DESCRIPTION
METHOD FOR PRODUCING ISOPROPYL ALCOHOI, RY CONTlNtJOUS CULTURE
Technical field
[OOOI] The invention relates to a method of producing isoproyyl alcoliol.
Background Art
[0002] Propylene is an itliportatit basic raw material for sy~~thetriecs ins sucl~as
polypropylene or petrocliemical products, anci propylene widely is used in bumpers for cars,
food containers, films, medical instruments, and tlie like.
Isopropyl alcohol produced fro111 a plant-derived raw material can be co~ivertedt o
propylene thro~~gal id ehydratio~ip rocess. Therefore, isopropj4 alcoliol is expected to be
usefill as a raw ~iiateriafl or carbon-neutral propyle~~e.C onsidering the curreilt situation ill
\\~IiichK yoto Protocol mandates reduction of total amount of greenhouse gas eniitted fion~
developed cou~~tribeys 5% daring tlie period of 2008 to 2012 as compared to tliat it1 1990,
plupylene, \\4iich is carboll-~~eutrails, extremely importa~itf roui the viewpoint of global
ct~viro~~mdeunet to its versatility.
[0003] Ivlicroorgat~ismst l~aat ssi~uilatea plant-derived raw inaterial to produce isopropyl
alcohol me already known.
For exa~liple\,V O 20091008377 discloses that isopropyl alcohol is produced usiiig all
Esrlin.icl~irrc oli ~~~odittioc pdr oduce isoprol~yal lcol~olf ro~ng lucose as a raw illaterial wllile
a semibatch cultivation witli sequential addition of a substrate solutiotl is carried out. It is
described that tl~isis opropyl alcobol-prodoci~~Egs chericlrio coli has excelle~ipt roperties as a
biocatalyst for i~idustrialp roductio~ib ecause of its liigl~is opropyl alcohol selectivity.
[0004] In order to produce isopropyl alcohol at tlie industt.ial level using a culture ~~iethod,
effective production of isopropyl alcohol tl~luughlo ng-term continuous cultivatio~is~
required.
Addressing this request. for exan~plec, ontin~~oucusl tivation of butaool-isopropyl
alcol~oul sing a microorganism separated from the soil belonging to tlie genus Clostridium is
reported in Jor~rrrrrlo j'Biocliet~ricnlE~~giireeri7~1rg(1, ), pp. 9-14, (1993). In this docume~~t,
cot~tinuousc ultivation is performed for 30 days. how eve^ this ~iiicroorganis~ins not
~iiodifiedb y genetic recon~bi~~atainod~ tl~ie, isopropyl alcohol selection ratio thereof is as low
as about 25%.
[0005] Productio~o~f isopropyl alcol~otll irougli long-term semibatch cultivation using an
Escl~erirlrirrr oli nioditied to produce isopropyl alcol~oli s reported in .IB iosri. Bioerrg.,
I
110(6), pp. 696-701, (2010). In this document, isopropyl alcoliol produced is transferred
fro111 tlie culture solution into the gas by gas strippi~lga, nd the isopropyl alcoliol contained in
the gas is recovered usi~igw ater as a capturing solution. Here, an Erlenmeyer flask is used
as tlie culture tank, atid tlie specific surface area of the culture solution is i~icreasedb y
cliarging tlie culture solution in a very small amount, which is 1/10 or less of tlie volume of
tlie flask; fiirtliel; altliougli the cultivation is semibatcli cultivatiori witli sequential addition,
tlie produced isopropyl alcohol as well as tlie culture solution are evaporated, whereby tlie .
amount of tlie culture solutio~di ecreases, and a long operation time of 240 Iiours is possible.
[0006] J. Iild Microbiol. Biotecl~riol3, 3, pp. 834-844, (2006) reports etlia~~cooln tinuous
cultivation witliout aeration, in wliicli a genetically-modified Escliericl~inc oli for ethanol
production. Here, co~iti~iuocuusl tivation witli fluid-cilrulatioti-type fixed bed is carried out
in which, in addition to feeding of a sterilized culture medium to tlie culture tank and drawilig
of the culture solutio~fir o111 tlie culture tauk carried out in general continoous cultivatioo, tlie
solutiolt in tlie culture tank is circulated.
[0007] It is known tliat acetic acid is produced as a by-prodoct in aerobic cultivation using
E.sc11ericliioc oli in which oxygen gas or an oxyge~i-co~itainilgigas is supplied. An illcreased
con cent ratio^^ of accamlated acetic acid causes ililiibitioti of tlie growtl~o f Eschericl~inc oli
atid a decrease it1 tlie efliciency of tlie prodoction of a target protluct. To address this issue, a
DO-Stat metl~odi s well know11 in wliicli tlie aeratio~o~r s tirring late is regulated in order to
suppress l~iglai ccu~nulationo f acetic acid, and ill \vliicli tlie concentratio~io f dissolved
oxygen ill tlie coltore tauk is adjusted to several pp11i ill order to prevent tlepletioti. In regard
to the accumolatioo of acetic acid, Biorecl~. Bioerlg., 36, pp. 750-758, (1990) reports tliat tlie
conce~itrationo f acetic acid at 48 hours in the ordioary semibatcl~c ultivatioli is 35 g/L, that
tlie concentration of acetic acid at 36 liours witli control by tlie DO-Stat metliod is 17 g/L, atid
tliat acetic acid is riot produced in a Balanced DO-Stat ntetliod in wl~iclrie gulation of the
conce~itratioot~f glucose in tlie culture tauk by co~itrool f tlie addition rate of tlie substrate
solutiou in the se~iiibatchc ultivation is also carried out it1 addition to the regulatioti of the
concentration of dissol\red oxygen.
SUMMARY OF INVENTION
Tecluiical Problem
[0008] However, tlie method in \vIiicli tile specific surface area is iticreased for tlie purpose
of long-term cultivation leads to use of at1 excessively large culture tank, aud, therefore, the
metliod is not practical ill the industrial scale. In tlie case of ordi~iarys emibatch cultivation,
altliougli the produciio~i aliioulit of isopropyl alcoltol increases as tlie operation time increases,
2
the volume of culture solution co~lti~~tuoe isn crease, as a result of wl~icha large culture tank
becomes necessary, and the costs for the facilities, maintenance, and operation become
extremely 11igl1w hen the ordina~ys enlibatcli cultivation is employed in industries.
Therefore, the ordinary se~~~ibactuclltliv ation is not suitable for production of general
cl~e~nicparlo ducts.
In regard to the growth of bacterial cells, it is also known that, with the semibatch
cultivatiou, growtl~o f bacteral cells nearly stops in about 16 hours to about 48 hours, and the
isopropyl alcol~olp roduction speed decreases as the cultivatior~t ime further increases. Also
in the techrlology described i n J Biosci. Bioerig., 110(6), pp. 696-701, (2010), it is reported
that productio~o~f isopropyl alcohol stops in 240 hours or thereafter ever1 if a concentrated
nutrient culture mediuo~ is added.
[0009] The production of isopropyl alcol~orle quires oxygen. However, it is described tliat,
with tile techno log)^ described in J. IJICI~.1 4;crobiolB. ioteclrrrol, 33, pp. 834-844, (2006),
plaso~idsre tained by u~~i~ll~~~ofbreiel ibzaectde ral cells begin to be lost since day 2 of the
cultivation in a case ill wl~ichtl ie bacterial cell's oxygen uptake rate becomes 1 m~nol/L/hd ue
to oxygen pern~eationf rom the tube used in tile fluid circ~~latiloin~ei. It is generally known
that, ollce the plas~~~biedgsin to be lost, gro\vtli OF bacterial cells not retaining the plasmids
becomes domina~~t.T htls, the tecl~nologyi s not suitable for cultivation ill which bacterial
cells proliferate for a lolig time. 111 addition. the regulation using the DO-stat ruethod or the
Balanced DO-Stat metliod for the purpose of suppressit~gp roductio~a~c etic acid as a
by-product requires desig~ingo l'a co~~iplicatepdro graoi for tlie regulatio~a~n,d it is ~iecessary
to use pore oxygen, whicl~in currs higl~c osts, in inany cases.
