The present invention relates to the field of vaccine development.
More particularly, the present invention relates to a live attenuated vaccine for
Leishmaniasisand method thereof.
BACKGROUND
10 [0002] Background description includes information that may be useful in
understanding the present invention.
[0003] Leishmaniasis is a disease which has been classified as emerging and
uncontrolled by WHO and estimates that the infection results in approximately
one million new cases annually (https://www.who.int/news-room/fact15 sheets/detail/leishmaniasis). Leishmaniasis is endemic in 88 countries and affects
some of the poorest people on earth, and is associated with malnutrition,
population displacement, poor housing, a weak immune system and lack of
financial resources.
[0004] Leishmaniasis is caused by the protozoan Leishmaniawhich is
20 transmitted by the bite of infected female phlebotomine sandflies. There are 3
main forms of Leishmaniasis – visceral (also known as kala-azar, which is most
serious form of the disease), cutaneous (the most common), and muco-cutaneous.
[0005] The life cycle of Leishmania alternates between insect (sandfly) vector
and the eukaryote host. In the insect stage, the parasite resides inside the gut of the
25 sand fly. The movement of the parasite through the gut is a part of the
development process wherein the parasite differentiates from the amastigotes to
the eukaryote infectious metacyclic parasites. Once inside the eukaryote host, the
parasite adopts the Trojan horse strategy. The initially infected neutrophils of the
host serve to protect Leishmania from components of the immune system. The
3
5 initially infected cells deliver Leishmania to the macrophages which then serves
as the host for this invading pathogen. Inside the macrophages, Leishmania
differentiates into amastigotes and divides.
The parasitophorous vacuole are the residence sites of Leishmania inside
of the macrophages. Amastigotes increase in number to eventually rupture the
10 macrophage and are released in the surroundings. These amastigotes then further
invade other macrophages to maintain the infection.This implies that the
protozoan Leishmania is an obligate intracellular parasite of macrophages in the
amastigote form in humans.
In the view of foregoing, it is evident that the treatment for Leishmaniasis
15 is complicated. The available medications such as
pentavalentantimonials,amphotericin B and pentamidine have severe side effects,
arecostly and administered exclusively by the parenteral route. Moreover,
resistance to these medications has been reported.
[0006] There arises a need for the vaccine which can prevent infection of
20 Leishmania without any above mentioned limitations.However, the vaccines
tested so far viz., the subunit vaccines and the whole cell killed vaccineshave
failed to develop long-term immunityin the clinical trials. The live attenuated
vaccine seems to be the only solution for the problem.
[0007] Live attenuated vaccinesare weakened(or attenuated) form of the
25 pathogens that causes a disease.Because these vaccines are so similar to the
natural infection that they help in creating a strong and long-lasting immune
response. Just 1 or 2 doses of most live vaccines can give a lifetime of protection
against a pathogen (https://www.vaccines.gov/basics/types).
[0008] Very few antileismanial vaccines have been reported till date.
30 Vaccination with dihydrofolatereductase-thymidylate synthase (dhfr-ts) knockout
4
5 Leishmania parasites led to protection in a mouse model, (Titus RG, GueirosFilho FJ, de Freitas LA, Beverley SM. Development of a safe live Leishmania
vaccine line by gene replacement. ProcNatlAcadSci U S A. 1995;92:10267–71)
but failed to protect monkeys against an infectious challenge. Deletion of cysteine
proteinases in Leishmaniam exicana led to an attenuated strain capable of
10 triggering partial protection against challenge in animal models.These moderately
encouraging results were thought to be due to rapid elimination of parasites by the
host, since knockout parasites were not persistent. Conversely, L. major parasites
lacking the lpg2 gene persisted in mice without pathology and were able to confer
protection against infection. However, over time these mutants regained their
15 ability to cause disease. L. donovanicentrin null mutants (LdCEN-/-) have been
reported by US patent 7,887,812B2to have selective growth arrest in the
amastigote stage of development, but were viable in culture as promastigotes.
[0009] In the view of the foregoing, there arises a need of an attenuated
antileishmanial vaccine which is sufficiently attenuated to avoid unacceptable
20 pathological effectsbut on the other hand it must elicit an adequate immune
response capable of conferring a lasting protection in the host against the disease
(protective immunity) independently of the Leishmania strain.
