Mesodiaminopimelate dehydrogenase mutant polypeptide and L-threonine production method using the same
technical field
[1]
The present application relates to a mutant polypeptide in which the activity of meso-diaminopimelate dehydrogenase is weakened and a method for producing L-threonine using the same.
[2]
background
[3]
Corynebacterium genus (the genus Corynebacterium ) Microorganisms, particularly Corynebacterium glutamicum ( Corynebacterium glutamicum ) is a gram-positive microorganism that is widely used to produce L- amino acids and other useful substances. In order to produce the L-amino acid and other useful substances, various studies are being conducted for the development of high-efficiency production microorganisms and fermentation process technology. For example, a target substance-specific approach such as increasing the expression of a gene encoding an enzyme involved in L-lysine biosynthesis or removing a gene unnecessary for L-lysine biosynthesis is mainly used (US Patent Registration) 8048650).
[4]
On the other hand, among L-amino acids, L-lysine, L-threonine, L-methionine, L-isoleucine, and L-glycine are amino acids derived from aspartate, and the synthesis level of oxaloacetate, a precursor of aspartate, is the L- It can affect the level of synthesis of amino acids.
[5]
Meso-diaminopimelate dehydrogenase (meso-diaminopimelate dehydrogenase) is a piperodiene 2,6-dicarboxylate (piperodeine 2,6-dicarboxylate) produced during the lysine production process of microorganisms to meso-2,6- It is converted to diaminopimelate (meso-2,6-diaminopimelate) and is an important enzyme that fixes the nitrogen source in the lysine production pathway. The phenotype change of the L-threonine-producing strain due to the deletion of the ddh gene encoding meso diaminopimelate dehydrogenase and the L-lysine excretion gene lysE has been reported in the prior literature (X Dong, Y Zhao, J Hu, Y Li, X Wang - Enzyme and microbial technology, 2016). However, in the case of the lysE gene deletion, there is a negative effect of delaying the growth rate of the strain and decreasing the production of threonine, and in the case of the ddh gene deletion, the growth of the strain is also inhibited. A joint study is still needed.
[6]
DETAILED DESCRIPTION OF THE INVENTION
technical challenge
[7]
As a result of earnest efforts to increase the production of L-threonine while decreasing the production of L-lysine without delaying the growth rate of the strain, the present inventors have produced a novel variant that attenuates mesodiaminopimelate dehydrogenase activity to a specific level. The present application was completed by confirming that the production of L-threonine is increased as well as the growth of microorganisms is maintained when the polypeptide is used.
[8]
means of solving the problem
[9]
One object of the present application is to provide a meso-diaminopimelate dehydrogenase (meso-diaminopimelate dehydrogenase) variant polypeptide derived from Corynebacterium glutamicum .
[10]
Another object of the present application is to provide a polynucleotide encoding the variant polypeptide.
[11]
Another object of the present application is to provide a microorganism of the genus Corynebacterium comprising the meso diaminopimelate dehydrogenase variant polypeptide or a polynucleotide encoding the same.
[12]
Another object of the present application is to provide a method for producing L-threonine comprising the step of culturing the microorganism in a medium.
[13]
Another object of the present application is to provide a use of the microorganism for producing L-threonine.
[14]
Effects of the Invention
[15]
The production of L-threonine can be further improved when the novel mutant polypeptide with weakened meso diaminopimelate dehydrogenase activity of the present application is used. Accordingly, the effect of high yield and convenience of production can be expected from an industrial point of view.
[16]
Best mode for carrying out the invention
[17]
This will be described in detail as follows. Meanwhile, each description and embodiment disclosed in the present application may be applied to each other description and embodiment. That is, all combinations of the various elements disclosed in the present application fall within the scope of the present application. In addition, it cannot be seen that the scope of the present application is limited by the detailed description described below.
[18]
[19]
One aspect of the present application for achieving the above object, Corynebacterium glutamicum ( Corynebacterium glutamicum ) It provides a meso diaminopimelate dehydrogenase (meso-diaminopimelate dehydrogenase) variant polypeptide derived from.
[20]
Specifically, it is a meso diaminopimelate dehydrogenase variant polypeptide in which the 169th amino acid is substituted with another amino acid in the amino acid sequence of SEQ ID NO: 1, and more specifically, the 169th amino acid in the amino acid sequence of SEQ ID NO: 1 is leucine (leucine) ), phenylalanine (phenylalanine), glutamate (glutamate) or cysteine ​​(cystein) provides a substituted meso diaminopimelate dehydrogenase variant polypeptide.
[21]
[22]
As used herein, the term "meso-diaminopimelate dehydrogenase" is a NADPH-dependent reductase that catalyzes an intermediate process for lysine biosynthesis. The enzyme converts piperodiene 2,6-dicarboxylate, which is produced in the lysine production process of microorganisms, to meso-2,6-diaminopimelate (meso-2,6- It is an enzyme that produces diaminomelate) and is an important enzyme that fixes the nitrogen source in the lysine production pathway. Specifically, as a meso-2,6-diaminopimelate synthetase, it plays a rate-regulating role in the third step of the lysine production pathway. In addition, the enzyme catalyzes the reaction of fixing an ammonia group to piperodiene 2,6-dicarbylate to form meso-2,6-diaminopimelate.
[23]
"Meso diaminopimelate dehydrogenase" of the present application may be used interchangeably with citrate synthetase, meso-diaminopimelate dehydrogenase, or DDH.
[24]
[25]
In the present application, the sequence of the meso diaminopimelate dehydrogenase can be obtained from GenBank of NCBI, which is a known database. As an example, it may be meso diaminopimelate dehydrogenase derived from Corynebacterium sp. , and more specifically, it may be a polypeptide/protein comprising the amino acid sequence set forth in SEQ ID NO: 1, but is limited thereto it doesn't happen In addition, sequences having the same activity as the amino acid sequence may be included without limitation. In addition, it may include the amino acid sequence of SEQ ID NO: 1 or an amino acid sequence having 80% or more homology or identity therewith, but is not limited thereto. Specifically, the amino acid may include an amino acid having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% homology or identity to SEQ ID NO: 1 and SEQ ID NO: 1. can In addition, it is apparent that proteins having amino acid sequences in which some sequences are deleted, modified, substituted or added are included within the scope of the present application as long as the amino acid sequence has such homology or identity and exhibits efficacy corresponding to the protein.
[26]
[27]
As used herein, the term "variant" means that one or more amino acids differ from the recited sequence in conservative substitution and/or modification, but the function of the protein Refers to a polypeptide in which functions or properties are maintained. A variant polypeptide differs from the identified sequence by several amino acid substitutions, deletions or additions. Such variants can generally be identified by altering one of the polypeptide sequences and evaluating the properties of the modified polypeptide. That is, the ability of the variant may be increased, unchanged, or decreased compared to the native protein. Such variants can generally be identified by modifying one of the polypeptide sequences and evaluating the reactivity of the modified polypeptide. In addition, some variants may include variants in which one or more portions, such as an N-terminal leader sequence or a transmembrane domain, are removed. Other variants may include variants in which a portion is removed from the N- and/or C-terminus of the mature protein.
[28]
As used herein, the term “conservative substitution” means substituting an amino acid for another amino acid having similar structural and/or chemical properties. Such variants may have, for example, one or more conservative substitutions while still retaining one or more biological activities. Such amino acid substitutions may generally occur based on similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity and/or amphipathic nature of the residues. For example, positively charged (basic) amino acids include arginine, lysine, and histidine; negatively charged (acidic) amino acids include glutamic acid and aspartic acid; Aromatic amino acids include phenylalanine, tryptophan and tyrosine, and hydrophobic amino acids include alanine, valine, isoleucine, leucine, methionine, phenylalanine, proline, glycine and tryptophan. Typically, conservative substitutions have little or no effect on the activity of the resulting polypeptide.
[29]
In addition, variants may include deletions or additions of amino acids that have minimal effect on the properties and secondary structure of the polypeptide. For example, the polypeptide can be conjugated with a signal (or leader) sequence at the N-terminus of the protein that is involved in the transfer of the protein either co-translationally or post-translationally. The polypeptide may also be conjugated with other sequences or linkers to enable identification, purification, or synthesis of the polypeptide.
[30]
As used herein, the term "meso diaminopimelate dehydrogenase variant polypeptide" refers to meso diaminopimelate comprising one or more amino acid substitutions in the amino acid sequence of a polypeptide having meso diaminopimelate dehydrogenase protein activity. A dehydrogenase mutant polypeptide, wherein the amino acid substitution includes an amino acid in which the amino acid at position 169 from the N-terminus is substituted with another amino acid.
[31]
Specifically, it includes a variant polypeptide in which the amino acid at the position corresponding to the 169th amino acid is substituted with another amino acid in the amino acid sequence of a polypeptide having meso diaminopimelate dehydrogenase protein activity. For example, the variant polypeptide includes a variant polypeptide in which a mutation occurs at the 169th position from the N-terminus in the amino acid sequence of SEQ ID NO: 1. More specifically, the variant polypeptide may be a protein in which the amino acid at the position corresponding to the 169th amino acid in the amino acid sequence of SEQ ID NO: 1 is substituted with another amino acid.
[32]
The 'substitution with another amino acid' is not limited as long as it is substituted with an amino acid different from the amino acid before the substitution. Specifically, L-lysine, L-histidine, L-glutamic acid, L-arpartic acid, L-glycine, L-alanine, L-valine, L-leucine, L-isoleucine, L-methionine, L-phenylalanine, L- It may be substituted with any one amino acid of tryptophan, L-proline, L-serine, L-cysteine, L-tyrosine, L-asparagine, and L-glutamine. More specifically, in the variant polypeptide, the 169th amino acid in the amino acid sequence of SEQ ID NO: 1 may be one of L-leucine, L-phenylalanine, L-glutamic acid, or L-cysteine, but is not limited thereto.
[33]
In addition, the substituted amino acid residue may include a natural amino acid as well as a non-natural amino acid. The unnatural amino acid may be, for example, a D-amino acid, a homo-amino acid, a beta-homo-amino acid, an N-methyl amino acid, an alpha-methyl amino acid, an unconventional amino acid (eg, citrulline or naph thylalanine, etc.), but is not limited thereto. On the other hand, in the present application, when it is expressed that 'a specific amino acid has been substituted', it is obvious that the amino acid is substituted with an amino acid different from the amino acid before the substitution, even if it is not separately indicated that it is substituted with another amino acid.
[34]
[35]
As used herein, the term “corresponding to” refers to an amino acid residue at a position listed in a protein or peptide, or an amino acid residue similar to, identical to, or homologous to a residue listed in a protein or peptide. As used herein, "corresponding region" generally refers to a similar position in a related protein or reference protein.
[36]
In the present application, specific numbering may be used for amino acid residue positions within the polypeptides used in this application. For example, by aligning the polypeptide sequence of the present application with the target polypeptide to be compared, it is possible to renumber the position corresponding to the amino acid residue position of the polypeptide of the present application.
[37]
In the variant of meso diaminopimelate dehydrogenase provided in the present application, amino acids at specific positions in the aforementioned meso diaminopimelate dehydrogenase are substituted, and L-threonine production ability is a polypeptide before mutation can be increased compared to
[38]
[39]
The variant polypeptide has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more homology or identity to SEQ ID NO: 1 and/or SEQ ID NO: 1 described above. In the amino acid, the amino acid at the 169th position from the N-terminus may be mutated.
[40]
In addition, the variant polypeptide has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% homology to the amino acid sequence of SEQ ID NO: 1 and/or SEQ ID NO: 1, or At least 80%, 90%, 95%, 96%, 97%, 98%, or 99% of the amino acid sequence of SEQ ID NO: 1 and the amino acid at position 169 from the N-terminus is mutated from the amino acid having the same identity. Above, it may have a sequence homology of less than 100% and have an activity of meso diaminopimelate dehydrogenase.
[41]
The activity of meso diaminopimelate dehydrogenase of the mutant polypeptide may be weaker than that of meso diaminopimelate dehydrogenase having the amino acid sequence of SEQ ID NO: 1, which is a wild type.
