Sign In to Follow Application
View All Documents & Correspondence

Method For Electroeluting Genetic Material From Dried Samples

Abstract: In accordance with the present disclosure a method for extracting genetic material from a biological sample stored on a solid medium is provided. The method includes obtaining the solid medium wherein the biological sample is applied on the solid medium and the solid medium includes chemicals that lysed the biological sample and preserved the genetic material. The method also includes electroeluting the genetic material directly from the solid medium to a subsequent medium.

Get Free WhatsApp Updates!
Notices, Deadlines & Correspondence

Patent Information

Application #
Filing Date
22 May 2013
Publication Number
47/2014
Publication Type
INA
Invention Field
CHEMICAL
Status
Email
remfry-sagar@remfry.com
Parent Application
Patent Number
Legal Status
Grant Date
2020-09-21
Renewal Date

Applicants

GENERAL ELECTRIC COMPANY
1 River Road Schenectady New York 12345

Inventors

1. FINEHOUT Erin Jean
One Research Circle Niskayuna New York 12309
2. NELSON John Richard
One Research Circle Niskayuna New York 12309
3. SPOONER Patrick McCoy
One Research Circle Niskayuna New York 12309

Specification

METHOD FOR ELECTROELUTING GENETIC MATERIAL
FROM DRIED SAMPLES
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims priority to United States patent application number
12/972,236 filed 17 December 2010; the disclosure of which is incorporated herein by
reference in its entirety.
BACKGROUND OF THE INVENTION
[0002] The subject matter disclosed herein relates to a solid medium for use in the
storage of genetic material from biological samples and more particularly to methods
to electroelute genetic material from the biological samples directly from the solid
medium.
[0003] Various facilities (e.g., research or medical institutions) include storage
systems for large collections of genetic material (e.g., DNA) collected from a wide
range of sources (e.g., human blood, cell lines, etc.). The genetic material is stored in
a safe, convenient, and minimally labor intensive manner within these storage systems
for later analysis. For example, solid media, such as Whatman® FTA® substrates, are
used to store genetic material from various biological samples, such as tissues or cells.
However, extracting genetic material from the solid media involves additional labor,
sometimes intensive labor when dealing with numerous samples. For example,
extraction of genetic material may include either using detergents or incubating the
solid media at high temperatures. The detergent may interfere with analysis of the
genetic material, thus additional labor is required to remove the detergent. Also, the
higher temperatures may fragment the genetic material. Thus, there is a need to
reduce the work required to extract genetic material, while also minimizing the
fragmentation of the genetic material.BRIEF DESCRIPTION OF THE INVENTION
[0004] In a first embodiment, a method for extracting genetic material from a
biological sample stored on a solid medium is provided. The method includes
obtaining the solid medium, wherein the biological sample is applied on the solid
medium, and the solid medium includes chemicals that lyzed the biological sample
and preserved the genetic material. The method also includes electroeluting the
genetic material directly from the solid medium to a subsequent medium.
[0005] In a second embodiment, a method for extracting genetic material from a
fixed tissue sample stored on a solid medium is provided. The method includes
applying at least a portion of the fixed tissue sample to the solid medium, wherein the
solid medium includes chemicals that can lyse the cells or preserve the genetic
material. The method further includes electroeluting the genetic material directly
from the solid medium to a subsequent medium.
[0006] In a third embodiment, a method for extracting DNA from a biological
sample stored on a cellulose-based paper is provided. The method includes obtaining
the cellulose-based paper, wherein the biological sample is applied on the cellulose-
based paper, and the cellulose based paper includes chemicals that lyse the biological
sample and preserve the DNA. The method also includes electroeluting DNA directly
from the cellulose-based paper into an electrophoresis gel.
BRIEF DESCRIPTION OF THE DRAWINGS
[0007] These and other features, aspects, and advantages of the present invention
will become better understood when the following detailed description is read with
reference to the accompanying drawings in which like characters represent like parts
throughout the drawings, wherein:
[0008] FIG. 1 is a flow chart illustrating a method for extracting genetic material
from a biological sample stored on a solid medium in accordance with aspects of the
present disclosure;[0009] FIG. 2 depicts a SYBR® Gold stained electrophoresis gel of DNA
electroeluted from solid media using pulsed-field gel electrophoresis in accordance
with aspects of the present disclosure;
[0010] FIG. 3 depicts a SYBR® Gold stained electrophoresis gel of DNA
electroeluted from solid media using alkaline gel electrophoresis in accordance with
aspects of the present disclosure;
[0011] FIG. 4 is a flow chart illustrating a method for extracting genetic material
from a fixed tissue sample stored on a solid medium in accordance with aspects of the
present disclosure;
[0012] FIG. 5 depicts a SYBR® Gold stained electrophoresis gel, using a vertical
polyacrylamide gel electrophoresis (PAGE) system, of multiplex PCR amplification
of DNA that has been extracted from a human prostate sample fixed in formalin and
applied to Whatman® FTA®paper;
[0013] FIG. 6 depicts a SYBR® Gold stained electrophoresis gel of DNA
electroeluted from solid media using native gel electrophoresis in accordance with
aspects of the present disclosure;
[0014] FIG. 7 depicts a SYBR® Gold stained electrophoresis gel of DNA
electroeluted from solid media using native gel electrophoresis in accordance with
aspects of the present disclosure; and
[0015] FIG. 8 depicts a SYBR® Gold stained electrophoresis gel of DNA
electroeluted from solid media using native gel electrophoresis in accordance with
