Sign In to Follow Application
View All Documents & Correspondence

Method For Generation Of Tissue System With Undifferentiated Stem Cells Derived From Corneal Limbus For Autologous Or Allogenic Use

Abstract: N/A

Get Free WhatsApp Updates!
Notices, Deadlines & Correspondence

Patent Information

Application #
Filing Date
27 January 2004
Publication Number
0
Publication Type
INA
Invention Field
BIOTECHNOLOGY
Status
Email
Parent Application
Patent Number
Legal Status
Grant Date
2007-04-04
Renewal Date

Applicants

RELIANCE LIFE SCIENCES PRIVATE LIMITED
CHITRAKOOT, 2ND FLOOR, GANPATRAO KADAM MARG, SHREE RAM MILLS COMPOUND LOWER PAREL, MUMBAI - 400 013, MAHARASHTRA, INDIA

Inventors

1. TOTEY SATISH MAHADEORAO
FLAT NO. 72, 7TH FLOOR, A WING, NAPEROL TOWER, R A KIDWAI ROAD, WADALA, MUMBAI - 400 031, MAHARASHTRA, INDIA.

Specification

FORM 2
THE PATENTS ACT, 1970 (39 of 1970)
COMPLETE SPECIFICATION
SECTION 10
"Method For Generation Of Tissue System With Undifferentiated Stem Cells Derived From Corneal Limbus For Autologous or Allogenic Use"
RELIANCE LIFE SCIENCES PVT.LTD.
an Indian Company having its Registered office at
Chitrakoot, 2nd Floor,
Shree Ram Mills Compound,
Ganpath Rao Kadam Marg,
Lower Parel, Mumbai - 400 013,
Maharashtra, India.
The following specification particularly describes and ascertains the nature of this invention and the manner in which it is performed: -
11-3-2005

1

FIELD OF THE INVENTION
The present invention relates to the method for generating tissue system comprising mammalian undifferentiated stem cells, preferably human undifferentiated stem cells, which are derived from corneal limbus tissue suitable for autologous or allogenic use in restoring damaged or diseased ocular surfaces. The present invention more particularly relates to the tissue system comprising of more than 70% of undifferentiated stem cells.
BACKGROUND OF INVENTION
Stem cells are responsible for cellular replacement and tissue regeneration throughout life. Stem cells are populations of undifferentiated cells, which comprise a small proportion of the total tissue that, have a high capacity for proliferation and self-maintenance. A stem cells population present in corneoscleral limbus in eye has enormous capacity to participate in the dynamic equilibrium of the ocular surface. In order to preserve clear vision and ocular comfort it is must to maintain the normal structure and function of ocular surface which, consists of corneal epithelium, conjuctival epithelium and precorneal tear film. The corneal epithelium is continuously being shed and renewed by corneoscleral limbal stem cells. A centripetal and circumferential migration of stem cells from the corneoscleral limbus in addition to the vertical movement from the basal layers results in the renewal of epithelial layers in times of shedding or injury.
The first pointer towards the existence of such limbal stem cells in the corneal epithelium was provided in the 1980 (Schermer A, Galvin S, Sun TT (1986)
2

Differentiation-related expression of a major 64 K corneal keratin in vivo and in culture suggests limbal location of corneal epithelial stem cells. J cell Biol. 103:49-62; Cotsarelis G Cheng SZ, Dong G, Sun TT, Lavker RM (1989) Existence of slow-cycling limbal epithelial basal cells that can be preferentially stimulated to proliferate: implications on epithelial stem cells. Cell 57:201-209). Stem cells with their high proliferative capacity are clearly crucial for maintenance of a viable ocular surface because they provide an unbroken supply of corneal epithelial cells with the appropriate phenotype. If this supply is interrupted, the implications for the health of the ocular surface are dire.
The loss or damage of the ocular surface due to limbal stem cells deficiency is no doubt hugely troublesome. Such situation of limbal stem cells deficiency can arise for a number of reasons. Primary limbal stem cell deficiency occurs from hereditary conditions e.g. aniridia a genetically determined ocular abnormality due to incomplete differentiation of the corneoscleral limbus, characterised by ocular surface abnormalities as well as absence of iris; keratitis associated with hereditary multiple endocrine deficiency; or limbitis or may be due to idiopathy etc. Secondary limbal stem cell loss may commonly occur from acquired conditions like infections e.g. Steven-Johnson syndrome or severe microbial keratitis which lead to inflammatory destruction of limbal stem, or traumatic destruction of limbal stem cells caused by chemical or thermal injury or ultraviolet radiation or multiple surgeries or cry therapies or corneal intraepithelial neoplasia or keratopathy or toxic effect induced by contact lens or lens cleaning fluids, pterygium and pseudopterygium or peripheral corneal ulcerative keratitis or any other factor.
3

Deficiency and depletion of the limbal stem cells in all these conditions results in abnormal corneal surface, which often leads to corneal blindness. This loss of vision due to abnormal corneal surface may occur even when the reminder of the eye has normal vision.
Several approaches have been used earlier for restoring normal vision by corneal surface impairments. One of the conventional approach is the repair of damaged corneal surface with the transplantation of amniotic membrane (Anderson DF, Elites P, Pires RTF, Tseng SCG, 2001. Br J. Opthalmol 85:567-575). However such amniotic membrane transplantation suffers from serious disadvantage of ameliorated annoying photophobia or pain, (Shimazaki J, Yang H-Y, Tsubota K 1997. Amniotic membrane transplantation for ocular surface reconstruction in patients with chemical and thermal burn. Ophthalmology 104:2068-2076). Amniotic membrane has been found to facilitate epithelization, maintain a normal epithelial phenotype, reduce inflammation, reduce scarring, reduce the adhesion of tissue and reduce vascularization. In particular amniotic membrane express incomplete HLA-A, B, C and DR. antigens and hence immunological rejection do not observe. Moreover this process is not uniformly successful and in many cases, final outcome is not much different from the patient's starting point (Tseng SCG, Prabhasawat P, Lee SH. 1997. Amniotic membrane transplantation for conjuctival surface reconstruction. American Journal of Ophthalmology 124: 765-774). Hence this method can only be applied in case of patients with partial limbal stem cells deficiency.
Another approach involves corneal transplantation, which is also generally not

4

successful in the chronic ocular surface problems since the ultimate success of the therapy is dependent on the gradual replacement of the donor corneal epithelium with the recipient's {Lindstrome RL, (1986). N Engl J Med 315:57-59). This poor prognosis is due to the deficiency of limbal stem cells in the recipient eye.
Still another approach is to transplant entire limbus of one eye. This involves transplantation of two large free conjuctival limbal grafts, each spanning approximately 6-7 mm in limbal arc length, to be harvested from the healthy fellow eye. This procedure has been shown to restore the corneal surface more electively than conjuctival transplantation in a rabbit model (Tsai RJF, Sun TT, Tseng SCG (1990). Comparison of limbal and conjuctival autograft transplantation for corneal surface reconstruction in rabbits. Opthalmology. 97:446-455) and has been practiced by many to relive the ocular discomfort experienced by many patients and to restore their vision and corneal surface. However one major concern is that the large amount of limbal stem cells are required to be removed from healthy eye, which may put the healthy eye to the risk of limbal stem cells deficiency and further complications arising out of such severe loss of limbal stem cells.
Considering the drawback of removal of large amount of limbal stem cells, there are method intended for treating stem cell deficient eyes which relied on taking only a small biopsy of limbal epithelium from the healthy eye of an individual {Pellegrini G, Tr aver so CE, Franzi AT, Zingirini M, Cancedda R, De Luca M (1997). Long-term restoration of damaged corneal surfaces with autologous
5

cultivated corneal epithelium. The Lancet 349:990-993). Biopsy derived limbal cells is cultured on plastic petri plates for two to three weeks. On confluent, these cells are removed by trypsinization and transplanted onto patient's damaged eye. Also to further refine this method in order to correct the stem cell deficiency and to have proper carrier, attempts were made to grow limbal stem cells on amniotic membrane (Koizumi N, Fullwood NJ, Bairaktaris G, Inatomi T, Kinoshita S, Quantock AJ. (2000). Cultivation of corneal epithelial cells on intact and denuded human amniotic membrane. Invest. Ophthalmol Vis Sci. 41: 2506-2513 ; Koizumi N, Inatomi T, Quantock AJ, Fullwood NJ, Dota A, Kinoshita S. (2000) Amniotic membrane as a substrate for cultivating limbal corneal epithelial cells for autologous transplantation in rabbit. Cornea 19:65-71.Dua HS, Azuara-Blanco A. (2000). Limbal stem cells of the corneal epithelium. Survey of Ophthalmology. 44:415-425).
However these limbal, corneal transplants, or grafts in long term follow up would fail to show the uniform stability and thereby satisfactory ocular surface repair particularly in patients with severe limbal stem cells deficiency. The stability and success of any transplant would depend upon its ability to regenerate continuously the viable limbal stem cells for repopulating the ocular surface. Most of the transplants or grafts have differentiated epithelial cells and hence the amount of stem cells in them will be very limited. Therefore the donor epithelium in such transplanted grafts will survive only for a short period of time owing to very limited supply of limbal stem cells and on long run graft usually would not be stable and hence would fail to provide the ocular surface restoration and thereby vision improvement.
6