[42]
[43]
For the purpose of the present application, in the case of a microorganism containing the meso diaminopimelate dehydrogenase mutant polypeptide, the L-amino acid production is higher than that of the microorganism in which the meso diaminopimelate dehydrogenase mutant polypeptide does not exist. characterized by increasing. The meso diaminopimelate dehydrogenase mutant polypeptide is characterized in that it has gene regulatory activity to increase the ability to produce L-amino acids compared to natural wild-type or unmutated meso diaminopimelate dehydrogenase. This is significant in that it is possible to increase the production of L-amino acids through the microorganism into which the meso diaminopimelate dehydrogenase mutant polypeptide of the present application is introduced. Specifically, the L-amino acid may be an amino acid derived from L-threonine and L-threonine, but if it is an L-amino acid that can be produced by introducing or including the meso diaminopimelate dehydrogenase mutant polypeptide included without limitation.
[44]
The L-threonine-derived amino acid means an amino acid that can be biosynthesized using L-threonine as a precursor, and is not limited as long as it is a material that can be biosynthesized from L-threonine.
[45]
[46]
The meso diaminopimelate dehydrogenase variant polypeptide is, for example, a variant polypeptide comprising an amino acid sequence in which the amino acid corresponding to the 169th position in the amino acid sequence shown in SEQ ID NO: 1 is substituted with another amino acid, the sequence It may be composed of number 3. The mutant in which the amino acid corresponding to the 169th position in the amino acid sequence of SEQ ID NO: 1 is substituted with leucine may consist of SEQ ID NO: 3, but is not limited thereto. In addition, the meso diaminopimelate dehydrogenase variant polypeptide may include the amino acid sequence of SEQ ID NO: 3 or an amino acid sequence having at least 80% homology or identity therewith, but is not limited thereto. Specifically, the meso diaminopimelate dehydrogenase variant polypeptide of the present application is SEQ ID NO: 3 and at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, Or it may include a protein having at least 99% homology or identity. In addition, if an amino acid sequence having such homology or identity and exhibiting efficacy corresponding to the protein, in addition to the amino acid corresponding to the 169th position, a protein having an amino acid sequence in which some amino acids are deleted, modified, substituted or added is also within the scope of the present application. It is self-evident that it is included within.
[47]
That is, even if it is described as 'a protein having an amino acid sequence described in a specific sequence number' in the present application, if it has the same or corresponding activity as a protein consisting of the amino acid sequence of the corresponding SEQ ID NO: some sequences are deleted, modified, It is apparent that proteins having substituted, conservatively substituted or added amino acid sequences may also be used in the present application. For example, if it has the same or corresponding activity as the mutant protein, adding a sequence that does not change the function of the protein before or after the amino acid sequence, a naturally occurring mutation, or a silent mutation or conservation thereof It is obvious that the substitution is not excluded, and it falls within the scope of the present application even if it has such sequence additions or mutations.
[48]
[49]
As used herein, the term "homology" or "identity" refers to the degree to which two given amino acid sequences or base sequences are related to each other and may be expressed as a percentage.
[50]
The terms homology and identity can often be used interchangeably.
[51]
Sequence homology or identity of a conserved polynucleotide or polypeptide is determined by standard alignment algorithms, with default gap penalties established by the program used may be used. Substantially homologous or identical sequences under moderate or high stringent conditions generally contain at least about 50%, 60%, 70%, 80% of the total or full-length of the sequence. or more than 90% hybrid. Hybridization is also contemplated for polynucleotides containing degenerate codons instead of codons in the polynucleotides.
[52]
Whether any two polynucleotide or polypeptide sequences have homology, similarity or identity can be determined, for example, by Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: 2444, using a known computer algorithm such as the “FASTA” program. or, as performed in the Needleman Program (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later) of the EMBOSS package, The Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) can be used to determine. (GCG program package (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215] : 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego, 1994, and [CARILLO ETA/.] (1988) including SIAM J Applied Math 48: 1073) For example, BLAST of the National Center for Biotechnology Information Database, or ClustalW, can be used to determine homology, similarity or identity.
[53]
Homology, similarity or identity of polynucleotides or polypeptides is described, for example, in Smith and Waterman, Adv. Appl. Math (1981) 2:482, see, for example, Needleman et al. (1970), J Mol Biol. 48: 443 by comparing sequence information using a GAP computer program. In summary, the GAP program is defined as the total number of symbols in the shorter of two sequences divided by the number of similarly aligned symbols (ie, nucleotides or amino acids). Default parameters for the GAP program are: (1) a binary comparison matrix (containing values ​​of 1 for identity and 0 for non-identity) and Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979), Gribskov et al (1986) Nucl. Acids Res. 14: weighted comparison matrix of 6745 (or EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix); (2) a penalty of 3.0 for each gap and an additional 0.10 penalty for each symbol in each gap (or a gap opening penalty of 10, a gap extension penalty of 0.5); and (3) no penalty for end gaps. Thus, as used herein, the term "homology" or "identity" refers to a relevance between sequences.
[54]
[55]
Another aspect of the present application provides a polynucleotide encoding the meso diaminopimelate dehydrogenase variant polypeptide.
[56]
As used herein, the term "polynucleotide" refers to a DNA or RNA strand of a certain length or longer as a polymer of nucleotides in which nucleotide monomers are connected in a long chain by covalent bonds, and more specifically, the mutant protein It refers to a polynucleotide fragment that encodes.
[57]
The polynucleotide encoding the meso diaminopimelate dehydrogenase variant polypeptide of the present application may be included without limitation as long as it is a polynucleotide sequence encoding the meso diaminopimelate dehydrogenase variant polypeptide of the present application. The polynucleotide encoding the meso diaminopimelate dehydrogenase variant polypeptide may be included without limitation as long as it is a sequence encoding a variant protein in which the 169th amino acid is substituted with another amino acid in the amino acid sequence of SEQ ID NO: 1. Specifically, it may be a polynucleotide sequence encoding a variant in which the 169th amino acid in the amino acid sequence of SEQ ID NO: 1 is substituted with leucine. For example, the polynucleotide encoding the meso diaminopimelate dehydrogenase variant polypeptide of the present application may be a polynucleotide sequence encoding the amino acid sequence of SEQ ID NO: 3, but is not limited thereto. More specifically, it may be composed of a polynucleotide sequence consisting of SEQ ID NO: 4, but is not limited thereto. In the polynucleotide, various modifications can be made to the coding region within the range that does not change the amino acid sequence of the protein due to the degeneracy of the codon or in consideration of the codon preferred in the organism in which the protein is to be expressed. . Accordingly, it is obvious that a polynucleotide that can be translated into a polypeptide consisting of the amino acid sequence of SEQ ID NO: 3 or a polypeptide having homology or identity therewith may also be included due to codon degeneracy.
[58]
In addition, the 169th amino acid in the amino acid sequence of SEQ ID NO: 1 is a different amino acid by hydridation under stringent conditions with a probe that can be prepared from a known gene sequence, for example, a sequence complementary to all or part of the nucleotide sequence. Any sequence encoding a substituted meso diaminopimelate dehydrogenase variant polypeptide may be included without limitation.
[59]
The "stringent condition" means a condition that enables specific hybridization between polynucleotides. These conditions are specifically described in the literature (eg, J. Sambrook et al., supra). For example, genes with high homology or identity, 80% or more, 85% or more, specifically 90% or more, more specifically 95% or more, even more specifically 97% or more, In particular, the conditions in which genes having 99% or more homology or identity hybridize with each other and genes with lower homology or identity do not hybridize, or at 60° C., which is a washing condition for normal Southern hybridization , 0.1 X SSC, 0.1% SDS, specifically at a salt concentration and temperature equivalent to 60° C., 0.1 X SSC, 0.1% SDS, more specifically 68° C., 0.1 X SSC, 0.1% SDS, once, specifically Conditions for washing 2 to 3 times can be exemplified.
[60]
Hybridization requires that two nucleic acids have complementary sequences, although mismatch between bases is possible depending on the stringency of hybridization. The term "complementary" is used to describe the relationship between nucleotide bases capable of hybridizing to each other. For example, with respect to DNA, adenosine is complementary to thymine and cytosine is complementary to guanine. Accordingly, the present application may also include isolated nucleic acid fragments that are complementary to substantially similar nucleic acid sequences as well as the entire sequence.
[61]
Specifically, polynucleotides having homology or identity can be detected using hybridization conditions including a hybridization step at a Tm value of 55° C. and using the above-described conditions. In addition, the Tm value may be 60°C, 63°C or 65°C, but is not limited thereto and may be appropriately adjusted by those skilled in the art according to the purpose.
[62]
The appropriate stringency for hybridizing polynucleotides depends on the length of the polynucleotides and the degree of complementarity, and the parameters are well known in the art (see Sambrook et al., supra, 9.50-9.51, 11.7-11.8).
[63]
[64]
As used herein, the term "vector" refers to a DNA preparation containing the base sequence of a polynucleotide encoding the variant protein of interest operably linked to a suitable regulatory sequence so that the variant protein of interest can be expressed in a suitable host. means The regulatory sequences may include a promoter capable of initiating transcription, an optional operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence regulating the termination of transcription and translation. After transformation into an appropriate host cell, the vector can replicate or function independently of the host genome, and can be integrated into the genome itself.
[65]
The vector used in the present application is not particularly limited as long as it can replicate in a host cell, and any vector known in the art may be used. Examples of commonly used vectors include plasmids, cosmids, viruses and bacteriophages in a natural or recombinant state. For example, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A may be used as phage vectors or cosmid vectors, and pBR-based, pUC-based, and pBluescriptII-based plasmid vectors may be used. , pGEM-based, pTZ-based, pCL-based and pET-based and the like can be used. Specifically, pDZ, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC vectors and the like can be used.
[66]
For example, a polynucleotide encoding a target mutant protein in a chromosome may be replaced with a mutated polynucleotide through a vector for intracellular chromosome insertion. Insertion of the polynucleotide into the chromosome may be accomplished by any method known in the art, for example, homologous recombination, but is not limited thereto. It may further include a selection marker (selection marker) for confirming whether the chromosome is inserted. The selection marker is used to select cells transformed with a vector, that is, to determine whether a target nucleic acid molecule is inserted, and a selectable phenotype such as drug resistance, auxotrophic tolerance, resistance to cytotoxic agents, or expression of a surface variant protein. Markers that give ? may be used. In an environment treated with a selective agent, only cells expressing a selectable marker survive or exhibit other expression traits, and thus transformed cells can be selected. As another aspect of the present application, the present application provides a microorganism comprising the mutant protein or a polynucleotide encoding the mutant protein to produce L-threonine. Specifically, the microorganism containing the mutant protein and/or the polynucleotide encoding the mutant protein may be a microorganism prepared by transformation with a vector containing the polynucleotide encoding the mutant protein, but is not limited thereto. .
[67]
As used herein, the term “transformation” refers to introducing a vector including a polynucleotide encoding a target protein into a host cell so that the protein encoded by the polynucleotide can be expressed in the host cell. The transformed polynucleotide may include all of them regardless of whether they are inserted into the chromosome of the host cell or located outside the chromosome, as long as they can be expressed in the host cell. In addition, the polynucleotide includes DNA or RNA encoding a target protein. The polynucleotide may be introduced into a host cell and expressed in any form, as long as it can be expressed. For example, the polynucleotide may be introduced into a host cell in the form of an expression cassette, which is a gene construct including all elements necessary for self-expression. The expression cassette may include a promoter, a transcription termination signal, a ribosome binding site, and a translation termination signal, which are usually operably linked to the polynucleotide. The expression cassette may be in the form of an expression vector capable of self-replication. In addition, the polynucleotide may be introduced into a host cell in its own form and operably linked to a sequence required for expression in the host cell, but is not limited thereto.
[68]
In addition, the term “operably linked” as used herein means that a promoter sequence that initiates and mediates transcription of a polynucleotide encoding the target variant protein of the present application and the gene sequence are functionally linked.