aspects of the present disclosure.
DETAILED DESCRIPTION OF THE INVENTION
[0016] As discussed in detail below, embodiments of the invention include a
method for extracting genetic material (e.g., DNA) directly from biological samples
stored on a solid medium (e.g., chemically treated cellulose substrate) using
electroelution. In one embodiment, the method includes obtaining the solid mediumthat includes a stored biological sample previously applied and dried on the solid
medium. The solid medium includes chemicals that lyse the biological sample and
preserve the genetic material. The method also includes electroeluting the genetic
material directly from the solid medium to a subsequent medium after removing the
chemicals from the solid medium. The subsequent medium may include an
electrophoresis gel, a solution, or a capture surface (e.g., a blotting membrane).
Alternatively, fixed samples of cells or tissues may be applied to the solid medium.
The fixed samples may be processed prior to or after application to the solid medium.
For example, processing of the fixed samples may include rehydrating and/or lyzing
the fixed sample. Whether fixed or not, the samples may be further processed
subsequent to application to the solid medium. In particular, repair of nicks and
abasic sites within the genetic material may occur, while the genetic material is in a
fixed position on the solid medium. The methods above provide a single platform for
lyzing a biological sample, extracting DNA from the biological sample, binding the
DNA to a surface, washing the DNA, and eluting high molecular weight (e.g., at least
10 kilobases) as wells as less fragmented DNA. The ability to directly electroelute
the genetic material from the solid medium avoids the use of detergents normally used
to extract DNA as well as the extra steps necessary to remove the detergent and make
the DNA usable for subsequent analysis. In addition, directly electroeluting the
genetic material from the solid medium without using high temperatures reduces the
fragmentation of DNA. Prior to this invention, researchers have had to insert the solid
medium on which the DNA is located directly into subsequent genetic analysis
reactions (e.g. PCR) to analyze the DNA that is bound on the solid medium. It can be
appreciated that elution of DNA from the solid medium allows for the evaluation of
the genetic material in more than just one reaction. Overall, the disclosed
embodiments reduce the work of the user in extracting the DNA from the solid
medium while improving the quality and availability of the DNA.
[0017] Biological samples used in the embodiments below may include
physiological/pathological body liquids (e.g., secretions, excretions, exudates, and
transudates) or cell suspensions (e.g., blood, lymph, synovial fluid, semen, saliva
containing buccal cells, skin scrapings, hair root cells, etc.), liquid extracts orhomogenates of cell suspensions of humans and animals; physiological/pathological
liquids or cell suspensions of plants; liquid products, extracts or suspensions of
bacteria, fungi, plasmids, viruses, etc.; liquid products, extracts, or suspensions of
parasites including helminths, protozoas, spirochetes, etc.; human or animal body
tissues (e.g., bone, liver kidney, etc.); media from DNA or RNA synthesis; mixtures
of chemically or biochemically synthesized DNA or RNA; and any other source in
which DNA and/or RNA is or can be in a liquid medium.
[0018] Turning now to the figures, FIG. 1 is a flow chart illustrating an
embodiment of a method 10 for extracting genetic material (e.g., DNA) from a
biological sample (e.g., tissues, cells, viruses, bacteriophages, or any other sample
containing nucleic acid) stored on a solid medium. Processing of the biological
sample (block 12) may occur prior to application of the biological sample to the solid
medium. For example, in certain embodiments as described in greater detail below,
biological samples including cells or tissues may be fixed (e.g., in formalin).
Processing of the fixed tissue or cells may include rehydrating the fixed cells or
tissues, lyzing the cells or tissues (e.g., with protease), and/or reversing cross-linking
between the genetic material (e.g., DNA) and proteins. In certain embodiments, some
of the processing, such as reversing cross-linking, may occur subsequent to
application of the fixed cells or tissues to the solid medium.
[0019] Application of the desired biological sample to the solid medium then
occurs (block 14). In one embodiment, the solid medium includes a chemically
treated absorbent cellulose-based material. For example, the solid medium may
include Whatman® FTA® or FTA® Elute paper (GE Healthcare). The solid medium
includes chemicals that lyze the biological sample (e.g., tissues or cells) and/or
preserve the genetic material on the solid medium. Indeed, the solid medium and
composition of chemicals may be as described in greater detail in U.S. Patent No.
5,976,572, entitled "Dry Solid Medium for Storage and Analysis of Genetic
Material," and U.S. Patent No. 5,985,327, entitled "Solid Medium and Method for
DNA Storage," both of which are hereby incorporated by reference in their entirety
for all purposes. For example, the solid medium may include a weak base (e.g., tris-
hydroxymethyl methane (tris)), chelating agent (e.g., ethylene diamine tetracetic acid(EDTA)), anionic surfactant or detergent (e.g., sodium dodecyl sulphate (SDS)),
and/or uric acid or urate salt. Upon application to the solid medium, the chemicals
lyse the biological sample and denature proteins. In addition, the chemicals inactivate
nucleases and pathogens to allow for the preservation and long term storage of the
genetic material. Any liquid within the applied sample evaporates after application.
Drying of the sample on the solid medium (block 16) occurs after application. For
example, the solid medium containing the sample may dry overnight in a desiccator.
In certain embodiments, the solid medium containing the sample may be encased in a
protective material (e.g., a plastic case) to further preserve the genetic material.
[0020] Upon obtaining the solid medium containing the desired dry sample, a
portion of the solid medium containing the sample is removed for electroeluting the