Thus the above mentioned approaches" particularly those intended to supply limbal stem cells which may have shown initial promise, have limitations with respect to the limited supply of the undifferentiated limbal stem cells with self-regenerative capacity which are must for stability of the transplanted graft for providing satisfactory success rate of ocular repair and vision improvement.
Therefore from the foregoing it is quite obvious that for successful repair and reconstruction of ocular surface impairments particularly with limbal stem cells deficiency there is a need for a system with sufficient amount of undifferentiated limbal stem cells, which have the self-regenerating capacity to provide the viable limbal stem population for substantial stability, successful transplantation of the tissue system and consequently ocular surface restoration and vision improvement.
PRIOR ARTS:
Cancedda Ranieri et al., in EP Patent No. 057364, discloses the process to grow in vitro differentiated ocular surface epithelial cells from donor site which comprises of eye limbus and/or perlimbus; eye forrinx and/or conjunctiva. Said cells are useful for eye transplantation by means of suitable carrier like sterilze gauze or semirigid lens. However such differentiated ocular surface epithelial cells would run a risk of failure in patients with sever limbal stem cells deficiency or completely lacking the limbal stem cells on account of limited supply of limbal stem cells by such differentiated epithelial cells with less of undifferentiated limbal stem cells. Moreover in patients with sever ocular and particularly corneal surface damage the insertion of such contact lens would not be desirable and
7

be desirable and again the acceptability of such contact lens would be questionable. Presence of contact lens on already damaged surface may cause the irritation, discomfort and may further aggravate the complications.
Isseroff Roslyn R. et al., in US Patent Applicatio No. 20020039788 relates to a bioengineered composite graft for the treatment of a damaged or diseased corneal epithelial surface wherein composite graft comprises a multilayered epithelium comprising of differentiated epithelial cells. Such graft with differentiated epithelial cells would necessarily mean that there would be fewer amounts of undifferentiated stem cells necessary for successful ocular repair and can live for a shorter period. Such graft may not be good proposition for patients with either severely deficient limbal stem cells or no limbal stem cells.
Michele De Luca, et al., in US Patent No. 6610538, discloses a method of reconstructing laminae of human epithelial cornea in vitro to be used in grafts from cultures of limblar stem cells as well as a method of selecting and transferring such cells to fibrin substrate. The disclosure provides the method of selecting limblar stem cells by clonal analysis and using marker such as K-19, K-12, K-3 and p63. It is well known to those skilled in the art that these markers are for indicating the presence of the corneal nature and may not be very specific for confirming the stem-ness of the cells. Moreover the clonal analysis provides the selection of the cells that is haloclones, belonging to the basal limbal layer, which may not necessarily assure the enriched population of limbal stem cells in particular.
8

Dhillon Baljeen et al., in patent No.WO03030959 discloses a corneal repair device for treating corneal lesions, comprises contact lens having modified surface for culturing limbal stem cells. However one can never be sure of constant release of the stem cells from the contact lens on which they are seeded. Also the contact lens comprises of limbal stem cell population as little as 10% as disclosed therein. Such low population of limbal stem cells would not be adequate for successful corneal repair in patients with severe limbal stem cell deficiency or having no limbal stem cells at all.
Tsai, Ray Jui-Fang, in US published Patent Application No. 20030208266 describes transplantation of epithelial stem cells, cultures ex vivo on specifically treated amniotic membrane, yields with that amniotic membrane, a surgical graft having expanded epithelial stem cells. The method for creating a surgical graft as disclosed however does not employ any kind of isolation step for exclusive selection of limbal stem cells prior to culture procedure, assuring the presence of limbal stem cells in the graft. Moreover the distribution of so called stem cells layer is non-uniform throughout the graft as it is said to be 4-5 layers near the margin and 1-4 layers in the area between the margin and original explant. Also such poor quantity would not assure the stability of the transplanted epithelial particularly in patients lacking the limbal stem cells or having the severe deficiency.
Perrella Guiseppina in WO 03093457 discloses a method for the identification and isolation of stem cells of a human tissue, which provides at least an identification and isolation step, by means of specific selection of stem cells of
9

human tissue expressing as a differentiating marker a membrane protein belonging to the cluster differentiation CD. However it is known to those skilled in the arts that CD34 or CD 133 markers are specific for isolating human haematopoietic lines. Therefore one cannot rule out the possibility of selection of the stem cells due to contamination with the blood cells present along with them.
From the foregoing it is apparent that the prior arts as mentioned above are predominantly directed towards the transplants or grafts with differentiated corneal epithelial cell layers. Since the corneal epithelial layers as claimed are specified as differentiated, which implies that the amount of undifferentiated limbal stem cells with self-regenerating capacity in such grafts may be limited. It is well known to those skilled in the field of the art that there can be risk of failure of the transplant with fewer limbal stem cells particularly in case of patients with severe deficiency of limbal stem cells or in cases where they are completely lacking and therefore no longer able to regenerate the cells of the corneal tissue. In such cases the transplant may primarily seem to be successful, with a clear corneal epithelium present. However, on account of lack of sufficient limbal stem cells, there may be no generation of phenotypically correct corneal epithelial cells, leading to an abnormal epithelial surface and poor healing resulting in failure in ocular surface repair and vision improvement. Therefore it is imperative that the adequate amount of undifferentiated limbal stem cells should be provided in any such transplant with the ability to regenerate and supply the limbal stem cells continually for successful transplantation and thereby ocular repair.
10

The inventors of the present invention have been successful in fulfilling this necessity by providing a tissue system with large number of undifferentiated limbal stem cells having the self-regenerating capacity for effectively repopulating the limbal stem cells and thereby rendering the transplanted tissue system stable for successful ocular surface repair.
Moreover it is also obvious that the prior arts either do not involve any special technique for identification and isolation step of isolation of limbal stem cells for confirming their presence in the transplants or employs the techniques for isolating stem cells which are not very specific to stem cells. Also there is no specific attempt to enrich the limbal stem cells in particular. The approach of clonal analysis for selection of limblar stem cells using marker such as P-63 disclosed in one of the prior arts as known to those ordinary skilled in the arts are suitable only for indicating the corneal nature of the stem cells rather than their stem-ness. Another approach of identification and isolation of the stem cells by determining the presence of CD 34 positive membrane protein(s) and/or CD 133 positive protein (s) as known to those skilled in the arts would render the identification of adult stem cells only, unlike the present invention selection method which is specifically directed towards isolation of undifferentiated limbal stem cells which would have the fundamental characteristics of embryonic like stem cells such as undifferentiated nature, self-regenerating capacity and more of stem-ness. Besides the present invention improved method of development of tissue system from a small limbal biopsy on an appropriate tissue base in presence of enriched culture medium further assures of large amount of undifferentiated limbal stem ells population in the tissue system.
11

Furthermore unlike above mentioned prior arts the present invention also provides the generation of the additional tissue systems in case of autologous patients in the event of rejection of the same on account of immune response or any such reasons, without removing any additional biopsy form the patient and putting him/her at risk of limbal deficiency and any further complications arising out of such additional removal. The present invention also provides for generation of multiple tissue systems suitable for transplantation in any allogenic biocompatible patient in the need thereof.
OBJECTS OF THE INVENTION
It is an object of the present invention to provide the method for generation of tissue system comprising of large population of undifferentiated stem cells derived from corneal limbus for autologous or allogenic use for restoring ocular surface impairments particularly with limbal stem cells deficiency which could be primary limbal stem cells deficiency like aniridia, keratitis, limbitis or due to idiopathy; or secondary limbal stem cells loss occurring from acquired conditions like infections like Steven-Johnson syndrome or severe microbial keratitis; or traumatic destruction of limbal stem cells caused by chemical or thermal injury or ultrviolet radiation or multiple surgeries or cryotherapies, or corneal intraepithelial neoplasia or keratopathy or toxic effect induced by contact lens or lens cleaning fluids, pterygium and pseudopterygium or peripheral corneal ulcerative keratitis or any other factor.
It is still an object of the present invention to provide the method of generating the tissue system with undifferentiated limbal stem cells using undifferentiated
12

stem cells obtained by technique specific for sorting and isolating the undifferentiated stem cells.
It is still an object of the present invention to provide the method of obtaining pure population of undifferentiated limbal stem cells by employing specific technique for sorting and isolating undifferentiated limbal stem cells for ensuring their presence in the tissue system.
It is still an object of the present invention to provide the method of obtaining pure population of undifferentiated limbal stem cells by magnetic affinity cell sorting.
It is still an object of the present invention to provide the method of obtaining pure population of undifferentiated limbal stem cells by fluorescent activated cell sorting.
It is still an object of the present invention to provide the method of sorting and isolating of pure population of undifferentiated limbal stem cells using specific stem cell surface marker like stage specific embryonic antigen marker - 4.
It is still an object of the present invention to provide the method of development of the tissue system with undifferentiated, limbal stem cells on a tissue base biocoated with binding agent in presence of enriched medium for transplantation onto ocular surface.
13