[0010] Present invention caters to the limitations in the above mentioned
vaccines and provides a mutant Leishmania strain in which both copies of
25 XP_003722285.1 gene has been deleted thus rendering theSTKc_AMPK_Alpha
domain inactivated. Since the gene has been knocked out completely, the chances
of reverting to virulent state is zero.
[0011] STKc_AMPK alpha domain - This domain is essential in yeast for
shifting from one carbon source to another. The mutants of this protein domain
30 are unable to shift from glucose as primary carbon source to secondary carbon
sources like sucrose, galactose, ethanol etc. Apart from its role in metabolism, this
protein also has a role in stress adaptation including various stresses as sodium ion
5
5 stress, heat shock response, alkaline pH, oxidative stress as ROS and genotoxic
stress. Often a correlation is observed between the processes effecting stress with
the processes effecting development. Since, Leishmania cycles between the
sandfly and the animal host during its life cycle. In the sandfly, Leishmania
undergoes various developmental stages depending upon the location in the gut of
10 the sandfly. In the midgut, the parasite differentiates from macrophages to
procyclicpromastigotes which has two forms i.e. leptomonad and nectomonad.
The procyclicpromastigotes has the lipophosphioglycan (LPG) on their surface to
bind and attach to the mid gut of the sandfly and prevent its excretion along with
the digested blood. This LPG expressing form then converts to metacyclic forms
15 which are highly infectious to animal host. These metacyclics move from the
sandfly mid gut to the sandfly proboscis from where these are deposited into the
skin dermis as the sand fly takes a blood meal. Leishmania uses carbohydrates as
a mode of nutrition in the sandfly and shifts to fatty acid metabolism inside of the
animal host.
20 Apart from nutrition, Leishmania also undergoes a shift in temperature
and pH as it moves from the sand fly mid gut to the parasitophorous vacuole
inside the macrophage of the animal host. During its lifecycle, Leishmania
undergoes several stresses as changes in temperature and environmental
conditions. Considering the importance of STKc_AMPK alpha domain in
25 Leishmania to survive in eukaryotes, this domain was chosen and gene expressing
it was knocked or/ deleted to develop Leishmania mutants.
OBJECTS OF THE INVENTION
[0012] Some of the objects of the present disclosure, which at least one
30 embodiment herein satisfy, are listed hereinbelow.
6
5 [0013] The principal object of the present subject matter is toprovide alive
attenuated vaccine for Leishmaniasis.
[0014] Another object of the present subject matter is to providemutant/
genetic modified Leishmania strain with deleted XP_003722285.1 gene.
[0015] Another object of the present subject matter is toprovide mutant/
10 genetic modified Leishmania strain with inactivated STKc_AMPK_Alpha
domain.
[0016] Another object of the present subject matter is the method of
production of antileishmanial live attenuated vaccine.
[0017] These and other objects and advantages will become more apparent
15 when reference is made to the following description and accompanying drawings.
SUMMARY
[0020]This summary is provided to introduce concepts related tolive attenuated
vaccine for Leishmaniasisand method thereof. The said vaccine comprises of
20 mutant Leishmania strain in a pharmaceutically acceptable carrier or diluent and
optionally an adjuvant. The mutant strain has knocked out/ deleted
XP_003722285.1 gene and hence inactivated STKc_AMPK_Alpha domain.
STKc_AMPK_Alpha domain of Leishmania was targeted as it is essential for
stress management and in shifting from one carbon source to another. Since
25 Leishmania shifts from sand fly to eukaryotic host such as dog, human beings, it
will not be able to flourish in the eukaryotic host as the carbon sources are
different in both hosts.
Further, the said vaccine when administered in foot pad of mice, no pathological
symptoms appeareven after 12 weeks (3 months). Furthermore, when mice
30 immunized with vaccine of present invention is challenged with virulent (wild)
7
5 Leishmania strain, mild disease symptoms developed as mice are extremely
susceptible to infection. Thus, the vaccine when used in appropriate quantity with
pharmaceutically acceptable carrier or diluents in animals including humans, is
capable of giving desirable results i.e. preventing Leishmaniasis.
Various objects, features, aspectsand advantages of the inventive subject matter
10 will become more apparent from the following detailed description of preferred
embodiments, along with the accompanying drawing figures in which like
numerals represent like components.