[69]
[70]
Another aspect of the present application provides a microorganism of the genus Corynebacterium comprising the meso diaminopimelate dehydrogenase variant polypeptide or a polynucleotide encoding the same.
[71]
[72]
As used in the present application, the term "microorganism comprising a meso diaminopimelate dehydrogenase mutant polypeptide or a polynucleotide encoding the same" refers to the expression of the meso diaminopimelate dehydrogenase mutant polypeptide of the present application. It may refer to a recombinant microorganism. For example, it is transformed with a vector containing a polynucleotide encoding a meso diaminopimelate dehydrogenase variant polypeptide or a polynucleotide encoding a meso diaminopimelate dehydrogenase variant polypeptide. It refers to a host cell or microorganism capable of expressing the mutant. Specifically, for the purpose of the present application, the microorganism is a microorganism expressing a meso diaminopimelate dehydrogenase variant polypeptide comprising one or more amino acid substitutions in the amino acid sequence of SEQ ID NO: 1, wherein the amino acid substitution is from the N-terminus The 169th amino acid is substituted with leucine, and may be a microorganism expressing a mutant protein having a meso diaminopimelate dehydrogenase mutant polypeptide activity, but is not limited thereto.
[73]
The microorganism comprising the meso diaminopimelate dehydrogenase variant polypeptide or a polynucleotide encoding the same, the meso diaminopimelate dehydrogenase variant polypeptide or a polynucleotide encoding the same, including the L-amino acid , For example, any microorganism capable of producing L-threonine is possible, but is not limited thereto. For example, the microorganism comprising the meso diaminopimelate dehydrogenase variant polypeptide or a polynucleotide encoding the same is meso diaminopimelate dehydrogenase in a natural wild-type microorganism or a microorganism producing L-amino acids. By introducing a polynucleotide encoding a naise variant polypeptide, the meso diaminopimelate dehydrogenase variant polypeptide is expressed, and it may be a recombinant microorganism having an increased ability to produce L-amino acids. The recombinant microorganism having an increased ability to produce L-amino acids may be a microorganism having an increased ability to produce L-amino acids compared to a natural wild-type microorganism or an unmodified microorganism, and the L-amino acid may be L-threonine, but is limited thereto. it is not
[74]
[75]
As used herein, the term "microorganism that produces L-amino acids" includes both wild-type microorganisms and microorganisms in which genetic modification has occurred naturally or artificially, in which an external gene is inserted or the activity of an intrinsic gene is enhanced or inactivated. It may be a microorganism in which a specific mechanism is weakened or strengthened due to a cause, and may be a microorganism in which genetic mutation or activity is enhanced for the production of the desired L-amino acid. The microorganism may be a microorganism genetically modified through any one or more of the mutant polypeptide, a polynucleotide encoding the same, and a vector containing the polynucleotide; a microorganism modified to express the variant polypeptide, or a polynucleotide encoding the same; a recombinant microorganism expressing the variant polypeptide, or a polynucleotide encoding the same; Or it may be a recombinant microorganism having the mutant polypeptide activity, but is not limited thereto.
[76]
The microorganism producing the L-amino acid may include the mutant polypeptide or a polynucleotide encoding the same, or a vector containing the polynucleotide is introduced to increase the production ability of the desired L-amino acid. Specifically, the introduction may be made by transformation, but is not limited thereto.
[77]
In addition, in the present application, the microorganisms producing L-amino acids or microorganisms having L-amino acid producing ability are those in which a part of a gene in the L-amino acid biosynthesis pathway is enhanced or weakened, or a part of a gene in the L-amino acid degradation pathway is enhanced or weakened. It may be a microorganism.
[78]
For the purposes of the present application, the microorganism may include any microorganism capable of producing L-threonine or L-threonine-derived amino acids, including the variant polypeptide.
[79]
The "unmodified microorganism" is a native strain itself, a microorganism that does not contain the meso diaminopimelate dehydrogenase mutant polypeptide, or a polyencoding the meso diaminopimelate dehydrogenase mutant polypeptide. It refers to a microorganism that has not been transformed with a vector containing nucleotides. As long as the "microorganism" is a microorganism capable of producing L-amino acids, any of prokaryotic microorganisms and eukaryotic microorganisms may be included. For example, Escherichia genus, Erwinia genus, Serratia genus, Providencia genus, Corynebacterium genus , and Brevibacterium genus microbial strains belonging to may be included. Specifically, it may be a microorganism of the genus Corynebacterium, and more specifically, it may be Corynebacterium glutamicum , but is not limited thereto.
[80]
[81]
The microorganism of the genus Corynebacterium specifically uses thrC encoding threonine synthetase, phosphoenol pyruvate carboxylase to enhance the biosynthetic pathway of L-threonine. ppc gene encoding, galP gene involved in glucose uptake, lysC gene encoding lysine-sensitive aspartokinase 3, hom gene or oxalogene encoding homoserine dehydrogenase The expression of the pyc gene, which induces an increase in the acetate (Oxaloacetate) pool, can be enhanced or increased in microorganisms.
[82]
In order to release the feedback inhibition for the L-threonine, for example, a lysC gene, a hom gene, or a thrA gene having a dual function of aspartokinase and homoserine dehydrogenase 1 (Bifunctional aspartokinase / homoserine dehydrogenase 1) Genetic mutations can be introduced into the back.
[83]
In order to inactivate a gene that weakens the biosynthetic pathway of L-threonine, for example, oxaloacetate (OAA), which is an L-threonine biosynthesis intermediate, is converted to phosphoenol pyruvate (PEP) Expression of the pckA gene involved in lysC gene, the tyrR gene that suppresses the lysC gene, the galR gene that suppresses the expression of the galP gene involved in glucose uptake, or the mcbR gene that is a DNA-binding transcriptional dual regulator can be attenuated or inactivated within the microorganism.
[84]
In order to increase the activity of the L-threonine operon, aspartokinase (aspartokinase), homoserine dehydrogenase (homoserine dehydrogenase), homoserine kinase (homoserine kinase) and threonine synthase (threonine synthase) By introducing a plasmid containing a threonine operon (Japanese Patent Laid-Open No. 2005-227977) composed of a gene encoding a threonine operon derived from E. coli or the like into a microorganism (TURBA E, et al, Agric. Biol. Chem) 53:2269~2271, 1989), may increase the expression of the threonine operon in microorganisms.
[85]
In addition, resistance to L-threonine analogs such as α-amino-β-hydroxy valeric acid or D,L-threonine hydroxamate can be conferred.
[86]
In addition, dapA (dihydrodipicolinate synthase), lysA (diaminopimelate decarboxylase), which are genes acting on the biosynthetic pathway of L-lysine, which has a precursor in common with L-threonine, , may attenuate the ddh (diaminopimelate dehydrogenase) gene.
[87]
However, the present invention is not limited thereto, and L-threonine production ability can be enhanced by a method for regulating gene expression known in the art.
[88]
In the present application, the term “enhancement/increase” is a concept that includes all those in which activity is increased compared to intrinsic activity.
[89]
This enhancement or increase in gene activity can be achieved by application of various methods well known in the art. Examples of the method include increasing the intracellular copy number of a gene; a method of introducing a mutation into an expression control sequence of a gene; a method of replacing a gene expression control sequence with a sequence with strong activity; a method of additionally introducing a mutation into the gene to enhance the activity of the gene; And it may consist of any one or more methods selected from the group consisting of a method of introducing a foreign gene into a microorganism, and may be achieved by a combination thereof, but is not particularly limited by the above example.
[90]
In the present application, the term "inactivation" is a concept that includes all of the activity is weakened or no activity compared to the intrinsic activity.
[91]
Inactivation or attenuation of such gene activity can be achieved by application of various methods well known in the art. Examples of the method include a method of deleting all or part of a gene on a chromosome, including when the activity of the gene is removed; a method of replacing a gene encoding the protein on a chromosome with a gene mutated to reduce the activity of the protein; a method of introducing a mutation into an expression control sequence of a gene on a chromosome encoding the protein; a method of replacing the expression control sequence of the gene encoding the protein with a sequence with weak or no activity (eg, a method of replacing the promoter of the gene with a promoter weaker than the endogenous promoter); a method of deleting all or part of a gene on a chromosome encoding the protein; a method of introducing an antisense oligonucleotide (eg, antisense RNA) that complementarily binds to the transcriptome of a gene on the chromosome and inhibits translation from the mRNA into a protein; A method for making the attachment of ribosomes impossible by artificially adding a sequence complementary to the SD sequence to the front end of the SD sequence of the gene encoding the protein to form a secondary structure and ORF (open reading frame) of the sequence There is a reverse transcription engineering (RTE) method of adding a promoter so as to be reverse transcribed at the 3' end, and the like, which can also be achieved by a combination thereof, but is not particularly limited by the above example.
[92]
For example, increase the intracellular copy number of a gene to enhance the activity of lysC, hom, pyc; a method of introducing a mutation into an expression control sequence of a gene; a method of replacing a gene expression control sequence with a sequence with strong activity; a method of additionally introducing a mutation into the gene to enhance the activity of the gene; and a method of introducing a foreign gene into a microorganism, but is not limited thereto, and a known method for enhancing or increasing activity may be used without limitation.
[93]
For example, a method of deleting all or a part of a gene on a chromosome, including a case in which the activity of the gene is removed to weaken the activity of dapA, ddh, and lysA; a method of replacing a gene encoding the protein on a chromosome with a gene mutated to reduce the activity of the protein; a method of introducing a mutation into an expression control sequence of a gene on a chromosome encoding the protein; a method of replacing the expression control sequence of the gene encoding the protein with a sequence with weak or no activity (eg, a method of replacing the promoter of the gene with a promoter weaker than the endogenous promoter); It may consist of a method of deleting all or part of a gene on a chromosome encoding the protein, but is not limited thereto, and a known method for weakening the activity may be used without limitation.
[94]
[95]
In addition, in the present application, the microorganism containing the meso diaminopimelate dehydrogenase variant polypeptide may additionally contain any one or more of the following variant polypeptides, or any one or more of polynucleotides encoding the following variant polypeptides. may include
[96]
The variant polypeptide further included is a variant polypeptide of dihydrodipicolinate reductase (dapB) in which the 13th amino acid in the amino acid sequence of SEQ ID NO: 81 is substituted from arginine to asparagine, the amino acid of SEQ ID NO: 82 a diaminopimelate decarboxylase (lysA) variant polypeptide in which the amino acid at position 408 in the sequence is substituted from methionine to alanine; And it may be any one or more selected from the dihydrodipicolinate synthase (dapA) variant polypeptide in which the 119th amino acid in the amino acid sequence of SEQ ID NO: 83 is substituted with phenylalanine from tyrosine.
[97]
The amino acid sequence of the dihydropicolinate reductase variant polypeptide in which the 13th amino acid is substituted from arginine to asparagine in the amino acid sequence of SEQ ID NO: 81 may be SEQ ID NO: 66, but is not limited thereto. In the present application, by introducing the variant polypeptide or a polynucleotide encoding the same, the production of lysine can be reduced and the production of threonine can be increased.
[98]
The amino acid sequence of the diaminopimelate dicarboxylase variant polypeptide in which the 408th amino acid is substituted from methionine to alanine in the amino acid sequence of SEQ ID NO: 82 may be SEQ ID NO: 71, but is not limited thereto. The diaminopimelate dicarboxylase is the last enzyme acting on lysine biosynthesis, and as the 408th amino acid is substituted from methionine to alanine, the production ability of lysine may be reduced and the production of threonine may be increased.
[99]
The amino acid sequence of the dihydrodipicolinate synthase variant polypeptide in which the 119th amino acid in the amino acid sequence of SEQ ID NO: 83 is substituted from tyrosine to phenylalanine may be SEQ ID NO: 76, but is not limited thereto. The dihydrodipicolinate synthase is an enzyme for biosynthesis of lysine from aspartyl semialdehyde, a common precursor of lysine and threonine, and as the 119th amino acid sequence is substituted from tyrosine to phenylalanine, The production capacity may be reduced, and the production of threonine may be increased.