genetic material (e.g., DNA) from this portion (block 18). In certain embodiments,
the entire sample may be used. Prior to electroelution, the portion of the solid
medium containing the biological sample may be rinsed to remove the chemicals
(block 20). In certain embodiments, rinsing the portion of the sample-containing solid
medium includes soaking the solid medium portion in a buffer solution or flowing
buffer through or across the solid medium portion. In certain embodiments, the buffer
solution includes an alkaline buffer solution (e.g., pH 8.0) including at least tris and
EDTA (e.g., T.E.). For example, the solid medium portion with the sample may be
soaked one or more times for a fixed time (e.g., 5 minutes) in the alkaline buffer
solution. In some embodiments, the buffer solution includes Whatman® FTA®
purification reagent from GE Healthcare. For example, the solid medium portion with
the sample may be soaked one or more times for a fixed time (e.g., 5 minutes) in the
FTA® purification reagent. In other embodiments, both the alkaline buffer solution
and the FTA® purification reagent may be used to rinse the sample-containing solid
medium portion. For example, the sample-containing solid medium portion may be
soaked for a fixed time (e.g., 5 minutes each soaking) twice in the alkaline buffer
solution and for a fixed time (e.g., 5 minutes each soaking) twice in the FTA®
purification reagent. In alternative embodiments, rinsing the portion of the sample-
containing solid medium includes soaking the solid medium portion in water or
flowing water through or across the solid medium portion. For example, the solidmedium portion with the sample may be soaked one or more times for a fixed time
(e.g., 5 minutes) in the water. In certain implementations of electroelution (e.g.,
electroelution in dialysis tubing), rinsing of the sample-containing solid medium may
not be necessary.
[0021] Also, prior to electroeluting genetic material from the sample-containing
solid medium portion, the solid medium portion with the sample may be treated with
enzymes (block 22) to reduce or eliminate non-DNA contaminants (e.g., proteins,
lipids, carbohydrates, etc.). For example, an enzymatic solution may include
hydrolytic enzymes such as proteases, lipases, and/or glycoside hydrolases.
[0022] Further, prior to electroeluting genetic material from the sample-containing
solid medium portion, the genetic material (e.g., DNA) may be repaired while fixed in
position on the solid medium (block 24). Genetic material, such as DNA, stored on
the solid medium may include nicks (i.e., absence of phosphodiester bond between
adjacent nucleotides) or abasic sites (also called AP sites, i.e., absence of a purine or
pyrimidine base in a nucleotide while retaining the integrity of the phosphodiester
ribose backbone) introduced via a fixing agent (e.g., formalin) in pre-processed
samples or via other means. In certain embodiments, repairing the genetic material
includes applying a solution containing at least DNA polymerase (e.g., E. coli DNA
polymerase I) and DNA ligase (e.g., T4 DNA ligase or a bacterial DNA ligase) to
repair the nicked damage. For example, the DNA polymerase includes DNA
polymerase activity in addition to both 3' to 5' exonuclease activity to mediate
proofreading and 5' to 3' exonuclease activity to mediate nick translation during DNA
repair. DNA polymerase requires dNTP's. The DNA ligase includes enzymatic
activity to form a phosphodiester bond between adjacent nucleotides. DNA ligase
requires either rATP or NAD. The sample-containing solid medium portion may be
incubated with the DNA repair solution at 37°C for 30 minutes, and then incubated at
65°C for 20 minutes. In other embodiments, the DNA repair solution may include
other DNA repair enzymes with similar or different DNA repair mechanisms. For
example, AP endonuclease (e.g., E. coli endonuclease IV) can also be used to remove
abasic sites. The abasic site can be cleaved by an AP endonuclease, leaving 3'hydroxyl and 5' deoxyribosephosphate termini. This structure can be subsequently
repaired by the combined action of DNA polymerase and DNA ligase.
[0023] After obtaining the sample-containing solid medium, the genetic material is
directly electroeluted from the solid medium to a subsequent medium (block 26). In
certain embodiments, the sample-containing solid medium portion may be disposed
directly into a well of an electrophoresis gel (e.g., agarose gel), the well sealed with
agarose, and the genetic material directly electroeluted into the electrophoresis gel
(FIGS. 2 and 3). In other embodiments, the genetic material may be electroeluted into
a solution. Electroelution into a solution may occur in a variety of ways. For
example, D-tube™ dialyzers (Merck Biosciences Ltd.), dialysis cassettes or tubing,
Whatman® Elutrap® Electroelution Systems (GE Healthcare), or other devices may be
used to electroelute the genetic material directly from the solid medium into solution.
In further embodiments, the genetic material may be directly electroeluted from the
solid medium onto a capture surface. The capture surface may be on a blotting
membrane (e.g., diethylaminoethyl cellulose (DEAE)).
[0024] Following electroelution, the extracted genetic material may be analyzed
(block 28). The genetic material extracted from the sample-containing solid medium
includes high molecular weight DNA optimally of at least 10 kilobases with few nicks
present. Indeed, the DNA extracted in accordance with the present approaches may
approach 40 kilobases. In particular, DNA extraction, according to the above
embodiment, occurs in the absence of detergents. If detergent were used in extracting
the DNA from the solid medium, additional steps would typically be performed to
remove the detergent before any subsequent analysis of the extracted DNA could
occur. In addition, the extraction of DNA at high temperatures (e.g., 95°C), which
fragments DNA, is avoided in the above embodiment. Thus, high molecular weight
DNA with minimal fragmentation is made available for analysis with minimal work.
The extracted DNA may be used in a variety of analyses including polymerase chain
reaction (PCR), single-nucleotide polymorphism analysis, real-time PCR, and other