[OOIO] As described above, production of isopropyl alcohol wit11 Iiig11 efficieucy tl~rougl~
econo~nicallya dvantageous continoous cultivation is still desired.
An object of the present inve~~tioisn p rovision of a method of producing isopropyl
alcohol \\,liereby isopropyl alcoliol is stably produced for a long time in a simple and
con\~e~~iieilnant ller wit11 liigl~p roduction etticiet~cyt l~rougcl~o nti~~uoucusl tivation.
Solution to Problem
[00111 Aspect of the inve~~tiopnro vide isopropyl alcohol productioo methods described
belo\\,.
[I] A metl~odo f producing isopropyl alcohol, iocluding:
colturil~ga n isopropyl alcohol-producing Esclrericlrio coli u~idera bacterial cell
grotvtl~c o ~ ~ d i tiino w~h~ic h tile Esclrericlrio coli stably proliferates ill an isopropyl alcol~ol
production period wl~ilec ontinuously supplying a substrate solution to a culture tank and
continuously retnoving a cuiture solution Troln the culture tarth, the substr~teso lotion
3
containing a plant-derived raw material, the culture solution containing a product, the tlumber
of cells of the isopropyl alcohol-producitlg Escl~ericl~iccro li in the culture tank being
maintained during the culturing, and the isopropyl alcol,ol-producing E~clwrichinc oli having
isopropyl alcollol prodt~ctiona bility i~itroducedo r modified by genetic recombination;
bringing the isopropyl-alcohol-~>rod~~cEisncgl l~er.icl~cico~li into contact with the
plant-derived raw material ill the culture tank to produce isopropyl alcohol; and
recovering the isopropyl alcohol produced by the isopropyl alcohol-producing
Escherichio coli fro111 the culture solutiou that contai~lsth e product and tliat has been reinoved
from the ciilture tank.
[2] Tl~epr odoction inethod according to [I], wherein the bacterial cell growth
coudition is a co~lditiowl~h ich provides a specific growth rate of 0.0151h or Ilighel:
[3] Tlle productioil inethod according to [I] or [2], wlterein the culturing is
performed at an oxygen uptake rate of from I0 11~rnol/L11to1 250 m~nol/L/l~.
[4] The production method according to any one of [I] to [3], wherein the
bacterial cell gro\vtli condition is a cot~ditiotwl hicli provides a specific gro\vth rate of 0.02111
or Iligller.
Adva~ltageous Effects of invention
[0012] Accorcling to the invention, a method of proclucing isopropyl alcollol wbereby
isopropyl alcollol is stably produced for a long time in a simple and convenient rnanner with
lligll productio~le fficiet~cyt llrough conti~luousc ulti\~atiotc~al l be pro\lidetl.
BRIEF DESCRIPTION OF DRAWINGS
[0013] Fig. I is a scllematic co~>figuratiod~ialg ram of one example of a continoous culture
ta~lktl iat can be ttsccl in the itlventio~~.
Fig. 2 is a graph that shows a cliatlge over time of the bacterial mass ill the culture
soltitio~lin the culture tank in Example 1 accorditig to the inventiotl atld in Coiiiparative
Example 1.
Fig. 3 is a graph that sllo\\,s a cllange over titne of the mass of isopropyl alcollol
produced in Exatilple 1 according to tllc i~lventio~anl d in Co~nparativeE xample 1.
Fig. 4 is a graph that shows a change over titile of the bacterial mass in the culture
solutio~lin the coltore tank in Eyatnples 2 to 4 accorditig to the invention and in Comparative
Exa~nple2 .
Fig. 5 is a graph that sbows a change over time of the Inass of isopropyl alcollol
produced in Exanlples 2 to 4 according to the inventiotl atld in Comparative Exa~nple2 .
'I
Fig. 6 is a graph that sllows a change over time of tlie plas~llidlo ss ratio in Examples
2 to 4 according to the invention and in Comparative Example 2.
Fig. 7 is a graph that sliows a correlation betweell the OlJR atid the yield of isop~.opy!
alcohol in Examples 5 to 10 accorditlg to tlie invention.
Fig. 8 is a graph that sliows a correlation between the OUR and the isopropyl alcohol
production speed in Examples 5 to 10 according to the invention.
Fig. 9 is a graph that sliows a cliange over time of the mass of isopropyl alcollol
produced in Exaniples 5, 7 and 9 accorditlg to the invention.
Fig. 10 is a graph that shows a change over time of dissolved oxygetl in the culture
tank in Example 5 accordi~lgto tlie invention.
Fig. 11 is a grapli that siiows a cliange over time of dissolved oxygell in the culture
tank in Example 7 according to tlie invention.
Fig. 12 is a grapli that sl~olvsa change over time of dissolved oxygen in the culture
tank in Esa~liple9 accorditlg to tlie inve~ltion.
Fig. 13 is a graph that shows a clia~igeo ver time of the bacterial mass in the culture
solution ill the culture tank ill Example I I according to tlie inventioti.
Fig. 14 is a graph that sl~o\\,sa change over time of the mass of isop~opyla lcollol
produced it1 Example I I according to the invention.
Fig. 15 is a graph tllat sIio\\~sa clla~igeo ver time of the plasmid loss ratio in Example
I I accordi~lgto tlie in\,e~ition.
DESCRIPTION OF EMBODIMENTS
[0014] The metliod of produci~lgis opropyl alcoliol according to tlie invention is a metbod of
producing isopropyl aicollol \i;llicll illcludes:
cultc~ritlga n isopropyl alcohol-producing E.scliericliio coli under a bacterial cell
gro\\ltli condition in \\~hicIit llr Esclter~icltinc oli stably proliferates in an isopropyl alcoliol
productioti period while co~ltinuouslys ui)plying a substrate solutio~lto a culture tank and
contitu~octsly removing a culture solution fro111 tlie culture tank, the substrate soltttiotl
cotltaini~iga pla~lt-derivedr aw material, tlie culture solutio~cl ontai~linga pludoct, tlie nu~iiber
of cells of the isopropyl alc~l~ol-produciEt~s~gI ter.icl~icror li in tlie culture tank beiog
maintained dttri~lgth e culturing. and tlie isopropyl alcol~ol-prodt~cEi~sc~liger .ic11in coli having
isopropyl alcollol prodoctiot~a bility introduced or 1iiodit7ed by genetic recombiliation;
bringing the isopropyl-alcoliol-prodt~ciogE sclterichio coli illto contact wit11 the
plant-derived raw material it1 the cultt~reta nk to produce isopropyl alcohol; and
recoveri~igth e isopropyl alcoliol produced by tlie isopropyl alcoliol-l~roduci~~g
5
Escl~ericl~cioaI i from the culture solution that contains the product and that 11as been renioved
fro111 the culture tank.
LO0151 According to the invention, an isopropyl alcol~ol-producitig Esclrerichio coli that has
isopropyl alcol~opl roduction ability introduced or modified by genetic recombination is
cultured under a bacterial cell growth condition in which the Esclfericliia coli stably
proliferates ill an isopropyl alcohol production period while supply of a substrate solution that
contains a plant-derived raw material to a culture tank and removal of a culture solution that
contains a product from the culture tank are carried out continuously, the number of cells of
the isoproppl alcoliol-producing Escliericl~icrc oli in the culture tank being maintained during
the colturing. Specifically, isopropyl alcol~olis produced wliile tlie isopropyl
alcol~ol-producingE scltericlticr coli is continuously cultured under the specified bacterial cell
growth condition with the nt~t~tboefr cells of the isopropyl alcol~ol-producingE scl~ericliinc oli
being n~aintaineda, s a resc~lto fwhich isopropyl alcol~ocl all be stably produced for a long
tiole in a simple and covenient manner wit11 high production efliciency even in the continuous
cultivation using the isopropyl alcohol-producing Escl~e~.iclc~oilai.
[OO 161 More specifically, in the tec1111ologyd isclosed in, for example, .I. 1 ~ dA. i crobiol.