BRIEF DESCRIPTION OF THE DRAWINGS
[0001] The illustrated embodiments of the subject matter will be understood
15 by reference to the drawings that are consistent with the subject matter as claimed
herein,
Figure 1:Agarose gel electrophoresis of knock out screening PCR. The
screening primers amplify 2698 base pair of the product N2 (mutant strain
described in this invention) which includes the wild type gene open reading
20 frame and adjoining untranslated region. The size of the replacement
cassette is 1850 base pairs. The figure shows the replacement of the mutant
strain wild type DNA with the replacement cassette. N2 is the product
described in the invention.
Figure 2:Chromatogram of sequenced PCR product of the mutant strain.
25 The blue color highlights the wild type genomic DNA while the Yellow
color depicts the integrated cassette containing the neomycin resistance
gene.
Figure 3: Microscopic images of the wild (a) and the mutant (b) strains
showing increase in size and bulbous nature of the mutant cells.
8
5 Figure 4: FACS forward and side scatter gating images comparing the wild
and the mutant strains. A1 is the wild type and A2 is mutant strains.
Figure 5: Footpad lesion and lymph node swelling images at 4, 8 and 12
weeks post infection. A1,A2 and A3 shows lesion and lymph node images
of wild type virulent strain infected mice at 4, 8 and 12 weeks respectively.
10 Progressive increase in lesion size and lymph node swelling can be
observed. B1, B2 and B3 shows the lesion size and lymph node swelling at
4, 8 and 12 weeks post infection for the wild type avirulent strain infected
mice respectively. There is no infection development at 4 weeks post
infection. Progressive disease development can be observed at 8 and 12
15 weeks post infection. C1,C2 and C3 shows the lesion size and lymph node
swelling for the mutant strain infected mice at 4, 8 and 12 weeks post
infection respectively. No sign of disease development was observed till 12
weeks (three months) post infection.
Figure 6: Lymph node weight after 4, 8 and 12 weeks post infection (A),
20 (B), (C) respectively. Foot pad thickness (D) measured per week post
infection.N2 represents the mutant strain of the present invention.
Figure 7:Growth curve analysis of the mutant strain (product of present
invention) with the wild type strain. A slower growth can be observed in
the mutant strain as compared to the wild type strain.
25 Figure 8:Multiple sequence alignment for the four proteins of Leishmania
with Saccharomyces cerevisiae SNF1 kinase protein. E9AE64_LEIMA
protein was chosen for the study. Only the highly similar N-terminal region
containing the STKc_AMPK_alpha domain is shown in the figure.
Figure 9:Phylogenetic tree showing relatedness between the different
30 proteins under study. Strain chosen for mutation was found to be highly
similar to the Saccharomyces cerevisiae protein SNF1 kinase.
9
5
DETAILED DESCRIPTION
[0002] The detailed description of various exemplary embodiments of the
disclosure is described herein with reference to the accompanying drawings. It
should be noted that the embodiments are described herein in such details as to
10 clearly communicate the disclosure. However, the amount of details provided
herein is not intended to limit the anticipated variations of embodiments; on the
contrary, the intention is to cover all modifications, equivalents and alternatives
falling within the scope of the present disclosure as defined by the appended
claims.
15 [0003] It is also to be understood that various quantities and ratios may be
devised that, although not explicitly described or shown herein, embody the
principles of the present disclosure. Moreover, all statements herein reciting
principles, aspects and embodiments of the present disclosure, as well as specific
examples, are intended to encompass equivalents thereof.
20 [0004] The terminology used herein is for the purpose of describing particular
embodiments only and is not intended to be limiting of example embodiments. As
used herein, the singular forms “a",” “an” and “the” are intended to include the
plural forms as well, unless the context clearly indicates otherwise. It will be
further understood that the terms “comprises,” “comprising,” “includes” and/or
25 “including,” when used herein, specify the presence of stated features, integers,
steps, operations, elements and/or components, but do not preclude the presence
or addition of one or more other features, integers, steps, operations, elements,
components and/or groups thereof.
[0005] It should also be noted that in some alternative implementations, the
30 functions/acts noted may occur out of the order noted in the figures. For example,
two figures shown in succession may, in fact, be executed concurrently or may
10
5 sometimes be executed in the reverse order, depending upon the functionality/acts
involved.
