42), a majority of published
studies are believed to support the role of the 5-lipoxygenase pathway, and LTB4, in AAA
pathogenesis. Elevated levels of LTB4 derived from neutrophils play a key role in the
pathogenesis of AAA (Houard et al. FASEB J. (2009), 23: 1376-1383; Ahluwalia, et al.
J. Immunol. (2007), 179: 691-697; Kristo et al. Atherosclerosis, (2010), 210: 107-1 13).
The following in vitro and in vivo studies demonstrate the activity and efficacy of
the compound of Formula (I), or the sodium salt thereof, in treating atherosclerosis and
AAA by antagonizing LTB4. These assays are generally recognized by those skilled in
the art as indicative of human clinical therapeutic activity. Assays evidencing LTB4
signaling antagonism activity and efficacy may be carried out substantially as follows or
by similar assays affording similar data.
In vitro Assay Procedures;
BLTl binding and activation by LTB4 increases intracellular inositol 1,4,5-
triphosphase levels that leads to intracellular calcium release and calcium influx is
mediated by coupling with and signaling through specific G-protein coupled signal
transduction pathway subunits (Gaudreau et al. Biochem. J. (1998), 335 (Pt 1): 15-18).
Following are two in vitro assays used to demonstrate Example 2 antagonism of the
BLTl proximal signaling cascade events: a [ H]-LTB4 ligand displacement assay using
membrane preparations generated from BLT 1 and BLT2 stable cell lines and a whole cell
calcium mobilization assay.
LTB4 Ligand Displacement assay
[ H]-LTB4 and known BLTl and BLT2 antagonists are used to generate LTB4
displacement curves and IC50 values for compounds of the present invention. Receptor
inhibition by compounds of the present invention is determined relative to BLTl inhibitor
and BLT2 inhibitor reference molecules to obtain percent efficacies.
hBLTl test compound preparations; For hBLTl assays, test compounds are prepared
in DMSO to make up a 10 mM stock solution. The stock solution is initially diluted 1:10
in Buffer A (50 mM 4-(2-hydroxyethyl)piperazine-l-ethanesulfonic acid (HEPES) pH
7.4, 10 mM MgCl2, 10 mMNaCl, 10% glycerol (v/v), 1% bovine serum albumin (BSA)
(w/v)), followed by 3X serial dilutions in Buffer B (50 mM HEPES pH 7.4, 10 mM
MgCl2, 10 n M NaCl, 10% glycerol (v/v), 1% BSA (w/v), 10% DMSO (v/v)) creating a
ten-point dilution curve. Final compound concentrations ranging from 30 mM to 1.52 nM
are plated in a 96-well round-bottom plate for conducting the in vitro assays.
hBLT2 test compound preparations; For hBLT2 assays, test compounds are prepared
in DMSO to make up a 10 mM stock solution. The stock solution is initially diluted 1:10
in Buffer A (50 mM HEPES pH 7.4, 10 mM MgCl2, 10 mM NaCl, 10% glycerol (v/v), 1
% BSA (w/v)), followed by 3X serial dilutions in Buffer B (50 mM HEPES pH 7.4, 10
mM MgCl2, 10 mM NaCl, 10% glycerol (v/v), 1% BSA (w/v), 10% DMSO (v/v))
creating a ten-point dilution curve. Final compound concentrations ranging from 300 mM
to 15.2 nM are plated in a 96-well round-bottom plate for conducting the in vitro assays.
Methods for generation of BLT1/CHO-K1 and BLT2/CHO-K1 stable cell lines:
Generally, these cell lines are generated using commercially available materials
and by procedures known to those skilled in the art.
hBLTl/CHO-Kl stable xcell line preparations: Human BLTl receptor DNA (National
Center for Biotechnology Information (NCBI), Reference Sequence NM_181657) is
synthesized and cloned into expression vector pcDNA3.1/Hygro(+) (Invitrogen V87020).
The cDNA expression vector construct is transfected into Chinese hamster ovary (CHOKl)
cells (American Type Culture Collection (ATCC) CCL-61) using Lipofectamine
2000 (Invitrogen) as transfection reagent. Cells are cultured in selective Dulbecco's
Modified Eagle Medium (DMEM) containing 200 mg/mL Hygromycin, 24 hours post
transfection. Single clones are isolated and screened for BLTl expression and function
using Western Blot analysis and Fluorometric Imaging Plate Reader (FLIPR®) calcium
release assay.
hBLT2/CHO-Kl stable cell line preparations: Human BLT2 short form receptor DNA
(National Center for Biotechnology Information (NCBI), Reference Sequence GenBank
AB029892, which is 32 amino acids shorter than the long form BLT2 on the N-terminus,
Wang et al. J. Biol Chem. (2000), 275 (52): 40686-40694) is synthesized and cloned into
expression vector pcDNA3. l/Hygro(+) (Invitrogen V87020). The cDNA expression
vector construct is transfected into CHO-K1 cells (ATCC CCL-61) using Lipofectamine
2000 (Invitrogen) as transfection reagent. Cells are cultured in selective DMEM medium
containing 200 mg/mL Hygromycin, 48 h post transfection. Single clones are isolated and
screened for BLT2 expression and function using Western Blot analysis and FLIPR®
calcium release assay.