[100]
[101]
Another aspect of the present application is threonine or threonine comprising the step of culturing a microorganism of the genus Corynebacterium comprising a mutant polypeptide having the meso diaminopimelate dehydrogenase activity in a medium A method for producing a derived L-amino acid is provided.
[102]
[103]
The threonine-derived L-amino acid may include not only threonine-derived L-amino acid, but also derivatives thereof. For example L-threonine, L-isoleucine, O-acetyl-L-homoserine, O-succinyl-L-homoserine, O-phospho-L-homoserine, L-methionine and/or L- It may be glycine, but is not limited thereto. More specifically, it may be L-threonine, L-isoleucine, O-acetyl-L-homoserine, O-succinyl-L-homoserine and/or L-methionine, but is not limited thereto.
[104]
[105]
In the method, the step of culturing the microorganism is not particularly limited, but may be performed by a known batch culture method, a continuous culture method, a fed-batch culture method, and the like. At this time, the culture conditions are not particularly limited thereto, but use a basic compound (eg, sodium hydroxide, potassium hydroxide or ammonia) or an acidic compound (eg, phosphoric acid or sulfuric acid) to an appropriate pH (eg, pH 5 to 9, specifically can adjust pH 6 to 8, most specifically pH 6.8), and introduce oxygen or oxygen-containing gas mixture into the culture to maintain aerobic conditions, but is not limited thereto. The culture temperature may be maintained at 20 to 45° C., specifically 25 to 40° C., and may be cultured for about 10 to 160 hours, but is not limited thereto. The L-amino acids produced by the culture may be secreted into the medium or remain in the cells.
[106]
In addition, the culture medium used is a carbon source that includes sugars and carbohydrates (eg, glucose, sucrose, lactose, fructose, maltose, molasses, starch and cellulose), oils and fats (eg, soybean oil, sunflower seed). Oil, peanut oil and coconut oil), fatty acids (eg palmitic acid, stearic acid and linoleic acid), alcohols (eg glycerol and ethanol) and organic acids (eg acetic acid) may be used individually or in combination. , but not limited thereto. Nitrogen sources include nitrogen-containing organic compounds (such as peptone, yeast extract, broth, malt extract, corn steep liquor, soy meal and urea), or inorganic compounds (such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate) may be used individually or in combination, but is not limited thereto. As the phosphorus source, potassium dihydrogen phosphate, dipotassium hydrogen phosphate, sodium-containing salt corresponding thereto, etc. may be used individually or in combination, but is not limited thereto. In addition, the medium may contain essential growth-promoting substances such as other metal salts (eg, magnesium sulfate or iron sulfate), amino acids and vitamins.
[107]
[108]
The step of culturing the microorganism of the present application may further include recovering L-threonine or L-amino acid derived from L-threonine from the cultured medium and the microorganism.
[109]
The method of recovering L-threonine or L-threonine-derived L-amino acid produced in the culturing step is performed by using a suitable method known in the art according to the culture method to obtain the desired L-threonine or L-amino acids derived from L-threonine can be collected. For example, centrifugation, filtration, anion exchange chromatography, crystallization and HPLC may be used, and the desired L-threonine or L-threonine from a medium or microorganism using a suitable method known in the art. The derived L-amino acid can be recovered.
[110]
In addition, the recovery step may include a purification process, and may be performed using a suitable method known in the art. Therefore, the recovered L-threonine or L-threonine-derived L-amino acid may be in a purified form or a microbial fermentation broth containing L-amino acid (Introduction to Biotechnology and Genetic Engineering, AJ Nair., 2008). ).
[111]
[112]
Another aspect of the present application is a variant polypeptide having the meso diaminopimelate dehydrogenase activity of the present application; a polynucleotide encoding the variant polypeptide; and a vector comprising the polynucleotide; Or, it provides a composition for producing L-threonine, including a microorganism or a culture solution thereof, including any one or more thereof.
[113]
[114]
The meso diaminopimelate dehydrogenase, its mutant polypeptide, polynucleotide, vector and microorganism are as described above.
[115]
The microorganism may be of the genus Corynebacterium, specifically Corynebacterium glutamicum, but is not limited thereto. This is the same as described above.
[116]
[117]
The composition for producing L-threonine may refer to a composition capable of producing L-threonine by the mutant polypeptide having meso diaminopimelate dehydrogenase activity of the present application. The composition may include, without limitation, a composition capable of activating the mutant polypeptide having the meso diaminopimelate dehydrogenase activity or the mutant polypeptide having the meso diaminopimelate dehydrogenase activity. The mutant polypeptide having the meso diaminopimelate dehydrogenase activity may be in a form included in a vector so that the operably linked gene can be expressed in the introduced host cell.
[118]
The composition may further comprise a cryoprotectant or an excipient. The cryoprotectant or excipient may be a non-naturally occurring material or a naturally occurring material, but is not limited thereto. In another embodiment, the cryoprotectant or excipient may be a material that the microorganism does not naturally contact, or a material that is not naturally included with the microorganism at the same time, but is not limited thereto.
[119]
[120]
Another aspect of the present application is the meso diaminopimelate dehydrogenase variant polypeptide of the present application; a polynucleotide encoding the variant polypeptide; a vector comprising the polynucleotide; Or it provides a use for the production of L- threonine or L- threonine-derived L-amino acid of a microorganism comprising at least one of them.
[121]
Modes for carrying out the invention
[122]
Hereinafter, the present application will be described in more detail through examples. However, these examples are for illustrative purposes only, and the scope of the present application is not limited to these examples.
[123]
[124]
Example 1: Construction of vector library for mutation in ddh gene ORF
[125]
[126]
Corynebacterium glutamicum (Corynebacterium glutamicum) library was prepared by the following method for the purpose of discovering a mutant with attenuated expression level or activity of the ddh gene of the gene.
[127]
First , the GenemorphII Random Mutagenesis Kit (Stratagene) was used for the purpose of introducing 0-4.5 mutations per kb of a DNA fragment (963 bp) containing the ddh (963 bp) gene. Error-prone PCR was performed using the chromosome of Corynebacterium glutamicum ATCC13032 (WT) as a template and primers SEQ ID NOs: 5 and 6. Specifically, a reaction solution containing the chromosomes of the WT strain (500 ng), primers 5 and 6 (125 ng each), Mutazyme II reaction buffer (1X), dNTP mix (40 mM), Mutazyme II DNA polymerase (2.5U) After denaturing at 94°C for 2 minutes, denaturation at 94°C for 1 minute, annealing at 56°C for 1 minute, and polymerization at 72°C for 3 minutes were repeated 25 times, followed by polymerization at 72°C for 10 minutes.
[128]
The amplified gene fragment was ligated to the pCRII vector using the TOPO TA Cloning Kit (Invitrogen), transformed into E. coli DH5α, and plated on LB solid medium containing kanamycin (25 mg/l). After selecting 20 transformed colonies, a plasmid was obtained, and as a result of analyzing the nucleotide sequence, it was confirmed that mutations were introduced at different positions with a frequency of 0.5 mutations/kb. Finally, about 10,000 transformed E. coli colonies were taken and plasmids were extracted, and this was named pTOPO- ddh (mt) library.
[129]
[130]
Example 2: ddh -deficient strain production and random mutant library screening
[131]
[132]
In order to confirm the influence of L-lysine production according to the ddh deletion, Corynebacterium glutamicum KCCM11016P (Korea Patent No. 10-0159812) that produces L-lysine was used. In order to construct a strain in which the ddh gene is deleted in the Corynebacterium glutamicum KCCM11016P (Korean Patent No. 10-0159812) strain, a vector pDZ-Δ ddh in which the ddh gene is deleted as follows was prepared.
[133]
Specifically, DNA fragments located at the 5' and 3' ends of the ddh gene (600 bp each) were prepared in a form linked to the pDZ vector (Korean Patent No. 2009-0094433). Based on the reported base sequence (SEQ ID NO: 2) of the ddh gene, primers SEQ ID NOs: 7 and 8 with restriction enzyme XbaI recognition sites inserted into the 5' fragment and 3' fragment, and primer SEQ ID NO: 9 at positions 663 bp away from them, respectively and 10 were synthesized (Table 1). Using the chromosome of Corynebacterium glutamicum ATCC13032 as a template, the 5' end gene fragment was prepared by PCR using primers SEQ ID NOs: 7 and 9. In the same manner, a gene fragment located at the 3' end of the ddh gene was prepared through PCR using SEQ ID NOs: 8 and 10. PCR conditions include denaturation at 94°C for 2 minutes, denaturation at 94°C for 1 minute, annealing at 56°C for 1 minute, and polymerization at 72°C for 40 seconds were repeated 30 times, followed by polymerization at 72°C for 10 minutes.
[134]
On the other hand, after treatment with restriction enzyme XbaI , the pDZ vector heat-treated at 65° C. for 20 minutes and the insert DNA fragment amplified through the PCR were ligated using Infusion Cloning Kit, transformed into E. coli DH5α, and kanamycin (25 mg/l ) was plated on LB solid medium containing After selecting colonies transformed with the vector into which the desired gene was inserted through PCR using primers SEQ ID NOs: 7 and 8, a plasmid was obtained using a conventionally known plasmid extraction method, and the plasmid was named pDZ-Δ ddh .
[135]
[136]
[Table 1]
SEQ ID NO: sequence (5' -> 3')
SEQ ID NO: 7 CGGGGATCCTCTAGATGACCAACATCCGCG
SEQ ID NO: 8 CAGGTCGACTCTAGATTAGACGTCGCGTGCG
SEQ ID NO: 9 CGGTGAAATCGGCGACATCAAAGACTG
SEQ ID NO: 10 GATGTCGCCGATTTCACCGCTTCCTC
[137]
The constructed vector pDZ-Δ ddh was transformed into a Corynebacterium glutamicum KCCM11016P strain by an electric pulse method (Van der Rest et al ., Appl. Microbiol. Biotecnol. 52:541-545, 1999) to transform the homologous chromosome A strain in which the ddh gene was deleted was prepared by recombination . As such , the strain in which the ddh gene is deleted was named Corynebacterium glutamicum WT::Δ ddh .
[138]
In addition, the pTOPO- ddh (mt) library prepared in Example 1 was transformed by the electric pulse method for the KCCM11016P()::Δ ddh strain and spread on a complex plate medium containing kanamycin (25 mg/l). Thus, about 20,000 colonies were secured. Each of 300 μl of the following selection medium was inoculated and incubated in a 96-deep well plate at 32° C. 1000 rpm for about 24 hours.
[139]
[140]

[141]
Glucose 10 g, 5.5 g Ammonium sulfate, MgSO 4 7H 2 O 1.2 g, KH 2 PO 4 0.8 g, K 2 HPO 4 16.4 g, biotin 100 μg, thiamine HCl 1 mg, calcium-pantothenic acid 2 mg , nicotinamide 2 mg (based on 1 liter of distilled water)
[142]
[143]
To analyze the production of L-lysine produced in the culture medium, the ninhydrin method was used (Moore, S., Stein, WH, Photometric ninhydrin method for use in the chromatography of amino acids. J. Biol. Chem. 1948, 176, 367-388).
[144]
After the culture was completed, 10 μl of the culture supernatant and 190 μl of the ninhadrin reaction solution were reacted at 65° C. for 30 minutes, and absorbance was measured with a spectrophotometer at a wavelength of 570 nm. WT and WT::Δ ddh strains were used as controls. While the absorbance decreased compared to the wild-type WT strain, 60 strains showing higher absorbance than the WT::Δ ddh strain were selected.
[145]
After culturing the selected 60 strains again in the same way as above, the ninhydrin reaction was repeated, and as a result, the L-lysine production capacity was improved than that of the KCCM11016P::Δ ddh strain, but L-lysine rather than the KCCM11016P strain. The top five mutants with reduced production capacity were selected. The five strains selected above were named KCCM11016P:: ddh (mt)-1 to 5 (Table 2).