[0006] In addition, the descriptions of "first", "second", “third”, and the like in
the present invention are used for the purpose of description only, and are not to
be construed as indicating or implying their relative importance or implicitly
10 indicating the number of technical features indicated. Thus, features defining
"first" and "second" may include at least one of the features, either explicitly or
implicitly.
[0007] Unless otherwise defined, all terms (including technical and scientific
terms) used herein have the same meaning as commonly understood by one of
15 ordinary skill in the art to which example embodiments belong. It will be further
understood that terms, e.g., those defined in commonly used dictionaries, should
be interpreted as having a meaning that is consistent with their meaning in the
context of the relevant art and will not be interpreted in an idealized or overly
formal sense unless expressly so defined herein.
20 [0008] It should be noted that the description merely illustrates the principles
of the present subject matter. It will thus be appreciated that those skilled in the art
will be able to devise various arrangements that, although not explicitly described
herein, embody the principles of the present subject matter and are included
within its scope.
25 [0009] An aspect of the invention refers to a method for the production of a
pharmaceutical composition, preferably a vaccine, comprising mutant live
Leishmania strains for XP_003722285.1 gene, more preferably
STKc_AMPK_Alpha domain, preferably wherein the pharmaceutical composition
is suitable for the prophylactic treatment (before infection) of animals and/or
30 humans against infection with the wild type form of Leishmania, and wherein said
11
5 pharmaceutical composition is produced by a method comprising the steps as
below:
i. Obtaining mutant live Leishmania Strain for XP_003722285.1 gene,
more preferably STKc_AMPK_Alpha domain
ii. Introducing said mutant live Leishmania strains in a pharmaceutically
10 acceptable carrier or diluent and optionally adding an adjuvant; and
iii. Optionally freeze-drying the pharmaceutical composition.
[0010] In preferred embodiment of the invention, the production method
comprises the steps of:
15 i. Providing a Leishmania strain having fully functional
XP_003722285.1 gene
ii. Inactivating/ deleting both copies of XP_003722285.1 gene; and
iii. Introducing said mutant live Leishmania strains in a pharmaceutically
acceptable carrier or diluent and optionally adding an adjuvant.
20
[0011] In another preferred embodiment of the invention, gene deleted or/and
inactivated is the gene expressing for
theproteinLMJF_29_2020/XP_003722285.1, more preferably
XP.003722285.1gene.
25 [0012] In another preferred embodiment of the invention, gene deleted or/and
inactivated is the gene expressing for the STKc_AMPK_Alpha domain
[0013] In another preferred embodiment of the invention, the pharmaceutical
composition is a vaccine and the production method comprises adding
an adjuvant.
12
5 [0014] In another preferred embodiment of the invention, the Leishmania strain
is preferably one of L. aethiopica, L. donovani, L. infantum, L. major,
L. mexicana and L. tropica.
[0015] The inactivation mentioned above can be an insertion, a deletion, a
substitution or a combination thereof, provided that the inactivation
10 leads to the failure to express a functional
LMJF_29_2020/XP_003722285.1 protein.
[0016] In another embodiment, the method of deletion of genes preferred is
CRISPR (clustered regularly interspaced short palindromic repeats)
based gene editing/modification.
15 [0017] In another embodiment, said pharmaceutically acceptable carrier or
diluent is selected from the list consisting of water, culture fluid, a
solution of physiological salt concentration and/or stabilisers such as
SPGA, carbohydrates (e.g. sorbitol, mannitol, starch, sucrose, glucose,
dextran), proteins such as albumin or casein, protein containing agents
20 such as bovine serum or skimmed milk and buffers (e.g. phosphate
buffer).
[0018] In another preferred embodiment, said pharmaceutical composition
comprises a dose of mutant live Leishmania strains ranging between
103 and 1010 Leishmania cells.
25 [0019] In another embodiment, said pharmaceutical composition is in a freezedried form.
[0020] The mutations of the loci and genes described herein may be any
mutation, such as one or more nucleic acid deletions, insertions or substitutions.
The mutations may be any deletion, insertion or substitution of the loci or genes
30 that results in a reduction or absence of expression from the loci or genes, or a
reduction or absence of activity of a polypeptide encoded by the loci or genes.
13
5 [0021] EXAMPLES
Hereinafter, the present disclosure is being described in further detail through
examples. However, the following examples are for illustrative purposes only and
it will be apparent to those of ordinary skill in the art that the scope of the present
disclosure is not limited by the examples.