hBLTl membrane preparations: hBLTl transfected CHO-Kl cells are suspended in 50
mM HEPES pH 7.4, 10 mM MgCl2, 10 mM NaCl buffer, sonicated, and concentrated by
differential centrifugation. Briefly, after sonification, the homogenates are centrifuged at
1000 X g for 10 min. Supernatants are recovered and centrifuged again at 50,000 X g for
60 min. The pellet is collected, resuspended in buffer containing 50 mM HEPES at pH
7.4, 10 mM MgCl2, 10 mM NaCl, 10% glycerol and used as the hBLTl membrane.
hBLT2 membrane preparations: hBLT2 transfected CHO-Kl cells are suspended in 50
mM HEPES pH 7.4, 10 mM MgCl2, 10 mM NaCl buffer, sonicated, and concentrated by
differential centrifugation. Briefly, after sonification, the homogenates are centrifuged at
1000 X g for 10 min. Supernatants are recovered and centrifuged again at 50,000 X g for
60 min. The pellet is collected, resuspended in buffer containing 50 mM HEPES pH 7.4,
10 mM MgCl2, 10 mM NaCl, 10% glycerol and used as the hBLT2 membrane.
[ H]-LTB4 binding assay in hBLTl containing membranes:
[ H]-LTB4 (30 of 1.3 nM, PerkinElmer NET-852) is aliquoted into a 96-well
Millipore Multiscreen-filter binding plate (catalogue number MAFBNOB10) which is
pre-wetted with Buffer A (50 mM HEPES pH 7.4, 10 mM MgCl2, 10 mM NaCl, 10%
glycerol, 1% BSA). A previously prepared dose response range of test compound (10
m ) is then added in columns 2-11, with final compound concentrations ranging from 3
mM ί o 152 pM. For binding controls, aliquots of sodium 2-[3-[3-[(5-ethyl-4'-fluoro-2-
hydroxy[l,l'-biphenyl]4-yl)oxy]propoxy]-2-propylphenoxy]-benzoate (LY29311 1Na, a
commercially available known hBLTl inhibitor; Sawyer et al. J. Med. Chem. (1995), 38:
441 1-4432, compound 43b) (10 mΐ of 3 mM, final concentration) are added (as a positive
control) or 10 mΐ of Buffer B (50 mM HEPES pH 7.4, 10 mM MgCl2, 10 mM NaCl, 10%
glycerol, 1% BSA, 10% DMSO) (negative control) into selected wells. hBLTl
membrane protein (0.7 mg) is added to appropriate wells of the microtiter plate for a total
volume of 100 m The plate is placed on a plate mixer at low speed and incubated for 1
h. After incubation, the plate is aspirated and then washed with 200 m of ice cold Buffer
C (50 mM HEPES pH 7.4, 10 mM MgCl2, 10 mM NaCl) followed by an additional 2 x
100 washes, aspirating between washes. The plate is air dried, and then Microscint®
20 (PerkinElmer) (100 m ) is added. The plate is allowed to sit for 16 h and then read on
a Packard Instrument Company Topcount® for 1 min. CPMs (Counts per minute) are
plotted versus inhibitor concentration and a curve fitted with a 3-parameter logistic fit
with fixed bottom to obtain IC50 values. The IC50Sare converted to K values by dividing
by 2.7 (previously calculated). (2.7 is a constant previously determined by running a
saturation binding curve with [ H]-LTB4 and hBLT l and determining the K , using the
formula Ki = IC50 l+[Substrate] / K and simplifying Ki= ICso/2.7).
Following a protocol essentially as described above, the compound of Example 2
displayed an absolute Ki of 5.5 nM (relative Ki of 10.4 nM) under these conditions.
These data evidence potent antagonism of LTB4 by the compound of Example 2 at the
high affinity LTB4 receptor.