Bioteclt~~o3l3, , pp. 834-844, (2006): it is described that stable retention ofplastnids in
Escltrvichio coli requires an oxygen uptake rate that is regulated to be 0.6 1nniollLl11 or less.
In addition, there has been no report about a long-tern1 continuoi~sc ultivation using an
Escliericl~i~cor li and employi~lga erobic cultivatio~\\~,it 11 high oxygell uptake rate. These
suggest tl~at,in a case in ml~iclla n unin~n~obilizegde netically-tnotlified Esclfer~icl~iccot li is
used in aerobic coltivation witli oxygen supply, bacterial cells that 11ave lost the plasmids
increase over time, and tl~usth e production speed of a target product is expected to decrease
in long-term continuous cultivatiou. In addition, in a case in wl1ic11 i~ntnobilizedb acterial
cells are used, tlie extent of contact between the bacterial cells and oxygen decreases, and thus
it is suggested that the procluction speed of a target product decreases ill aerobic cultivation
that requires oxygen.
In addition, for example, in the tecl~nologdj~is closed in Biotecll. Uioeflg., 36, pp.
750-758, (1990), aerobic sen~ibatchc ultivation witli an operation time of 2 days using
Eselfe~~ichciocl~i is perfortned. Altliougli there is no description witl~re gard to oxpgell
uptake rate, n person skilled in the art can easily presume that the oxygen uptake rate is high
based on that fact that air or pure oxygen is supplied at I vvn~us ing a fer~neotera, nd that the
stirring rotatio~ra~t e is up to 1350 rpnl. It is described that altl~ougtlh~e re is nearly no
intlue~~fcreo m the loss of plasn~idsa t aboi~dt ay 2 of tlie cultivation, gro\\rt11 is inhibited and
the pl.oductio11s peed oTa target prodoct decreases doe to ltigl~a cct~~i~olaotfi aoc~et~ic acid ill
6
the case of aerobic cultivation, arid that the concentration of dissolved oxygen most therefore
be cotltrolled by the DO-Stat ~netliodt,l le Balanced DO-stat metliod or the like.
[0017] 111 contrast, in tlie invention, the inventors focusetl on the behavior of tlie isopropyl
alcohol-producing Escltericllia coli in tlie the isopropyl alcohol production period, which
comes after certain tiiile from the start of tlie cultivation, rather tlla~lth at in tlie initial period
in wliicli the isoproppl alcohol-producing Escltericl~iac oli is added to tlie culture tank, and the
irive~itorsa djusted the culture condition in the isopropyl alcoliol productio~pl eriod to a
condition in wllicli tlie bacterial cells stably proliferate. Due to this, isopropyl alcoliol can be
produced, using a simple arid convenient culture method, for a long tinie in aerobic cultivation
without a decrease in the isopropyl alcoliol production efficiency of tlie isopropyl
alcoliol-producing Eschericllio coli, even when a complicated control of the concentratioti of
dissolved oxygen or the concentration of glucose in tlie cclltt~reta nk according to tlie DO-Stat
method or tlie Balanced DO-stat metl~od is not performed.
Furtl~er~norbey, adjusting the aeration and stirring conditions to be witltin ranges
suitable for productioo of isopropyl alcoliol, isoprop)~l alcoliol can be prodticetl more
effectively.
[OO 181 Any nu~nericalr ange expressed Iierciti usirig "to" refers to a range iocluding tlie
numerical values before and after "to" as tlie minimom and niaxiiiiam values, respectively.
Tlie scope oftlie tenn "process" as used herein includes not only a discrete process,
but also a process tliat cannot be clearly distinguislied fro111 another process as loilg as tlle
expected purpose of tlie process of interest is acliieved.
In a case in wliich the amotlnt of a component that !nay be included in the
composition is indicated in tlie invention, when tliere are plural sobstances corresponding to
tlle co~nponeoitn tlle coniposition, tlie indicated alnouiit nieaas tlle total amount of the plural
sltbstances present in the co~nposition, unless specificalls stated otherwise.
The invention will be described below.
[OOI 91 Tlle isopropyl alcoliol-producing Eschericlricr coli in the inventio~ii s an Escl~ericllin
coli tliat has an isoprol)yl alcoliol production system for prodiiciog isopropyl alcol~ol. Since
E.~clrer.iclric~o~li does not inllerently have a system that produces isopropyl alcoliol, the
isopropyl alcol~ol-prodocingE schericlticr coli according to tlie invention is an Esclterichia coli
that possesses the ability to produce isopropyl alcol~olw liicli llas been introduced or modified
by genetic recombination. Tlie isopropyl alcoliol production systeiii may be any system tliat
causes a target Escl~erirltirrc oli to prodt~cei sopropyl alcoliol. At least a part of tlie isopropyl
alcoliol production system may be introduced or lnodified by genetic reconibination. Known
nictl~odsin ny be e~nployedfo r the i~~troductioonr modificatio~lb y genetic recombioatio~~,
7
such as homologous reco~nbination into a genome or introduction nsing a plasnlid.
[0020] Tlie isopropyl alcoliol-producing Eschericltin coli in the invention is preferably an
Eschericliio coli of which tile enzyme activity involved in production of isopropyl alcol~olis
enhanced. The scope of the phrase "by genetic recoolbination" encolllpasses any change in a
base sequence caused by insertion of an extrinsic base sequence having a different sequence
fro111t hat a base sequence of an innate gene, or by substih~tiono r deletion of a certain region
of a gene, or by any co~llbinationtl lereof. For example, the genetic recombination may
result fron~m utation.
[0021] It is n~orep referable that four types of et~zytneac tivities - an acetoacetate
decarboxylase activity, an isopropyl alcollol dellydrogenase activity, a CoA transferase activity,
and a thiolase activity - are imparted from outside the bacterial cell into the isopropyl
alcohol-producing Eschericllin coli according to the invention, or that tlie expression of the
four types of enzyme activities is enhanced in tlie bacterial cell, or that both of these are
carried out.
[0022] Tlie tl~iolasei n tile invention refers to a generic name of enzymes which are
classified as enzynie code nunibet.: 2.3.1.9 based on tlie Report of the Enzy~neC ommission of
Inter~~ationUaln io~o~f B ioclleniistry (l.U.B), and wllicli catalyze a reaction of producing
acetoacetyl CoA fro111 acetyl CoA.
TIie acetoncetate decarboxylase in tlie invention is a generic name of enzymes which
are classified as enzyme code number: 4.1.1.4 based on the Report of tlie Enzyme
Conin~issio~f~ Iin ternational Uoioci of Biocl~cniistry(I .U.B), and wliicl~c atalyze a reaction of
producing acetone from acetoacetic acid.
The isopropyl alcohol dehydrogenase ill t11e invention is a generic nanle of enzymes
wl~icalr~e classified as enzytiie code nunlber: 1.1.1.80 based on the Report of the Enzyme
Commission of International Union of Bioche~nistry(I .U.B), and which catalyze a reaction of
producing isopropyl alcoliol fro111 acetone.
The CoA transferase it1 the in\'ention is a generic nanle of enzymes whicli are
classified as enzyme code number: 2.8.3.8 based 011 the Report of the Enzyme Commission of
It~ternationaUl nion of Biocl~emistry( I.U.B), and wl~iclci atalyze a reactio~io f producing
acetoacetic acid fro111 acetoacetyl CoA.
[0023] In the invention, an example of an isopropyl alcoliol-producing Escltericlrirr coli
equipped \\.it11 an isopropyl alcoliol production system is the plPAIB strain or the pIaadB
strail1 described in WO 20091008377. The scope of t11e Escl~~riclticcro li i~~cludae sst mi11
(which is also referred to as a "p1afB::atoDAB strain"), in \vl~ich,fr o111 among tlie enzymes
involved in tlie production of isopropyl alcohol, tl~eC oA t~ansfewsea ctivity and the tl~iolasc
8
activity are enhanced by e~iliancingth e expression of respective genes tliereof in tlie genome
of the Escl?er.icI~icco~l i, and it1 wliicli tlie isopropyl alcoliol dehydrogenase activity and tlie
acetoacetate decarboxylase activity are enliaoced by enlia~~cintlgie expression of respective
genes thereof using a plasmid.