It is still an object of the present invention to provide the medium for transportation of biopsy from hospital to cGMP facility for development of tissue system so as to keep the biopsies viable.
It is still an object of the present invention to provide the medium for culture of biopsies or single cell suspension of biopsy tissue to grow the limbal stem cells. It is still an object of the present invention to provide the enriched culture medium for selective augmentation of the isolated limbal stem cells on tissue base so that the limbal stem cells proliferate faster and large population of limbal stem cells remain undifferentiated and retain the self-regeneration capacity.
It is still an object of the present invention to provide the method of generation of tissue system with large population of undifferentiated stem cells for autologous use from tissue derived from patients own eye.
It is still an object of the present invention to provide the method of generation of tissue system with large population of undifferentiated stem cells for allogenic use from tissue derived from biocompatible - close relative or donor or cadaveric
eye.
14

It is still an object of the present invention to maintain the culture of pure population of undifferentiated limbal stem cells into several passages without any differentiation or change in characteristic.
It is still an object of invention to preserve the culture with pure population of undifferentiated limbal stem cells after every passage for generation of additional or multiple tissue system.
It is still an object of the present invention to generate additional or multiple tissue system at any given point of time from the culture passages maintained of the pure population of undifferentiated limbal stem cells.
It is still an object of the present invention to provide limbal stem cells additional tissue system for autologous use in the event of failure of tissue system in the patient on account of immunosuppression, complications due to previous surgery or any such reasons.
It is still an object of the present invention to provide multiple tissue system comprising of undifferentiated stem cells for allogenic use in biocompatible patients in the need thereof.
15

It is still an object of the present invention to provide the means for transportation of the tissue system from centrally located cGMP facility to any distant hospital without loosing its viability and to keep the tissue system transplantable.
SUMMARY OF THE INVENTION
In accordance with the forgoing objects, the present invention provides the tissue system, comprising of more than 70% of undifferentiated limbal stem cells derived from mammalian limbus preferably human limbus suitable for autologous or allogenic use in effectively restoring ocular surface impairments particularly with sever limbal stem cell deficiency.
The present invention for the first time provides the sorting and isolation of undifferentiated limbal stem cells with self-regenerating capacity using technique like magnetic affinity cell sorting (MACS) or fluorescent activated cell sorting (FACS) employing stem cell specific surface markers such as stage specific embryonic antigen marker-4 or the like marker. Further the undifferentiated limbal stem cell population in the tissue system is characterized by array of stem cell specific surface markers like stem cell factor, stage specific embryonic antigen marker - 4, Rexl, Tral-81, Tral-60, OCT -3/4, hTDG, hUTF, BMP2, BMP5, Nanog and/pr combinations thereof for confirming undifferentiated limbal stem cells with high degree of certainty. Such sorting and selection technique along with final characterization of the limbal stem cells in the tissue system can assure the presence of undifferentiated limbal stem cells, which have the potential to continuously repopulate the ocular surface with fresh viable limbal stem cells and thereby provide long term stability for effective repair of
16

ocular surface impairments particularly associated with sever limbal stem cells deficiency.
The present invention provides for the method of generation of tissue system with large population of undifferentiated stem cells derived from mammalian preferably human corneal limbus from suitable for autologous or allogenic use for repairing or restoring ocular surface disorder or diseases steps of: obtaining biopsies from eye; culturing biopsies on tissue culture plates biocoated with binding agent; segregating the cells with dispase or trypsin EDTA; subjecting the segregated cells to technique like magnetic affinity cell sorting (MACS) or fluorescent activated cell sorting (FACS) for sorting and obtaining undifferentiated limbal stem cells with the help of stem cell specific surface marker; culturing the isolated undifferentiated limbal stem cells on tissue base biocoated with binding agent; selectively augmenting undifferentiated limbal stem cells on tissue base in presence of culture medium enriched with inactivated human embryonic fibroblast cells culture medium and human leukemia inhibitory factor, further fortified with growth facilitating agent thereby providing tissue system comprising of large population of undifferentiated limbal stem cells amounting to more than 70%.
According to one embodiment of the present invention the agent facilitating binding of the limbal stem cells on tissue base or for biocoating the tissue culture plates used for culturing biopsies is matrigel. In other embodiment binding agent is laminin. In some another embodiment binding agent is collagen IV. In some other embodiment binding agent is tenascin. In still another
17

embodiment binding agent is fibrinogen. In yet another embodiment the binding agent is fibronectin. In still additional embodiments it can be combinations of any or all of the binding agent mentioned herein.
According to one embodiment of the present invention the tissue base for developing tissue system with undifferentiated limbal stem cells is human amniotic membrane. In some other embodiment, it is fibrinogen and thrombin sheet (Fibrin Sealant, Reliseal™, Reliance Life Sciences). In another embodiment, it is laminin. In still another embodiment, it is collagen IV sheet. In yet another embodiment, it is a combination of fibrinogen, laminin and collagen base. In further embodiment, it is matrigel. In some additional embodiments it can be combinations of any or all of the previously mentioned tissue base.
According to one embodiment of the present invention the growth-facilitating agent for fortifying enriched culture medium for isolated undifferentiated limbal stem cells is epidermal growth factor. In another it is insulin. In still another embodiment it is transferrin. In yet another embodiment it is laminin. In further embodiment it is fibronectin. In some additional embodiments it is combination of any or all of the above mentioned growth facilitating agent.
According to one aspect of the invention there is provided a medium for transportation or storage of biopsies so as to keep them viable.
According to still another aspect of the present invention there is provided means
18

for transportation of the tissue system from cGMP facility to any distant hospital without loosing its viability and to keep the tissue system transplantable.
According to one aspect of the present invention there is provided autologous tissue system using tissue derived from the patient's own eye. According to another aspect of the present invention there is provided allogenic tissue system using tissue derived from biocompatible close relative or donor or cadaver.
According to some other aspect of the present invention there is provided additional tissue system with undifferentiated limbal stem cells, for autologous use in the event of failure of tissue system in the patient on account of immunosuppression, complications due to previous surgery or any such reasons.
According to still some other aspect of the present invention there is provided multiple tissue system with undifferentiated limbal stem cells, for allogenic use in the biocompatible patients in the need thereof.
The present invention tissue system with undifferentiated limbal stem cells can
be used in restoring ocular surface impairments particularly with sever limbal
stem cells deficiency which could be primary limbal stem cells deficiency like
aniridia, keratitis, limbitis or due to idiopathy; or secondary limbal stem cells loss
occurring from acquired conditions like infections like Steven-Johnson syndrome
or severe microbial keratitis; or traumatic destruction of limbal stem cells caused
by chemical or thermal injury or ultrviolet radiation or multiple
surgeries or cryotherapies, or corneal intraepithelial neoplasia or
19

keratopathy or toxic effect induced by contact lens or lens cleaning fluids, pterygium and pseudopterygium or peripheral corneal ulcerative keratitis or any other factor.
These and other features, aspects and advantages of the present invention will become apparent from the ensuing detailed description and accompanying figures.
BRIEF DESCRIPTION OF THE FIGURES
The following figures are incorporated to further demonstrate certain aspects of the present invention. The invention may be better understood by reference to these figures in combination with the detailed description presented herein.
Fig 1: shows the flow cytometric analysis of cultured biopsy samples. Fig 1A shows the analysis of unlabelled cells as control. Fig. IB shows cells treated with anti-mouse fluorescent isothiocyanate (FITC) a secondary antibody as label control. Fig 1C shows cells treated with primary antibody for stage specific embryonic antigen marker-4 and labeled with anti-mouse FITC (secondary antibody), showing that about 30% cells are positive for stage specific embryonic antigen marker-4.
Fig 2: shows the flow cytometric analysis of tissue system samples. Fig 2A shows the analysis of unlabelled cells. Fig. 2B shows cells treated with anti-mouse fluorescent isothiocyanate (FITC) a secondary antibody as label control. Fig 2C shows cells treated with primary antibody for stage specific embryonic
20

antigen marker-4 and labeled with anti-mouse FITC (secondary antibody), showing that about 74 % of the cells are immunopositve for stage specific embryonic antigen marker-4.
Figs 3, 4 and 5: shows the phase contrast photomicrographs of three different stages of development of tissue system with undiffenretiated limbal stem cells on human amniotic membrane. Fig 3 shows the 7th day of culture with semi confluent growth of cells where in a small area around the explant is seen with cells outgrown. Fig 4 shows the 14th day of culture with confluent growth. Fig 5 shows the hematoxylin and eosin staining of the multilayered tissue system on the amniotic membrane at the termination point of the culture.
Fig 6: shows the immunofluorescence photomicrograph of tissue system showing, positivity for stage specific embryonic antigen marker-4.
Fig 7: shows the immunofluorescence photomicrograph of tissue system showing, positivity for stem cell factor.
Fig 8: shows the immunofluorescence photomicrograph of tissue system showing, positivity for Tra 1-60.
Fig 9: shows the immunofluorescence photomicrograph of tissue system showing, positivity for Oct-4.
21