[ H]-LTB4 binding assay in hBLT2 containing membranes:
[ H]-LTB4 (30 mΐ of 2.8 nM, PerkinElmer NET-852) is aliquoted into each well
of a Falcon® 3072 microtiter plate (BD Biosciences). A previously prepared 10 point
dose response range of test compound (10 is then added in columns 2-11, with final
compound concentrations ranging from 30 mM to 1.5 nM. For binding controls, aliquots
of l-(5-ethyl-2-hydroxy-4-(6-methyl-6-lH-tetrazol-5-yl)heptyloxy)phenyl)ethanone
(LY255283, a commercially available known hBLT2 inhibitor) (10 m of 100 mM , final
concentration of 10 mM ) are added (as a positive control) or 10 m of Buffer B (50 mM
HEPES pH 7.4, 10 mM MgCl2, 10 mM NaCl, 10% glycerol, 1% BSA, 10% DMSO)
(negative control) into selected wells. hBLT2 membrane protein (7.5 mg) is added to the
appropriate wells of the microtiter plate for a total volume of 100 m . The plates are
placed on a plate mixer at low speed and incubated for 1 h. After incubation, 90 m from
each well of the reaction mixture is transferred to a 96-well Millipore Multiscreen-filter
binding plate (catalogue number MAFBNOB IO), which is pre-wet with Buffer A (50 mM
HEPES pH 7.4, 10 mM MgCl2, 10 mM NaCl, 10% glycerol, 0.03 % BSA). The plate is
aspirated and then washed 3 times with 300 ice cold Buffer C (50 mM HEPES pH 7.4,
10 mM MgCl2, 10 mM NaCl), aspirating after each wash step. The plate is air dried, and
then Microscint® 20 (PerkinElmer)(100 m ) is added. The plate is allowed to sit for 16 h
and then read on a Packard Instrument Company Topcount® for 1 min. CPMs (Counts
per minute) are plotted versus inhibitor concentration and a curve fitted with a 3-
parameter logistic fit with fixed bottom to obtain IC50 values.
Following a protocol essentially as described above, the compound of Example 2
displayed an absolute IC50 of 16.5 mM (relative IC50 of 15.4 mM) under these conditions.
These data evidence statistically insignificant antagonism of LTB4 by the compound of
Example 2 at the low affinity LTB4 receptor.
FLIPR® calcium release assay:
Chinese hamster ovary (CHO-K1) cells stably expressing the high-affinity (BLT1)
LTB4 receptor are seeded at 10,000 cells/well in a 96 well plate (Corning) in growth
medium containing DMEM/F-12 (3:1) w/o phenol red (Invitrogen), 5% fetal bovine
serum (FBS) (Hyclone), 20 mM HEPES (Invitrogen), 200 mg/mL Hygromycin B
(Invitrogen) and 40 mg/mL L-Proline (Sigma). The plate is incubated for 22-24 h at 37
°C 5% CO2 then growth medium is replaced with 50 m II of test medium containing
Roswell Park Memorial Institute (RPMI) RPMI- 1640 w/o phenol red, 20 mM HEPES
(both from Invitrogen), and 0.2% w/v Bovine Serum Albumin (Sigma). After 30-60 min
of incubation at 37 °C 5% CO2, 50 mΐ of diluted FLIPR Calcium 3 Assay Kit reagent
(Molecular Devices) containing 5 mM probenecid (Sigma) are added to wells and the
plate is incubated for an additional 1.25 h at 37 °C 5% CO2. The plate is placed in
FLIPR® instrument (Molecular Devices) and 50 m of 4% v/v DMSO or compound is
added followed 6 min later by 50 m of vehicle or LTB4. Final concentration of LTB4 is
8 nM. The plate is read using a 0.5 second exposure length and 0.6 Watt laser power.
The compound of Example 2 evidenced an inhibition of LTB4-induced calcium
mobilization (potency and selectivity) Kb (nM) of 0.98 (n of 2; +/- 1.64) and a relative
IC 0 (nM) of 6.48 (n of 2; +/- 10.8).
Further, below are several additional assays used to measure downstream events
that are induced by LTB4 binding to BLT1, including phosphorylation of extracellular
signal-regulated kinases 1 and 2 (ERK) in monocytes (Lindsay et al. J. Leukoc. Biol.
(1998), 64: 555-562), and induction of CD1 l b in neutrophils in relevant cell types in
mouse and human blood as well as LTB4 bindingaffinijty to the nuclear receptor
subfamily of peroxisome proliferator activated receptors (PPAR).
Human phosphorylated extracellular-related kinase (pERK) assay:
The ability of the compound of Example 2 to block LTB4-induced signaling
through BLT1 was assessed in whole blood obtained from healthy human volunteers and
from 129SvEv mice that are the model strain for preclinical AAA efficacy evaluation.
Whole blood is collected from human donors in 10 mL K2
ethylenediaminetetraacetic acid (EDTA) vacutainer tubes (BD Biosciences). Aliquots of
whole blood are pre-warmed at 37 °C for 20 min. 10 point dose response curves of test
compounds are assayed at final concentrations of 20nM - 10mM. 10 point ½ serial
dilutions of compound at lOOOx of final assayed concentration are prepared in DMSO.
Compound is then diluted to lOx in Dulbecco's Phosphate Buffered Saline (DPBS)
(DMSO concentration is now 1%). 10 of compound dilutions (at lOx in DPBS) or 1%
DMSO in DPBS are added to wells of a 2.0 mL volume 96 deep well plate (Nunc) and
placed in 37 °C heat block.
Immediately thereafter, 80 whole blood is added and incubated for 20 min at
37 °C (10 x anti-human CD14-FITC from BD Biosciences is added for final 10 min).
