[001] The present disclosure in general relates to a process for identifying anti-ageing effects of an ingredient.
BACKGROUND OF INVENTION
[002] Ageing has been associated with multiple structural and functional changes
in gastrointestinal tract [Ageing and the gut, DOI:
http://dx.doi.org/10.1017/S0029665112002807]. Efforts are ongoing to understand the reason for structural and functional changes in an ageing gut. Invariably, various studies mention the association between the gut microbiota and ageing (Saraswati and Sitaraman, 2015. Front. Microbiol. 2015 Jan 12;5:764. doi: 10.3389/fmicb.2014.00764. eCollection 2014.). However, the mechanism of change in gut microbiota with age is still an enigma. Centenarians have a different microbiota as compared to older adults. A person’s lifestyle and diet play a huge role in the formation of microbiota. Evidence also exists that suggests that loss of diversity of microbiota can affect the ageing process.
[003] Average lifespan has seen an increase in recent decades and the credit goes to constant research that is ongoing in the field of ageing. There are various compounds that affect ageing. As discussed previously, gut microbiota depends a lot on diet of a person, likewise various dietary components affect the ageing process. The change in the microbiota of a human with age is believed to be caused by age related decline in functioning of immune system and a low-grade chronic inflammation.
[004] Due to various ongoing research in the present field, gut microbiota has been recently considered as a target for improving health. The dietary components targeting the microbiota and probiotic interventions have been shown to favourably affect the human health and ageing. It has been shown to enhance antioxidant activity, improve immune homeostasis, suppress chronic inflammation, regulate fat deposition and metabolism, and prevent insulin resistance.

[005] Therefore, there has been a keen interest to identify various compounds that
exhibit anti-ageing effects, but the study is hampered due to lack of a model to
carry out such studies. Such a model should depict the gut microbiota which
responds to the compounds which exhibits the respective effects.
[006] US20100172874A1 discloses a method for altering gut microbiome for
decreasing body fat or promoting weight loss in a subject.
[007] Although, there are disclosures which relate to the study of gut but most of
them focus on the use of gut microbiome as a biomarker for treating a disorder.
There are limited studies that focus on the model that could support the testing of
different drugs/compounds that might have anti-ageing effects.
SUMMARY OF THE INVENTION
[008] In an aspect of the present invention, there is provided a method to identify anti-ageing effects of an ingredient, said method comprising: (a) obtaining a bacterial premix; (b) obtaining cells; (c) obtaining an ingredient; (d) contacting the bacterial premix, the cells, and the ingredient for a time-period in a range of 3-6 hours, at a temperature in a range of 30oC- 40oC; (e) processing the cells of step (d) to obtain processed cells; and (f) evaluating gene expression of age-associated biomarkers of the processed cells to identify anti-ageing effects of the ingredient. [009] These and other features, aspects, and advantages of the present subject matter will be better understood with reference to the following description and appended claims. This summary is provided to introduce a selection of concepts in a simplified form. This summary is not intended to identify key features or essential features of the claimed subject matter, nor is it intended to be used to limit the scope of the claimed subject matter.
BRIEF DESCRIPTION OF ACCOMPANYING DRAWINGS
[0010] The following drawings form a part of the present specification and are included to further illustrate aspects of the present disclosure. The disclosure may be better understood by reference to the drawings in combination with the detailed description of the specific embodiments presented herein.

[0011] Figure 1 depicts a schematic representation of incubation of caco-2 cells with bacterial premix, in accordance with an embodiment of the present disclosure. [0012] Figure 2 depicts the effect of bacterial combinations with and without resveratrol and sirtinol on the expression of SIRT-1 (Sirtuin-1) gene, in accordance with an embodiment of the present disclosure.
[0013] Figure 3 depicts the effect of natural extracts (anthocyanin and annatto) on combination-3 mediated modulation of expression of SIRT-1, in accordance with an embodiment of the present disclosure.
DETAILED DESCRIPTION OF THE INVENTION
[0014] Those skilled in the art will be aware that the present disclosure is subject to variations and modifications other than those specifically described. It is to be understood that the present disclosure includes all such variations and modifications. The disclosure also includes all such steps, features, compositions, and compounds referred to or indicated in this specification, individually or collectively, and any and all combinations of any or more of such steps or features.
Sequences:
[0015] SEQ ID NO: 1 depicts forward primer sequence of SIRT-1 gene.
TCGCAACTATACCCAGAACATAGACA
[0016] SEQ ID NO: 2 depicts reverse primer sequence of SIRT-1 gene.
CTGTTGCAAAGGAACCATGACA
[0017] SEQ ID NO: 3 depicts forward primer sequence of FGF-23 gene.
CCTCTGCATGGATTTCAGAGGCAAC
[0018] SEQ ID NO: 4 depicts reverse primer sequence of FGF-23 gene.
ATGGGTCACTGGCCATCGGG
[0019] SEQ ID NO: 5 depicts forward primer sequence of GAPDH gene.
ATGACATCAAGAAGGTGGTG
[0020] SEQ ID NO: 6 depicts reverse primer sequence of GAPDH gene.
CATACCAGGAAAATGAGCTTG
Definitions