[146]
[147]
[Table 2] L-lysine production concentration of 5 selected random mutants
strain Absorbance (572 nm)
batch 1 batch 2 batch 3 Average
control KCCM11016P 0.228 0.205 0.216 0.215
1 KCCM11016P::ddh(mt)-1 0.214 0.193 0.205 0.204
2 KCCM11016P::ddh(mt)-2 0.185 0.181 0.179 0.182
3 KCCM11016P::ddh(mt)-3 0.164 0.163 0.145 0.157
4 KCCM11016P::ddh(mt)-4 0.135 0.141 0.128 0.135
5 KCCM11016P::ddh(mt)-5 0.198 0.201 0.189 0.196
control KCCM11016P::△ddh 0.106 0.112 0.098 0.105
[148]
[149]
Example 3: Confirmation of nucleotide sequences of 5 ddh mutants
[150]
[151]
Five types of selection strain KCCM11016P:: To confirm the ddh gene sequence of ddh (mt)-1 to 5 , a DNA fragment containing the ddh gene in the chromosome was prepared using the primers specified in Example 1 (SEQ ID NOs: 5 and 6). PCR amplification. PCR conditions were denatured at 94°C for 2 minutes, denatured at 94°C for 1 minute, annealed at 56°C for 1 minute, and polymerization was repeated 30 times at 72°C for 40 seconds, followed by polymerization at 72°C for 10 minutes.
[152]
[153]
[Table 3]
SEQ ID NO: sequence (5' -> 3')
SEQ ID NO: 5 ATGACCAACATCCGCGTAGC
SEQ ID NO: 6 TTAGACGTCGCGTGCGATCAG
[154]
As a result of analyzing the nucleotide sequence of the amplified gene, the 5 strains were i) the 13th amino acid from the N-terminus, which was changed from AAC to GAC by introducing one mutation in the nucleotide sequence located 37bp lower from the ddh gene ORF start codon. Phosphorus asparagine was substituted with aspartic acid, ii) 3 mutations were introduced in the nucleotide sequence located at the lower 106-108bp, and the existing CGC was changed to ATG. Arginine, the 36th amino acid from the N-terminus, was substituted with methionine , iii) two mutations were introduced in the nucleotide sequence located at the lower 448-449bp and changed from CAG to ATG, glutamine, the 150th amino acid at the N-terminus, was substituted with methionine, iv) at the lower 505-506bp Two mutations were introduced in the nucleotide sequence located at the base sequence, which was changed from ACC to CTC, and threonine, the 169th amino acid from the N-terminus, was substituted with leucine, v) Two mutations in the nucleotide sequence located at the lower 584-585bp It was confirmed that it was a meso diaminopimelate dehydrogenase (DDH) variant in which arginine, the 195th amino acid from the N-terminus, which was introduced and changed from CGC to CAA, was substituted with glutamine.
[155]
[156]
Example 4: Production of ATCC13032 strain introduced with 5 ddh mutations and evaluation of threonine and lysine production capacity
[157]
[158]
With respect to the five mutations identified in Example 3, strains introduced with mutations derived from wild-type strains were prepared in order to finally select strains in which L-lysine-producing ability was reproducibly reduced and L-threonine increased.
[159]
In order to construct a strain into which the mutant ddh gene was introduced in the wild-type Corynebacterium glutamicum ATCC13032, five vectors pDZ:: ddh m1-5 capable of introducing the mutant ddh gene were prepared as follows.
[160]
Specifically, DNA fragments located at the 5' and 3' ends of the ddh gene (963 bp each) were prepared in a form linked to the pDZ vector (Korean Patent No. 2009-0094433). Based on the reported base sequence (SEQ ID NO: 2) of the ddh gene, primer SEQ ID NO: 11 in which a restriction enzyme XbaI recognition site was inserted into the 5' fragment and 3' fragment, and primer SEQ ID NO: 12 at a position 931 bp away from these were synthesized did A mutant DNA fragment was prepared by PCR using primers SEQ ID NOs: 11 and 12 using the chromosomes of KCCM11016P:: ddh (mt)-1 to 5 identified in Example 3 as a template. PCR conditions include denaturation at 94°C for 2 minutes, denaturation at 94°C for 1 minute, annealing at 56°C for 1 minute, and polymerization at 72°C for 40 seconds were repeated 30 times, followed by polymerization at 72°C for 10 minutes.
[161]
On the other hand, after treatment with restriction enzyme XbaI , the pDZ vector heat-treated at 65°C for 20 minutes and the mutant DNA fragment amplified through the PCR were ligated using the Infusion Cloning Kit, transformed into E. coli DH5α, and kanamycin (25 mg/ l) was plated on LB solid medium containing this. After selecting colonies transformed with the vector into which the desired gene was inserted through PCR using primers SEQ ID NOs: 11 and 12, a plasmid was obtained using a conventionally known plasmid extraction method, and this plasmid was pDZ:: ddh (mt)1 to 5 were named.
[162]
The constructed vector pDZ:: ddh (mt) 1 to 5 was transformed into Corynebacterium glutamicum ATCC13032 by electroporation, and a strain in which each variant base was substituted on the chromosome through a secondary crossover process got it Whether or not the substitution is appropriate was determined by using the following primer combinations and using the MASA (Mutant Allele Specific Amplification) PCR technique (Takeda et al ., Hum. Mutation, 2, 112-117 (1993)) to combine primers matching the mutant sequence. In (SEQ ID NO: 13 and SEQ ID NO: 14), it was determined primarily by selecting the amplified strain, and the ddh sequencing of the selected strain was secondary confirmed by sequencing the variant using the primer combination of SEQ ID NO: 13 and SEQ ID NO: 15 did The strain into which the variant ddh gene was introduced was named Corynebacterium glutamicum ATCC13032:: ddh (mt)1 to ATCC13032:: ddh (mt)5.
[163]
[164]
[Table 4]
SEQ ID NO: sequence (5' -> 3')
SEQ ID NO: 11 CGGGGATCCTCTAGATGACCAACATCCGCG
SEQ ID NO: 12 CAGGTCGACTCTAGATTAGACGTCGCGTGCG
SEQ ID NO: 13 CACAATTTTGGAGGATTAC
SEQ ID NO: 14 TGGGTGACCACGATCAGAT
SEQ ID NO: 15 GGAAACCACACTGTTTCC
[165]
For the 5 strains introduced with the 5 mutations, in order to finally select the strains in which the L-lysine production ability was reproducibly reduced and the L-threonine increased, flask culture was performed using the following medium. After the culture was completed, the concentrations of L-lysine and threonine in the culture were analyzed using HPLC, and the L-lysine and threonine production concentrations of each mutant were shown in Tables 5 and 6 below.
[166]
[167]

[168]
Glucose 20 g, peptone 10 g, yeast extract 5 g, urea 1.5 g, KH 2 PO 4 4 g, K 2 HPO 4 8 g, MgSO4 7H 2 O 0.5 g, biotin 100 μg, thiamine HCl 1 mg, calcium- Pantothenic acid 2 mg, nicotinamide 2 mg (based on 1 liter of distilled water)
[169]
[170]

[171]
Glucose 100 g, (NH 4 ) 2 SO 4 40 g, Soy Protein 2.5 g, Corn Steep Solids 5 g, Urea 3 g, KH 2 PO 4 1 g, MgSO 4 7H 2 O 0.5 g, Biotin 100 ㎍, thiamine hydrochloride 1 mg, calcium-pantothenic acid 2 mg, nicotinamide 3 mg, CaCO 3 30 g (based on 1 liter of distilled water)
[172]
[173]
[Table 5] L-lysine production concentration of 5 selected random mutants
strain L-Lysine (g/L) Sugar consumption rate (g/hr)
batch 1 batch 2 batch 3 Average
control ATCC13032 1.25 1.20 1.19 1.21 4.33
1 ATCC13032::ddh (mt)1 1.20 1.15 1.19 1.18 4.30
2 ATCC13032::ddh (mt)2 1.05 1.10 1.02 1.06 4.21
3 ATCC13032::ddh (mt)3 0.85 0.88 0.90 0.88 3.79
4 ATCC13032::ddh (mt)4 0.75 0.79 0.76 0.77 3.71
5 ATCC13032::ddh (mt)5 1.11 1.08 1.13 1.11 4.12
control ATCC13032::△ ddh 0.70 0.68 0.71 0.70 3.56
[174]
[175]
[Table 6] L-threonine production concentration of 5 selected random mutants
strain L-threonine (g/L)
batch 1 batch 2 batch 3 Average
control ATCC13032 0.35 0.37 0.36 0.36
1 ATCC13032::ddh (mt)1 0.38 0.37 0.35 0.37
2 ATCC13032::ddh (mt)2 0.39 0.39 0.37 0.38
3 ATCC13032::ddh (mt)3 0.40 0.39 0.41 0.40
4 ATCC13032::ddh (mt)4 0.42 0.43 0.42 0.42
5 ATCC13032::ddh (mt)5 0.37 0.38 0.37 0.37
control ATCC13032::△ ddh 0.45 0.41 0.42 0.43
[176]
Among the five selected mutants, ATCC13032::ddh (mt)4 was selected as a strain in which L-lysine-producing ability was significantly reduced and L-threonine was improved .
[177]
[178]
Example 5: Production of ATCC13869 strain introduced with 5 ddh mutations and evaluation of threonine and lysine production ability
[179]
[180]
For the five mutations selected in Example 3, in order to finally select strains in which L-lysine-producing ability is reproducibly reduced and L-threonine increased, strains introduced with mutations derived from wild-type strains were prepared.
[181]
In order to construct a strain into which the mutant ddh gene was introduced in the wild-type Corynebacterium glutamicum ATCC13869, the vectors pDZ:: ddh (mt)1 to 5 prepared in Example 4 were electroporated with Corynebacterium glutamicum ATCC13869. Lium glutamicum ATCC13869 was transformed, and a strain in which each variant base was substituted on the chromosome was obtained through a secondary crossover process. Whether or not the substitution is appropriate was determined by using the following primer combinations and using the MASA (Mutant Allele Specific Amplification) PCR technique (Takeda et al ., Hum. Mutation, 2, 112-117 (1993)) to combine primers matching the mutant sequence. In (SEQ ID NO: 13 and SEQ ID NO: 14), it was determined primarily by selecting the amplified strain, and the ddh sequencing of the selected strain was secondary confirmed by sequencing the variant using the primer combination of SEQ ID NO: 13 and SEQ ID NO: 15 did. The strain into which the mutant ddh gene was introduced was named Corynebacterium glutamicum ATCC13869:: ddh (mt)1-5 .
[182]
For the 5 strains introduced with the 5 mutations, in order to finally select the strains in which the L-lysine production ability was reproducibly reduced and the L-threonine increased, flask culture was performed using the following medium. After the culture was completed, the concentrations of L-lysine and threonine in the culture were analyzed using HPLC, and the L-lysine and threonine production concentrations of each mutant were shown in Tables 7 and 8 below.