11 m of pre-warmed lOx LTB4 from Cayman Chemicals (final concentration 10 nM) is
added and incubated at 37 °C for 1 min. The reaction is stopped with 1.5 mL of IX
Phosflow Lyse/Fix from BD Biosciences (pre-warmed to 37 °C). The plate is sealed,
vortexed, and incubated at 37 °C for 10 min. Cells are washed once with 1.5 mL DPBS
(Hyclone) then permeablized with 100 of 2% Cytofix (BD Biosciences) + 900 cold
methanol for 30 min on ice. The cells are washed once with 1 mL wash buffer
(Dulbecco's Phosphae-Buffered Saline (DPBS)+5% FBS) then incubated with 100 mΐ
pERK antibody (Cell Signaling diluted 1:100) for 1 h at room temperature. Cells are
washed once with wash buffer then incubated with 100 mΐ of 2 m anti-rabbit IgG-PE
(Invitrogen) for 30 min at room temperature in the dark. The cells are washed again with
wash buffer then fixed in 400 m 1% Cytofix (BD Biosciences). Cells are transferred to
12 75 tubes and then refrigerated until analysis. Samples are warmed to room
temperature and analyzed on a Beckman Coulter FC500 flow cytometer. Human
monocytes are isolated by gating strategy side scatter vs CD14-FITC positive. Data are
analyzed with WinList software (Verity Software House) to determine mean and median
fluorescent intensity values for pERK-PE from monocyte population.
When the compound of Example 2 is added to human whole blood at varying
concentrations, LTB4-induced phosphorylation of ERK in monocytes is blocked with an
IC50 of 814 nM evidencing antagonism of downstream signaling events by the compound
of Example 2.
Mouse pERK assay:
Whole blood is collected from 129SvEv mice in 50 mM EDTA (Gibco). For in
vitro experiments, 10 point dose response curves of test compounds are assayed at final
concentrations of 20nM - 10mM. 10 point ½ serial dilutions of compound at lOOOx of
final assayed concentration are prepared in DMSO. Compound is then diluted to lOx in
DPBS (DMSO concentration is now 1%). 10 of compound dilutions (at lOx diluted in
DPBS) or 1% DMSO in DPBS are added to wells of a 96 deep well plate. 80 mΐ whole
blood is added and incubated for 20 min at room temperature (10 m of anti-mouse
LY6G-FITC antibody (BD Pharmingen) and IOmI of anti-mouse CDllb-APC BD
Biosciences at 1 mg/mL final concentrations are added for final 10 min). 1 1 m of lOx
pre-warmed LTB4 (final concentration 20 nM) is added and incubated at 37 °C for 2 min.
Reaction is stopped with 1.5 mL of IX Phosflow Lyse/Fix from BD Biosciences (prewarmed
to 37 °C). The plate is sealed, vortexed, and incubated at 37 °C for 10 min.
Cells are washed once with 1.5 mL DPBS then permeablized with 1 mL BD Perm/Wash
buffer (BD Biosciences) for 10 min at room temperature. Cells are washed once with 1
mL Perm/Wash buffer, then incubated with 100 mΐ pERK antibody (Cell Signaling diluted
1:100) for 1 h at room temperature. Cells are washed again with Perm/Wash buffer then
incubated with 100 m of 2 mg/mL anti-rabbit IgG-PE (Invitrogen) for 30 min at room
temperature in the dark. Cells are washed again with Perm/Wash buffer and then fixed in
400 m 1% BD Cytofix. Mouse monocytes are isolated by gating strategy LY6G-FITC
negative/CDl lb-APC positive.
The compound of Example 2 blocked LTB4-induced phosphorylation of ERK in
mouse whole blood monocytes with an IC50 of 243 nM evidencing antagonism of
downstream signaling events.
CDl l b Assay:
Inflammation is one pathophysiological process amenable to the development of
biomarkers. For example, a simple blood test may serve as a surrogate to a tissue biopsy
to monitor neutrophil activation. Neutrophil activation leads to their migration from the
blood to the site of tissue damage and is central to the inflammatory process (Busse, Am.
J. Respir. Crit Care Med. (1998), 157: S210-213), and neutrophils are typically absent in
healthy tissues. An assay based on a biomarker that is specific to neutrophil activation in
blood is a less-invasive indicator of an inflammatory response in tissue. Increased
expression of the b2 integrin CDl lb/CD18 (Mac-1), a glycoprotein on the neutrophil
surface, is an early step in the migration of neutrophils into the area of inflammation
(Parkos, BioEssays (1997), 19: 865-873). The utility of CDl lb as a preclinical and
clinical biomarker of BLT1 receptor antagonism is based on the fact that LTB4 potently
upregulates CDl lb expression on neutrophils (Turner et al. J. Clin. Invest. (1996), 97:
381-387), and stimulation of CDl lb by LTB4 has been shown to be reduced significantly
by antagonists of the LTB4 receptor (Allen et al. J. Pharmacol. Exp. Ther. (1996), 277:
341-349; Davis et al. J. Immunol. Methods (2000), 240: 125-132; Marder et al. Biochem.
Pharmacol. (1995), 49: 1683-1690).