[0021] For convenience, before further description of the present disclosure,
certain terms employed in the specification, and examples are delineated here.
These definitions should be read in the light of the remainder of the disclosure and
understood as by a person of skill in the art. The terms used herein have the
meanings recognized and known to those of skill in the art, however, for
convenience and completeness, particular terms and their meanings are set forth
below.
[0022] The articles “a”, “an” and “the” are used to refer to one or to more than one
(i.e., to at least one) of the grammatical object of the article.
[0023] The terms “comprise” and “comprising” are used in the inclusive, open
sense, meaning that additional elements may be included. It is not intended to be
construed as “consists of only”.
[0024] Throughout this specification, unless the context requires otherwise the
word “comprise”, and variations such as “comprises” and “comprising”, will be
understood to imply the inclusion of a stated element or step or group of element or
steps but not the exclusion of any other element or step or group of element or
steps.
[0025] The term “including” is used to mean “including but not limited to”.
“Including” and “including but not limited to” are used interchangeably.
[0026] Ratios, concentrations, amounts, and other numerical data may be presented
herein in a range format. It is to be understood that such range format is used
merely for convenience and brevity and should be interpreted flexibly to include
not only the numerical values explicitly recited as the limits of the range, but also
to include all the individual numerical values or sub-ranges encompassed within
that range as if each numerical value and sub-range is explicitly recited.
[0027] “Ingredient” as described in the present disclosure might include but is not
limited to compounds, drugs, chemical entities, active pharmaceutical ingredients,
herbal, non-herbal compositions. In essence, the term ingredient refers to any
substance or agent that can be tested for having anti-ageing properties using the
claimed method.

[0028] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the disclosure, the preferred methods, and materials are now described. All publications mentioned herein are incorporated herein by reference.
[0029] Positive modulation of gut microflora is one of the most important factor being associated with ageing population. In a comparative study, the gut microbiota in elders with C. difficile infections showed higher diversity of Lactobacillus and Clostridia, and lower diversity of Bacteroides, Prevotella and Bifidobacteria. It is believed that alteration in the gut microbiota during ageing provide a favorable environment for growth of pathogens in the gut. The use of prebiotics or probiotics could maintain a beneficial diversity of intestinal microbes, which could prevent or delay C. difficile infections in ageing subjects (Hopkins MJ, Macfarlane GT. J Med Microbiol. 2002; 51(5):448–54, 2002). Hypothesizing the impact of relative microflora population gut ageing, the present disclosure evaluates the effect of bacterial premixes (using key members of gut microbiota, different ratios) on markers associated with gut ageing. Surprisingly, a specific combination of microbiota shows age related impact on molecular markers including SIRT-1 and FGF-23.
[0030] The present disclosure discloses a method for identifying anti-ageing effects of an ingredient. The process as disclosed herein makes use of a combination of bacteria – bacterial premix comprising Clostridium histolyticum ATCC 19401 having a concentration in a range of 1- 4 x 107 CFU/10ml, Bacteriodes thetathiomicron ATCC 29148 having a concentration in a range of 1.1- 4 x 107 CFU/10ml, Lactobacillus casei NCDC 298 having a concentration in a range of 0.5- 5 x 107 CFU/10ml, and Bifidobacterium lactis NCDC 229 having a concentration in a range of 0.2- 2 x 107 CFU/10ml.
[0031] The present disclosure is not to be limited in scope by the specific embodiments described herein, which are intended for the purposes of