10 Example 1
Genetic modification (mutation) of Leishmania strainSteps are as belowSynthesis of guide RNA: Guide RNA was synthesized by extending the annealed
primers by polymerase chain reaction (PCR). The primers used for the generation
15 of the guide RNA were as given by Beneke.T, et al. 2017
(https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5451818/). The PCR product
was gel purified and electroporated in Leishmania.
Donor template synthesis: Donor template was generated by PCR with primers
given by Beneke.T,etal, 2017. Plasmid with Neomycin resistance cassette was
20 chosen as template and PCR amplified product was purified.
Knocking out of gene XP_003722285.1: The gene XP_003722285.1 of
Leishmania was knocked out by using CRISPR based gene deletions. Genes in
Leishmania are present in two copies and it is essential to delete both copies to get
knock out of that particular gene. The gene of interest i.e. XP_003722285.1was
25 replaced by a drug resistance cassette using a plasmid containing the cas9 and T7
RNA polymerase (CRISPR based strategy) by electroporation technique. The
electroporation of the cas9 plasmid (50ug) was done using Bioradelectroporator at
1500V. The plasmid contains a gene for the hygromycin resistance, so blood agar
plates were made having antibiotic hygromycin. The hygromycin resistant strain
30 developed was maintained by liquid media propagation with selection antibiotic.
14
5 Example 2
Confirmation of complete deletion/ knockout of the genein Leishmania
Strain- The genomic DNA was isolated from the mutant and wild type strains of
Leishmania by Qiagen blood and tissue genomic DNA isolation Kit. PCR primers
(Seq 1) were designed specifically to span the open reading frame of each gene of
10 interest. The PCR product were run on agarose gels to identify their size.
Primers used to confirm knock out:
Name Sequence 5’-3’
scr 1f ACCTCGTTGGCTCTGATGAC
scr 1 r GTCTTCCACCACCATCCCAC
Result- The band size obtained for the wild type and mutant strain confirmed the
replacement of the genetic wild typefragment withthe desired DNA cassette
(Figure 1). The size of the DNA cassette is approximately 1850 base pairs for all
15 the cassettes and hence the size of flanking primer PCR in all genetically modified
strains is around 1850 base pair. The size of the genomic DNA (replaced by DNA
cassette) as seen in terms of the PCR product of flanking primers is variable and
depends on the size of wild type gene.
The PCR products were also sequenced to identify the region where the genomic
20 DNA is altered by the insertion of the replacement cassette and Figure 2 shows
Chromatogram of Sequenced PCR product of the mutant strain and the sequence
(Seq 2) is as belowGGAAGGGAGCCGGAATTCTTTCTATACCACCGAAGTATGGGTGTACGT
GCTGAGGAGCACGTACACAGAAAAACACGCACACACCTTTTGCAACA
25 ACCCCGCCGCCAATTTGAGAGACCTGTGCAGATGAGAAAGCGCGGCC
15
5 ATCAGCAGAAGCAAAGAAGGGAGGGGGAGGGGTGTCGATGGAATGTC
AGTGAGAAGAAAACGTGAGATGCATACACGACGTAGGGCAACGTGAT
TGGCGGCCAGCGCAGGCGGGCGCTTTTCGAGATGGAGCACGGCTCAG
CGTCACAGAGACGGGCAACCGCAAACGTTGGAGCATTGCAACAAACA
CCAGGCGAACACCAAAAAAAAAACTACATGGTGCGTGACGTCGTGCG
10 GGATAGCGCACCAACCGCCCATGCGACGCGCGAAACAACGCTCATAT
ATGATCAACGGTGCCCATCGTGAAGTACATGATGCACACACGGCACAG
ACAGTGGTCAGCCTCTCCATTCTCCACAAGTTCGACACGAGAGCGTGG
CTCTTCTCCTTGTGGTGGGGGGTCTTTGCATGAAAACGTTACTCAAAAA
CGAAAAACAAAAAGAAAACACACCGAAGGGCAGGTAGAAGTACACTC
15 GAAACATCGCCACACGGGATGGCAGCGTCAGTGGACGGGTCATTGGA
CTATGCATTCGAGAAAGGACGAAACACCGGGCGGGAAGCTTTCAGAA
AAAACTCGTCCAAGAAGGGA.