[183]
[184]

[185]
Glucose 20 g, peptone 10 g, yeast extract 5 g, urea 1.5 g, KH 2 PO 4 4 g, K 2 HPO 4 8 g, MgSO4 7H 2 O 0.5 g, biotin 100 μg, thiamine HCl 1 mg, calcium- Pantothenic acid 2 mg, nicotinamide 2 mg (based on 1 liter of distilled water)
[186]
[187]

[188]
Glucose 100 g, (NH 4 ) 2 SO 4 40 g, Soy Protein 2.5 g, Corn Steep Solids 5 g, Urea 3 g, KH 2 PO 4 1 g, MgSO 4 7H 2 O 0.5 g, Biotin 100 ㎍, thiamine hydrochloride 1 mg, calcium-pantothenic acid 2 mg, nicotinamide 3 mg, CaCO 3 30 g (based on 1 liter of distilled water)
[189]
[190]
[Table 7] L-lysine production concentration of 5 selected random mutants
strain L-Lysine (g/L) Sugar consumption rate (g/hr)
batch 1 batch 2 batch 3 Average
control ATCC13869 1.21 1.22 1.22 1.22 4.03
1 ATCC13869::ddh (mt)1 1.19 1.19 1.20 1.19 3.98
2 ATCC13869::ddh (mt)2 1.08 1.07 1.10 1.08 3.89
3 ATCC13869::ddh (mt)3 0.88 0.87 0.85 0.87 3.75
4 ATCC13869::ddh (mt)4 0.73 0.77 0.76 0.75 3.68
5 ATCC13869::ddh (mt)5 1.09 1.11 1.12 1.11 3.89
control ATCC13032::△ ddh 0.71 0.69 0.71 0.70 3.47
[191]
[Table 8] L-threonine production concentration of 5 selected random mutants
strain L-threonine (g/L)
batch 1 batch 2 batch 3 Average
control ATCC13869 0.25 0.27 0.28 0.27
1 ATCC13869::ddh (mt)1 0.27 0.29 0.27 0.28
2 ATCC13869::ddh (mt)2 0.30 0.31 0.31 0.31
3 ATCC13869::ddh (mt)3 0.35 0.33 0.36 0.35
4 ATCC13869::ddh (mt)4 0.38 0.39 0.38 0.38
5 ATCC13869::ddh (mt)5 0.31 0.29 0.32 0.31
control ATCC13869::△ ddh 0.40 0.41 0.39 0.40
[192]
It was confirmed that the ATCC13869::Δ ddh strain lacking ddh compared to the wild-type ATCC13869 had a significantly lowered glucose consumption rate and inhibited the growth of the strain, whereas the five selected strains maintained the same level of glucose consumption rate compared to the wild-type strain , It was confirmed that the production of L-lysine decreased and the production of L-threonine increased.
[193]
Among the five selected mutants, ATCC13032::ddh (mt) 4 identical to Example 4 was finally selected as a strain with significantly reduced L-lysine-producing ability and improved L-threonine .
[194]
[195]
Example 6: Production and evaluation of a mutant ddh introduced strain in a microbial strain of the genus Corynebacterium having L-threonine-producing ability
[196]
[197]
A strain producing L-threonine was developed from the wild species Corynebacterium glutamicum ATCC13032. Specifically, in order to solve the feedback inhibition of aspartate kinase (lysC), which acts as the first important enzyme in the threonine biosynthesis pathway, the amino acid 377 of lysC, Leucine, was substituted with Lysine ( SEQ ID NO: 16).
[198]
More specifically, PCR was performed using the primers of SEQ ID NO: 17 and SEQ ID NO: 18 or SEQ ID NO: 19 and SEQ ID NO: 20 using the chromosome of ATCC13032 as a template to prepare strains in which the lysC (L377K) mutation was introduced. As a polymerase for the PCR reaction, PfuUltra TM high-confidence DNA polymerase (Stratagene) was used, and PCR conditions were denaturation 95°C for 30 seconds; annealing 55° C. 30 seconds; and the polymerization reaction at 72° C. for 1 minute was repeated 28 times.
[199]
As a result, a 515 bp DNA fragment at the 5' upper end and a 538 bp DNA fragment at the 3' lower end were obtained, respectively, centering on the mutation of the lysC gene. Using the two amplified DNA fragments as templates, PCR was performed with primers of SEQ ID NO: 17 and SEQ ID NO: 20. PCR conditions were repeated 28 times of denaturation at 95°C for 5 minutes, then denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 2 minutes, followed by polymerization at 72°C for 5 minutes.
[200]
[201]
[Table 9]
SEQ ID NO: sequence (5' -> 3')
SEQ ID NO: 17 TCGAGCTCGGTACCCGCTGCGCAGTGTTGAATAC
SEQ ID NO: 18 TGGAAATCTTTTCGATGTTCACGTTGACAT
SEQ ID NO: 19 ATGTCAACGTGAACATCGAAAAGATTTCCA
SEQ ID NO: 20 CTCTAGAGGATCCCCGTTCACCTCAGAGACGATT
[202]
As a result, a 1023 bp DNA fragment containing a mutation in the lysC gene encoding an aspartokinase variant in which the leucine at position 377 was substituted with a lysine was amplified. The amplification product was purified using QIAGEN's PCR purification kit and used as an insert DNA fragment for vector construction. On the other hand, after treatment with restriction enzyme smaI , the molar concentration (M) ratio of the pDZ vector and the insert DNA fragment amplified through PCR, which was heat-treated at 65° C. for 20 minutes, was 1:2, so that the Infusion Cloning Kit of TaKaRa was used to construct a vector pDZ-L377K for introducing L377K mutations onto a chromosome by cloning according to the provided manual.
[203]
The prepared vector was transformed into ATCC13032 by electroporation, and through a secondary crossover process, a strain in which each nucleotide mutation was substituted with a mutant nucleotide on the chromosome was obtained, which was named CJP1. The CJP1 was named CA01-2307, and was deposited with the Korea Center for Microorganisms Conservation (KCCM), an international depository under the Budapest Treaty, as of March 29, 2017, and was given an accession number KCCM12000P.
[204]
To solve the feedback inhibition of homoserine dehydrogenase (hom), which acts as the second important enzyme for L-threonine production, arginine, the 407 amino acid of hom, was substituted with histidine (sequence number 21).
[205]
More specifically, PCR was performed using the primers of SEQ ID NO: 22 and SEQ ID NO: 23 or SEQ ID NO: 24 and SEQ ID NO: 25 using the chromosome of ATCC13032 as a template to produce strains into which the hom (R407H) mutation was introduced. As a polymerase for the PCR reaction, PfuUltra TM high-confidence DNA polymerase (Stratagene) was used, and PCR conditions were denaturation 95°C for 30 seconds; annealing 55° C. 30 seconds; and the polymerization reaction at 72° C. for 1 minute was repeated 28 times.
[206]
[207]
[Table 10]
SEQ ID NO: sequence (5' -> 3')
SEQ ID NO: 22 TCGAGCTCGGTACCCCGGATGATGTGTACTGCG
SEQ ID NO: 23 GACCACGATCAGATGTGCATCATCATCGCGC
SEQ ID NO: 24 GATGATGATGCACATCTGATCGTGGTCACCC
SEQ ID NO: 25 CTCTAGAGGATCCCCGAGTCAGCGGGAAATCCG
[208]
As a result, a 533 bp DNA fragment at the 5' upper end and a 512 bp DNA fragment at the 3' lower end were obtained centering on the hom gene mutation. Using the two amplified DNA fragments as templates, PCR was performed with primers of SEQ ID NO: 22 and SEQ ID NO: 25. PCR conditions were repeated 28 times of denaturation at 95°C for 5 minutes, then denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 2 minutes, followed by polymerization at 72°C for 5 minutes.
[209]
As a result, a 1018 bp DNA fragment containing a mutation in the hom gene encoding an aspartokinase mutant in which arginine at position 407 was substituted with histidine was amplified. The amplification product was purified using QIAGEN's PCR purification kit and used as an insert DNA fragment for vector construction. On the other hand, after treatment with restriction enzyme smaI , the molar concentration (M) ratio of the pDZ vector and the inserted DNA fragment amplified through the PCR, which was heat-treated at 65° C. for 20 minutes, was 1:2, so that the Infusion Cloning Kit of TaKaRa was used to construct a vector pDZ-R407H for introducing the R407H mutation onto a chromosome by cloning according to the provided manual.
[210]
The prepared vector was transformed into CJP1 by electroporation, and through a secondary crossover process, a strain in which each nucleotide mutation was substituted with a mutant nucleotide on the chromosome was obtained, which was named CA09-0900 (Accession No. KCCM12418P). .
[211]
In order to clearly confirm the change in the production of L-threonine and L-lysine of the strain, L-threonine in Examples 5 and 6 for the gene encoding meso diaminopimelate dehydrogenase (DDH) The T169L mutation with the highest production and the greatest reduction in L-lysine was introduced. Specifically, in order to introduce the T169L mutation into the CA09-0900 strain, the pDZ:: ddh (mt)4 vector prepared in Example 5 was transformed into CA09-0900 by electroporation, and 2 in the same manner as in Example 4 A strain in which base mutations are substituted with mutant nucleotides on the chromosome was obtained through a secondary crossover process. The strain substituted with the variant base (T169L) was named CA09-0904.
[212]
The strain CA09-0904 was internationally deposited with the Korea Center for Microorganisms Conservation (KCCM), an international depository under the Budapest Treaty, as of April 25, 2019, and was given a deposit number as KCCM12503P.
[213]
[214]
[Table 11] Confirmation of L-threonine and L-lysine production ability of the production strain
strain Amino acid (g/l)
Thr Lys
CA09-0900 1.50 2.67
CA09-0904 2.35 1.58
[215]
As a result, in the strain introduced with the mutation, the production of L-lysine decreased by 1.09 g/L and the production of L-threonine increased by 0.85 g/L compared to the control strain CA09-0900 (Table 11). Therefore, the activity of Ddh was greatly reduced, and it was confirmed that the weakening of the L-lysine production pathway was positive for L-threonine production.
[216]
[217]
Example 7: Preparation of various strains in which asparagine, the 169th amino acid of the ddh gene, was substituted with another amino acid
[218]
[219]
Through CA09-0904 prepared in Example 6, it was confirmed that the strain with reduced L-lysine production had a positive effect on L-threonine production. In the amino acid sequence 1, at the position of the 169th amino acid, a substitution with other proteogenic amino acids except for threonine of the wild type was attempted to confirm whether there is a mutation in which threonine production is better.
[220]
In order to introduce 19 kinds of heterologous base substitution mutations including T169L, which is the mutation confirmed in Example 6, each recombinant vector was prepared in the following way.
[221]
First, using the genomic DNA extracted from the WT strain as a template, primers SEQ ID NOs: 26 and 27 with restriction enzyme XbaI recognition sites inserted into the 5' fragment and 3' fragment at positions approximately 600 bp back and forth from positions 505 to 506 of the ddh gene, respectively. synthesized. Primers SEQ ID NOs: 28-65 for substituting the 505-506th nucleotide sequence of the ddh gene were synthesized to introduce 19 heterogeneous base substitution mutations (Table 12).
[222]
Specifically, the pDZ- ddh (T169A) plasmid was constructed in a form in which DNA fragments located at the 5' and 3' ends of the ddh gene (600bp each) were linked to the pDZ vector (Korean Patent No. 2009-0094433). Using the chromosome of the WT strain as a template, 5' end gene fragments were prepared by PCR using primers SEQ ID NOs: 26 and 28. PCR conditions include denaturation at 94°C for 2 minutes, denaturation at 94°C for 1 minute, annealing at 56°C for 1 minute, and polymerization at 72°C for 40 seconds were repeated 30 times, followed by polymerization at 72°C for 10 minutes. In the same manner, a gene fragment located at the 3' end of the ddh gene was prepared through PCR using SEQ ID NOs: 27 and 29. After the amplified DNA fragment was purified using Quiagen's PCR purification kit, it was used as an insert DNA fragment for vector construction.
[223]
Meanwhile, the pDZ vector, which was treated with restriction enzyme XbaI and heat-treated at 65° C. for 20 minutes, and the inserted DNA fragment amplified through the PCR were ligated using an Infusion Cloning Kit, and then transformed into E. coli DH5α. The strain was plated on LB solid medium containing kanamycin (25 mg/l). After selecting colonies transformed with the vector into which the desired gene was inserted through PCR using primers SEQ ID NOs: 26 and 27, a plasmid was obtained using a commonly known plasmid extraction method. This plasmid was named pDZ- ddh (T169A).