downstream uses of the DNA.[0025] FIGS. 2 and 3 illustrate examples of the electroelution of DNA directly
from the sample-containing solid medium into electrophoresis gels. FIG. 2 depicts a
SYBR® Gold (Invitrogen) stained electrophoresis gel of DNA electroeluted from solid
media using pulsed-field gel electrophoresis. Electrophoresis was in a 1% agarose
gel, 0.5X TE, ph 8.0 for 18 hours at 6 V/cm with a switch angle of 120° and switch
time from 50-90 seconds. 20 Ε of Jurkat cells (suspended at 2 x 106 cells/mL) were
applied to either Whatman® FTA® or FTA® Elute paper and dried as described above.
Portions of the dried samples of Jurkat cells were removed from the FTA® or FTA®
Elute paper and washed according to a variety of methods indicated below. In
addition, some of the samples were eluted, prior to loading, into 95°C water. Wet
paper portions including the samples of Jurkat cells were placed directly into the wells
of the electrophoresis gel and sealed with agarose. The samples electroeleuted into
the electrophoresis gel, shown in FIG. 2, are as follows:
[0026] Lane 1: Saccharomyces cerevisiae chromosomal DNA size marker
(BioRad); Lane 3 : FTA® paper soaked for 5 minutes in TE, ph 8.0; Lane 5 : FTA®
paper soaked for 5 minutes in FTA® purification reagent (two times) and soaked for 5
minutes in TE buffer, ph 8.0 (two times); Lane 7 : FTA® Elute paper soaked in water
for 5 minutes; Lane 9 : FTA® Elute paper soaked in water for 5 minutes, then vortexed
for 15 seconds; Lane 11: FTA® Elute paper soaked in water for 5 minutes, then eluted
into 95°C water for 25 minutes; Lane 12: FTA® Elute paper soaked in water for 5
minutes, then eluted into 95°C water for 25 minutes, and vortexed for 60 seconds; and
Lane 14: Saccharomyces cerevisiae chromosomal DNA size marker (BioRad). After
pulsed-field gel electrophoresis, the DNA was stained with SYBR® Gold and the gel
was imaged on a Typhoon™ Imager fluorescent scanner.
[0027] The results in FIG. 2 demonstrate the electroelution of high molecular
weight DNA from the samples of Jurkat cells directly from the solid medium (i.e.,
FTA® or FTA® Elute paper) into the electrophoresis gel. The electroeluted DNA is
less than 225 kilobases but estimated to be approximately 40 kilobases. FIG. 2 also
demonstrates the absence of high molecular weight DNA when attempting to elute the
DNA under high temperature conditions (e.g., 95°C). Thus, in order to electroelute
high molecular weight DNA from the solid medium directly into the electrophoresisgel only a simple rinse in a buffer solution (e.g., TE buffer or FTA purification
reagent) or water is needed.
[0028] FIG. 3 illustrates similar results using alkaline gel electrophoresis. FIG. 3
depicts a SYBR® Gold stained electrophoresis gel of DNA electroeluted from solid
media using alkaline standard gel electrophoresis. Electrophoresis was in a 1%
agarose gel, 30mM NaOH, 1 mM EDTA, for 2 hours at 150mA. During
electrophoresis the gel was covered in a glass plate to prevent diffusion out of the gel.
As above, 20 Ε of Jurkat cells (suspended at 2 x 106 cells/mL) were applied to
Whatman® FTA® paper and dried as described above. Portions of the dried samples
of Jurkat cells were removed from the FTA® paper and washed according to a variety
of methods indicated below. Wet paper portions including the samples of Jurkat cells
were placed directly into the wells of the electrophoresis gel and sealed with agarose.
The samples electroeleuted into the electrophoresis gel, shown in FIG. 3, with lanes 1-
8 are as follows:
[0029] Lane 1: FTA® paper soaked for 5 minutes in TE, ph 8.0; Lane 3 : FTA®
paper soaked for 5 minutes in FTA® purification reagent (two times) and soaked for 5
minutes in TE buffer, ph 8.0 (two times); Lane 5 : purified human DNA (Male,
Applied Biosystems); and Lane 7 : 1 kb ladder (New England Biolabs). After
electrophoresis, the gel was neutralized in a solution containing 1M Tris-HCL
(pH=7.7) and 1.5M NaCl for 30 minutes. The DNA was stained with SYBR® Gold
and the gel was imaged on a Typhoon™ Imager fluorescent scanner.
[0030] The results in FIG. 3 also demonstrate the electroelution of high molecular
weight DNA from the samples of Jurkat cells directly from the solid medium (i.e.,
FTA® or FTA® Elute paper) into the electrophoresis gel. The electroeluted DNA is
greater than 10 kilobases. Thus, as above, in order to electroelute high molecular
weight DNA from the solid medium directly into the electrophoresis gel only a simple
rinse in a buffer solution (e.g., TE buffer or FTA® purification reagent) or water is
needed. The fact that the large DNA is also present on an alkaline gel indicates that
the electroeluted DNA contains few nicks. As the DNA in an alkaline gel is single
stranded, any nicks in the backbone would result in DNA fragments.[0031] As discussed above, the electroelution of DNA directly from the solid
medium also applies to fixed cells or tissues. FIG. 4 is a flow chart illustrating a
method 30 for extracting genetic material (e.g., DNA) from a fixed tissue sample
stored on a solid medium. Although the method 30 is discussed in terms of fixed
tissues samples, the fixed samples may also include fixed cells (e.g., derived from
tissues or cell culture lines). To begin, tissue is collected from a source (e.g., a mouse
or human) (block 32). Following collection of the tissue, the tissue sample is fixed
with a fixing agent (block 34) such as formalin, paraformaldehyde, or other fixing
agent, according to methods know to the art. During fixation, the genetic material
(e.g., DNA) forms cross-links with proteins. In certain embodiments, such as the
embedding of the fixed tissue sample in paraffin, the fixed tissue samples may be
dehydrated (block 36) in a series of ethanol washes with the ethanol sequentially
increasing in concentration. The dehydrated samples may then be washed in xylene
and embedded in paraffin.
[0032] After obtaining the desired fixed tissue sample, if the sample was
previously dehydrated, then the sample is rehydrated (block 38) in a series of ethanol
washes sequentially decreasing in concentration. For example, the fixed tissue
sample is rehydrated sequentially for 5 minutes each in 100% ethanol, 75% ethanol,