exemplification only. Functionally-equivalent products, compositions, and methods are clearly within the scope of the disclosure, as described herein.
[0032] In an embodiment of the present disclosure, there is provided a method to identify anti-ageing effects of an ingredient, said method comprising: (a) obtaining a bacterial premix; (b) obtaining cells; (c) obtaining an ingredient; (d) contacting the bacterial premix, the cells, and the ingredient for a time-period in a range of 3-6 hours, at a temperature in a range of 30oC- 40oC; (e) processing the cells of step (d) to obtain processed cells; and (f) evaluating gene expression of age-associated biomarkers of the processed cells to identify anti-ageing effects of the ingredient. [0033] In an embodiment of the present disclosure, there is provided a method to identify anti-ageing effects of an ingredient, said method comprising: (a) obtaining a bacterial premix; (b) obtaining cells; (c) obtaining an ingredient; (d) contacting the bacterial premix, the cells, and the ingredient for a time-period in a range of 3-6 hours, at a temperature in a range of 30℃- 40℃; (e) processing the cells of step (d) to obtain processed cells; and (f) evaluating gene expression of age-associated biomarkers of the processed cells to identify anti-ageing effects of the ingredient, wherein the bacterial premix comprises bacteria selected from the group consisting of Clostridium histolyticum, Bacteriodes thetathiomicron, Lactobacillus casei, Bifidobacterium lactis, and combinations thereof.
[0034] In an embodiment of the present disclosure, there is provided a method to identify anti-ageing effects of an ingredient, said method comprising: (a) obtaining a bacterial premix; (b) obtaining cells; (c) obtaining an ingredient; (d) contacting the bacterial premix, the cells, and the ingredient for a time-period in a range of 3-6 hours, at a temperature in a range of 30℃- 40℃; (e) processing the cells of step (d) to obtain processed cells; and (f) evaluating gene expression of age-associated biomarkers of the processed cells to identify anti-ageing effects of the ingredient, wherein the bacterial premix comprises bacteria selected from the group consisting of Clostridium histolyticum ATCC 19401, Bacteriodes thetathiomicron ATCC 29148, Lactobacillus casei NCDC 298, Bifidobacterium lactis NCDC 229, and combinations thereof.

[0035] In an embodiment of the present disclosure, there is provided a method to identify anti-ageing effects of an ingredient, said method comprising: (a) obtaining a bacterial premix; (b) obtaining cells; (c) obtaining an ingredient; (d) contacting the bacterial premix, the cells, and the ingredient for a time-period in a range of 3-6 hours, at a temperature in a range of 30℃- 40℃; (e) processing the cells of step (d) to obtain processed cells; and (f) evaluating gene expression of age-associated biomarkers of the processed cells to identify anti-ageing effects of the ingredient, wherein the bacterial premix comprises a combination of Clostridium histolyticum ATCC 19401, Bacteriodes thetathiomicron ATCC 29148, Lactobacillus casei NCDC 298, and Bifidobacterium lactis NCDC 229.
[0036] In an embodiment of the present disclosure, there is provided a method to identify anti-ageing effects of an ingredient, said method comprising: (a) obtaining a bacterial premix; (b) obtaining cells; (c) obtaining an ingredient; (d) contacting the bacterial premix, the cells, and the ingredient for a time-period in a range of 3-6 hours, at a temperature in a range of 30℃- 40℃; (e) processing the cells of step (d) to obtain processed cells; and (f) evaluating gene expression of age-associated biomarkers of the processed cells to identify anti-ageing effects of the ingredient, wherein the bacterial premix comprises bacteria selected from the group consisting of Clostridium histolyticum having a concentration in a range of 1- 4 x 107 CFU/10ml, Bacteriodes thetathiomicron having a concentration in a range of 1.1- 4 x 107 CFU/10ml, Lactobacillus casei having a concentration in a range of 0.5- 5 x 107 CFU/10ml, Bifidobacterium lactis having a concentration in a range of 0.2- 2 x 107 CFU/10ml, and combinations thereof.
[0037] In an embodiment of the present disclosure, there is provided a method to identify anti-ageing effects of an ingredient, said method comprising: (a) obtaining a bacterial premix; (b) obtaining cells; (c) obtaining an ingredient; (d) contacting the bacterial premix, the cells, and the ingredient for a time-period in a range of 3-6 hours, at a temperature in a range of 30℃- 40℃; (e) processing the cells of step (d) to obtain processed cells; and (f) evaluating gene expression of age-associated biomarkers of the processed cells to identify anti-ageing effects of the ingredient, wherein the bacterial premix comprises bacteria selected from the group consisting