Fig 10: shows the immunofluorescence photomicrograph of tissue system showing, absence of connexin 43 in the tissue system, which is a negative marker for limbal cells (by vector elite kit).
Fig 11: shows the immunocytochemistry photomicrograph of tissue system showing, p63 positive. It is a deparaffinised section upon which immumoperoxidase was performed (vector elite kit) using the chromegen DAB. P63 is a nuclear antigen and the brown colored spots are the positive nuclei of the cells.
Fig 12: shows the immunofluorescence photomicrograph of tissue system showing, the focal presence of K3/K12 positive cells in the superficial layers of the tissue system.
Fig 13: shows the immunofluorescence photomicrograph of tissue system showing, the basal layer expression of K19 in the tissue system.
Fig 14: shows the RT-PCR analysis of limbal cells in the tissue system showing the expression of genes for Oct4, Nanog, Rexl, BMP2 and BMP 5.
Fig 15: shows the bar graph showing the viability of the biopsies as depicted from % rate of success of development of tissue system from biopsies received at different period of transportation in transportation medium.
22

Fig 16: shows the bar graph showing the viability of the tissue system upto 24 hrs at 4° C.
DETAILED DESCRIPTION OF THE INVENTION
Unless specifically stated, the terms used in the specification have the same meaning as used in the art. As used herein, a "tissue system" is a population of cells comprising USCs, preferably on an appropriate tissue base, suitable for transplantation, implantation, or graft to a mammalian subject. Preferably, the tissue system is a transplant, implant, or graft, for example a surgical graft or a composite graft, with multi-layered aggregates of cells. As used herein, the term "undifferentiated stem cells" or "USCs" refers to undifferentiated or substantially undifferentiated cells or uncommitted progenitor cells, which express one or more stem cell-specific markers, preferably embryonic stem cell-specific markers. USCs of the present disclosure exhibit ES cell-like characteristics and properties such as, for example, expression of ES-specific markers, for example SSEA-4, SSEA-3, Oct-4, Nanog, Rex 1, Sox, Tra-1-60, and/or long-term proliferation in culture. In addition, USCs of the present disclosure may proliferate and generate progeny, which may be undifferentiated or differentiated cells, depending on environmental conditions. For example, USCs of the present disclosure have the potential to differentiate into corneal epithelial cells, which are essential to the healthy function of the ocular surface of the eye. As used herein, the term "differentiation" refers to a process whereby undifferentiated stem cells or precursors cells acquire a more specialized fate.
The present invention relates to the method for generating tissue system comprising mammalian undifferentiated stem cells, preferably human undifferentiated stem cells, which are derived from corneal limbus tissue suitable for autologous or allogenic use in restoring damaged or diseased ocular surfaces. The present invention more particularly relates to the tissue system comprising of more than 70% of undifferentiated stem cells useful in effectively restoring ocular surface impairments particularly with sever limbal stem cells deficiency.
The transplants, grafts, devices presently met with to address the ocular surface
23

damage are in general differentiated that is comprising of differentiated tissue like epithelial cell layers in principle and fewer limbal stem cells population. The ocular surface impairments which is becoming one of a leading cause of vision loss which is chiefly due to the severely lacking limbal stem cells, however would require a system having ability to supply uninterruptedly limbal stem cells to heal the ocular surface damages and consequently provide vision improvement. The present invention is thus directed towards a method of generation of tissue system with large population of undifferentiated limbal stem cells, for ocular surface restoration in patients lacking limbal stem cells severely or where limbal stem cells are completely absent.
The main advantage of the present invention amongst many other advantages is that of the presence of large population of undifferentiated limbal stem cells in the tissues system. Such large population of undifferentiated limbal stem cells allows the tissue system to be stable for longer duration on transplantation by continuously repopulating the ocular surface with fresh viable limbal stem cells and thereby restoring the ocular surface and improve vision.
The present invention accordingly provides the method of generation of the tissue system comprising of large population of undifferentiated limbal stem cells amounting to more than 70%.
The present invention method of development of the tissue system with undifferentiated stem cells comprises essentially at least a step of sorting and isolating explicitly undifferentiated limbal stem cells to assure their presence in the ensuing tissue system.
The present invention provides a highly selective method for obtaining the undifferentiated stem cells by employing specific technique for sorting and isolating undifferentiated stem cells. In accordance with the present invention
24

the techniques for sorting and isolating undifferentiated limbal stem cells is selected from technique like magnetic affinity cell sorting (MACS) or fluorescent activated cell sorting (FACS) or like technique with the help of stem cell specific surface marker. These techniques allow the identification and isolation of undifferentiated limbal stem cells from the other tissues present in the original tissue with high degree of specificity. The limbal stem cells isolated thus are undifferentiated in nature with self-regenerative capacity and of substantially unadulterated homogenous composition. Further the tissue system developed from these undifferentiated limbal stem cells are characterized using stem cell specific surface markers to show the population of undifferentiated limbal stem cells in the tissue system. Additionally the tissue system is also characterized for keratinocytes using specific marker to confirm the corneal nature of the limbal stem cells to be acceptable for successful transplantation.
In accordance with the present invention the stem cell specific surface marker which can be employed for sorting and isolating undifferentiated limbal stem cells is stage specific embryogenic antigen marker - 4 (SSEA - 4) or Tra-1-60 or Tra-1-81.
In accordance with the present invention the stem cell specific surface markers that may be employed for characterizing limbal stem cells can be selected from SSEA - 1, SSEA - 3, SSEA - 4, Oct-4, Rex 1, Nanog, Tral-81 and Tral-60, hTDGFl, hUTF or the like and/or combinations thereof.
In accordance with the present invention the specific surface markers that may be
25

employed for characterizing keratinocytes cells can be selected from p63, k3/ kl2, kl9, or the like and/or combinations thereof.
The additional markers used for characterization can be selected from BMP2, BMP5,orthelike.
The present invention provides the method of generation of tissue system with undifferentiated stem cells comprises steps of: obtaining biopsies; culturing biopsy pieces on tissue culture plates biocoated with binding agent in presence of culture medium; segregating the cells with dispase or trypsin EDTA; subjecting the segregated cells to technique for sorting and isolating undifferentiated stem cells, like magnetic affinity cell sorting (MACS) or fluorescent activated cell sorting (FACS) with the help of stem cell specific surface marker; culturing the isolated undifferentiated limbal stem cells on tissue base biocoated with binding agent; selectively augmenting the undifferentiated limbal stem cells in presence of culture medium enriched with inactivated human embryonic fibroblast cells culture medium, human leukemia inhibitory factor and/or combination thereof, further fortified with growth facilitating agent on a tissue base thereby providing tissue system comprising of large population of undifferentiated limbal stem cells amounting to more than 70%.
In accordance with the present invention extremely small biopsies of limbal epithelium of size 0.8 mm to 2 mm are used to develop the tissue system with undifferentiated stem cells.
26