50% ethanol, 25% ethanol, and distilled water (or T.E.). Following rehydration of the
fixed tissue sample, the rehydrated sample may be incubated overnight in 1 M
potassium thiocyanate. The fixed tissue sample, rehydrated or not, may be lyzed
(block 40), e.g., with a protease, prior to application to the solid medium. For
example the fixed tissue sample may be lyzed in a digest buffer solution including
Proteinase K (0.5 mg/mL), 50 mM Tris at pH 7.4, 10 mM EDTA, 0.5% SDS, and 50
mM NaCl at 55°C for at least three hours. In certain embodiments, the fixed tissue
sample may be lysed via chemicals present on the solid medium as described above.
[0033] Application of at least a portion of the desired fixed tissue sample to the
solid medium then occurs (block 42). The sample of fixed is applied to the solid
medium via such methods as rubbing the sample against the media, pressing the
sample against the media, etc. The solid medium is as described above. The solid
medium includes chemicals to preserve the genetic material on the solid medium. Incertain embodiments, where lyzing of the fixed tissue is desired subsequent to
application of the sample, the solid medium includes chemicals that lyze the fixed
tissue sample as described above. Any liquid within the applied tissue sample
evaporates after application. Drying of the sample on the solid medium (block 44)
occurs after application. For example, the solid medium containing the sample may
dry overnight in a desiccator. In certain embodiments, the solid medium containing
the sample may be encased in a protective material (e.g., a plastic film) to further
preserve the genetic material.
[0034] Upon obtaining the solid medium containing the desired dry, fixed tissue
sample, a portion of the solid medium containing the sample is removed for
electroeluting the genetic material (e.g., DNA) from this portion. In certain
embodiments, the entire sample may be used. Prior to electroelution, the portion of
the solid medium containing the sample may be rinsed to remove the chemicals
(block 46). In certain embodiments, rinsing the portion of the sample-containing solid
medium includes soaking the solid medium portion in a buffer solution. As described
above, the buffer solution may include an alkaline buffer solution (e.g., TE) or FTA®
purification reagent. For example, the sample-containing solid medium portion may
be soaked for a fixed time (e.g., 5 minutes each soaking) twice in the FTA®
purification reagent and for a fixed time (e.g., 5 minutes each soaking) twice in the
alkaline buffer solution. However, in certain embodiments, the rinses may occur
only in the alkaline buffer solution, only in the FTA® purification reagent, or only in
water as described above. As previously mentioned, in certain embodiments of
electroelution (e.g., electroelution in dialysis tubing), rinsing of the sample-containing
solid medium may not be necessary.
[0035] As mentioned above, prior to electroeluting genetic material from the
sample-containing solid medium portion, the solid medium portion with the fixed
sample may be treated with enzymes (block 48) to reduce or eliminate non-DNA
contaminants (e.g., proteins, lipids, carbohydrates, etc.). For example, an enzymatic
solution may include hydrolytic enzymes such as proteases, lipases, and/or glycoside
hydrolases.[0036] In addition, prior to electroeluting, the cross-linking between the genetic
material and protein may be reversed (block 50) subsequent to applying the fixed
tissue sample to the solid medium. For example, a crosslink repair buffer including a
primary amine (e.g., bicine, pH 8.5) or other nucleophile with a pH higher than 7.0
(preferably with a pH between 7.5-10). To reverse the cross-links, the sample-
containing solid medium portion is incubated in the crosslink repair buffer (e.g. at
65°C for 20 hours). The primary amine or nucleophile reacts with the portion of the
crosslink that comes from the aldehyde that originally formed the cross-links
(between the genetic material and/or the protein) and reverses these cross-links.
Alternatively, a sulfhydryl reagent can be used in place of amine, which will also
react with the portion of the crosslink that is derived from the aldehyde. This reaction
occurs more rapidly than amine-based nucleophile when performed at a pH below 7.
In certain embodiments, as mentioned above, the reversal of the cross-linking may
occur prior to application of the fixed tissue sample to the solid medium. Further,
prior to electroeluting genetic material from the sample-containing solid medium
portion, the genetic material (e.g., DNA) may be repaired while fixed in position on
the solid medium (block 52) as described above.
[0037] After obtaining the solid medium portion with the fixed tissue sample, the
genetic material is directly electroeluted from the solid medium to a subsequent
medium (block 54) as described above to obtain high molecular weight DNA of at
least 10 kilobases. The extracted genetic material may then be analyzed (block 56) in
a variety of ways (e.g., PCR) as demonstrated in FIG. 5.
[0038] FIG. 5 illustrates the quality of the DNA extracted from formalin-fixed
tissue samples on solid media following crosslink reversal and DNA repair as
described above. FIG. 5 depicts a SYBR® Gold stained electrophoresis gel, using a
vertical polyacrylamide gel electrophoresis (PAGE) system, of multiplex PCR
amplification of DNA that has been extracted from a human prostate sample fixed in
formalin and applied to Whatman® FTA® paper as described above. Electrophoresis
was in a 6% TBE (Tris-Borate-EDTA)-UREA gel and IX TBE for 40 minutes at
160V. The fixed human prostate sample was processed as described above (e.g.,
rehydrated or lysed) and applied to the FTA® paper. The samples on the FTA® paperwere then subjected to crosslink reversal and/or DNA repair (with or without
endonuclease IV (Endo IV)). After crosslink reversal and/or DNA repair, the solid
media is added directly to a PCR reaction containing 3 sets of PCR primers. The
sequences of the primers are as follows: 5' CTCACCCTGAAGTTCTCAGG 3'
(primer 1), 5' CCTCAAGGGCACCTTTGCCA 3' (primer 2), 5'
GTCTACCCTTGGACCCAG 3' (primer 3), and 5' GATGAAGTTGGTGGTGAGG
3' (primer 4). The PCR primers are designed to produce products of 78 base pairs