[0024] A reco~iibinatitE sc11er.ichiac oli having a inore effectively improved isopropyl
alcol~olp roduction efficiency inay be used, and an exaul~pleth ereof is inactivated GntR
activity, inactivated glucose-6-phosphate isomerase (Pgi) activity, inactivated
pliospliogluconate dehydrogenase (G~id)a ctivity, and enhanced
glucose-6-phosphate- I-dehydrogenase (Zwt) activity. Tlie combination of theses can
drastically iniprove tlie productio~ei fficiency of isopmpyl alcoliol as compared to other
combinations of factors or enzymes.
[0025] The glucose-6-pliosplate iso~nerase(P gi) in the invention is a generic name of
enzymes which are classified as enzyme code {lumber: 5.3.1.9 based 011 tlie Report of the
E~izynieC onimissio~ol f Internatio~ialU ~iiotio f Biochemistry (I.U.B), and wliicl~c atalyze a
reaction of producing D-fructose-6-phosphoric acid fro111 D-glucose-6-phosplioric acid.
[0026] Tlte glucose-6-pl1ospl1ate-I-deliydroge1ia(sZew f) in the i~iventiois~ a~ g eneric name
of euzy~uesw liicli are classified as enzyme code ~iutnber:1 .1 .I .49 based on the Report of the
Et~zymeC ommissio~oi f I~~ternatiooUaln ioti of Biochemistry (I.U.B), and ivl~iccl~at alyze a
reaction of producing D-glucono-I,5-lactone-6-pliosphoriacc id fro111D -glucose-6-pl1os~~I1oric
acid.
[0027] As a gene of tlie glucose-6-pliospliate-I-deliytlrogenase (Zwt) used ill the invention,
a DNA having tlie base sequence of a tliiolase-encoding gene of any of the above-mentio~ied
source organisms or a syl~tlieticD NA sequence syntliesized based 011 a know11 base sequence
of the gene can be used.
[0028] Tlie phospliogli~co~iadteh ydrogenase (Gad) in tlie invention is a generic llanle of^
enzymes \vliich are classified as elizyme code iiumber: 1.1.1.44 based on the Report of the
E~~zy~Cloiem ~iiissio~ofl International Utiio~io f Biocliemistry (I.U.B), atid wliicli catalyze a
reaction of producing D-ribulose-5-phosphoric acid and COz from 6-pliosplio-D-glucotiic
acid.
[0029] Exaniples of preferable e~iibodime~iotsf the isopropy I alcoliol-produci~igE scl1er.ic11ic1
coli include a strain obtained by the pll'A/B strain, plaadB strain or p1dB::atoDAB strain to
inactivate tlie GntR activity tliereof; a strain obtained by rnodifj4ng the pla/B::atoDAB strain
to i~iactivateth e GntR activity atid glucose-6-pliospliate isomerase (Pgi) activity tl~ereofa s
well as ellhalice tlie glucose-6-pliospliate-I-dehydrogenase (Zwft activity thereof; and a strain
obtni~~chtyl ~nodifyi~tihge pIdB::otoD;\B strain to illactivate tlie GntR activity,
9
glucose-6-pl~ospl~aitseo merase (Pgi) activity, attd pl~ospl~ogluconadtee hydrogenase (Gnd)
activity thereof as well as enhance the glucose-6-pl~ospl~ate-l-del~ydrogen(aZswe f) activity
tl~ereof.
[0030] In tlle method of producing isoplupyl alcol~oal ccording to the invention, isopropyl
alcol~oils produced fro111 a plant-derived raw tl~ateriabl y continuous cultivatioti using the
isopropyl alcol~ol-producingE scl~ericl~cioal i described above.
The tuethod of producing isopropyl alcol~oli ncludes, specifically:
culturii~gth e isopropyl alcohol-producing Escherichio coli under a bacterial cell
growth conditio~in~ w hich the Eschericliin coli stably proliferates in an isopropyl alcollol
productiotl period wit11 the number of cells of the isopropyl alcol~ol-producingE scl~ericl~in
coli in the culture tank being inaintained, while a substrate solutio~co~n taining a plant-derived
raw nlaterial is continuously supplied to the culture tank and a culture solution that contains a
product is conti~lito~csrlyet noved from the culture tank (hereinafter also referred to as a
"culture process");
bringing the isopropyl-alcol~ol-proc111ciEngs cl~er.icl~icrorl i into contact with tlle
plant-derived ra\v material it1 the culture tank to produce isopropyl alcol~ol( Ilerei~laftera lso
referred to as the "productio~lp rocess"); and
recoveriog the isopropyl alcol~olp roduced by the isopropy 1 alcol~ol-prodt~cing
Eschericllirr coli from the cultore solutio~tlh at contai~lsth e product and that llas been re~l~ovetl
fro111t he culture tank (herei~~aftaelrs o referred to as a "recove~yp rocess").
[003 I] Tlle cultivation of the isopropyl alcohol-producing Escl~er.icl~ci~orli in the production
method is performed under a bacterial cell gro\vtl>c ondition ill wl~ictlh~e isopmpyl
alcol~ol-produci~E~sgcl tericl~inc oli stably proliferates wit11 the nonlber of the cells thereof
being tnairltained. Tlie maintaining of the nuoiber of t11e bacterial cells is acllicved by the
supply oftlle substrate solutior~t,h e re~novalo f tlle culture solution, and the cultivation undcr
the bacterial cell growth condition. Due to this, the growth ability of tlle Esche~.iclfioc oli is
nlaintai~lede ven ill tlle isopropyl alcol~olp roduction period, as a result of \\~11iclt1h e
productio~lo f isopropyl alcol~ocl an be maintained eve11 in conti~luousc ultivation.
[0032] In the production n~etllodp, roduction of isopropyl alco11ol is perfortned using
C O I I ~ ~ I ~ U OcItI~S lti\'atio~~T.l terefore, the production process, in \\rl~ictll~e isopropyl
alcohol-producing E.scl~er.icl~cico~li is brought into contact wit11 the plant-derived raw ~naterial
in tlle coltitre tank to produce isopropyl alcol~olp, roceeds simultaneously wit11 the cultt~re
process. Howevel; si111plec ultivatio~lf or gro\vth or iilai~~te~laonfc teh e isopropyl
alcohol-produci~~Egs cl~ericl~icot li, wl~icils~ n ot limited to the bacterial cell growth condition
described above, nlay bc. performed not si~nc~ltaneousl\\y.it 11 tllc procluctiot~p rocess.
10
The recovery process is a process ill w11ic11 isopropyl alcol~opl roduced by the
isopropy l alcol~ol-producingE scl~ericl~ciao li is recovered fioti~tl ie culture solt~tionw liicl~
contains tlie product and which has been reinoved frotii the coltuse tank. 1l1e recovely
process may be perfonned simultaneously with tlie culture process and t11e production process.
Alternatively, the recovety process may be performed not simulta~ieouslyw ith the culture
process and the production process.
[0033] The culture process is perfor~iieda fter tlie conce~itrationo f the bacterial cells in the
initial stage of cultivation reacl~esa bacterial cell colicentration with wl~icltih e number of the
bacterial cells can stably be maintained.
The "bacterial cell conce~itratioiln~ wl~ictll~ie number oftlie bacterial cells can stably
be maintained" in the initial stage of the cultivation is not particularly limited as long as it is a
bacterial cell concentration with which growtli of tlie Escl~ericlrioc oli can be maintained after
tlie start of continoous cultivation, and, for exao~plea, bacterial cell cot~cetitratio~l
conesportding to 2.4 g-dry cell/L in terms of dry mass is suff~eie~it.
[0034] The "cotltinuous ct~ltivation"i n tlie invention iiieans culturing bacterial cells and
producing a target product by the bacterial cells using a ~iietliodi ncluding continuously
supplying the substrate solutioi~d escribed above to a ct~ltoreta nk (Ilereinafter also referred to
as "feeding") and contint~oaslyr emovi~tga culture solution that contains tlie product, as
described in "Principles of Ferlue~~tatioTnc clinology", Stanbury, Peter F.; Wliitakel; Allao,
Center for Acade~iiicS ocieties Japan, 1988, 1114 to p15. In this case, tlie liquid volume in tlie
culture tank is ~ i ~ a i ~ i t aii~~r~nreldyc o nstant by removing, fiotii tlie culture tank, all aiiiount of
the culture solt~tiontl iat is equal to the amou~iot fthe supplied substrate solutiot~.