of Clostridium histolyticum ATCC 19401 having a concentration in a range of 1- 4 x 107 CFU/10ml, Bacteriodes thetathiomicron ATCC 29148 having a concentration in a range of 1.1- 4 x 107 CFU/10ml, Lactobacillus casei NCDC 298 having a concentration in a range of 0.5- 5 x 107 CFU/10ml, Bifidobacterium lactis NCDC 229 having a concentration in a range of 0.2- 2 x 107 CFU/10ml, and combinations thereof.
[0038] In an embodiment of the present disclosure, there is provided a method to identify anti-ageing effects of an ingredient as described herein, wherein contacting the bacterial premix, the cells, and the ingredient is for a time-period in a range of 3.5-5.5 hours, at a temperature in a range of 35℃- 40℃.
[0039] In an embodiment of the present disclosure, there is provided a method to identify anti-ageing effects of an ingredient, said method comprising: (a) obtaining a bacterial premix; (b) obtaining cells; (c) obtaining an ingredient; (d) contacting the bacterial premix, the cells, and the ingredient for a time-period in a range of 3-6 hours, at a temperature in a range of 30℃- 40℃; (e) processing the cells of step (d) to obtain processed cells; and (f) evaluating gene expression of age-associated biomarkers of the processed cells to identify anti-ageing effects of the ingredient, wherein the bacterial premix comprises bacteria selected from the group consisting of Clostridium histolyticum having a concentration of 2 x 107 CFU/10ml, Bacteriodes thetathiomicron having a concentration of 1.5 x 107 CFU/10ml, Lactobacillus casei having a concentration of 2.2 x 107 CFU/10ml, Bifidobacterium lactis having a concentration in the range of 0.4 x 107 CFU/10ml, and combinations thereof.
[0040] In an embodiment of the present disclosure, there is provided a method to identify anti-ageing effects of an ingredient, said method comprising: (a) obtaining a bacterial premix; (b) obtaining cells; (c) obtaining an ingredient; (d) contacting the bacterial premix, the cells, and the ingredient for a time-period in a range of 3-6 hours, at a temperature in a range of 30℃- 40℃; (e) processing the cells of step (d) to obtain processed cells; and (f) evaluating gene expression of age-associated biomarkers of the processed cells to identify anti-ageing effects of the ingredient, wherein the bacterial premix comprises bacteria selected from the group consisting

of Clostridium histolyticum ATCC 19401 having a concentration of 2 x 107 CFU/10ml, Bacteriodes thetathiomicron ATCC 29148 having a concentration of 1.5 x 107 CFU/10ml, Lactobacillus casei NCDC 298 having a concentration of 2.2 x 107 CFU/10ml, Bifidobacterium lactis NCDC 229 having a concentration in the range of 0.4 x 107 CFU/10ml, and combinations thereof.
[0041] In an embodiment of the present disclosure, there is provided a method to identify anti-ageing effects of an ingredient, said method comprising: (a) obtaining a bacterial premix; (b) obtaining cells; (c) obtaining an ingredient; (d) contacting the bacterial premix, the cells, and the ingredient for a time-period in a range of 3-6 hours, at a temperature in a range of 30℃- 40℃; (e) processing the cells of step (d) to obtain processed cells; and (f) evaluating gene expression of age-associated biomarkers of the processed cells to identify anti-ageing effects of the ingredient, wherein the bacterial premix comprises bacteria selected from the group consisting of Clostridium histolyticum having a concentration of 1.5-3.5 x 107 CFU/10ml, Bacteriodes thetathiomicron having a concentration of 1.3-2 x 107 CFU/10ml, Lactobacillus casei having a concentration of 1-1.5 x 107 CFU/10ml, Bifidobacterium lactis having a concentration in the range of 0.3-1 x 107 CFU/10ml, and combinations thereof.
[0042] In an embodiment of the present disclosure, there is provided a method to identify anti-ageing effects of an ingredient, said method comprising: (a) obtaining a bacterial premix; (b) obtaining cells; (c) obtaining an ingredient; (d) contacting the bacterial premix, the cells, and the ingredient for a time-period in a range of 3-6 hours at a temperature in a range of 30℃- 40℃; (e) processing the cells of step (d) to obtain processed cells; and (f) evaluating gene expression of age-associated biomarkers of the processed cells to identify anti-ageing effects of the ingredient, wherein the bacterial premix comprises bacteria selected from the group consisting of Clostridium histolyticum, Bacteriodes thetathiomicron, Lactobacillus casei, Bifidobacterium lactis and combinations thereof, and wherein the bacterial premix represents microbiota of ageing human gut.
[0043] In an embodiment of the present disclosure, there is provided a method to identify anti-ageing effects of an ingredient, said method comprising: (a) obtaining