Example 3
Maintenance of Leishmania strains20 Maintenance of mutant/ genetically modified strainwas done by growing mutant
strains on blood agar plates made with RPMI-1640 medium. Liquid cultures of
such strains were maintained on blood agar slants overlaid with RPMI-1640
medium and 10 %fetal bovine serum (FBS).The media were supplemented with
antibiotics as hygromycin (50ug/ml) and neomycin (50ug/ml) for the selection
25 and propagation of mutant strains.
Maintenance of wild strain- was done in-vitro as well as in-vivo.
In-vitro maintenance-was done in form of axenic culture in RPMI-1640 medium
containing 10% fetal bovine serum (FBS).
16
5 In-vivo maintenance- was done in mice by inoculating wild strain in mice
footpads. Infected footpads were crushed to release the amastigotes. These
amastigotes were cultivated in liquid culture medium to facilitate conversion to
promastigotes. Developed promastigotes were again inoculated into mice footpads
to maintainthe infectivity of the strain.
10 Strain with reduced virulence (avirulent strain) was achieved by skipping the mice
inoculation of Leishmania and maintaining the promastigote culture by repeated
passages in liquid culture medium.
Example 4
Analysis of cell shape15 i. By staining- The cultured cells of the wild Leishmania and mutant
Leishmania strain were fixed and stained by Giemsa stain. Stained slides
were observed under thermo fisher scientific EVOS microscope.
Change in the morphology of mutantstrain was observed under a light
microscope. Wild type Leishmania cells (as seen in Figure 3) are elongated
20 cells with flagellum larger than the cell body while mutant Leishmania cells
are bulbous, slightly rounded and has shortened flagellum. Mutant Leishmania
cells are less motile as compared to the wild Leishmania cells. A major
determinant of virulence in Leishmania is the aggregation of cells. Large
clumps of cells form aggregates in only virulent and low passage cultures.
25 These aggregates are reduces as the culture loses virulence and are absent in
high passage avirulent cultures. These aggregates can be observed in the wild
strain but are absent in the mutant strain.
ii. By Fluorescence-activated cell sorting (FACS)-Cell shape was also analyzed
by FACS by measuring the forward and side scatter. Cells of different strains
17
5 were cultivated on liquid culture medium and harvested in mid log phase. The
cells were washed with phosphate buffer solution(PBS) and finally resuspended in PBS before acquiring on FACS aria instrument. Forward and
side scatter gating was performed.
Increase in forward scatter was observed in mutant cells as compared
10 to the wild type cells. Higher forward scatter is observed with larger cells as
compared to smaller cells (Figure 4).
Example 5
Evaluation of efficacy of the mutant Leishmania strain (to be used as vaccine)
of the disclosure:
15 Efficacy of the mutant Leishmania strain was evaluated byinoculatingfootpad of
the mice with 1× 106 to1× 107 cells of wild, mutant and avirulent strains. The size
of the footpad swelling and the lymph node weight was measured by calipers at 4,
8 and 12 weeks post infection. The foot pad Leishmania load was also measured
by Real time PCR.
20 Result- The results are summarised in Table 1 below
Table 1.Evaluation of efficacy of the mutant Leishmania strain
Mice
inoculated
with
Appearance of Lesions in mice
footpad after ------weeks of
inoculation
Weight of Lymph node after ------
weeks of inoculation
0wee
k
4weeks 8weeks 12weeks 0week 4weeks 8weeks 12weeks
Control
(None)
None None None None 2 mg 2 mg 2mg 2mg
Mutant
Leishmania
Strain
None None None None 2 mg 2 mg 2mg 2mg
18
(Product of
the present
invention)
Wild strain (
virulent)
None Lesion
appeare
d
Lesion
became
bigger
Footpad
deformed
2mg
/
20 mg
/
45mg 75 mg
Avirulent
strain
None None Lesion
appeare
d
Lesion
became
bigger
2mg
/
2mg
/
3 mg 6 mg
5
As interpreted fromTable 1, no lesion was observed in the mice inoculated with
mutant Leishmania strain after 12 weeks (3 months) and size of lymph node also
remained same while in case of wild type (virulent, non-mutant) strain lesion
became bigger with each passing day and footpad was totally deformed. Avirulent
10 strain (which is generated by repeated laboratory passage without inoculation in
mice for virulence maintenance) showed no lesion after 4 weeks (one month) post
infection but within 12 weeks lesion appeared and became bigger with each
passing day (Figure5).