[0035] Methods for feeding are not partict~larlyl imited, and examples thereof include a
clietuo stat ii~etl~oind \vliicl~f eeding is perforiiied at a constaltt rate, and a iiietl~odin which
feeding is intermittently perfomled in order to reduce loss of tlie carbon source (plant-derived
raw tnaterial). Exaniples of the metl~odi ~\iv Iiicli feeding is inter~nittentlyp erformed iiiclude
a pH stat n~ethod. Tliis pH stat t~~etlioisd a metl~odi ll \\rl~iclia fter feeding of a carbon source
(plant-derived raw material) is once stopped, tlie feeding is resumed based on an increase in
pH, an increase in tlie concelltration of dissolved oxygen, and a decrease in tlie carbon dioxide
con cent ratio^^ in tlie exl~ausgt as, \\.hicli are caused by depletion of tlie carbon source
(pla~~t-deriveradw material) in tlie culture tank, as irldexes.
Tlie scope of tlie temis "co~iti~~uosuiipsp ly" or "continuous remo\ral" in the i~~vention
encompasses feeding neth hods of any manner as long as the liquid volu~iieil l the culture tank
is maii~taii~ende arly constant. Flere, the phrase "the liquitl volutiie in the culture tank is
maintained nearly constant" tneans that a c l ~ a ~ ~ill gtlcie liqoid volu~i~freo m the liquid volunie
I I
in the culture tank at the start of tlie production of isopropyl alcohol is within a range of from
0 volutl,e% to I0 volulne%, and, from tlie viewpoint of the stability of co~~tiououopse ration,
preferably within a range of fro111 0 volu~ne%to 5 volume%.
[0036] As used herein, the phrase "isopropyl alcoliol productio~ip eriod" refers to a period in
wllich isopropyl alcollol is produced after the gro\vtll of the bacterial cells has reached the
steady state. The culture process can be divided, based on the growtli sitoation oftlie
bacterial cells, into a lag phase in which tlie bacterial cells llardly grow immediately after the
start of the production, and a logarith~oicg rowth phase that follows the lag phase. In the
invention, the phrase "growth of bacterial cells reaches the steady state" means a state in the
logaritllmic growtli phase in which the amount of bacterial cells removed by the removal of
tlie culture solutio~iis balanced with the amount of bacterial cells newly provided by gro\\th.
After the growth of bacterial cells reaches the steady state, the concentration of tlie bacterial
cells in the cultt~reta nk becomes constant. The time it takes for the growth of bacterial cells
to reach the steady state varies witli the co~lcentrationo f the bacterial cells and the state of the
bacteriu~ila t tlie time of the start of cultivation, tlte volume of the culture solution, and the
concentration of tlie carbon source to be supplietl. In a case in \\zllicll the concetltratioll of
the bacterial cells at the time of tllc start ofcoltivatio~is~ 0 .08 g-dry cell/L, atid in wliicll the
concentration of carbon source is 2 glL, and in \\lllicl~t lie volunie of tlie ct~ltures olutio~lis 0.5
L, the time it takes 'for the growth of bacterial cells to reach the steady state is ge~lerallyfr om
24 to 48 hours after the the start ofcultivation. Thos, the isopropyl alcol~olp rodoction
period niay be provided at least 24 Ilours aftcr the start of cultivatio~,, and is preferably
provided at least 48th hours after the the start of cttltivatio~~.
[0037] Tl~eb acterial cell growth conditio~n~le alls a conditiol~f or allowing the growth of tlie
bacterial cells after the bacterial cells rcacll tlie logarith~nicg rowtl~p hase. Specificalb: in
the culture system it1 the coltore tank, it is necessary to at least maintain each of the densityof
the cells of tlie isopropyl alcol~ol-producingE schericl~inc oli, the concentration of the
sobstrate solution, and the co~lcentrationo f tlle product within a range in which the growtl~o f
the isopropyl alcol~ol-producingE schericlrirr coli is not inhibited. I11 a case in wllicl~a t least
one selected from the group consisting of a11 excessive density of the cells of the isopluppl
alcol~ol-produciogE sclrericlticr coli or an increase in tlte dead cells of the isopropyl
alcohol-produci~~Eg~ cl~ei.icl~cioclri , an excessive concentration of the substrate solution, and
all excessive concentration of the product occurs, the growth of tlie isopropyl
alcol~ol-produciugE sclrericl~i~cor li stagllates or is inllibited, and tllus the growth of the
isopropyl alcol~ol-produci~E~sgc l~ericl~cioo li cannot be maintained. As a result, tlie
production efticiency of isopropyl in tlle entire alcoliol culture system is impaired.
12
[0038] The bacterial cell growth condition is preferably a condition whicl~p rovides a
specific growtll rate of 0.015n1 or highet; frolorn the viewpoint of maintaining the steady state.
When the specific growt11 rate is 0.015111 or higher, there is a tendency for the growvtl~a bility
of the isopropyl alcol~ol-producingE scllerichio coli in tlle culture system to be maintained by
effective adjustment of the density of the cells of the isopropyl alcol~ol-producii~Egs cl~erichia
coli, the co~~centratioonf the substrate sol~ttiona, tid the concentration of tlie product in a
simple and convenient mannel: The specific growth rate is more preferably 0.02111 or l~ighel;
fi~rtllepr referably 0.025/h or liigl~et;a nd particularly preferably 0.03h or Iiighe~;f rom the
viewpoint of eidiancing the speed of tlle isopropyl alcohol production. In addition, the upper
limit value of tlle specific growtlt rate is not particularly limited, and the upper liniit value of
the specific gro\\?t11r ate is preferably 4/11 or less, more preferably 1/11 or less, fi~rthern ore
preferably 0.5/h or less, and particularlp preferably 0.2/h or less, in consideration of the
generatio11 time of Escherichio coli. A mcmcrical range defined by a preferable upper limit
value a~ida preferable lower limit value selected fro111t hose described above may be a
nome~~icvaal lue defined by a combination ofany ofthe upper linlit values described above
and ally of the lower limit values described above.
[0039] The specific gro\vt11 rate is a glu\\~tIi rate per bacterial inass (=unit bacterial inass, an
increase in tlie Inass of the bacterial cells per unit tioie), and the specific growtl~r ate in the
steady state is represented by Eqoation 1, as described in "Principles of Fermentation
Tech~iology"(P . F. Stanbury, 1988, pl4 to p15). This Equation I is applied to tlle specific
gluwtl~r ate in the invention.
(Equation I)
IL = FIV
p: Specific Growth Rate (li")
F: Sul~plyS peed of Substrate Solution (LIII) ;;. Removal Speed of Culture Solution
(Llll)
V: Liqtrid Volutne in Cultore Tank (L)
[0040] Fro111 Equation I, the supply rate of the substrate solution and tl~ere t~~ovraalt e of the
culture solotio~lv at-). wit11 the liquid volutl~eit 1 the culture tank, and illay be, for example,
fro111 0.0 15 Llh to 4 Llli in a case in \~liichth e liquid volume in tile culture tank is 1 L, and the
supply rate and tl~cre tnoval rate are preferably fr01110 .02 L111 to 4 Llh, and more preferably
fron~0 .025 Lih to I LIII, from the \rie\q,oint of enl~aecingth e isopropyl alcol~olp roductio~~
speed. In a case in wl1ic11 the liquid volume ill the culture tank is I in', the supply rate and
the reiiioval rate rliay be, for example, fro111 0.01 5 ii?/li to 4 m31h, preferably from 0.02 II?/II
to 4 111~111a, nd itlore preikrably f i o 0~.0~25~ in 3/ll to 1 m3nl. from the vie\vl,oi~~otf enl~anci~~g
13
the isopropyl alcol~opl roduction speed.