a bacterial premix; (b) obtaining cells; (c) obtaining an ingredient; (d) contacting the bacterial premix, the cells, and the ingredient for a time-period in a range of 3-6 hours, at a temperature in a range of 30℃- 40℃; (e) processing the cells of step (d) to obtain processed cells; and (f) evaluating gene expression of age-associated biomarkers of the processed cells to identify anti-ageing effects of the ingredient, wherein the bacterial premix comprises bacteria selected from the group consisting of Clostridium histolyticum having a concentration in a range of 1- 4 x 107 CFU/10ml, Bacteriodes thetathiomicron having a concentration in a range of 1.1- 4 x 107 CFU/10ml, Lactobacillus casei having a concentration in a range of 0.5- 5 x 107 CFU/10ml, Bifidobacterium lactis having a concentration in a range of 0.2- 2 x 107 CFU/10ml, and combinations thereof, and wherein the bacterial premix represents microbiota of ageing human gut.
[0044] In an embodiment of the present disclosure, there is provided a method to identify anti-ageing effects of an ingredient, said method comprising: (a) obtaining a bacterial premix; (b) obtaining cells; (c) obtaining an ingredient; (d) contacting the bacterial premix, the cells, and the ingredient for a time-period in a range of 3-6 hours at a temperature in a range of 30℃- 40℃; (e) processing the cells of step (d) to obtain processed cells; and (f) evaluating gene expression of age-associated biomarkers of the processed cells to identify anti-ageing effects of the ingredient, wherein the bacterial premix comprises bacteria selected from the group consisting of Clostridium histolyticum having a concentration of 2 x 107 CFU/10ml, Bacteriodes thetathiomicron having a concentration of 1.5 x 107 CFU/10ml, Lactobacillus casei having a concentration of 2.2 x 107 CFU/10ml, Bifidobacterium lactis having a concentration in the range of 0.4 x 107 CFU/10ml, and combinations thereof, and wherein the bacterial premix represents microbiota of ageing human gut.
[0045] In an embodiment of the present disclosure, there is provided a method as described herein, wherein the cells are selected from a group consisting of human epithelial cells, human intestinal cells, human immune cells, and human skeletal cells.

[0046] In an embodiment of the present disclosure, there is provided a method as described herein, wherein the cells are human epithelial cells. In another embodiment of the present disclosure, the cells are human immune cells. In yet another embodiment of the present disclosure, the cells are human skeletal cells. [0047] In an embodiment of the present disclosure, there is provided a method to identify anti-ageing effects of an ingredient, said method comprising: (a) obtaining a bacterial premix; (b) obtaining cells; (c) obtaining an ingredient; (d) contacting the bacterial premix, the cells, and the ingredient for a time-period of 4 hours, at a temperature of 37℃; (e) processing the cells of step (d) to obtain processed cells; and (f) evaluating gene expression of age-associated biomarkers of the processed cells to identify anti-ageing effects of the ingredient.
[0048] In an embodiment of the present disclosure, there is provided a method to identify anti-ageing effects of an ingredient, said method comprising: (a) obtaining a bacterial premix; (b) obtaining cells; (c) obtaining an ingredient; (d) contacting the bacterial premix, the cells, and the ingredient for a time-period of 4 hours at a temperature of 37℃; (e) processing the cells of step (d) to obtain processed cells; and (f) evaluating gene expression of age-associated biomarkers of the processed cells to identify anti-ageing effects of the ingredient, wherein bacterial premix comprises bacteria selected from the group consisting of Clostridium histolyticum, Bacteriodes thetathiomicron, Lactobacillus casei, and Bifidobacterium lactis, and combinations thereof.
[0049] In an embodiment of the present disclosure, there is provided a method to identify anti-ageing effects of an ingredient, said method comprising: (a) obtaining a bacterial premix; (b) obtaining cells; (c) obtaining an ingredient; (d) contacting the bacterial premix, the cells, and the ingredient for a time-period of 4 hours, at a temperature of 37℃; (e) processing the cells of step (d) to obtain processed cells; and (f) evaluating gene expression of age-associated biomarkers of the processed cells to identify anti-ageing effects of the ingredient, wherein the bacterial premix comprises bacteria selected from the group consisting of Clostridium histolyticum having a concentration in a range of 1- 4 x 107 CFU/10ml, Bacteriodes thetathiomicron having a concentration in a range of 1.1- 4 x 107 CFU/10ml,