(primers 1 and 2), 218 base pairs (primers 1 and 3), and 380 base pairs (primers 1 and
4) if high molecular weight human DNA is present. Amplification conditions were as
follows: step 1: 95°C for 7 minutes; step 2 (for 15 cycles): 95°C for 1minute, 69°C for
1 minute, and 72°C for 1 minute; step 3 (for 15 cycles): 95°C for 1 minute, 63°C for 1
minute, and 72°C for 1minute; step 4 : 72°C for 10 minutes; and then step 5 : 4°C. The
samples shown in FIG. 5 are as follows:
[0039] Lane 1: low molecular weight DNA ladder (New England Biolabs); Lane 3 :
purified human DNA (Male, Applied Biosystems); Lane 4 : no DNA control; Lane 5 :
purified human DNA treated with repair reaction (without Endo IV); Lane 6 : purified
human DNA treated with repair reaction (with Endo IV); Lane 8 : formalin-fixed
human prostate sample on FTA® paper with crosslink reversal and repair reactions
(without Endo IV); Lane 9 : formalin-fixed human prostate sample on FTA® paper
with repair reaction only (with Endo IV); Lane 10: formalin-fixed human prostate
sample on FTA® paper with crosslink reversal and repair reactions (with Endo IV);
Lane 11: formalin-fixed human prostate sample on FTA® paper with repair reaction
only (with Endo IV); Lane 12: formalin-fixed human prostate sample on FTA® paper
with crosslink reversal reaction only; Lane 13: formalin-fixed human prostate sample
on FTA® paper without crosslink reversal and repair reactions; and Lane 15: low
molecular weight DNA ladder. After PAGE gel electrophoresis, the DNA was
stained with SYBR® Gold and the gel was imaged on a Typhoon™ Imager
fluorescent scanner.
[0040] The results in FIG. 5 demonstrate the appearance of the higher molecular
weight PCR products (218 base pairs and 380 base pairs) when the sample on the
FTA® paper has been treated to reverse cross-links and to repair DNA (Lane 10) asdescribed above. All other combinations of treatment fail to produce these higher
molecular weight PCR products. While the DNA in this experiment has not been
eluted from the FTA® paper prior to PCR, it can be appreciated that if the repaired
sample still located on the FTA® paper can be used for PCR amplification of higher
molecular weight targets, this result in combination with the ability to elute DNA
from FTA® paper would allow for a greater range of DNA interrogation experiments
to be performed on such samples.
[0041] FIGS. 6 and 7 illustrate the benefit of rehydrating fixed samples prior to
electroelution from the FTA paper. FIGS. 6 and 7 depict a SYBR® Gold stained
electrophoresis gel of DNA electroeluted from solid media using native gel
electrophoresis. Electrophoresis was in a 0.8% agarose TBE gel for 80 minutes at 110
volts. The samples shown in FIG. 6 are as follows: Lane 1: 1 kb DNA ladder (New
England Biolabs); Lane 2 : 0.5 mm slice of formalin-fixed human prostate sample
applied directly to FTA® paper, dried, and rinsed in water and electroeluted; Lane 3 :
20 µ of Jurkat cells (suspended at 2 x 106 cells/mL) were applied to FTA® paper,
dried, and electroeluted; and Lane 4 : purified human DNA (Male, Applied
Biosystems). The electroeluted samples shown in FIG. 7 are as follows: Lane 1:
purified human DNA (Male, Applied Biosystems); Lane 2 : 20 µ of Jurkat cells
(suspended at 2 x 106 cells/mL) were applied to FTA® paper, and dried; Lane 3 : an
approximately 0.5 mm slice of formalin-fixed human prostate sample was rehydrated
as described above and applied to FTA® paper, dried, and rinsed in water; and Lane 4 :
approximately 0.5 mm of formalin-fixed human prostate sample was scraped off the
paraffin block as a series of flakes, then rehydrated as described above, applied to
FTA® paper, dried, and rinsed in water. After TBE-gel electrophoresis, the DNA was
stained with SYBR® Gold and the gel was imaged on a Typhoon™ Imager
fluorescent scanner.
[0042] The results in FIGS. 6 and 7, in particular a comparison between lane 2 of
FIG. 6 and lanes 3 and 4 of FIG. 7, clearly indicate that the rehydration process aids in
the retrieval of DNA from fixed samples. The inclusion of steps to rehydrate tissue
samples that have been dehydrated in preparation for fixation and for paraffinembedding increases the yield of genetic material from the fixed sample upon
electroelution.
[0043] FIG. 8 illustrates the effect of DNA repair on the molecular weight of DNA
obtained from fixed samples that have been electroeluted from FTA paper. FIG. 8
depicts a SYBR® Gold stained electrophoresis gel of DNA electroeluted from solid
media using native gel electrophoresis. Electrophoresis was in a 0.8% agarose TBE
gel for 80 minutes at 110 volts. Samples from formalin-fixed human lung (ILS
19279-A04) were applied to FTA® paper as described above. Cross-links were
repaired in 100 mM bicine pH 9.5 and/or treated with a DNA repair reaction in certain
samples as described above. The samples were stopped at different stages of the
reactions. The samples shown in FIG. 8 are as follows:
[0044] Lane 1: 1 kb DNA ladder (New England Biolabs); Lane 2 : post rehydration
(i.e., ethanol and T.E. washes); Lane 3 : post FTA® purification reagent washes; Lane
4 : post Proteinase K digestion; Lane 5 : post crosslink reversal reaction conducted at
65°C; Lane 6 : post crosslink reversal reaction conducted at room temperature; Lane 7 :
post DNA precipitation (plus crosslink reversal reaction conducted at 65°C); Lane 8 :
post DNA precipitation (plus crosslink reversal reaction conducted at room
temperature); Lane 9 : post DNA repair reaction (plus crosslink reversal reaction
conducted at 65°C); and Lane 10: post DNA repair reaction (plus crosslink reversal
reaction conducted at room temperature).
[0045] The results in FIG. 8 demonstrate the appearance of high molecular weight
material in lanes 9 and 10 (indicated by the arrow) only after the DNA repair reaction
has been used to repair the DNA that is still attached to the FTA®paper. The DNA is
repaired while it is still attached to the FTA® paper, before the DNA has been
subjected to the forces involved in elution of the DNA from the FTA® paper and the
forces that are applied to DNA in solution. This prevents strands of DNA which
contain nicks that are located relatively near each other, but on opposite sides, from