EDTA anti-coagulated blood is collected from human donors or mice as before.
For in vitro experiments, 8 or 10 point dose response curves of test compounds are
assayed at final concentrations of 78nM - 10 mM or 20nM - 10 mM respectively. ½ serial
dilutions of compound at lOOOx of final assayed concentration are prepared in DMSO.
Compound is then diluted to lOx in DPBS (DMSO concentration is now 1%). 10 of
compound dilutions (at lOx in DPBS) or 1% DMSO in DPBS are added to wells of a 96
deep well plate. 90 whole blood is added and incubated 20 min at room temperature.
1 1 mΐ 10x LTB4 (final concentration 25nM for mouse or 10 nM human) is added and
incubated at 37 °C for 30 min. The reaction is stopped by incubating the plate on ice for
5 min. The cells are stained with 10 m anti-mouse or anti-human CDl lb-PE (BD
Biosciences diluted 1:20 for mouse and undiluted for human) and incubated on ice for 30
min in the dark (for mouse experiments, 10 m anti-mouse LY6G-FITC antibody (BD
Pharmingen) diluted 1:25 is added for the final 10 min). Red blood cells (RBCs) are
lysed by adding 1.5 mL of IX BD FACSlyse (BD Biosciences) and incubating for 10 min
at room temperature in the dark. Cells are washed once with 1.5 mL DPBS and then
fixed in 400 of 1% Cytofix. Mouse neutrophils are isolated by gating strategy LY6GFITC
positive and human neutrophils are isolated by light scatter properties. Data are
analyzed with WinList software (Verity Software House) to determine mean and median
fluorescent intensity values for CDl lb-PE from neutrophil population.
LTB4-induced CDl lb expression in neutrophils is inhibited dose-dependently in
this preclinical model by the compound of Example 2 and Example 2 blocks LTB4-
induced CDlib expression in mouse and human whole blood neutrophils. LTB4-induced
expression of CDl lb in human whole blood neutrophils is blocked with an IC50 of 193
nM. Similarly, the compound of Example 2 inhibits CDl lb expression in mouse whole
blood neutrophils with an IC50 of 1.45 mM.
Ligand activated Peroxisome Proliferator-Activated Receptor alpha, delta and
gamma (PPAR a, d, g ) binding assay:
LTB4 and BLT receptor antagonists have been shown to be ligands of the nuclear
receptor subfamily of peroxisome proliferator activated receptors (PPAR) and is believed
to be a limitation in their development opportunities (Devchand et al J. Biol. Chem.
(1999), 274: 23341-23348; Devchand et al. Nature (1996), 384: 39-43).
PPAR functional lysate preparation:
Generally, these cell lines are generated using commercially available materials
and by procedures known to those skilled in the art.
The nucleotide sequences encoding full-length PPARa receptor DNA (National
Center for Biotechnology Information (NCBI) Reference Sequence NM_005036.4),
PPAR8 receptor DNA (NCBI Reference Sequence NM_006238.4), PPARy receptor DNA
(NCBI Reference Sequence NM_0 15 869.4) and Retinoid X Receptor (RXR) a DNA
(NCBI Reference Sequence NM_002957. 4) are synthesized and inserted into
pFastBacHTb (Invitrogen) vector in-framed with the N-terminal HIS tag from the vector.
Recombinant bacmid (baculovirus shuttle vector plasmid) are created by transforming
DHlOBac cells and isolating DNA from white colonies according to the manufacturer's
protocol of Bac-to-Bac Baculovirus Expression system (Invitrogen; See also Invitrogen
User Manual, Version F, dated 04 September 2010; and Invitrogen Instruction Manual
dated 27 February 2002). Sf9 cells are transfected in 6-well plates at 0.9 x 106 cells/well
using CellFectin reagent (Invitrogen). P0 virus is collected at 72 h post-transfection and
used to infect Sf9 insect cells in suspension at 100 m of P0 virus per 50 mL cells at 1.5 x
10 cells/mL. PI virus is collected after 96 h. For protein production, 1L of Sf9 cells are
infected at 1.5 x 106 cells/mL with 5 mL of PI virus and the cells harvested after 48 h.
To prepare cell lysate, cell pellets from 1 L culture are resuspended with 12.5 mL of icecold
lysis buffer (20 mM HEPES, pH7.8, 160 mM KC1, 1mM MgCl2, 2 mM
dithiothreitol (DTT), 1% 3-[(3-chloramidopropyl)dimethylammonio]-l-propanesulfonate
(CHAPS), 40% glycerol, 1 x Roche protease inhibitor cocktail) for PPAR or lysis buffer
B (10 mM Tris-HCl, pH7.5, 500 mM NaCl, 1mM EDTA, 1mM DTT, 50% Glycerol, 1 x
Roche protease inhibitor cocktail) for RXRa, and then homogenized and sonicated on ice.
After centrifugation on Beckman JA18 rotor at 16,500 rpm for 45 min at 4 °C, the
supernatant is aliquoted and frozen at -80 °C. The protein concentration is determined by
Bradford assay using BSA as the standard.