Lactobacillus casei having a concentration in a range of 0.5- 5 x 107 CFU/10ml, Bifidobacterium lactis having a concentration in a range of 0.2- 2 x 107 CFU/10ml, and combinations thereof.
[0050] In an embodiment of the present disclosure, there is provided a method to identify anti-ageing effects of an ingredient, said method comprising: (a) obtaining a bacterial premix; (b) obtaining cells; (c) obtaining an ingredient; (d) contacting the bacterial premix, the cells, and the ingredient for a time-period of 4 hours at a temperature of 37℃; (e) processing the cells of step (d) to obtain processed cells; and (f) evaluating gene expression of age-associated biomarkers of the processed cells to identify anti-ageing effects of the ingredient, wherein the bacterial premix comprises bacteria selected from the group consisting of Clostridium histolyticum having a concentration of 2 x 107 CFU/10ml, Bacteriodes thetathiomicron having a concentration of 1.5 x 107 CFU/10ml, Lactobacillus casei having a concentration of 2.2 x 107 CFU/10ml, Bifidobacterium lactis having a concentration in the range of 0.4 x 107 CFU/10ml, and combinations thereof.
[0051] In an embodiment of the present disclosure, there is provided a method as described herein, wherein said contacting is further carried out at 5% CO2 under anaerobic conditions.
[0052] In an embodiment of the present disclosure, there is provided a method as described herein, wherein said age-associated biomarkers are selected from the group consisting of SIRT-1, FGF-23, NRF, IL-6, IL-8, IL-10, and combinations thereof. In another embodiment of the present disclosure, said age-associated biomarkers are antioxidant related markers. In yet another embodiment of the present disclosure, said age-associated biomarkers are other immunomodulatory genes. In an alternate embodiment of the present disclosure, the antioxidant related marker is SOD, and other immunomodulatory genes are IL-8 and IL-10. [0053] In an embodiment of the present disclosure, there is provided a method as described herein, wherein said age-associated biomarker is SIRT-1. [0054] In an embodiment of the present disclosure, there is provided a method as described herein, wherein said age-associated biomarker is FGF-23.

[0055] In an embodiment of the present disclosure, there is provided a method as described herein, wherein processing the cells comprises a combination of trypsinisation and lysing.
[0056] Although the subject matter has been described in considerable detail with reference to certain examples and implementations thereof, other implementations are possible.
EXAMPLES
[0057] The disclosure will now be illustrated with working examples, which is intended to illustrate the working of disclosure and not intended to take restrictively to imply any limitations on the scope of the present disclosure. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which this disclosure belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice of the disclosed methods and compositions, the exemplary methods, devices and materials are described herein. It is to be understood that this disclosure is not limited to particular methods, and experimental conditions described, as such methods and conditions may apply. [0058] The examples as described herein asserts the importance of the disclosed process in identifying anti-ageing effects of an ingredient. The process has been validated by studying the expression of age-related biomarkers like SIRT-1 and FGF-23. Sirtinol and resveratrol have been used as antagonists and agonists of SIRT-1 expression.
Example 1
Preparation of bacterial premix
[0059] The microbe combinations (bacterial premix) used in the present disclosure have been depicted in Table 1. Table 1: Combination of bacterial premixes

[0060] It can be derived from Table 1, that the bacterial premix of the present disclosure comprises Clostridium histolyticum ATCC 19401, Bacteriodes thetathiomicrone ATCC 2914, Bifidobacterium lactis NCDC 229, and Lactobacillus casei NCDC-298. The bacterial premix was prepared in anaerobic soft agar in 12 well plate. Inoculation media was prepared without glucose (peptone, 10g/L; beef extract, 8g/L; yeast extract, 4g/L; dipotassium hydrogen phosphate, 2g/L; sodium acetate, 5g/L; tri ammonium citrate, 2g/L; magnesium sulphate, 0.2g/L; manganese sulphate, 0.05g/L, hemin, 0.001g/L; cysteine hydrochloride, 0.002g/L, mucin, 0.2g/L).
[0061] The three different combinations of the bacterial premixes were tested for the desired anti-ageing effects of an ingredient.
Example 2 Expression studies
[0062] SIRT-1 and FGF-23 are well established markers for ageing (Wellman et. al., 2017. Gastroenterology. 2017 Sep;153(3):772-786; Herranz et al., 2010. Nature Communications volume 1, Article number: 3 (2010) doi:10.1038; Razzaque et al., 2006. FASEB J. Apr;20(6):720-2.). Sirtuin 1 (SIRT1), a conserved mammalian NAD+-dependent protein deacetylase, senses environmental stress to alter intestinal integrity. Dysregulation of its expression with age is associated with age associated pathologies. FGF-23 plays a crucial role in the regulation of phosphate homeostasis and vitamin D metabolism. Since it has a critical role in mineral