separating. By repairing these highly nicked and gapped strands, they are prevented
from becoming double stranded breaks, and the resulting product is higher molecularweight DNA. The increase in molecular weight provides evidence that the DNA
repair reaction was able to repair nicks and gaps in the DNA.
[0046] Technical effects of the disclosed embodiments include extracting genetic
material (e.g., high molecular weight DNA of at least 10 kilobases) directly from the
solid medium via electroelution. The extraction of genetic material occurs in the
absence of detergent, thus eliminating additional steps necessary for the removal of
detergent prior to any subsequent analysis of the genetic material. Also, the
extraction of genetic material avoids the use of high temperatures (e.g., 95°C), thus
allowing the extraction of minimally fragmented DNA. The extraction of genetic
material, via electroelution directly from the solid medium, applies to both fixed and
non-fixed samples. Further, the genetic material may be processed while still on the
solid medium. For example, genetic material may be repaired and/or cross-links
reversed in fixed cells between the genetic material and protein. Thus, the solid
medium provides a single platform for the extraction of genetic material and related
processes (e.g., DNA repair) minimizing the work for the user.
[0047] This written description uses examples to disclose the invention, including
the best mode, and also to enable any person skilled in the art to practice the
invention, including making and using any devices or systems and performing any
incorporated methods. The patentable scope of the invention is defined by the claims,
and may include other examples that occur to those skilled in the art. Such other
examples are intended to be within the scope of the claims if they have structural
elements that do not differ from the literal language of the claims, or if they include
equivalent structural elements with insubstantial differences from the literal languages
of the claims.CLAIMS:
1. A method for extracting genetic material from a biological sample
stored on a solid medium, comprising:
obtaining the solid medium, wherein the biological sample is applied on the
solid medium, and the solid medium comprises chemicals that lyse the biological
sample and preserve the genetic material; and
electroeluting the genetic material directly from the solid medium to a
subsequent medium.
2. The method of claim 1, wherein the solid medium comprises a
cellulose-based material.
3. The method of claim 1, comprising rinsing the solid medium prior to
electroelution.
4. The method of claim 3, wherein rinsing the solid medium comprises
soaking the solid medium in buffer or flowing buffer through or across the solid
medium.
5. The method of claim 3, wherein rinsing the solid medium comprises
soaking the solid medium in water or flowing water through or across the solid
medium.
6. The method of claim 3, further comprising repairing the genetic
material prior to electroelution.
7. The method of claim 6, wherein repairing the genetic material
comprises applying a solution containing at least DNA polymerase and DNA ligase.8. The method of claim 7, wherein the DNA polymerase comprises DNA
polymerase activity, 3' to 5' exonuclease activity for proofreading, and 5' to 3'
exonuclease activity for nick translation.
9. The method of claim 6, wherein repairing the genetic material
comprises applying a solution containing at least an endonuclease that nicks DNA
adjacent to abasic sites.
10. The method of claim 1, wherein the biological sample comprises fixed
cells.
11. The method of claim 10, comprising processing the fixed cells prior to
electroelution from the solid medium, wherein processing comprises rehydrating the
fixed cells, treating the fixed cells with protease, or reversing cross-linking.
12. The method of claim 1, wherein the subsequent medium comprises an
electrophoresis gel, a solution, or a capture surface.
13. A method for extracting genetic material from a fixed tissue sample
stored on a solid medium, comprising:
applying at least a portion of the fixed tissue sample to the solid medium,
wherein the solid medium comprises chemicals that can lyse the tissue sample or
preserve the genetic material; and
electroeluting the genetic material directly from the solid medium to a
subsequent medium.
14. The method of claim 13, wherein the solid medium comprises a
cellulose-based paper.
15. The method of claim 13, wherein the solid medium comprises FTA
paper.16. The method of claim 13, comprising treating the fixed tissue sample
with protease prior to or after applying the fixed tissue sample to the solid medium.
17. The method of claim 13, wherein the solid medium comprises
chemicals that lyse the fixed tissue sample.
18. The method of claim 13, comprising rehydrating the fixed tissue
sample prior to applying the fixed tissue sample to the solid medium.
19. The method of claim 18, comprising reversing cross-linking between
the genetic material and protein prior to or subsequent to applying the fixed tissue
sample to the solid medium.
20. The method of claim 19, wherein reversing cross-linking comprises
applying crosslink repair buffer comprising a nucleophile with a pH other than 7.0.
21. The method of claim 14, comprising repairing the genetic material
prior to electroelution.
22. The method of claim 21, wherein repairing the genetic material
comprises applying a solution containing at least DNA polymerase I and DNA ligase.
23. The method of claim 21, wherein repairing the genetic material
comprises applying a solution containing at least an endonuclease that nicks DNA
adjacent to abasic sites.
24. The method of claim 13, wherein the subsequent medium comprises an
electrophoresis gel, a solution, or a capture surface.25. A method for extracting DNA from a biological sample stored on a
cellulose-based paper, comprising:
obtaining the cellulose-based paper, wherein the biological sample is applied
on the cellulose-based paper, and the cellulose-based paper comprises chemicals that
lyse the biological sample and preserve the DNA;
repairing the DNA on the cellulose-based paper; and
electroeluting DNA directly from the cellulose-based paper into an
electrophoresis gel.