Also, the Leishmania strain of the present invention was evaluated by measuring
15 the weight of the draining lymph nodeof the foot. The weight of lymph node
remained same i.e.2 mg in the mice injected with mutant Leishmania strain of the
present invention, while the weight increased significantly in mice injected with
wild strain and avirulent strain (Figure 6).
Evaluation by Real time PCR:
20 Genomic DNA from 30 mg of footpad tissue was isolated by Qiagen blood and
tissue genomic DNA isolation kit. Real time PCR standards were prepared by
making serial dilutions from genomic DNA isolated from cultured cells. The
standards were run along with test samples on the Real time PCR
19
5 Result: Real time PCR was performed after12 weeks post infection and showed
that there wasno DNA of the Leishmania present in the footpad of the mice
infected with the mutant strain. However, Leishmania DNA was detected in the
foot pad of the wild strain infected mice. Quantification data suggest that there
were 7.5 ×104 wild strain parasites in the infected mice footpad two months post
10 infection.
Example 6
Whole proteome analysisWhole proteome analysis was performed by Liquid chromatography and mass
spectroscopy consecutively to identify changes in the protein profile of the
15 mutantstrain as compared to the wild strain. The steps are as belowThe cells of the mutantand the wild strain were grown on blood agar
slants. The cells were harvested and washed with Phosphate Buffered Saline
(PBS). Washed cells were then re-suspended in hot guanidinium hydrochloride
buffer and boiled for 10 minutes followed by sonication and boiling again for 5
20 minutes. The protein fraction from this lysate was purified by chloroform
methanol protein precipitation. The protein pellet was quantified and 100ug of
the protein was taken for trypsin digestion. The protein pellet was re-suspended
in guanidinium hydrochloride buffer and quantified by spectroscopy. Protein
denaturation and alkylation was performed followed by trypsin digestion at 1:20
25 trypsin to protein ratio for 24 hours. Trypsin was inactivated by acidification
with formic acid to reduce topH 2. Peptides were purified by C-18 reverse phase
columns. The purified peptides were stored at -80 oC.
Result: The proteome data suggests that there is a general reduction in metabolism
in the mutantstrain as compared to the wildstrain. In the mutantstrain there is an
20
5 up-regulation of the various ribosomal proteins(Figure 7). This increase in the
ribosomal proteins indicates a stressed state of the mutantcells.
EXAMPLE 8
Bioinformatics analysisBioinformatics studies of yeast protein database were done to identify proteins
10 having role in energy homeostasis and stress adaptation. Identified proteins were
searched using pBLAST for homologs in Leishmania major. The blast results
were filtered to yield four protein candidates in Leishmania major. The filtering of
the BLAST result was done on the basis of blast score (above 200) and only
proteins containing the STKc_AMPK alpha domain were included. To get a better
15 idea of the homology and the homologous region between the yeast and the
Leishmania proteins, multiple sequence alignment (MSA) was performed. MSA
was performed using CLUSTAL omega and for processing T-coffee and
BoxShade were used. A phylogenetic tree was also constructed by PhyML which
uses neighbour homology method for tree construction. Tree construction was
20 done to identify which of the Leishmania protein is most closely related to the
yeast counterpart.MSA comparing the SNF1 kinase protein sequence with the
protein sequence of Q4Q1Y6_LEIMA (N1),E9AE64_LEIMA
(N2),Q4QDX7_LEIMA (N3) andQ4Q416_LEIMA (N4). The alignment was
performed with T-Coffee by submitting all the files in FASTA format. The output
25 result from T-Coffee was processed using Boxshade tool.
Result- MSA shows high degree of similarity in the N terminal region of all
Leishmania sequences and yeast SNF1 kinase (Figure 8). The N terminal region
of all these proteins from Leishmania and yeast comprises of the
STKc_AMPK_Alpha domain(Figure 9). Therefore, the STKc_AMPK_Alpha
30 domain was chosen for the study.