Binding affinities of compounds for the PPAR a, d, g receptors are assessed
using Scintillation Proximity Assay (SPA) technology.
Biotinylated oligonucleotide(DR2)
TAATGTAGGTAATAGTTCAATAGGTCAAAGGG 3' (SEQ ID NO: 1) is used for
binding of receptors to Yttrium silicate streptavidin- coated SPA beads (Perkin Elmer).
The PPAR a, d, g and Retinoid X Receptor (RXR) a receptors (endogenously expressed
as heterodimers) are cell lysates from Baculovirus expression systems in Sf9 cells. The
DR2 is attached to the Streptavidin SPA beads by mixing over a 30 min period at room
temperature in a binding buffer containing 10 mM HEPES at pH 7.8, 80 mM KC1, 0.5
mM MgCl2, 1mM DTT, 0.5% CHAPS and 16.6 mg bovine serum albumin. The mixture
is spun at 2000 rpm for 3 min to pellet the bead-oligo mix. The supernatant is removed
and the bead-oligo pellet resuspended in the same binding buffer as above. The cell
lysates are incubated in each well with one of 11 concentrations of compound, ranging
from 0.17 to 10,000 nM, in the presence of ~0.0338 m i tritiated GW233 1 ( racemic 2-[4-
[2-[[(2,4-difluorophenyl)carbamoyl](heptyl)amino]ethyl]phenoxy]-2-methylbutanoic
acid) for the alpha and delta receptors and -0.0373 m tritiated 2-methyl-2-[4-[3-
[propyl[(5-pyridin-2-ylthiophen-2-yl)sulfonyl]amino]propyl]phenoxy]propanoic acid for
the gamma receptor, 110.3 mg of SPA Streptavidin coated beads, 0.126 nM HD Oligo
DR2, and either 0.3 mg PPARa with 0.5 mg RXRa, 0.5 mg PPAR5 with 0.5 mg RXRa, or
1.25 mg PPARy with 3.03 mg RXRa in the binding buffer above plus 14% glycerol and 5
mg of sheared salmon sperm DNA. Non-specific binding is determined in the presence of
10000 nM unlabeled GW233 1 (Kliewer, S. A. et al Proc. Natl. Acad. Sci. USA (1997),
94: 4318-4323) forthe alpha and delta receptors and 2-methyl-2-[4-[3-[propyl[(5-pyridin-
2-ylthiophen-2-yl)sulfonyl]amino]-propyl]phenoxy]propanoic (WO 2004/073606) forthe
gamma receptor. The binding reaction (100 per well in a 96 well [Costar 3632] plate)
is incubated for 10 h and counted as disintegrations per minute (dpm) on a Wallac
Microbeta Luminometer Liquid Scintillation Counter. Receptor binding affinity (IC50)
for the compounds is determined by fitting an 11 point concentration-response curve with
a 4-paramater logistic equation. ¾ is determined from the IC50 using the Cheng-Prussoff
equation and Kd determined by saturation binding.
Tritiated GW233 1 can be obtained by generally following procedures in the
literature for synthesis of the gem-dimethyl analogue (WO 92/10468; Hawke, R. L. et al
J. Lipid Res. 1997, 38: 1189-1203) to obtain the non-tritiated material. The tritiation can
be accomplished using tritium gas and Crabtree's Catalyst (Heys, J . R. et al J. Labelled
Cpd. Radiopharm. (1999), 42: 797-807) which places the tritium in the ortho position of
the difluorophenyl. Alternatively, tritium can be placed in the heptyl portion of the
molecule by palladium catalyzed reduction with tritium gas of the heptenyl analogue
(ibid, Kliewer, S. A).
Tritiated 2-methyl-2-[4-[3-[propyl[(5-pyridin-2-ylthiophen-2-
yl)sulfonyl]amino]propyl]phenoxy]propanoic acid can be made by catalytic reduction of
the ally precursor with tritium gas. The ally precursor (2-[4-[3-[allyl-[[5-(2-pyridyl)-2-
thienyl]sulfonyl]amino]propyl]phenoxy]-2-methyl-propanoic acid) can generally be made
by following procedures in WO 2004/073606, beginning with ethyl 2-methyl-2-[4-[3-(ptolylsulfonyloxy)
propyl]phenoxy]propanoate in reaction with allylamine, followed by
sulfonylation with 5-(2-pyridinyl)-2-thiophenesulfonyl chloride and hydrolysis of the
ethyl ester.
Use of the two radioligands can be found in the literature (Burris et al. Molecular
Pharmacology, 2004 67: 948-954 and Xu et al. J. Med. Chem. 2004, 47: 2422-2425).
Following a protocol essentially as described above the compound of Example 2
displayed a ¾ in the PPAR a, d, g binding assays of about 617 nM (n = 3), > 8830 nM (n
= 4), and 1380 nM (n = 2) respectively. These data demonstrate that the compound of
Example 2 is only weakly interactive, with PPAR receptors. The activity is believed to
evidence selectivity and not present a development limitation.