In accordance with the present invention the biopsy that may be used to develop the tissue system can be obtained either from the patient's own eye to construct autologous tissue system or donor's eye which could be his/her close relative or any other bio-compatible donor or cadaveric eye to construct the allogenic tissue system.
Once the biopsies are removed from the patient or donor or cadaver in the hospital they are required to be transported to the cGMP facility for development of the tissue system therefrom. However to successfully develop the tissue system from the biopsies it is must that biopsies should remain viable. Accordingly in the present invention there is provided a medium which can be used during the transportation or alternatively can be used for storage of biopsies before processing at cGMP facility to retain the viability of the biopsy. The present invention medium for transportation of biopsies comprises of Dulbecco's modified Eagles Medium (DMEM) and Ham's F-12 in the ration 1:1 supplemented with 3 - 5% human cord blood serum, dimethyl sulphoxide (DMSO) 0.1% - 0.5%, recombinant human epidermal growth factor (rhEGF) 0.5 ng/ml - 2 ng/ml, insulin 0.5 µg/ml - 5 µg/ml, transferrin 0.5µg/ml - 5µg/ml, sodium selenite 0.5µg/ml - 5µg/ml, hydrocortisone 0.1µg/ml - 0.5 µg/m\, cholera toxin A 0.01 nmol/1 - 0.1 nmol/1, gentaycin 10 µg/ml 50µg/ml and amphotericin B 0.5 µ.g/ml 1.25 µg/ml. The transportation of biposies in such medium assures the viability of biopsies for the period upto 48 hours as seen from Fig. 14. The viability of the biopsies were evaluated based on the success
27

rate of number of tissue systems developed from biopsies, which were obtained, preserved in transportation medium, at different time interval of transportation. In accordance with the present invention the limbal biopsies obtained are cut into the small pieces and cultured on tissue culture plates biocoated with binding agent to follow the further culture procedure. Alternatively biopsies pieces are seeded on the biocoated tissue culture plates, dry incubated for the period of 2 to 5 minutes and then plated on the biocoated tissue culture dishes in presence of about 150 µl to 200µl of DMEM medium with 10% knock out serum or human cord blood serum so that they stick to bio-coated tissue culture surface agent to further follow the culture procedure.
In some other embodiments instead of biopsy pieces the single cell suspension is obtained from the biopsies to follow the culture procedure. For obtaining the single cell suspension on receiving the biopsies at cGMP laboratory, they are washed several times with ringer solution, a solution of freshly boiled distilled water containing 8.6 gm sodium chloride, 0.3 gm potassium chloride, and 0,33 gram calcium chloride per litre - the same concentrations as their occurrence in body fluids. Biopsies are then enzymatically treated in order to isolate pure population of limbal epithelial cells. Enzymatic treatment either given by 0.25% trypsin-EDTA for 20 - 30 minutes or by dispase overnight at 4°C aids in separating the epithelium for obtaining single cell suspension. Thus obtained single cell suspension is devoid of any stroma and mesenchymal cells. In accordance with the present invention the tissue culture dishes used to culture biopsies or single cell suspension are bio-coated with the support material facilitating the binding of the limbal stem cells onto the tissue culture plates and
28

thereby increase the number of limbal stem cells growing therefrom to many folds. The binding agents that may be employed in the present invention for biocoating of the tissue culture dishes can be selected from matrigel, laminin, tenascin, collagen IV, fibrinogen, fibronectin, or the like and/or combination thereof.
In accordance with the present invention the culture medium used for culturing the biopsies comprises of Dulbecco's modified Eagles Medium (DMEM) and Ham's F-12 in the ration 1:1 supplemented with the 5% - 15% knock out serum or human cord blood serum and growth facilitating agents for faster proliferation of limbal stem cells.
In accordance with the present invention the undifferentiated limbal stem cells
are propagated onto the appropriate tissue base to develop the tissue system with
undifferentiated stem cells. The tissue base in accordance to the present invention
is selected such that it is close to the natural ocular surface having characteristic
like being clear, thin, elastic, biocompatible, non-vascular, non-antigenic, support
the growth of undifferentiated limbal stem cells and which gradually infuses after
transplantation. The tissue base that is used in the present invention is selected
from human amniotic membrane, laminin, collagen IV sheet, fibrinogen,
fibronectn, thrombin, fibrinogen and thrombin sheet (Fibrin Sealant, Reliseal™,
Reliance Life Sciences), combination of fibrinogen, laminin and collagen base,
matrigel, or the like and or combinations thereof. The preferred tissue base in
accordance with the present invention is human amniotic membrane. In
accordance with the present invention the amniotic membrane is
29

used either intact and having epithelial surface on it or denuded for epithelial cells. In accordance with the present invention the amniotic membrane is prepared by the special process to serve as a tissue base.
In accordance with the present invention the tissue base used for development of tissue system with undifferentiated stem cells is bio-coated with binding agent facilitating binding of the limbal stem cells onto the tissue base. The binding agent that may be employed in accordance with the present invention can be selected from fibrinogen, laminin, collagen IV, tenascin, and or combinations thereof. The treatment of tissue base with such binding agent allows many fold increases in number of the resultant cells.
In accordance with the present invention the tissue base is placed on the culture insert from outside after removing 0.4 µM track-etched polyethylene terephthalate (PET) membrane by surgical blade and fitted with specially designed medical grade stainless steel ring or silicon rubber ring or simply by suture thread so as to fastened the tissue base to the cell culture insert.
In accordance with the present invention the undifferentiated limbal stem cells are selectively augmented on the tissue base in presence of enriched medium. The enriched medium of the present invention comprises of Dulbecco's modified Eagles Medium (DMEM) and Ham's F-12 in the ration 1:1. The present invention medium for culture of isolated limbal stem cells is enriched with 30% -50% conditioned medium obtained from inactivated human embryonic fibroblast and human leukemia inhibitory factor in the range of 4 ng/ml to 12 ng/ml.
30

and further fortified with growth facilitating agent. The culture medium is supplemented with 5% - 15 % knock out serum or 5% - 15 % heat inactivated human serum collected from the cord blood, dimethyl sulphoxide (DMSO) 0.1 % - 0.5%, hydrocortisone 0.1 µg/ml - 0.5 ug/ml, cholera toxin A 0.01 nmol/l - 0.1 nmol/l, gentamycin 10 jig/ml 50µg/ml and amphotericin B 0.5µig/ml 1.25µg/ml or any other suitable agent.
In accordance with the present invention the enriched medium for culture of isolated undifferentiated limbal stem cells is further fortified with growth facilitating agent selected from epidermal growth factor, sodium selenite, human transferrin, laminin, fibronectin, insulin, or the like and /or combinations thereof. In accordance with the present invention the growth facilitating agent that are used are of human recombinant origin.
The specifically enriched culture medium of the present invention facilitates the faster proliferation of limbal stem cells and is used for selectively augmenting the isolated limbal stem cells in the resultant tissue system. Such specifically designed medium would prevent the high differentiation of the limbal stem cells and thereby help to retain their self-regeneration capacity
The present invention enriched medium for culture of isolated undifferentiated limbal stem cells is also used for transportation of tissue system from cGMP facility to the hospital for keeping the tissue system viable and transplantable.
31

All the media of the present invention, that is the medium for transportation of biopsies, medium for culture of biopsies, enriched medium for culture of isolated limbal stem cells and transportation medium for tissue system do not contain any sera of animal origin. Thus these media are free from any xenogenic components and therefore do not have risk of contamination and are safe for human administration.
In accordance with the present invention the cultures of limbal stem cells are serially passaged upto 40 population doublings without any differentiation or change in characteristic of limbal stem cells.
In accordance with the present invention the cultures with pure population of undifferentiated limbal stem cells are preserved after every passage for generation of additional or multiple tissue system. Such preserved cultures serves as pool of undifferentiated, self-regenerating, viable limbal stem cells for generation of additional or multiple tissue system at any given point of time.
Alternately the cultures with pure population of undifferentiated limbal stem cells are frozen by using freezing medium that comprises of culture medium comprising of 10% - 20% heat inactivated serum collected from cord blood and 5 % - 10% DMSO.
The present invention also provides the development of additional tissue systems
32

from the preserved pool of pure population of undifferentiated viable limbal stem cells for autologous use in the event of failure of tissue system in the patient due to immunosuppression, or complications of previous surgery or any such reasons. The availability of such additional tissue system obviates the need of removal of extra biopsy form the patients in event of failure of tissue system and thereby prevents risks of limbal stem cells exhaustion in future.
The present invention also provides the development of multiple tissue systems from the preserved pool of pure population of undifferentiated viable limbal stem cells for allogenic use in biocompatible patients in the need thereof.
The present invention tissue system with undifferentiated stem cells can remain viable till period of about 24 hours at about 4° C. In accordance with the present invention the post culture viability of the tissue system with undifferentiated limbal stem cells was carried out to evaluate the viability of the tissue system after it reaches the required hospital for transplantation. The viability the tissue system was checked starting from 6 hrs to 24 hrs (Fig. 15) and of each tissue system terminated was characterized by an array of stem cell specific limbal and corneal, markers. The success rate was defined in terms of pH of the medium, viability of the cells checked and flat mount of the tissue system prepared which gave the picture of the intact layers of the tissue system.
The present invention tissue system with undifferentiated limbal stem cells
were characterized by stem cell specific markers to confirm the
33