21
5 In the view of the foregoing, it is evident that the present invention provides a
mutant/genetically modified Leishmania strain which can be used as live
attenuated vaccine as such or with pharmaceutically acceptable carrier or diluent
and with an adjuvant. The advantage of the using the mutant strain of the present
invention as vaccine is that when injected in mice in proper doses ( 106 – 107
cells )
10 does not develop any pathological symptoms which is very common with the
vaccines disclosed in the prior art literature. Thus, this strain when used as vaccine
provides complete immunity to Leishmaniasis without having any side effects in
form of mild lesions and discomforts.
15 [0022] It will be understood by those within the art that, in general, terms used
herein, and especially in the appended claims (e.g., bodies of the appended
claims) are generally intended as “open” terms (e.g., the term “including” should
be interpreted as “including but not limited to,” the term “having” should be
interpreted as “having at least,” the term “includes” should be interpreted as
20 “includes but is not limited to,” etc.). It will be further understood by those within
the art that if a specific number of an introduced claim recitation is intended, such
an intent will be explicitly recited in the claim, and in the absence of such
recitation no such intent is present. For example, as an aid to understanding, the
following appended claims may contain usage of the introductory phrases “at least
25 one” and “one or more” to introduce claim recitations. However, the use of such
phrases should not be construed to imply that the introduction of a claim recitation
by the indefinite articles “a” or “an” limits any particular claim containing such
introduced claim recitation to inventions containing only one such recitation, even
when the same claim includes the introductory phrases “one or more” or “at least
30 one” and indefinite articles such as “a” or “an” (e.g., “a” and/or “an” should
typically be interpreted to mean “at least one” or “one or more”); the same holds
true for the use of definite articles used to introduce claim recitations. In addition,
22
5 even if a specific number of an introduced claim recitation is explicitly recited,
those skilled in the art will recognize that such recitation should typically be
interpreted to mean at least the recited number (e.g., the bare recitation of “two
recitations,” without other modifiers, typically means at least two recitations, or
two or more recitations).
10 [0023] While the foregoing describes various embodiments of the invention,
other and further embodiments of the invention may be devised without departing
from the basic scope thereof. The scope of the invention is determined by the
claims that follow. The invention is not limited to the described embodiments,
versions or examples, which are included to enable a person having ordinary skill
15 in the art to make and use the invention when combined with information and
knowledge available to the person having ordinary skill in the art.

WE CLAIM:
1. A live attenuated vaccine for Leishmaniasis comprising an
immunogenically effective amount of a live attenuated mutant Leishmania
strain, pharmaceutically acceptable carrier WHEREIN the said
10 Leishmania strain has inactivated STKc_AMPK alpha domain.
2. The live attenuated vaccine for Leishmaniasis as claimed in claim 1
WHEREIN the STKc_AMPK alpha domain of Leishmania strain is
inactivated by deleting XP_003722285.1 gene.
15
3. The live attenuated vaccine for Leishmaniasis as claimed in claim 1 and 2
WHEREIN the protein inactivated in STKc_AMPK alpha domain is
preferably LMJF_29_2020/XP_003722285.1 protein.
20 4. The immunogenically effective amount of a live attenuated mutant
Leishmania strain as claimed in claim 1 comprises between 103 and
1010 cells of the live attenuated mutant of Leishmania strain.
5. The pharmaceutically acceptable carrier as claimed in claim 1 is selected
25 from the list comprising of water, culture fluid, a solution of physiological
salt concentration and/or stabilizers such as, carbohydrates (e.g. sorbitol,
mannitol, starch, sucrose, glucose), proteins such as albumin or casein,
protein containing agents such as bovine serum or skimmed milk and
buffers.
30
24
5 6. The Leishmania strain as claimed in the claim 1 is preferably one of
Leishmania ethiopica, Leishmania donovani, Leishmania infantum,
Leishmania major, Leishmaniam exicana and Leishmania tropica.
7. A method of production of live attenuated vaccine for
10 Leishmaniasiscomprises the steps of:
i. Providing a Leishmania strain having fully functional
XP_003722285.1 gene
ii. Inactivating/ deleting both copies of XP_003722285.1 gene; and
iii. Introducing said mutant live Leishmania strains in a pharmaceutically
15 acceptable carrier or diluent and optionally adding an adjuvant.
8. The method of deletion of genes as claimed in claim 6 is CRISPR
(clustered regularly interspaced short palindromic repeats) based gene
editing/ modification.
20
9. The Leishmania cells as claimed in claim 1 and 3 are bulbous, slightly
rounded and has shortened flagellum.