The volome (size) of the culture tank is not particularly limited, aud culture tauks
ordinarily used it1 production of substances tilay l)e applied. In addition, tile amouut of tlie
solutioti filled illto the culture tank can suitably be set in accordance with the volume of the
culture tank to be used.
[0041] Tlle specific growth rate in the isopropyl alcollol production period may be within the
above-described range. The specific growth rates in periods other that1 tlie isopropyl alcohol
production period are not particularly limited, and lnay be within the same range as described
above, or within a different ratlge from that described above. Wlien the specific growth rate
in periods other tllat~th e isopropyl alcol~opl roduction period is within a range differeut from
that described above, the specific growth rate may be, for example, 0.015/h or less.
Examples of conditiotls, other than the specific growth rate, for maintainiug the
steady state include tlie sugar concetitratiotl of tlle substrate solution, and the tetnperature atid
pH in tlie culture tank. The conditions are tlot particolarly iitnited as loug as the steady state
can be maintained, aud may be conditiotls that can easily be itiferred by a skilled person in the
art.
[0042] In the invetltion, the uuntber oftl~eba cterial cells it1 the isopropyl alcollol production
period is not 1)articlllarly limited, and tlie total bacterial mass in tlie culture tank is preferably
fro~u1 g-dry cell/L to 30 g-dry cell/L, and more preferably from 3 g-dry celVL to 20 g-d~y
cell/L, from tlie viewpoint of el'ficie~ltly produciug isoprol)yl alcollol. Tlie "nlaintainiug of
the iiotliber of tlie bacterial cells" 111c31itsh at the ratio ofcl~angein tlie itu~llbero f tlie bacterial
cells is 30% or snlallel; preferably 20% or smaller, after the bacterial cells have reached the
steady state in whicl~th e nunlber oftlie bacterial cells is a prescribed number. With respect
to tl~en u~i~boefr t he bacterial cells, n~easureiuenta t a waveleilgtll of 660 nm may be
performed using a spectropllotometer as described below, aod a concentration of bacterial
cells calculated according to the equatiotl, I OD660 = 0.3 g-dry celIlL, may be used.
[0043] The production metliod accordiug to tlie invention preferably enlploys aerobic
cultivatiotl from the viewpoint of the efficiency of the isopropyl alcoliol procluction. The
aerobic cultivation in the inventio~ilt leans cultivatio~p~e rfortned in the air or ill tile state in
which oxygen is presetlt, and refers to a state it1 \vhicll at1 alnoutlt of oxyge~pr~o viding at1
oxygen uptake rate of tlie bacterial cells of I mmoVLI11 or higher is prcseut. The oxygen
uptake rate (OUR) refers to tlie amount of oxyge~ci ol~sutnedb y the bacterial cells per unit
titne and unit culture solution. The value obtained according to Equatiotl 2 described below
using the exllaust gas atialysis metllod may be used as the OUR.
(Equation 2)
14
OUR = 7.22 x IO~xN (Q iPiyim - QoP,y&)
V: Liquid Voluoie it1 Culture Tank (L)
Qi and Q,: Air Flow Rates (L/~iiin)a t Air Inlet and Air Outlet
Pi and P,: Air Pressures (MPa) in Air inlet atid Air Otlet
Ti atid To: Absolute Temperature (K) in Air Inlet acid Air Outlet
yi and yo: Molar Fractions of oxygen in Air Irilet and Air Outlet
In a case in wliicli there is only a negligible degree of difference in tlie value of tlie
air flo\v rate, the air pressure, or the absolute temperature behveeti tlie air inlet and tlie air
outlet, tlie value measured at one place map be applied in order to obtain tlie OUR based on
Equatioii 2 described above. Further, the pressures and tlie air pressures in the illve~itiotai re
described in terms of absolute pressures.
[0044] Due to a change in the amount of tlie bacterial cells and the amount of oxyge~i
consumption per bacterial mass during tlie cultivation period, tlie OUR changes depending on
tlie aeration volume, the stirring rotation rate, the temperahlre, tlie pressure, tlie pH, arid the
like . Accordingly, ill order to adjust the OUR to be within tlie range described above, tlie air
flo\v rate, tlie air pressure, and tlie like may suitably be adjusted. The suitable adjust~iient
call be made by a persoti skilled in tlie art based on tlie Equation 2 described above, so as to
obtain a desired OUR value.
In tlie inve~itiont,l ie OUR is preferably hrii 10 ~i~n~ollLto/ l2i5 0 ~ii~iioI/L/liii,o re
preferably fro1112 0 ~iiniollLIIt~o 200 tnciiol/L/l~,i llore preferably from 50 tn11iollL1Ii to 200
oi~iiol/L/ha, nt1 fi~rtliepr referably from 100 nimol/L/ll to IS0 ~i~~iiollL/lWi.1 iw llie OUR is
10 mmol/L/li or liiglier, there is a tendency for by-products, sucli as organic acids atid etlia~iol
sucli as lactic acid and organic acids, to be liiore decreased. When the OUR is 250
~iimol/L/Ioi r lowel; there is a tendency for by-products sucli as carbon dioxide to be inore
-decreased. As a resc~lt,a n OUR within a range of from I0 ~ii~iioI/Lt/oli 250 iiiinol1Llli has a
tet~de~ictoy i~iiproveth e yield of isopropyl alcollol and (lie isopropyl alcohol productio~is peed
via a decrease in tlie production amoutit of by-prodt~cts.
[0045] In tlie inve~itio~cio, ndilio~isf or cultivatioli are preferably set as described below in
order to produce isopropyl alcoliol tilore effectively:
(l)Assumi~igth at tlie liquid volu~iiein tlie culture tank is I L, the supply rate of tlie
substrate solutio~ia nd tlie removalrate of tlie culture solutio~ar~e fro1110 .02 L/h to 4 L/Ii, the
specific gro\\rtli rate is fio~i0i .02/11 to 4/11, and the OUR is frolii 20 inmol/L/li to 200
mniol/L/li;
(2)Asso111ing that tlie liquid \rolonie ill tlie culture tank is 1 L, tlie supply rate of the
sobstlate sol~itioa~nid tlir remo\.nl rate of the culture solotio~ai re fro1110 .02 Llli to I LIII, the
15
specific growtll rate is from 0.02/11 to IAi, and the OUR is fro11120 ~ii~iioWLltIoi 200
n~~liol/LiIl;
(3) Assu~ningth at the liquid volume in tlle culture tank is I L, the st~pplyra te of tlle
substrate solutio~an~d the removal rate of tlie culture solution are from 0.02 L/11 to 0.5 Llll, the
specific growth rate is from 0.02h to 0.5/11, and tlle OUR is from 20 mmol/L/I~ to 200
mmol/L/h;
(4) Assuming that the liquid volu~liein the culture tank is 1 L, the supply rate of the
substrate solution and the removal rate of the culture solution are frolorn 0.02 LA1 to 0.5 L ~ Ith, e
specific growth sate is froni 0.02111 to 0.5111, and the OUR is from 50 mmol/L/h to 200
mmol/L/11;
(5) Assuming that the liquid volume in the culture tank is I L, the supply rate of tlie
substrate solutio~al nd tlie reti~ovarla te of tlie culture solution are from 0.02 Llh to 0.5 LIII, the
specific growtll rate is from 0.02lli to 0.5111, and the OUR is fro111 100 ~i~mol/Lt/oh 180
llllllol/I~lll;
(6) Assu~ningth at the liquid volume in tlle culture tank is I L, the supply rate oftlie
substrate solution and the removal rate of tlle culture solutio~al re from 0.02 Llh to 0.2 L/h, the
specific gron.tll rate is fro1110 .02il1 to 0.2111, aod tlie OUR is fro1112 0 11111ioIlLn1to 200
tu1nol/L/11;
(7) Assu~ni~tlhga t the liquid volu~nein the culture tank is I L, the supply rate of tlie
substrate solution and the removal rate oftlle culture solution are from 0.02 L/II to 0.2 L/Ii, the
specific growtll rate is from 0.02/11 to 0.2111, and the OUR is from 50 1n111ol/l./11to 200
mmol/L/I~;
(8) Assu~ningth at the liquid volurne in the culture taok is 1 L, the supply rate of tlle
substrate solution and the removal rate of tlle culture solotion are from 0.02 L111 to 0.2 Lni, the
specific growthrate is from 0.02111 to 0.2/h, and the OUR is from I00 m11iol1Llh to 180 . .