Documents

Application Documents

# Name Date
1 4526-DELNP-2013-RELEVANT DOCUMENTS [01-08-2023(online)].pdf 2023-08-01
1 4526-DELNP-2013.pdf 2013-06-07
2 4526-delnp-2013-Correspondence-Others-(24-06-2013).pdf 2013-06-24
2 4526-DELNP-2013-RELEVANT DOCUMENTS [17-09-2022(online)].pdf 2022-09-17
3 4526-delnp-2013-Assignment-(24-06-2013).pdf 2013-06-24
3 4526-DELNP-2013-ASSIGNMENT WITH VERIFIED COPY [13-10-2020(online)]-1.pdf 2020-10-13
4 4526-delnp-2013-GPA.pdf 2014-01-03
4 4526-DELNP-2013-ASSIGNMENT WITH VERIFIED COPY [13-10-2020(online)].pdf 2020-10-13
5 4526-delnp-2013-Form-5.pdf 2014-01-03
5 4526-DELNP-2013-FORM-16 [13-10-2020(online)]-1.pdf 2020-10-13
6 4526-delnp-2013-Form-3.pdf 2014-01-03
6 4526-DELNP-2013-FORM-16 [13-10-2020(online)].pdf 2020-10-13
7 4526-DELNP-2013-POWER OF AUTHORITY [13-10-2020(online)]-1.pdf 2020-10-13
7 4526-delnp-2013-Form-2.pdf 2014-01-03
8 4526-DELNP-2013-POWER OF AUTHORITY [13-10-2020(online)].pdf 2020-10-13
8 4526-delnp-2013-Form-1.pdf 2014-01-03
9 4526-delnp-2013-Correspondence-others.pdf 2014-01-03
9 4526-DELNP-2013-IntimationOfGrant21-09-2020.pdf 2020-09-21
10 4526-delnp-2013-Claims.pdf 2014-01-03
10 4526-DELNP-2013-PatentCertificate21-09-2020.pdf 2020-09-21
11 4526-DELNP-2013-ABSTRACT [21-06-2019(online)].pdf 2019-06-21
11 4526-delnp-2013-Form-3-(06-01-2014).pdf 2014-01-06
12 4526-DELNP-2013-CLAIMS [21-06-2019(online)].pdf 2019-06-21
12 4526-delnp-2013-Correspondence-Others-(06-01-2014).pdf 2014-01-06
13 4526-DELNP-2013-COMPLETE SPECIFICATION [21-06-2019(online)].pdf 2019-06-21
13 4526-delnp-2013-Form-3-(28-05-2014).pdf 2014-05-28
14 4526-delnp-2013-Correspondence-Others-(28-05-2014).pdf 2014-05-28
14 4526-DELNP-2013-DRAWING [21-06-2019(online)].pdf 2019-06-21
15 4526-DELNP-2013-FER_SER_REPLY [21-06-2019(online)].pdf 2019-06-21
15 4526-DELNP-2013-FORM 3 [27-07-2017(online)].pdf 2017-07-27
16 4526-DELNP-2013-OTHERS [21-06-2019(online)].pdf 2019-06-21
16 4526-DELNP-2013-RELEVANT DOCUMENTS [22-08-2017(online)].pdf 2017-08-22
17 4526-DELNP-2013-PETITION UNDER RULE 137 [21-06-2019(online)].pdf 2019-06-21
17 4526-DELNP-2013-Changing Name-Nationality-Address For Service [22-08-2017(online)].pdf 2017-08-22
18 4526-DELNP-2013-AMENDED DOCUMENTS [22-08-2017(online)].pdf 2017-08-22
18 4526-DELNP-2013-FER.pdf 2018-12-21
19 4526-DELNP-2013-AMENDED DOCUMENTS [22-08-2017(online)].pdf 2017-08-22
19 4526-DELNP-2013-FER.pdf 2018-12-21
20 4526-DELNP-2013-Changing Name-Nationality-Address For Service [22-08-2017(online)].pdf 2017-08-22
20 4526-DELNP-2013-PETITION UNDER RULE 137 [21-06-2019(online)].pdf 2019-06-21
21 4526-DELNP-2013-OTHERS [21-06-2019(online)].pdf 2019-06-21
21 4526-DELNP-2013-RELEVANT DOCUMENTS [22-08-2017(online)].pdf 2017-08-22
22 4526-DELNP-2013-FER_SER_REPLY [21-06-2019(online)].pdf 2019-06-21
22 4526-DELNP-2013-FORM 3 [27-07-2017(online)].pdf 2017-07-27
23 4526-DELNP-2013-DRAWING [21-06-2019(online)].pdf 2019-06-21
23 4526-delnp-2013-Correspondence-Others-(28-05-2014).pdf 2014-05-28
24 4526-DELNP-2013-COMPLETE SPECIFICATION [21-06-2019(online)].pdf 2019-06-21
24 4526-delnp-2013-Form-3-(28-05-2014).pdf 2014-05-28
25 4526-DELNP-2013-CLAIMS [21-06-2019(online)].pdf 2019-06-21
25 4526-delnp-2013-Correspondence-Others-(06-01-2014).pdf 2014-01-06
26 4526-DELNP-2013-ABSTRACT [21-06-2019(online)].pdf 2019-06-21
26 4526-delnp-2013-Form-3-(06-01-2014).pdf 2014-01-06
27 4526-delnp-2013-Claims.pdf 2014-01-03
27 4526-DELNP-2013-PatentCertificate21-09-2020.pdf 2020-09-21
28 4526-delnp-2013-Correspondence-others.pdf 2014-01-03
28 4526-DELNP-2013-IntimationOfGrant21-09-2020.pdf 2020-09-21
29 4526-delnp-2013-Form-1.pdf 2014-01-03
29 4526-DELNP-2013-POWER OF AUTHORITY [13-10-2020(online)].pdf 2020-10-13
30 4526-DELNP-2013-POWER OF AUTHORITY [13-10-2020(online)]-1.pdf 2020-10-13
30 4526-delnp-2013-Form-2.pdf 2014-01-03
31 4526-delnp-2013-Form-3.pdf 2014-01-03
31 4526-DELNP-2013-FORM-16 [13-10-2020(online)].pdf 2020-10-13
32 4526-delnp-2013-Form-5.pdf 2014-01-03
32 4526-DELNP-2013-FORM-16 [13-10-2020(online)]-1.pdf 2020-10-13
33 4526-delnp-2013-GPA.pdf 2014-01-03
33 4526-DELNP-2013-ASSIGNMENT WITH VERIFIED COPY [13-10-2020(online)].pdf 2020-10-13
34 4526-delnp-2013-Assignment-(24-06-2013).pdf 2013-06-24
34 4526-DELNP-2013-ASSIGNMENT WITH VERIFIED COPY [13-10-2020(online)]-1.pdf 2020-10-13
35 4526-DELNP-2013-RELEVANT DOCUMENTS [17-09-2022(online)].pdf 2022-09-17
35 4526-delnp-2013-Correspondence-Others-(24-06-2013).pdf 2013-06-24
36 4526-DELNP-2013-RELEVANT DOCUMENTS [01-08-2023(online)].pdf 2023-08-01
36 4526-DELNP-2013.pdf 2013-06-07

Search Strategy

1 4526searchstrgy_21-12-2018.pdf

ERegister / Renewals

3rd: 16 Dec 2020

From 14/12/2013 - To 14/12/2014

4th: 16 Dec 2020

From 14/12/2014 - To 14/12/2015

5th: 16 Dec 2020

From 14/12/2015 - To 14/12/2016

6th: 16 Dec 2020

From 14/12/2016 - To 14/12/2017

7th: 16 Dec 2020

From 14/12/2017 - To 14/12/2018

8th: 16 Dec 2020

From 14/12/2018 - To 14/12/2019

9th: 16 Dec 2020

From 14/12/2019 - To 14/12/2020

10th: 16 Dec 2020

From 14/12/2020 - To 14/12/2021

11th: 26 Oct 2021

From 14/12/2021 - To 14/12/2022

12th: 31 Oct 2022

From 14/12/2022 - To 14/12/2023

13th: 27 Oct 2023

From 14/12/2023 - To 14/12/2024

14th: 29 Oct 2024

From 14/12/2024 - To 14/12/2025