population of undifferentiated stem cells in the tissue system. The morphology and phenotype of the tissue was analysed by immunofluorescence and immunoperoxidase assays. The deparaffinised limbal culture sections are rinsed with PBS and permeabilised with 0.2% triton x-100 in PBS, blocked with 1% bovine serum albumin/PBS and incubated with the primary antibody (antibody dilution was made in 1% BSA/PBS) is carried out for 2hrs at room temperature. Then the sections are incubated with FITC labeled secondary antibody. The sections were mounted in immunoflour mounting medium and photographed using a fluorescence microscope (Nikon). For immunoperoxidase assay, the protocol followed was according to the Vector Elite kit information. The chromogen used was diaminobenzidine tetrahydrochloride.
The immunofluorescence and immunoperoxidase analysis of the sections of the cultures revealed the presence of about 30 - 70% of SSEA-4 positive cells (fig 6), nearly 25 - 45% of SCF positive cells (fig 7), 30 - 40 % of Tral-60 positive cells(fig 8), 45 - 55% of Oct-4 positive cells along with absence of connexin 43(fig 9 & 10). The analysis of sections also revealed the presence of about 50 -70 % of p63 positive cells(fig 11), presence of positivity to K3/K12 (fig 12) and basal layer expression of K19 (fig 13). The presence of stem cell specific surface in the tissue system confirms the presence of undifferentiated limbal stem cells with self-regenerating capacity. The other markers like K3/ K12, K19, p63 indicate the corneal nature of the limbal stem cells for them to be accepted for successful transplant and ocular repair.
34

In accordance with the present invention there is also provided the means for transportation of the tissue system from centrally located cGMP facility to any distant hospital without loosing its viability and to keep the tissue system transplantable. The tissue system for the said purpose is transported in a specially designed receptacle Consisting of transportation medium same as enriched medium for culture of isolated undifferentiated limbal stem cells for keeping the tissue system viable. The transportation receptacle in accordance with the present invention comprises of a portable, cylindrical housing base open at the upper end to receive the tissue system and closed at the bottom, with parallel means positioned within the upper end of the said housing base for supporting the tissue system fastened on the culture insert and a cap for closing the open upper end of the housing base. The present invention transportation receptacle is constructed of special tissue culture grade plastic-1, medical grade stainless steel like SS 316 L or any other suitable grade, medical grade silicone or any other suitable tissue culture grade material.
The receptacle for transportation of the present invention holds the tissue system in a securely fashion and thereby minimizes the chances of damage during transport and keep in the transplantable condition.
The present invention self-regenerating limbal stem cells tissue system comprising of large population of undifferentiated limbal stem cells is useful in effectively restoring ocular surface impairments particularly with sever limbal stem cells deficiency which could be primary limbal stem cells deficiency like aniridia, keratitis, limbitis or due to idiopathy; or secondary limbal stem cells
35

loss occurring from acquired conditions like infections like Steven-Johnson syndrome or severe microbial keratitis; or traumatic destruction of limbal stem cells caused by chemical or thermal injury or ultraviolet radiation or multiple surgeries or cryotherapies, or corneal intraepithelial neoplasia or keratopathy or toxic effect induced by contact lens or lens cleaning fluids, pterygium and pseudopterygium or peripheral corneal ulcerative keratitis or any other factor. The present invention can be further illustrated by way of the following examples. However the following examples are intended to illustrate some of the embodiments of the present invention and should not be construed as limiting to the present invention scope. The modifications and /or additions to the different aspects of the present invention as described heretofore, is possible without departing from the filed and scope of the present invention.
EXAMPLES
Example 1
Preparation of Amniotic Membrane to serve as tissue base:
The human placental membrane was collected from elective cesarean operation
and transported to the laboratory in the transport medium. The transport medium
comprised of Dulbecco's phosphate buffered saline (DPBS) supplemented with
penicillin and streptomycin 50 unit/ml, neomycin 100 µg/ml and amphotericin B
2.5 µg/ml. Placental membrane was transported to the laboratory within 3 hours
of surgery. Blood samples from each donor was collected and sent for infectious
disease diagnostic test.
36

Placenta was then washed with washing medium so as to remove the mucus and blood clots. Washing medium comprised of Dulbecco's phosphate buffered saline (DPBS) supplemented with penicillin and streptomycin 50 unit/ml, neomycin 100 µg/ml and amphotericin B 2.5 µg/ml. Placental tissue was then cut off from the amniotic membrane using sterile scissors. Amniotic membrane was washed thoroughly at least 7 times to remove all the blood clots from it. Chorion was peeled off from the amniotic membrane with the blunt forceps. Epithelial side was then washed 5 times with the washing medium. Amniotic membrane was then adhered on to the sterile nitrocellulose membrane with epithelial side up. Mounted placenta on nitrocellulose membrane was cut in to 5 cm x 5 cm area and place each of them in a cryo-vials filled with the freezing medium. Freezing medium comprised of 50% glycerol in DMEM. Entire batch of placenta was then stored at -80°C. Sterility, mycoplasma and endotoxin of each batch of processed placenta were checked before using it for limbal culture.
For culture of limbal cells, amniotic membrane was thawed at room temperature for 20 minutes. Amniotic membrane was then removed carefully from nitrocellulose membrane without tearing the surface with the help of blunt forceps. Amniotic membrane was then placed on sterile glass slide in a 100 mm petri plate. 1-1.5 ml of trypsin was then added to cover amniotic membrane and incubated at 37°C for 30 minutes. Epithelial layer of the placenta was then scraped. off with the help of cell scrapper under sterile aseptic conditions. Amniotic membrane was then washed 3 times with washing solution. In the present invention, processed and treated amniotic membrane to be used as a tissue base, was placed in the culture insert having 0.4 µM track-etched
37

polyethylene terephthalate (PET) membrane. Processed human amniotic membrane was fastened to the cell culture insert membrane using number 10 Ethilon non-absorbent suture.
Alternately the processed and treated amniotic membrane to be used as a tissue base, was placed on the culture insert from outside after removing 0.4 µM track-etched polyethylene terephthalate (PET) membrane by surgical blade and fitted with medical grade silicon O ring so as to fastened the amniotic membrane to the cell culture insert.
Amniotic membrane was spread in such a way that the denuded epithelial side faces the inner side of the insert and stromal side faces out of the insert. Amniotic membrane was stretched uniformly and O-ring was then inserted from the bottom to hold the amniotic membrane securely. Alternately amniotic membrane can also be sutured to the basement membrane of the insert. Entire set-up in culture medium in a 6-well dish was then incubated for at least 2 hours. After 2-hours entire culture medium was then removed and pre coated with laminin, fibrinogen or collagen IV singly or in combinations. Amniotic membrane was then washed two times with culture medium and again incubated in culture medium for 30 minutes. Amniotic membrane thus prepared was ready for culturing limbal stem cells.
Example 2
Culture of Biopsy:
The small biopsies of limbal epithelium of size 0.8 mm to 2 mm were removed
38

surgically from superior or temporal quadrant of the corneal surface which the rich loci for limbal stem cells, by lamellar keratectomy from the eye. Institutional review board approval was obtained before initiation of the procedure. Informed consent was obtained from patient and/or donor, and all human subjects were treated according to the Helsinki Accord. The biopsy thus obtained was then immediately put in 2-ml transport vial along with transport medium and transported to the main cGMP laboratory for the further processing.
The limbal biopsies thus derived were washed with ringer solution and made into small pieces. Small pieces of biopsies were seeded on the biocoated tissue culture plates and dry incubated for the period of 2-5 minutes. After dry incubation, biopsy pieces were placed on the biocoated tissue culture dish in a circular fashion and about 150 ul to 200ul of DMEM medium with 10% knock out serum so that they stick to bio-coated tissue culture surface. Next day 2 ml of medium was again added and incubated for 4 to 5 days at 37°C in C02 incubator. After 4-5 days limbal stem cells started proliferating. All the biopsies were gently and carefully removed using sterile forceps to allow all the limbal stem cells to proliferate. By following this method one can avoid the growth of mesenchymal or fibroblast cells.
Example 3
Isolation of undifferentiated limbal stem cells:
Limbal stem cells proliferating on the biocoated tissue culture plates were
allowed to reach the confluence to about 80%. The cells were subjected to
magnetic affinity cell sorting (MACS). Cells were dispersed with 0.05% trypsin-
39