metabolism, homozygous animals for the inserted transgene had a shorter life span and precociously developed pathologies related to ageing including osteoporosis (Kawaguchi et al., 1999. J Clin. Invest. 1999 Aug; 104(3):229-37).
[0063] Fourteen days post confluency caco-2 cells (P-46) were used for the experiment. The bacterial premix was grown in a media having a composition as described in the previous section. After 24 hours of anaerobic coculture (combinations), the agar inserts were added on top of caco-2 monolayer and incubated for 4 hours at 5% CO2 and 37°C (as depicted in Figure 1). After which Caco-2 cells were trypsinised and were used for evaluation of gene expression. Referring to Figure 1, label (1) depicts microbes in soft agar cultured overnight, and label (2) depicts caco-2 cells in 6-well plate.
[0064] Expression studies: The cells collected were washed with 0.1M phosphate buffer and harvested with Trizol reagent (Invitrogen) for isolation of RNA. The isolated RNA was checked for its integrity using conventional methods available to a person skilled in the art, following which the RNA was transcribed to prepare cDNA using ABI high capacity cDNA kit as per manufacturer’s instruction. Briefly 1µg of RNA was taken along with 2.5 µl of random hexamers and the volume was made to 15µl with nuclease free water. The sample was incubated at 65ºC for 5 min, following which 2.5µl of 25mM dNTPs, 2.5 µl of 10X RT buffer, 0.625µl of RNase inhibitor, 0.875 µl of RT enzyme and 3.5 µl of nuclease free water was added and incubated at a temperature in the range of 45-60°C to obtain cDNA. A person skilled in the art may vary the incubation temperature incubation according to experiment requirement. The cDNA prepared was used for evaluation of expression of genes by real time PCR with nucleotide sequence as set forth in SEQ ID NO: 1-4. cDNA of control and treatment samples were subjected to real time expression study by using SYBR green I mix (ABI system) along with respective primers. Using the protocols mentioned below. And expression was quantitated using ABI Prism 7500 Sequence Detection System (Applied Biosystems).
[0065] qPCR conditions: Initial denaturation at 95°C for 10 min was followed by 40 cycles of 95°C for 15s, the primer-specific annealing temperature at 60°C for

5s, and elongation at 72°C for 15s. Amplification using these primers resulted in a 130 bp fragment length respectively. At the end of each run melting curve profiles were produced by cooling the sample to 65°C for 15s and then heating slowly at 0.20°C/s to 95°C with continuous measurement of fluorescence to confirm amplification of specific transcripts. Amplification with GAPDH primers was used as internal control.
[0066] Resveratrol (10µM) and sirtinol (50µM) (procured from Sigma Aldrich) are well established agonists and antagonists of SIRT-1 gene respectively. [0067] Figure 2 depicts a graph representing fold change of SIRT-1 gene expression after treating caco-2 cells with the respective bacterial premixes in presence and absence of resveratrol and sirtinol. Resveratrol is known to exert an anti-ageing effect and displays an increase in SIRT-1 gene expression, on the other hand, sirtinol is known to exert an ageing effect and displays a decrease in SIRT-1 gene expression.
[0068] It can be appreciated from Figure2, that all the combinations display an increase in SIRT-1 expression in presence of resveratrol. Although the presence of sirtinol displays a decrease in SIRT-1 gene expression in case of all the combinations, but it can be observed that in case of combination 3 a significant decrease in SIRT-1 gene expression takes place. Therefore, it can be observed that in case of combination 3 although a significant modulation of SIRT-1 gene expression in presence of resveratrol is not seen but a drastic decrease of SIRT-1 gene expression in the presence of sirtinol is seen. Thus, the process as disclosed herein using the bacterial premix (combination 3) can be used to identify the anti-ageing effects of any ingredient. Whereas, significant effect is not observed in the presence of combinations 1 and 2 (Table 1).
Example 3
SIRT-1 gene expression using combination-3
[0069] As the combination 3 shows the best response in the presence of
ingredients, the present example depicts the effect of annatto and anthocyanin
(procured from Vinayak Ingredients, India) on SIRT-1 gene expression.