In vivo Assay Procedures;
CaCh-induced AAA animal efficacy model:
A targeted application of a calcium chloride solution to the mouse aorta induces
vessel dilatation Chiou et al. J. Surg. Res. (2001), 99: 371-376; Lomgo et al. J. Clin.
Invest. (2002), 110: 625-632. Two weeks after treatment, the vessel dilatation compared
to the original vessel diameter becomes statistically significant, with up to 75% increase
of aortic lumenal perimeter after 4 weeks. Calcium precipitates have been localized
primarily within the elastic network of the media. Disruption of this structure by the
calcium-elastic tissue complex weakens the vessel wall, contributing to aneurysm
formation. This injury also serves as a proinflammatory stimulus, recruiting neutrophils,
lymphocytes, monocytes, and mast cells.
Animals:
Mice: 129SvEv males, 7 weeks of age, are acquired from Taconic Farms, Germantown,
New York, USA.
Rats: Sprague-Dawley rats, 7-8 weeks of age, are acquired from Harlan, Indianapolis,
Indiana, USA
Aneurysm Induction Model: All procedures are performed in accordance with Eli Lilly
and Company Institutional Animal Care and Use guidelines. Upon their arrival, animals
have a one week acclimation period during which they have ad libitum access to standard
rodent chow (Purina #2014) and house water. Following the acclimation period, animals
are anesthetized with isoflurane, and a laparotomy is performed for the CaCl2 -stimulated
induction of the abdominal aortic aneurysm (AAA). The abdominal aorta from the level
of the renal arteries to the iliac bifurcation is isolated from the inferior vena cava and
surrounding connective tissues using micro-surgical techniques. Once isolated, the region
of interest (ROD of the abdominal aorta is wrapped with sterile, cotton gauze presoaked
in a 0.25 M CaC solution. In sham control animals, 0.9% saline is substituted for CaCi2.
After 7 min, the gauze is removed and a second CaCl2 soaked gauze reapplied.
Following the second 7 min period, the gauze is removed, the aorta rinsed with 0.9%
saline and the abdomen closed. Animals are returned to general housing at the end of
their surgical day.
Compound Administration: Mice receive test compound (Example 2) by oral gavage at
a dose volume of 10 mL/kg of body weight, and rats receive test compound (Example 2)
by oral gavage at a dose volume of 2.5 mL/kg of body weight. Compound administration
is BID (a.m. and p.m.) with the first dose given one day prior to surgery (p.m.) and the
second dose given the morning of surgery. Animals do not receive a p.m. dose on the day
of surgery. The day after surgery, dosing continues BID for 28 days.
Aortic Measurements by Ultrasound: Twenty-eight days following surgery, animals
are anesthetized and undergo abdominal ultrasound measurements using the eSaote
MyLab 30 Gold Biosound Ultrasound unit equipped with a 7.5 MHz probe. Due to the
asymmetrical development of AAA in preclinical CaCl2 rodent models, arterial
measurements are taken of outside diameter and lumenal (inside) diameter during peak
systole along both the longitudinal and cross sectional axes to identify the most dilated
section within the ROI. Interior cross sectional lumenal perimeter measurements (mm)
are collected at that point to assess efficacy and statistically analyzed with JMP® 7
software (Cary, North Carolina).
Statistical Analysis: Measurements of lumenal perimeter are expressed as mean values
± SE. To determine the percent of AAA inhibition for the drug treated groups, the
measurements from the vehicle-treated sham control group represent 100% inhibition of
AAA development, while the measurements from the vehicle treated CaC¾ group
represent 0% inhibition of AAA development. Statistical analysis is performed with
JMP® 7 software (Cary, North Carolina) and Dunnett's Test is used for statistical
comparisons across treatment groups. Statistical significance is accepted at P<0.05.
The efficacy signal window in the CaCl2-induced abdominal aortic aneurysm
model is determined by the lumenal perimeter of the aorta in mice treated with salinesoaked
gauze followed by 4-weeks dosing with vehicle that determines 100% efficacy
("Sham Vehicle") and the lumenal perimeter of the aorta in mice treated with CaC¾-
soaked gauze followed by 4-weeks dosing with vehicle ("Vehicle") that determines 0%
efficacy.
Following a protocol essentially as described above, using 129SvEv mice, the
luminenal perimeter of the aorta is statistically reduced (Table 1), as compared to
Vehicle-treated mice, using the compound of Example 2, and evidences the compound of
Example 2 reduces AAA in this animal model.
Table 1. In Vivo Percentage (%) Reduction of AAA in mice
% Reduced
Group P Value
(±S.E.)