EDTA. The action of the trypsin was neutralized by adding an equal amount of culture medium that contained trypsin inhibitor.
The cells were pipetted out into single cell suspension. Cells were counted using hemocytometer and resuspended as 10.sup.7 cells in 200 µ.1 of PBS. Cells were then incubated for half an hour at 4°C with 1 ul of primary antibody SSEA-4.
The cells were washed twice to remove unbound antibody. 20 ul of secondary antibody beads was added to 200 ul of cell suspension and mixed well and incubated at 4°C for 20 minutes. Cells were then washed three times with PBS so as to wash out unbound secondary antibody.
Cell suspension was then passed through magnetic column. Negative fraction was collected first. Column was washed again twice with PBS. Column was then removed from the magnet and positive fraction was collected. Positive fraction of the cells was washed twice which comprises of homogenous population of embryonic like undifferentiated limbal stem cells.
The essentially pure population of undifferentiated limbal stem cells thus isolated using MACS was used for culturing on tissue base in presence of enriched medium for developing the tissue system with undifferentiated limbal stem cells with self-regenerating capacity.
Example 4
Culture of undifferentiated limbal stem cells on amniotic membrane tissue base:
40

The homogenous collection of undifferentiated limbal stem cells isolated using MACS or FACS was used for developing tissue system with undifferentiated limbal stem cells with self-regenerating capacity.
The isolated undifferentiated limbal stem cells were seeded on amniotic membrane biocoated with laminin to facilitate adherence of the stem cells onto the amniotic membrane in presence of enriched culture medium. The culture medium comprised of Dulbecco's modified Eagles Medium (DMEM) and F-12 Ham's F-12 in the ration 1:1 enriched with 30% of inactivated human embryonic fibroblast cells and 10 ng/ml of human leukemia inhibitory factor. The enriched medium was supplemented with 10% knock out serum or 10% heat inactivated human serum collected from cord blood, 0.5%, dimethyl sulphoxide (DMSO) 2 ng/ml recombinant human epidermal growth factor (rhEGF), 5 ng/ml insulin, 5 ng/ml transferrin, 5 ng/ml sodium selenite, 0.5 ng/ml hydrocortisone, 50 ng/ml gentamycin and 1.25 \xg/m\ amphotericin B.
Undifferentiated limbal Cells were cultured for a period of 10-15 - 37°C in C02 incubator until a multilayered tissue system with large population of undifferentiated limbal stem cells was obtained. After 10-15 days the tissue system was ready for transplantation.
Example 5
Culture of undifferentiated limbal stem cells on amniotic membrane tissue base:
41

The homogenous collection of undifferentiated limbal stem cells isolated using MACS or FACS was used for developing tissue system with undifferentiated limbal stem cells with self-regenerating capacity.
The isolated undifferentiated limbal stem cells were seeded on amniotic membrane biocoated with Matrigel to facilitate adherence of the stem cells onto the amniotic membrane in presence of enriched culture medium. The culture medium comprised of Dulbecco's modified Eagles Medium (DMEM) and F-12 Ham's F-12 in the ration 1:1 enriched with 50 % of inactivated human embryonic fibroblast cells and 8 ng/ml of human leukemia inhibitory factor. The enriched medium was supplemented with 8% knock out serum or 8% heat inactivated human serum collected from cord blood, 0.5%, dimethyl sulphoxide (DMSO) 2 ng/ml recombinant human epidermal growth factor (rhEGF), 5 (µ,g/ml insulin, 5 µ,g/ml transferrin, 5 (µg/ml sodium selenite, 0.5 µ.g/ml hydrocortisone, 50 u,g/ml gentamycin and 1.25 (µg/ml amphotericin B.
Undifferentiated limbal cells were cultured for a period of 10-15 at 37°C in C02 incubator until a multilayered tissue system with large population of undifferentiated limbal stem cells was obtained. After 10-15 days the tissue system was ready for transplantation.
Example 6
Flow cytometry analysis of biopsy culture and tissue system:
42

To compare undifferentiated limbal stem cells population in the biopsy cultures and in the tissue system the flow cytometry analysis was carried out of the cell samples derived from the cultures grown from the biopsies and that from the tissues system.
The cells were collected from the cultures grown from the biopsies and also from the tissue system developed from the isolated pluripiotent limbal stem cells on amniotic membrane. The cell suspension was made by using sterile phosphate saline (PBS) solution. Permeabilisation of the cells was carried out for nuclear antigens. Cells were incubated with primary antibody for 20 minutes at 4° C. Cells were washed with PBS and again incubated with FITC - conjugate of secondary antibody for 20 minutes at 4° C in the dark. Cells were again washed with PBS and suspended in 400 - 500ul of PBS and loaded onto the cell sorter. The results of the flow cytometry analyis of the biopsy culture and tissue system are as presented in fig. 1 and fig.2.
Example 7
Passaging of undifferentiated limbal stem cells:
The undifferentiated limbal stem cells isolated using MACS or FACS were
seeded on Matrigel coated plates with culture medium. The culture medium
comprised of Dulbecco's modified Eagles Medium (DMEM) and F-12 in the
ratio of 1:1, supplemented with 10% knock out serum or 10% heat inactivated
human serum collected from cord blood, 0.5% dimethyl sulphoxide (DMSO), 2
ng/ml recombinant human epidermal growth factor (rhEGF), 5 µg/ml insulin, 5
µ.g/ml transferrin, 5 µ.g/ml sodium selenite, 0.5 µg/ml hydrocortisone, 4 rig/ml
43

fibroblast growth factor (bFGF), 10 r|g/ml human leukemia inhibitory factor (hLIF), 50 (ig/ml gentamycin and 1.25µg/ml amphotericin B.
The cells get confluent in 8-10 days. After getting confluent, the cells were dissociated and re-plated on fresh bio-coated tissue culture dishes at the rate of 1:3.
The limbal cells were then allowed to proliferate and serially passaged. The limbal cells were serially passaged up to 40 population doublings.
Example 8
Gene Expression Profile:
The cells were collected at the termination point of the culture on amniotic
membrane for RT-PCR.
Total cellular RNA was extracted from the cell pellet using Trizol method and stored at -20°C.
The cDNA synthesis was carried out using Moloney murine Leukemia Virus superscript II reverse trasncriptase and Oligo(dT). The cDNA synthesized was use for PCR amplification with different set of specific primers.
PCR amplification:
The PCR was carried out using cDNA and platinum Taq polymerase. Cycling
parameters were as follows:
44

Denaturation at 94°C for 30s, annealing at 55-65°C for 1 min, depending on the primer and elongation for 1 min. The number of cycles varied between 30-35.
The expression of the genes Rexl, Oct-4, Nanog, BMP2, BMP5, were analysed by RT-PCR. During analysis GAPDH gene was used as a house keeping (control) gene. The gene sequences are presented in the following table and fig. 14.
Table 1:

Gene Sequence Product Size
GAPDH 5'-TGAAGGTCGGAGTCAACGGATTTGGT -3' 5'- CATGTGGGCCATGAGGTCCACCAC - 3' 890
Rexl 5'- GCGTACGCAAATTAAAGTCCAGA - 3' 5'- CAGCATCCTAAACAGCTCGCAGAAT-3' 306
Oct-4 5' -CGRGAAGCTGGAGAAGGAGAAGCTG-3' 5'-CAAGGGCCGCAGCTTACACATGTTC-3' 247
Nanog 5'-CCTCCTCCATGGATCTGCTTATTCA-3' 5' -C AGGGTCTTC ACCTGTTTGTAGCTG AG-3' 262
BMP2 5'-GGAAGAACTACCAGAAACGCG-3' 5' -AGATGATC AGCCAGAGGAAA A-3' 657
BMP5 5'-AAGAGGACAAGAAGGACTAAAAATAT-3' 5 '-GTAGAGATCCAGCATAAAGAGAGGT-3' 303
Thus the above presented data, confirms the presence of undifferentiated limbal stem cells in the tissue system.
45

Example 9:
Viability study of the tissue system:
The viability study of the tissue system transported in a transportation means provided in the present invention was carried out to evaluate the period till which the tissue system can remain transplantable.
The tissue system was transported in the transportation means of the present invention comprising of the specially designed receptacle consisting of transportation medium same as enriched medium for culturing the isolated pluripotent limbal stem cells as stated in example 5. The viability of the tissue system was checked at an interval of 6 hrs, 12hrs, 24 hrs and 48 hrs. The viability was assessed based on the parameters like pH, no. of dead cells and the integrity of the tissue system architect as presented in fig. 16.
46