[0070] Figure 3 depicts the effect of annatto and anthocyanin on SIRT-1 gene expression. It can be observed that in the presence of anthocyanin and resveratrol a slight increase in SIRT-1 gene expression can be seen. Whereas, in the presence of annatto, a slight decrease in the presence of SIRT-1 gene expression can be observed. Therefore, it can be said that the compound anthocyanin is showing anti-ageing effect and annatto is not showing anti-ageing effect.
Advantages of the present disclosure
[0071] The present disclosure discloses a process for identifying the anti-ageing effects of an ingredient, which comprises incubating a bacterial premix with caco-2 cells in the presence of the ingredient. The cells are processed and further the ageing associated biomarkers are evaluated for the gene expression. The modulation in the gene expression of the respective markers depict the anti-ageing effects of the ingredient. The criticality lies in the bacterial premix used in the process herein which provides a perfect model for evaluating the anti-ageing effects of an ingredient. The process as described herein provides a simple method for studying the anti-ageing effects of an ingredient. As the gut microbiota is a new target for providing solution to ageing-related problems, there is a dire need to develop a process/model for studying anti-ageing effects of any ingredient. The present disclosure provides a simple and robust solution to this problem. Also, the process provides scope for screening different types of ingredient for their anti-ageing effects.

1. A method to identify anti-ageing effects of an ingredient, said method
comprising:
a) obtaining a bacterial premix;
b) obtaining cells;
c) obtaining an ingredient;
d) contacting the bacterial premix, the cells, and the ingredient for a
time-period in a range of 3-6 hours, at a temperature in a range of 30oC- 40oC;
e) processing the cells of step (d) to obtain processed cells; and
f) evaluating gene expression of age-associated biomarkers of the processed cells to identify anti-ageing effects of the ingredient.

2. The method as claimed in claim 1, wherein the bacterial premix comprises bacteria selected from the group consisting of Clostridium histolyticum, Bacteriodes thetathiomicron, Lactobacillus casei, Bifidobacterium lactis, and combinations thereof.
3. The method as claimed in claim 2, wherein the bacterial premix comprises bacteria selected from the group consisting of Clostridium histolyticum having a concentration in a range of 1- 4 x 107 CFU/10ml, Bacteriodes thetathiomicron having a concentration in a range of 1.1- 4 x 107 CFU/10ml, Lactobacillus casei having a concentration in a range of 0.5- 5 x 107 CFU/10ml, Bifidobacterium lactis having a concentration in a range of 0.2- 2 x 107 CFU/10ml, and combinations thereof.
4. The method as claimed in claim 2, wherein the bacterial premix comprises bacteria selected from the group consisting of Clostridium histolyticum having a concentration of 2 x 107 CFU/10ml, Bacteriodes thetathiomicron having a concentration of 1.5 x 107 CFU/10ml, Lactobacillus casei having a concentration of 2.2 x 107 CFU/10ml, Bifidobacterium lactis having a concentration in the range of 0.4 x 107 CFU/10ml, and combinations thereof.

5. The method as claimed in any one of the claims 1-4, wherein the bacterial premix represents microbiota of ageing human gut.
6. The method as claimed in claim 1, wherein the cells are selected from a group consisting of human epithelial cells, human intestinal cells, human immune cells, and human skeletal cells.
7. The method as claimed in claim 1, wherein contacting the bacterial premix, the cells, and the ingredient is for a time-period of 4 hours, at a temperature of 37oC.
8. The method as claimed in claim 7, wherein the contacting is further carried out at 5% CO2 under anaerobic conditions.
9. The method as claimed as claimed in claim 1, wherein the age-associated biomarkers are selected from the group consisting of SIRT-1 (Sirtuin), FGF-23 (Fibroblast growth factor), NRF (Nuclear factor erythroid-2 related factor), IL-6 (Interleukin-6), IL-8 (Interleukin-8), IL-10 (Interleukin-10), and combinations thereof.
10. The method as claimed in claim 9, wherein the age-associated biomarker is SIRT-1.
11. The method as claimed in claim 9, wherein the age-associated biomarker is FGF-23.