mmollL~I~;
(9)Assu111ing that tl~eli quid volume in tlle culture tank is I L, tlle supply rate of the
substrate solution and the removal rate of the culture solution are from 0.025 Llh to I L/h, the
specific growth rate is from 0.025/h to 0.2/11, and tlle OUR is frolorn 20 mmol/L/h to 200
llllllollL/Il:
( I 0) Assuming tliat the liquid volume in the culture tank is 1 L, the supply rate of tlle
substrate solution and the selnoval rate of the culture solution are from 0.025 LIIi to I Llh, tlie
specific glu\\'tll rate is from 0.0251h to 0.2111, and tlle OUR is fionl 50 1n1nol1Lh1to 200
m~iiol/L/I~an; d
(I I ) Assullling that tlle liquid volume it1 tile culture tank is I L, the supply rate of tlie
I6
substrate solution and the removal rate ofthe culture solution are from 0.025 Ll11 to 1 L/h, the
specific growtll rate is from 0.025h to 0.2il1, and the OUR is from 100 ~~imol/Lt/oh 180
mniol/L/li.
[0046] The culture condition (I) described above may be applied to production of isopropyl
alco11ol using any of the isopropyl alcol~ol-producingE sche~ichinc oli strains described
below:
(a) pIPA/B strain, pIaaa/B strain,
(b) a strain obtaiiied by modifying the pTa/B::atoDAB strain to inactivate the GntR
activity thereof,
(c) a strain obtained by tmodifying the p1dB::atoDAB strain to inactivate the GntR
activity and glucose-6-pl~ospl~atieso nierase (Pgi) activity tliereof as \\'ell as enhance the
glucose-6-phosphate-I-del~ydrogenase (Zivf) activity tliereof, and
(d) a strain obtained by modifying the p1dB::atoDAB strain to inactivate the GntR
activity, glucose-6-pliospliate isomerase (Pgi) activity, and pltospl~ogluconate deliydrogenase
(Gttd) activity tliereof as well as enhance the glucose-6-pliospl~ate-I-del~ydrogenas(Ze wf)
activity thereof.
Sitnilar to the above, the culture conditioo (2) niay be applied to production of
isopropyl alcollol using any of tlle isopropyl alcoliol-produci~tgE sc/~e~iclrcionl i strains (a) to
(d) describetl above; the culture condition (3) may be applied to prodaction of isopro1)yl
alcohol osing any of tlie isoprop).l alcol~ol-producingE .~cli~~iccloiilin s trains (a) to (d)
described above; the culture condition (4) may be applied to production of isopropyl alcollol
using any of tlie isopropyl alcohol-producing Escliericliin coli strains (a) to (d) described
above; and the cultc~rec ondition (5) may be applied to productio~io f isopropyl alcol~oul sing
any of tlte isopropyl alcohol-producing Escl~ericliiac oli strains (a) to (d) described above.
, . . . 111a ddition, si~nilarly,tl ie cultore conditioti (6) may be applied to production of ~ , . . ..
isopropyl alcol~oul sing any of tlie isopropyl alcoliol-producing Esclicr.iclii~c~o li strains (a) to
(d) described above; the culture condition (7) may be applied to production of isopropyl
alcol~olu sing any of tlie isoplapyl alcoliol-producing Escliericliin coli strains (a) to (d)
described above; the culturc co~ldition(8 ) tnay be applied to production of isopropyl alco11ol
using any of tlie isoproppl alcohol-producing Eschericliin coli strains (a) to (d) described
above; tlle culture condition (9) may be applied to production of isopropyl alcollol using any
of the isopropyl alcohol-producing Esclte~icltinc oli strailis (a) to (d) described above; the
culture condition (10) ]nay be applied to production of isopropyl alcol~olu sing any of the
isopropyl alcoliol-producing Esclit?,'iclii~cro li strains
@)
to (d) described above; and tlle
culture condition (I 1) niay be applied to production of isopropyl alcoliol c~singa ny of the
17
isopropyl alcohol-producing Eschericl~iac oli strains (a) to (d) described above.
[0047] The plant-derived raw illateria\ used in the production process is a carbon source
obtained from a plant, ant1 tlie plant-derived raw material is not particularly limited as long as
it is a plant-derived raw material. It1 the invention, plant-derived raw materials niay refer to
organs such as roots, stalkes, stems, branches, leaves, flowers, and seeds, plant bodies
incloding those plant organs, and decolnposition products of those plant organs. In addition,
the scope of the plant-derived raw material also encompasses carbon sources that can be
utilized as carbon sources by microorganisms during cultivation from among carbon sources
obtained fro111 the plant bodies, the plant organs, or decomposition products thereof.
[0048] The carbon sources included in sucli plant-derived ra\v materials ge~ierallyin clude
saccliarides sucli as starch, sucrose, glucose, fructose, xylose, and arabinose, or herbaceous
and ligneous plant decomposition products or cellulose Iiydrolysates, each of which contains
the above ingredients in large amount, and co~nbinationsth ereof. The carbon sources in the
invention may fi~rtherin clude vegetable oil-derived glycerin and fatty acid.
[0049] Preferable examples of the plant-derived raw inaterial in the invention include
agricultural products such as grain, con^, rice, \\heat, soybean, sugarcane, beet, cotton, and the
like, and combi~iatio~tli~esre of. Tlie usage form thereof as tl~era w inaterial is not
pa~Ticularlyl imited, and may be a crude l~luducts,q iieezed juice, a crt~sliedp roduct, or tl~eli ke.
Alternatively, tlie plant-derived raw material inay be in a form that co~~sisotnsl y of the carbon
sol~wed escribed above.
[0050] Tlie culture tnedium to be used for cultusing the isopuopyl alcohol-producing
Ercl~ericl~cico~li may be any osnally-employed culture mediutn that includes a carbon source,
a 11itroge1s1o urce, inorganic ions, and organic trace elenients, nucleic acids, vitami~~etsc .
required by n~icroorganismsto produce isopropyl alcol~olw, ithout particular restrictioti.
The pH and temperature co~iditionsf or the cultivation in the invention are not
partict~larlyl i~iiiteda, nd the cultivation may be carried out, for example, at an appropriately
controlled pH and temperature \vitlii~a~ r ange of fro111 pH 4 to 9, preferably fro111p H G to 8,
and \\'ithi11a range of fro111 20°C to 50°C, preferably from 25°C to 42'C, and witlii~a~ r ange
of fr01110 to 5 MPa, preferably from 0 to 3 MPa.
[OOjI] The substl.ate solution supplied to tlie cultore tank may be only a solutio~co~n taining
a plant-derived raw material as a carbon source, or a mixed solution of the culture 111ediu111
and a solution c o ~ i t a i ~a~ pil~an~t-gd erived raw inaterial as a carbon source. 111 order to
perfor111 more efkctive cultivation, it is preferable to use, as the substrate solotio~ia, culture
111ediolnt hat cc>ntainst lie plant-derived raw illaterial. In the inventio~it,h e solution in the
culture tank in \\liicl~t llr co~~ti~iiicocu~slt ivntioni s perforti~rdi s si11q)ly referred to by a
18
generic name, "culture solotion".
Tlie amount of tlie plant-derived raw tilaterial in the substrate solution to be supplied
to tlie culture tank niay be 60 mass% or less in terms of carbon source from the viewpoint of
tlie solubility of the raw material, and niay be fro111 5 mass% to 50 mass% fro111 the viewpoint
of tlie isopropyl alcohol production efficiency.
[0052] The aeration volume of gas illto tlie culh~reso lution is not particularly limited.