We claim,
1. A method for generating tissue system comprising large population of mammalian undifferentiated stem cells, preferably human undifferentiated stem cells, derived from corneal limbus tissue suitable for autologous or allogenic use in restoring damaged or diseased ocular surfaces comprising steps of:
i. culturing biopsies obtained from donor on tissue culture plates biocoated with support material in presence of dulbecco's modified Eagles Medium supplemented with knock out serum for expanding corneal limbal cells;
ii. segregating the corneal limbal cells with dispase or trypsin EDTA;
iii. subjecting the segregated cells to specific technique for sorting and isolating pure population of undifferentiated limbal stem cells using stem cell specific surface marker;
iv. selectively augmenting undifferentiated limbal stem cells by culturing undifferentiated stem cells on tissue base in presence of culture medium enriched with conditioned medium obtained from inactivated human embryonic fibroblast cells or culture medium enriched with human leukemia inhibitory factor and further fortified with growth facilitating agent thereby providing tissue system comprising of large population of undifferentiated limbal stem cells amounting to more than 70%;
v. characterizing tissue system with stem cell specific markers selected from group consisting of stem cell factor, stage specific embryonic antigen marker - 4, Tra-1-60, Tra-1-81 Oct-4, Nanog, Rexl, BMP2, hTDGl, hUTF and/or combinations thereof, and corneal stem cell markers are selected from group consisting of K3/ K12, K19, p63 or the like and/or combinations thereof; and
vi. transporting the tissue system in transportation means.
47

2. The method as claimed in claim 1, optionally comprises transporting biopsies obtained from donor in the transportation medium to to cGMP facility for developing the tissue system before culturing.
3. The method as claimed in claim 2, wherein the said transportation medium comprises Dulbecco's modified Eagles Medium (DMEM) and Ham's F-12 in the ration 1:1 supplemented with 3 - 5% inactivated human cord blood serum, dimethyl sulphoxide (DMSO) 0.1% - 0.5%, recombinant human epidermal growth factor (rhEGF) 0.5 ng/ml - 2 ng/ml, insulin 0.5 ug/ml - 5 ug/ml, transferrin 0.5ug/ml - 5ug/ml, sodium selenite 0.5µg/ml - 5µ-g/ml, hydrocortisone 0.1 p.g/ml - 0.5 µg/ml, cholera toxin A 0.01 nmol/1 - 0.1 nmol/1, gentamycin 10 µg/ml 50µg/ml and amphotericin B 0.5 fig/ml 1.25 ug/ml.
4. The method as claimed in claim 1, wherein the said biopsies are dry incubated for the period of 5 - 10 minutes before culturing.
5. The method as claimed in claim 1, wherein the said biopsies are digested with trypsin EDTA or dispase to give single cell suspension before culturing.
6. The method as claimed in claim 1, wherein the said support material for bio-coating culture plates can be selected from matrigel, laminin, collagen IV, fibrinogen, tenascin and fibronectin.
48

7. The method as claimed in claim 1, wherein the said tissue base for culturing undifferentiated limbal stem cells is selected from the group consisting of human amniotic membrane, laminin, collagen IV sheet, fibrinogen, fibronectin, thrombin, fibrinogen-thrombin sheet and matrigel.
8. The method as claimed in claim 1, wherein the said technique for sorting and isolation of undifferentiated limbal stem cells is magnetic affinity cell sorting (MACS) comprising steps of:
i. dispersing cultured corneal limbal cells by suitable agent like dispase or
trypsin EDTA and resuspending dispersed cells in phosphate buffer saline
(PBS); ii. incubating cells with stem cell specific primary antibody and removing
unbound primary antibody by washing; iii. incubating cells with fluorescent isothiocyanate(FITC) labeled secondary
antibody and removing unbound antibody by washing; iv. passing cell suspension through magnetic column, v. collecting negative fraction and washing twice with PBS, vi. collecting positive fraction by removing it from column and washing
twice to obtained homogenous population of cells comprising of
undifferentiated stem cells.
9. The method as claimed in claim 1, wherein the said technique for sorting and isolation of undifferentiated limbal stem cells is fluorescent activated cell sorting (FACS).
49

10. The method as claimed in claim 1, wherein the said tissue base for culturing undifferentiated limbal stem cells is preferably human amniotic membrane.
11. The method as claimed in claim 1, wherein the said tissue base is bio-coated with support material.
12. The method as claimed in claim 1, wherein the said support material for
biocoating tissue base is selected from group consisting of matrigel,
laminin, collagen IV, fibrinogen, tenascin, fibronectin, and thrombin.
13. The method as claimed in claim 1, wherein the said culture medium for selectively augmenting undifferentiated limbal stem cells, comprise Dulbecco's modified Eagles Medium (DMEM) and Ham's F-12 in the ratio of about 1:1, enriched with inactivated human embryonic fibroblast cells 2 ng/ml - 5 ng/ml and human leukemia inhibitory factor 4ng/ml to 12 ng/ml, further supplemented with 5% - 15 % knock out serum or 5% -15 % heat inactivated human serum collected from the cord blood, dimethyl sulphoxide (DMSO) 0.1% - 0.5%, hydrocortisone 0.1 ug/ml -0.5 µg/ml, cholera toxin A 0.01 nmol/1 - 0.1 nmol/1, gentamycin 10 µg/ml 50µ-g/ml and amphotericin B 0.5 µg/ml 1.25 µ.g/ml or any other suitable agent.
14. The method as claimed in claim 1, wherein the said culture medium for selectively augmenting undifferentiated limbal stem cells is fortified with
50

growth facilitating agent selected from group consisting of epidermal growth factor, laminin, fibronectin, insulin, transferrin, sodium selenite, and transferring.
15. The method as claimed in claim 1, wherein the said growth facilitating agent for fortifying culture medium is of human recombinant origin.
16. The method as claimed in claim 1, wherein corneal stem cell specific
marker is p63 .
17. The method as claimed in claim 1, wherein for autologous or allogenic use
,the tissue system is transported in the means for transportation comprising
of specially designed receptacle that comprises of a portable, cylindrical
housing base open at the upper end to receive the tissue system and closed
at the bottom, with the parallel means positioned within the upper end of
the said housing base for supporting the said tissue system fastened on the
culture insert and a cap for closing the open upper end of the housing base
and transportation medium for keeping tissue base transplantable .
18. The method as claimed in claim 17, wherein the said transportation
medium for tissue system is same as the culture medium for isolated
undifferentiated limbal stem cells.
51

19. The method as claimed in claim 1, optionally comprises generating additionally or multiple tissue system for autologous or allogenic use in future.
20. The method as claimed in claim 1, optionally comprises of serially culturing lIimbal stem cells upto 40 population doublings passages without any differentiation or change in characteristic of Iimbal stem cells.
21. The method as claimed in claim 1, wherein said tissue system is useful in restoring ocular surface impairments particularly with Iimbal stem cells deficiency of primary nature like aniridia, keratitis, limbitis or due to idiopathy; or secondary Iimbal stem cell loss occurring from acquired conditions like infections like Steven-Johnson syndrome or severe microbial keratitis; or traumatic destruction of Limbal stem cells caused by chemical or thermal injury or ultrviolet radiation or multiple surgeries or cryotherapies, or corneal intraepithelial neoplasia or keratopathy or toxic effect induced by contact lens or lens cleaning fluids, pterygium and pseudopterygium or peripheral corneal ulcerative keratitis or any other factor.
Dated this day of January 2004
For RELIANCE LIFE SCIENCES PVT.LTD.
52

Documents

Application Documents

# Name Date
1 75-mum-2004-form 5(27-01-2004).pdf 2004-01-27
2 75-mum-2004-form 19(27-01-2004).pdf 2004-01-27
3 75-mum-2004-form 1(27-01-2004).pdf 2004-01-27
4 75-mum-2004-form 3(11-03-2005).pdf 2005-03-11
5 75-mum-2004-form 2(granted)-(11-03-2005).pdf 2005-03-11
7 75-mum-2004-form 1(11-03-2005).pdf 2005-03-11
8 75-mum-2004-drawing(11-03-2005).pdf 2005-03-11
9 75-mum-2004-correspondence(11-03-2005).pdf 2005-03-11
10 75-mum-2004-claims(granted)- (11-03-2005).pdf 2005-03-11
12 75-mum-2004-cancelled pages(11-03-2005).pdf 2005-03-11
13 75-mum-2004-correspondence(ipo)-(18-07-2006).pdf 2006-07-18
14 abstract 1.jpg 2018-08-09

ERegister / Renewals

3rd: 11 Sep 2007

From 27/01/2006 - To 27/01/2007

4th: 11 Sep 2007

From 27/01/2007 - To 27/01/2008

5th: 11 Sep 2007

From 27/01/2008 - To 27/01/2009

6th: 26 Nov 2007

From 27/01/2009 - To 27/01/2010

7th: 26 Nov 2007

From 27/01/2010 - To 27/01/2011

8th: 17 Dec 2009

From 27/01/2011 - To 27/01/2012

9th: 28 Dec 2010

From 27/01/2012 - To 27/01/2013

10th: 12 Jan 2012

From 27/01/2013 - To 27/01/2014

11th: 26 Mar 2013

From 27/01/2014 - To 27/01/2015