[224]
In the same manner, pDZ-ddh (T169V) using primers SEQ ID NOs: 26 and 30, 27 and 31, pDZ-ddh (T169Q) using primers SEQ ID NOs: 26 and 32, 27 and 33 , primers SEQ ID NOs: 26 and 34, pDZ- ddh (T169H) using 27 and 35, pDZ- ddh (T169R) using primers SEQ ID NOs: 26 and 36, 27 and 37, pDZ- ddh (T169R) using primers SEQ ID NOs: 26 and 38, 27 and 39 ( T169P), pDZ- ddh (T169L) using primers SEQ ID NOs: 26 and 40, 27 and 41, pDZ- ddh (T169Y) using primers SEQ ID NOs: 26 and 42, 27 and 43 , primers SEQ ID NOs: 26 and 44, pDZ- ddh (T169S) using 27 and 45, pDZ- ddh (T169K) using primers SEQ ID NOs: 26 and 46, 27 and 47, pDZ- ddh using primers SEQ ID NOs: 26 and 48, 27 and 49 (T169M), pDZ- ddh (T169I) using primers SEQ ID NOs: 26 and 50, 27 and 51, pDZ- ddh (T169E) using primers SEQ ID NOs: 26 and 52, 27 and 53 , primers SEQ ID NOs: 26 and 54 , pDZ- ddh (T169D) using , 27 and 55, pDZ- ddh (T169G) using primers SEQ ID NOs: 26 and 56, 27 and 57, pDZ- ddh using primers SEQ ID NOs: 26 and 58, 27 and 59 (T169W), pDZ- ddh (T169C) using primers SEQ ID NOs: 26 and 60, 27 and 61, pDZ- ddh (T169F) using primers SEQ ID NOs: 26 and 62, 27 and 63 , primers SEQ ID NOs: 26 and 64 , 27 and 65 were used to construct pDZ- ddh (T169N).
[225]
[226]
[Table 12]
SEQ ID NO: sequence (5' -> 3')
SEQ ID NO: 26 CGGGGATCCTCTAGAATGACCAACATCCGCGTAG
SEQ ID NO: 27 CAGGTCGACTCTAGATTAGACGTCGCGTGCGATC
SEQ ID NO: 28 TCCAGTACGCTCTCCCATCCGAAGACGCCC
SEQ ID NO: 29 GGATGGGAGAGCGTACTGGACTGCCTTTTG
SEQ ID NO: 30 TCCAGTACGTCCTCCCATCCGAAGACGCCC
SEQ ID NO: 31 GGATGGGAGGACGTACTGGACTGCCTTTTG
SEQ ID NO: 32 TCCAGTACCAGCTCCCATCCGAAGACGCCC
SEQ ID NO: 33 GGATGGGAGCTGGTACTGGACTGCCTTTTG
SEQ ID NO: 34 TCCAGTACCACCTCCCATCCGAAGACGCCC
SEQ ID NO: 35 GGATGGGAGGTGGTACTGGACTGCCTTTTG
SEQ ID NO: 36 TCCAGTACCGACTCCCATCCGAAGACGCCC
SEQ ID NO: 37 GGATGGGAGTCGGTACTGGACTGCCTTTTG
SEQ ID NO: 38 TCCAGTACCCTCTCCCATCCGAAGACGCCC
SEQ ID NO: 39 GGATGGGAGAGGGTACTGGACTGCCTTTTG
SEQ ID NO: 40 TCCAGTACTTACTCCCATCCGAAGACGCCC
SEQ ID NO: 41 GGATGGGAGTAAGTACTGGACTGCCTTTTG
SEQ ID NO: 42 TCCAGTACTACCTCCCATCCGAAGACGCCC
SEQ ID NO: 43 GGATGGGAGGTAGTACTGGACTGCCTTTTG
SEQ ID NO: 44 TCCAGTACTCCCTCCCATCCGAAGACGCCC
SEQ ID NO: 45 GGATGGGAGGGAGTACTGGACTGCCTTTTG
SEQ ID NO: 46 TCCAGTACAAGCTCCCATCCGAAGACGCCC
SEQ ID NO: 47 GGATGGGAGCTTGTACTGGACTGCCTTTTG
SEQ ID NO: 48 TCCAGTACATGCTCCCATCCGAAGACGCCC
SEQ ID NO: 49 GGATGGGAGCATGTACTGGACTGCCTTTTG
SEQ ID NO: 50 TCCAGTACATCCTCCCATCCGAAGACGCCC
SEQ ID NO: 51 GGATGGGAGGATGTACTGGACTGCCTTTTG
SEQ ID NO: 52 TCCAGTACGAACTCCCATCCGAAGACGCCC
SEQ ID NO: 53 GGATGGGAGTTCGTACTGGACTGCCTTTTG
SEQ ID NO: 54 TCCAGTACGATCTCCCATCCGAAGACGCCC
SEQ ID NO: 55 GGATGGGAGATCGTACTGGACTGCCTTTTG
SEQ ID NO: 56 TCCAGTACGGTCTCCCATCCGAAGACGCCC
SEQ ID NO: 57 GGATGGGAGACCGTACTGGACTGCCTTTTG
SEQ ID NO: 58 TCCAGTACTGGCTCCCATCCGAAGACGCCC
SEQ ID NO: 59 GGATGGGAGCCAGTACTGGACTGCCTTTTG
SEQ ID NO: 60 TCCAGTACTGCCTCCCATCCGAAGACGCCC
SEQ ID NO: 61 GGATGGGAGGCAGTACTGGACTGCCTTTTG
SEQ ID NO: 62 TCCAGTACTTCCTCCCATCCGAAGACGCCC
SEQ ID NO: 63 GGATGGGAGGAAGTACTGGACTGCCTTTTG
SEQ ID NO: 64 TCCAGTACAACCTCCCATCCGAAGACGCCC
SEQ ID NO: 65 GGATGGGAGGTTGTACTGGACTGCCTTTTG
[227]
Each of the prepared vectors was transformed into CA09-0901 by the electric pulse method. As such , 19 strains in which heterologous base substitution mutations were introduced into the ddh gene were CA09-0900:: ddh (T169A), CA09-0900:: ddh (T169V), CA09-0900:: ddh (T169Q), CA09-0900: : ddh (T169H), CA09-0900:: ddh (T169R), CA09-0900:: ddh (T169P), CA09-0900:: ddh (T169L), CA09-0900:: ddh (T169Y), CA09-0900: : ddh (T169S), CA09-0900:: ddh (T169K), CA09-0900:: ddh (T169M), CA09-0900:: ddh (T169I), CA09-0900:: ddh(T169E), CA09-0900:: ddh (T169D), CA09-0900:: ddh (T169G), CA09-0900:: ddh (T169W), CA09-0900:: ddh (T169C), CA09-0900:: ddh (T169F), CA09-0900:: ddh (T169N), respectively.
[228]
The ddh gene was deleted in the CA09-0900 strain by the method used in Example 2, and this strain was named CA09-0900::Δ ddh . CA09-0900 and CA09-0900Δ ddh strains were used as controls, and 19 selected strains were cultured in the following manner to measure lysine, threonine concentrations and sugar consumption rates.
[229]
[230]
[Table 13] Measurement of lysine production capacity, threonine production capacity and sugar consumption rate
strain THR concentration (g/L) LYS concentration (g/L) Sugar consumption rate (g/hr)
CA09-0901 1.43 2.75 4.53
CA09-0900::△ddh 2.67 1.38 2.41
CA09-0900:: ddh (T169A) 1.32 2.73 3.98
CA09-0900:: ddh (T169V) 1.43 2.58 3.89
CA09-0900:: ddh (T169Q) 1.38 2.62 3.91
CA09-0900:: ddh (T169H) 1.67 2.63 4.23
CA09-0900:: ddh (T169R) 1.72 2.41 2.44
CA09-0900:: ddh (T169P) 1.81 2.25 3.16
CA09-0900:: ddh (T169L) 2.48 1.52 3.97
CA09-0900:: ddh (T169Y) 1.50 2.66 4.51
CA09-0900:: ddh (T169S) 1.62 2.33 4.28
CA09-0900:: ddh (T169K) 1.91 1.50 2.22
CA09-0900:: ddh (T169M) 1.02 1.75 2.38
CA09-0900:: ddh (T169I) 1.97 1.68 3.08
CA09-0900:: ddh (T169E) 1.54 1.66 2.59
CA09-0900:: ddh (T169D) 1.99 1.87 3.65
CA09-0900:: ddh (T169G) 1.42 2.61 4.07
CA09-0900:: ddh (T169W) 1.53 2.58 3.99
CA09-0900:: ddh (T169C) 1.91 1.74 3.78
CA09-0900:: ddh (T169F) 1.80 1.18 4.03
CA09-0900:: ddh (T169N) 1.44 2.77 4.35
[231]
In the case of the strain lacking the ddh gene, the threonine concentration increased by about 1.24 g/L and the lysine concentration decreased by 1.37 L compared to the parent strain. As a result of a decrease of 46.1% P per sugar, when the ddh gene was deleted and there was almost no DDH activity, THR increased and LYS decreased, but the growth of the strain was inhibited, making it difficult to utilize industrially. For all strains containing a variant polypeptide in which the 169th amino acid of SEQ ID NO: 1 was substituted with another amino acid, LYS decreased and THR increased while the growth of the strain was maintained at an industrially usable level. That is, weakening ddh helps to increase THR while decreasing LYS, and it was confirmed that ddh was weakened by a change in the 169th amino acid of ddh (Table 13). In addition, the 169th amino acid was determined to be the most effective because the mutation in which threonine was replaced with lysine had a large decrease in lysine and a large increase in threonine, and the rate of sugar consumption was at a commercially available level.
[232]
[233]
Example 8: Production and evaluation of mutant ddh and dapB introduced strains in Corynebacterium microbial strains having L-threonine-producing ability
[234]
[235]
Through CA09-0904 prepared in Example 6, it was confirmed that the strain with reduced L-lysine production had a positive effect on L-threonine production. By further weakening the L-lysine pathway in the strain, a strain was developed to confirm that the ability to produce L-threonine can be further increased.
[236]
Specifically, to attenuate the activity of 4-hydroxy-tetrahydrodipicolinate reductase (dapB), an enzyme involved in the second reaction in the lysine biosynthesis pathway, arginine, the 13th amino acid of dapB, was substituted with Aspargine ( SEQ ID NO: 66).
[237]
More specifically, PCR was performed using the primers of SEQ ID NO: 67 and SEQ ID NO: 68 or SEQ ID NO: 69 and SEQ ID NO: 70 using the chromosome of ATCC13032 as a template to prepare strains into which dapB(R13N) mutation was introduced. As a polymerase for the PCR reaction, PfuUltra TM high-confidence DNA polymerase (Stratagene) was used, and PCR conditions were denaturation 95°C for 30 seconds; annealing 55° C. 30 seconds; and the polymerization reaction at 72° C. for 1 minute was repeated 28 times.
[238]
As a result, a 512 bp DNA fragment at the 5' upper end and a 514 bp DNA fragment at the 3' lower end were obtained, respectively, centering on the mutation of the dapB gene. Using the two amplified DNA fragments as templates, PCR was performed with primers of SEQ ID NO: 67 and SEQ ID NO: 70. PCR conditions were repeated 28 times of denaturation at 95°C for 5 minutes, then denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 2 minutes, followed by polymerization at 72°C for 5 minutes.
[239]
As a result, a 1001 bp DNA fragment containing a mutation in the dapB gene encoding a hydroxy-tetrahydrodipicolinate reductase mutant in which the 13th arginine was substituted with asparagine was amplified. The amplification product was purified using QIAGEN's PCR purification kit and used as an insert DNA fragment for vector construction. On the other hand, after treatment with restriction enzyme smaI , the molar concentration (M) ratio of the pDZ vector and the insert DNA fragment amplified through PCR, which was heat-treated at 65° C. for 20 minutes, was 1:2, so that the Infusion Cloning Kit of TaKaRa was used to construct a vector pDZ-R13N for introducing R13N mutations onto a chromosome by cloning according to the provided manual.
[240]
The prepared vector was transformed into CA09-0904 by electroporation, and through a secondary crossover process, a strain in which each nucleotide mutation was substituted with a mutant nucleotide on the chromosome was obtained, which was named CA09-0904-R13N.
[241]
[242]
[Table 14] Confirmation of L-threonine and L-lysine production ability of the production strain
strain Amino acid (g/l)
Thr Lys
CA09-0900 1.52 2.70
CA09-0904 2.41 1.53
CA09-0904-R13N 3.03 1.08
[243]
As a result, in the strain introduced with the mutation, the production of L-lysine decreased by 1.62 g/L and the production of L-threonine increased by 1.51 g/L compared to the control CA09-0900 strain, and L-lysine compared to the CA09-0904 strain. production decreased by 0.48 g/L and L-threonine production increased by 0.62 g/L (Table 14). Therefore, it was confirmed that the weakening of the L-lysine production pathway was positive for L-threonine production.