Vehicle 0%±9
10 mg/kg b.i.d. 41%±13 p=0.0522
30 mg/kg b.i.d. 48%±10 p=0.0179
60 mg/kg b.i.d. 58%±13 p=0.0028
Sham 100%±8 p=<0.0001
In a similar study design, the ability of the compound of Example 2 to modulate
aortic aneurysm dilation following CaCl2-induced injury is evaluated in Sprague-Dawley
rats. The lumenal perimeter of the aorta is statistically reduced, as compared to Vehicletreated
rats (Table 2), and evidences that the compound of Example 2 reduces AAA.
Table 2. In Vivo Percentage (%) Reduction of AAA in rats
LDLr KO mouse brachiocephalic arch atherosclerosis model:
The compound of Example 2 is tested in the low density lipoprotein (LDL)
receptor knock-out (LDLr KO) mouse model of atherosclerosis. Mice deficient in the
ability to encode and synthesize the LDL receptor (LDLr KO) are hypercholesterolemic,
especially when maintained on high cholesterol diet, Ishibashi et al. J. Clin. Invest.
(1994), 93: 1885-1893. In the large arteries, LDLr KO mice develop spontaneous
atherosclerotic lesions that mimic major features of the cellular, lipid, and extracellular
matrix composition of human lesions. An important constituent of both human and
mouse lesions is the lipid-laden macrophage or "foam cell" in the arterial
subendothelium. The esterified cholesterol stored by macrophages is a surrogate for
lesion development. Assay of esterified cholesterol directly from mouse arterial tissue
(by LC/MS) provides a rapid index of lesion burden. The LDLr KO model used in the
present study takes advantage of the rapid development of mature atherosclerotic plaques
in the brachiocephalic artery (BCA). Primary endpoints for the study are arterial
cholesteryl ester content and lesion dimensions obtained by light microscopic
measurement of lesions in serial cross-sections of the artery.
LDLr KO mice (JAX #002207), 7 week old males, were obtained from The
Jackson Laboratory (Bar Harbor, Maine). Upon arrival at the testing facility and
continuing for a total of 10 weeks, mice were housed individually and fed the atherogenic
diet TD.88137 (Teklad) ad libitum. During the first 6 weeks, the mice rested undisturbed
in their cages. During the last 4 weeks, the mice received the test compound twice daily
by oral gavage. Data from the evaluations are reported in Table 3, below.
Table 3 : LDLr KO mouse BCA atherosclerosis lesion area illustrates dosedependent
reduction in atherosclerosis endpoints. Comparisons between treatment groups
were made with a 1-way ANOVA followed by Dunnett's test.
Table 3 shows that the compound of Example 2 at 30 mg/kg b.i.d dosing reduced
BCA cholesteryl ester (CE) content 23% compared to the vehicle treated group (p <
0.04). The compound of Example 2 at 10 mg/kg b.i.d, although less effective than at 30
mg/kg b.i.d., reduced CE content by 18% compared to vehicle treatment (p < 0.09). The
trend toward a significant reduction of BCA atherosclerosis suggested by these surrogate
data is confirmed and extended by the direct measurement of BCA lesions. Table 3
shows a significant reduction in lesion area produced by the compound of Example 2 at
30 mg/kg oral b.i.d dosing. Treatment at this dose results in a reduction of lesion area of
66% compared to treatment with vehicle alone (p < 0.017). The 58% and 53% reduction
in lesion area produced by the compound of Example 2 at 10 mg/kg b.i.d and 3 mg/kg
b.i.d. dosing, respectively, illustrates a similar dose-response effect as compared to the
effect on BCA CE content.
WE CLAIM:
1. A compound of Formula (I)
or a pharmaceutically acceptable salt thereof.
2. A compound of claim 1 which is Sodium 4-[[3-[3-[2-ethyl-4-(4-fluorophenyl)-
5-hydroxy-phenoxy]propoxy]-2-propyl-phenyl]amino]-2,2-dimethyl-4-oxo-butanoate.
3. A pharmaceutical composition comprising a compound according to claim 1 or
2 and a pharmaceutically acceptable carrier.
4. A method of treating abdominal aortic aneurysm, atherosclerosis or both in a
patient in need thereof, comprising administering to said patient a therapeutically
effective amount of a compound according to claim 1 or pharmaceutically acceptable salt
thereof.
5. A method of treating abdominal aortic aneurysm, atherosclerosis or both in a
patient in need thereof, comprising administering to said patient a therapeutically
effective amount of a compound according to claim 2.
6. A compound of claim 1, or pharmaceutically acceptable salt thereof for use in
therapy.
7. A compound of claim 2 for use in therapy.
8. A compound of claim 1, or a pharmaceutically acceptable salt thereof, for use
in the treatment of abdominal aortic aneurysm, atherosclerosis or both
9. A compound of claim 2 for use in the treatment of abdominal aortic aneurysm,
atherosclerosis or both.
10. The use of a compound of claim 1, or a pharmaceutically acceptable salt
thereof, for the manufacture of a medicament for the treatment of abdominal aortic
aneurysm, atherosclerosis or both.
11. The use of a compound of claim 2 for the manufacture of a medicament for
the treatment of abdominal aortic aneurysm, atherosclerosis or both.