[244]
[245]
Example 9: Production and evaluation of mutant ddh and lysA introduced strains in Corynebacterium microbial strains having L-threonine-producing ability
[246]
[247]
Through CA09-0904 prepared in Example 6, it was confirmed that the strain with reduced L-lysine production had a positive effect on L-threonine production. By further weakening the L-lysine pathway in the strain, a strain was developed to confirm that L-threonine production can be further increased.
[248]
Specifically, in order to weaken the activity of diaminopimelate decarboxylase (lysA) as the last enzyme involved in the lysine biosynthesis pathway, methionine, amino acid 408 of lysA, was substituted with alanine (Alanine) (Biochemical and Biophysical Research Communications, Volume) 495, Issue 2, 8 January 2018) (SEQ ID NO: 71).
[249]
More specifically, PCR was performed using the primers of SEQ ID NO: 72 and SEQ ID NO: 73 or SEQ ID NO: 74 and SEQ ID NO: 75 using the ATCC13032 chromosome as a template to produce strains into which lysA (M408A) mutation was introduced. As a polymerase for the PCR reaction, PfuUltra TM high-confidence DNA polymerase (Stratagene) was used, and PCR conditions were denaturation 95°C for 30 seconds; annealing 55° C. 30 seconds; and the polymerization reaction at 72° C. for 1 minute was repeated 28 times.
[250]
As a result, a 534 bp DNA fragment at the 5' upper end and a 527 bp DNA fragment at the 3' lower end were obtained based on the mutation of the lysA gene, respectively. Using the two amplified DNA fragments as templates, PCR was performed with primers of SEQ ID NO: 72 and SEQ ID NO: 75. PCR conditions were repeated 28 times of denaturation at 95°C for 5 minutes, then denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 2 minutes, followed by polymerization at 72°C for 5 minutes.
[251]
[252]
[Table 15]
SEQ ID NO: sequence (5' -> 3')
SEQ ID NO: 72 TCGAGCTCGGTACCCGTTGGGCCTGTACTCACAG
SEQ ID NO: 73 TAGCGGGAGCTCGCGGCGTAGCAGTATGCGCC
SEQ ID NO: 74 TACTGCTACGCCGCGAGCTCCCGCTACAACGC
SEQ ID NO: 75 CTCTAGAGGATCCCGTGCAAGGTGAACCAACTG
[253]
As a result, a 1035 bp DNA fragment containing a mutation in the lysA gene encoding a diaminopimelate dicarbolsilase mutant in which methionine at position 408 is substituted with alanine was amplified. The amplification product was purified using QIAGEN's PCR purification kit and used as an insert DNA fragment for vector construction. On the other hand, after treatment with restriction enzyme smaI , the molar concentration (M) ratio of the pDZ vector and the insert DNA fragment amplified through PCR, which was heat-treated at 65° C. for 20 minutes, was 1:2, so that the Infusion Cloning Kit of TaKaRa was used to construct a vector pDZ-M408A for introducing the M408A mutation onto the chromosome by cloning according to the provided manual.
[254]
The prepared vector was transformed into CA09-0904 by electroporation, and through a secondary crossover process, a strain in which each nucleotide mutation was substituted with a mutant nucleotide on the chromosome was obtained, which was named CA09-0904-M408A.
[255]
[256]
[Table 16] Confirmation of L-threonine and L-lysine production ability of the production strain
strain Amino acid (g/l)
Thr Lys
CA09-0900 1.61 2.51
CA09-0904 2.63 1.52
CA09-0904-M408A 3.08 1.10
[257]
As a result, in the strain introduced with the mutation, the production of L-lysine decreased by 1.41 g/L and the production of L-threonine increased by 1.33 g/L compared to the CA09-0900 strain, which is the control, and L-lysine compared to the CA09-0904 strain. production decreased by 0.42 g/L and L-threonine production increased by 0.35 g/L (Table 16). Therefore, it was confirmed that the weakening of the L-lysine production pathway was positive for L-threonine production.
[258]
[259]
Example 10: Production and evaluation of mutant ddh and dapA introduced strains in Corynebacterium microbial strains having L-threonine-producing ability
[260]
[261]
Through CA09-0904 prepared in Example 6, it was confirmed that the strain with reduced L-lysine production had a positive effect on L-threonine production. By further weakening the L-lysine pathway in the strain, a strain was developed to confirm that L-threonine production can be further increased.
[262]
Specifically, to weaken the activity of 4-hydroxy-tetrahydrodipicolinate synthase (dapA), an enzyme involved in the second reaction in the lysine biosynthesis pathway, tyrosine, amino acid 119 of dapA, was substituted with phenylalanine (Journal of Molecular biology, Volume 338, Issue 2, 23 April 2004) (SEQ ID NO:76).
[263]
More specifically, PCR was performed using the primers of SEQ ID NO: 77 and SEQ ID NO: 78 or SEQ ID NO: 79 and SEQ ID NO: 80 using the ATCC13032 chromosome as a template to produce strains into which dapA (Y119F) mutation was introduced. As a polymerase for the PCR reaction, PfuUltra TM high-confidence DNA polymerase (Stratagene) was used, and PCR conditions were denaturation 95°C for 30 seconds; annealing 55° C. 30 seconds; and the polymerization reaction at 72° C. for 1 minute was repeated 28 times.
[264]
As a result, a 538 bp DNA fragment at the 5' upper end and a 528 bp DNA fragment at the 3' lower end were obtained, respectively, centering on the dapA gene mutation. Using the two amplified DNA fragments as templates, PCR was performed with primers of SEQ ID NO: 77 and SEQ ID NO: 80. PCR conditions were repeated 28 times of denaturation at 95°C for 5 minutes, then denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 2 minutes, followed by polymerization at 72°C for 5 minutes.
[265]
[266]
[Table 17]
SEQ ID NO: sequence (5' -> 3')
SEQ ID NO: 77 TCGAGCTCGGTACCCTTCATATAGTTAAGACAAC
SEQ ID NO: 78 CGGCTTGGAGAAATAAGGAGTTACACAAAAAG
SEQ ID NO: 79 TAACTCCTTATTTCTCCAAGCCGAGCCAAGAG
SEQ ID NO: 80 CTCTAGAGGATCCCGAGCCTCAAGTTCCTGCTC
[267]
As a result, a 1000 bp DNA fragment containing a mutation in the dapA gene encoding a hydroxy-tetrahydrodipicolinate synthase variant in which tyrosine at position 119 is substituted with phenylalanine was amplified. The amplification product was purified using QIAGEN's PCR purification kit and used as an insert DNA fragment for vector construction. On the other hand, after treatment with restriction enzyme smaI , the molar concentration (M) ratio of the pDZ vector and the insert DNA fragment amplified through PCR, which was heat-treated at 65° C. for 20 minutes, was 1:2, so that the Infusion Cloning Kit of TaKaRa A vector pDZ-Y119F for introducing dapA(Y119F) mutations onto a chromosome was constructed by cloning according to the provided manual using .
[268]
The prepared vector was transformed into CA09-0904 by electroporation, and through a secondary crossover process, a strain in which each nucleotide mutation was substituted with a mutant nucleotide on the chromosome was obtained, which was named CA09-0904-Y119F.
[269]
[270]
[Table 18] Confirmation of L-threonine and L-lysine production ability of the production strain
strain Amino acid (g/l)
Thr Lys
CA09-0900 1.48 2.68
CA09-0904 2.52 1.57
CA09-0904-Y119F 3.31 0.82
[271]
[272]
As a result, in the strain introduced with the mutation, the production of L-lysine decreased by 1.86 g/L and the production of L-threonine increased by 1.83 g/L compared to the CA09-0900 strain, which is the control, and L-lysine compared to the CA09-0904 strain. of 0.75 g/L decreased and L-threonine production increased by 0.79 g/L (Table 18). Therefore, it was confirmed that the weakening of the L-lysine production pathway was positive for L-threonine production.
[273]
[274]
The above results are, in a strain comprising a meso diaminopimelate dehydrogenase variant polypeptide in which the 169th amino acid in the amino acid sequence of SEQ ID NO: 1 of the present application is substituted with leucine, phenylalanine, glutamic acid or cysteine, L-lysine As a result, the production is decreased and the production of L-threonine is increased, suggesting that the L-threonine production capacity is increased than that of the unmodified strain.
[275]
[276]
From the above description, those skilled in the art to which the present invention pertains will understand that the present invention may be embodied in other specific forms without changing the technical spirit or essential characteristics thereof. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of the present invention should be construed as being included in the scope of the present invention, rather than the above detailed description, all changes or modifications derived from the meaning and scope of the claims to be described later and their equivalents.

Claims
[Claim 1]
The amino acid corresponding to the 169th position of SEQ ID NO: 1 is substituted with leucine, phenylalanine, glutamate or cysteine, and at least 80%, or more, 100% of the amino acid sequence of SEQ ID NO: 1 A variant polypeptide having less than sequence homology and having meso-diaminopimelate dehydrogenase activity.
[Claim 2]
The variant polypeptide according to claim 1, wherein the meso diaminopimelate dehydrogenase activity of the variant polypeptide has a weakened activity than the wild-type meso diaminopimelate dehydrogenase activity having the amino acid sequence of SEQ ID NO: 1 .
[Claim 3]
A polynucleotide encoding the variant polypeptide of claim 1 .
[Claim 4]
The polynucleotide of claim 3, wherein the polynucleotide consists of the nucleotide sequence of SEQ ID NO: 4.
[Claim 5]
The amino acid corresponding to the 169th position of SEQ ID NO: 1 is substituted with leucine, phenylalanine, glutamate or cysteine. Corynebacter comprising a mutant polypeptide having meso diaminopimelate dehydrogenase activity or a polynucleotide comprising the same, having at least 80%, or more, less than 100% sequence homology to the amino acid sequence of SEQ ID NO: 1 Leum genus ( Corynebacterium sp. ) Microorganisms.
[Claim 6]
The microorganism of the genus Corynebacterium according to claim 5, wherein the microorganism of the genus Corynebacterium additionally comprises any one or more selected from the following (1) to (3) variant polypeptides. (1) dihydrodipicolinate reductase; A mutant polypeptide having reduced dihydrodipicolinate synthase (dapA) activity.
[Claim 7]
The microorganism according to claim 6, wherein the variant polypeptide comprises any one or more selected from variant polypeptides of (1) to (3) . (1) mutant polypeptide of dihydrodipicolinate reductase (dapB) in which the 13th amino acid in the amino acid sequence of SEQ ID NO: 81 is substituted from arginine (R) to asparagine (N) (2) SEQ ID NO: 82 a diaminopimelate decarboxylase (lysA) variant polypeptide in which the 408th amino acid in the amino acid sequence of methionine (M) is substituted with alanine (A); and (3) a dihydrodipicolinate synthase (dapA) variant polypeptide in which the 119th amino acid in the amino acid sequence of SEQ ID NO: 83 is substituted from tyrosine (T) to phenylalanine (F).
[Claim 8]
The microorganism of the genus Corynebacterium according to claim 5, wherein the microorganism has an increased ability to produce L-threonine compared to the non-mutant strain.
[Claim 9]
The microorganism of claim 5, wherein the microorganism is Corynebacterium glutamicum .
[Claim 10]
The amino acid corresponding to the 169th position of SEQ ID NO: 1 is substituted with leucine, phenylalanine, glutamate or cysteine, and at least 80%, or more, 100% of the amino acid sequence of SEQ ID NO: 1 A method for producing L-threonine, comprising the step of culturing a microorganism of the genus Corynebacterium comprising a mutant polypeptide having less than sequence homology and meso diaminopimelate dehydrogenase activity in a medium.
[Claim 11]
11. The method of claim 10, wherein the step of culturing the microorganism further comprises the step of recovering L-threonine from the culture medium and the microorganism, L- threonine production method.