When cultivation is performed in an aerated stirred tank, and air alone is used as tlie gas, tlie
aeration volu~iieis generally fro111 0.02 vvm to 3.0 vvln (vvm; aeration volunie [~nL]/solution
volunie [mL]l ti~iie[ minote]), and preferably fro111 0.1 vvnl to 2.0 vvm. The aeration volume
for achieving an appropriate OUR varies with tlie type of culture apparatus. In the case of
cultivation io a bobble towel; tlie aeration volume may be adjusted to be, for exaniple, fro111
0.02 vvm to 10.0 vv111.
[0053] Tlie n~etliodo f producing isopropyl alcohol according to the invention may include a
precultnre process before the culture preocess for producing isopropyl alcoliol, wit11 a view to
achieving an appropriate cell nunlber or appropriate activated state of tlie isopropyl
alcohol-producing Eschericl~ioc oli to be used. The preculture process niay be any
cultivatio~ip erformed under usually-e~nployedc ulture conditions suitable for tlie type of
isopropyl alcohol-producing bacterium.
[0054] 111 the recovery process, isopropyl alcohol produced by tlie isopropyl
alcoliol-prodt~cirigE sclleiicl~i~cro li is recovered fro111 the culture solution tliat contains tlie
product and tliat has been removed from tlie culti~reta nk (I~ereinatiera lso referred to as a
"removed solution"). Through tliis operation, isopropyl alcoliol, which is tlie product, can be
recovered fro111 the removed culture solution that contains tlie product.
Methods for recovering tlie isopropyl alcoliol co~~taineind t lie removed solution is
not particularly limited, and, for example, a ~oetliodm ay be employed which includes
re-emoving tlir bacterial cells fro111t he removed solution using centrif~lgatioo~r ~til e like, and
then separating isopropyl alcohol using an ordina~ys eparation ~nctliods uch as evaporatioo or
membrane separation. 111 a case ill wl~icltil ie recovered isopropyl alcol~olis in the state of an
aqueous solutioti, the metl~odo f producing isopropyl alcoliol may further include a
dcl~ydrationp rocess ill addition to the recovery process. Tlia del~ydrationo f isoplupyl
alcohol may be performed using an ordinary nietliod.
[0055] The culture process oiap be a process in wl~ichtl ie isopropyl alcohol-prodocing
Escheiichio coli is cultured while a gas is supplied into a inistore containing Llie isopropyl
alcohol-producing bacterium and a plant-derived raw niaterial, thereby producing isopropyl
alcoliol using tlie Escl~ericlrioc oli . l'lle recovery process ill this case includes a gaseous
19
isopropyl alcohol collection process of collecting isopropyl alcohol in the gas that has
volatilized fro111 the culture soli~tiond oe to the supply of the gas, as well as a recovely process
of isolating isopropyl alcohol @om the collected gaseous isopropyl alcohol.
LO0561 Examples of neth hods for collectitig the gaseous isopropyl alcohol include: cold
condetisation using a condenser; trapping with a scrubber or a trap pipe; and adsorption using
a filter having high adsorption capacity to isopropyl alcohol, such as an active fiber filter. 111
regard to examples of recovery methods for isolating isopropyl alcohol after the collecting,
tlie recovering tnetllods described above may be used as they are, and the recovery method
may be selected, as appropriate, in accordance with the collection metllod.
In this embodiment, a process of collecting liquid isopropyl alcoliol may be included
in addition to the process of collecting the gaseous isoproppl alcohol. In this case, the
collection process may include collecting liquid isopropyl alcohol as well as the gaseous
isopropyl alcollol.
[0057] Exanlples of apparatuses that can be applied for culturing the isopropyl
alcohol-protluci~ig Esclter.iclticr coli wllile supplying a gas to tlie nlixtore may include an
apparatus that includes a cultlire tank, a supply cl~anne\lv llicli is connected to the culture tank
and \vhicli supplies a gas into the interior of tlie n~isedso lutioti ill the ccllture tank, and a
recovering clianoel \\'11icI1 is connected to the cnlture tank and wl~iclir ecovers a gas ill tlie
cultt~reta nk.
Examples of sucll an apparatus include a production apparatus illustrated ill Fig. 1 of
\VO 20091008377 A pamphlette.
In tliis production apparatus, an injection tube for injecting a gas fi.0111 the outside of
the apparatos is connected to a culture tank in which a culture 111ediuoi containing tlie
isopropyl alcol~ol-producingb acteriuni and tlie plant-derived raw material is acco~nodated,
whereby aeration into the culture medititu isenabled.
[0058] The culture tank is connected, via a connection tube, to a trap tank in mhicll a trap
liqoid as a capture liquid is acco~nodated. With tliis structure, a gas or a liquid Illat has
~novedto the trap tank contacts the trap liquid. as a result of wliich bubbling occurs.
As a result of this. isopropyl alcohol produced by aeration cultivationi~in~ the culture
tank is evaporated by aeration and easily separated from the cultore niedio~na, nd is trapped
by the trap liquid it1 the trap tank. As a result. isopropyl alcoliol can be conti~ulously
produced in a more purified fomi in an easy and convenient manner.
[0059] 111 tlie isopropyl alcol~ol-producingE sclior.ic11irrc oli according to tlie invention,
acetone, \\tliicIi is a precursor of isopropyl alcollol, is also produced at the same time. The
acetone obtained is preferably con\.erted into isapropyl alcol~olu sing a kno\vn n~etllod( for
20
example, a tiletliod described in Japa~ieseP atent No. 2786272) after purification thereof using
a ktlown method. This further increases tlie eflicietlcy of cotiversioll from sugar raw
material to isopropyl alcoliol.
[0060] Fig. 1 illustrates one example of a production apparatus that can be applied to the
i~lventiotl. hi Fig. 1, I0 represents a productiori apparahls, 12 represents a fermentation tank,
48 represents a substrate solution tank, 50 represents a pump, 54 represents a controller, 56
represents a removed-solution tank, 58 represeiits a punlp, and 62 represents a trap tank.
Tlie production apparatus 10 iticltides tlie culture tank 12 as an aerated stirred,tatik
for accommodating the bacterial cells and the plant-derived raw material and perfomling the
production of isopropyl alcollol. Tlie production apparatus 10 includes a oiassflow meter 14
for supplying air fro111 all air inlet to tlie inside of tlie culture tank 12, and a condenser 16 for
discharging tlie air in tlie tatik tlirot~gha n exhaust port. A tank internal pressure gauge 18
and all exhaust gas a~lalyze2r 0 are co~i~iectebdeh veen the co~idetiser1 6 and the exhaust port,
whereby the pressure inside tlie tank arid tlie tilolar partial pressure of oxygetl at tlie outlet call
be measured. The exhaust port is introduced into the inside of the trap tank 62, and opens in
the trap liquid acco1lio1odated in tlie illside of tlie trap tauk 62. A teniperature sensor 22, a
dissolved oxygc~si ensor 24, and a pH setisor 26 are disposed ill tlie culture tank 12. In
addition, a disk turbi~ieb lade 28 as a stirring machine is disposed ill tlie culture tank 12, and
tlie disk turbi~ieb lade 28 is controlled aod rotated to stir by a magnetic stirrer 44.
[0061] In additio~l,a band heater 38 is provided around tlie culture tank 12, and a cooling
rod 36 is provided in tlie culture tank 12. A circulation cooli~iga pparatus 40 and an
electromagnetic valve 42 for controlli~iga cooling water cliat~neal re co~ionectedto the cooling
rod 36. A neutralizer tank 30 into which a pH adjosti~iga gelit is filled is arratlged outside tlie
culture tank 12. The tieutralizer tank 30 is provided witli a balatice 34. Tlie pH adjusting
agent can be s~~ppliefrdo1 11t lie tlcutralizer tank30 to the coltciretaok 12 via a pu~iip3 2.
Tlie culture tank 12 is provided wit11 a controller 54 that controls the entire apparatus.
The co~itroller5 4 is connected to tlie temperature sensor 22, tlie tlissolved oxygen selisor 24,
a~idth e pH setisor 26, and i~iformntiona bout the temperature, the DO (dissolved oxygen), and
the pH in tlie reaction solution ill tlie culture tauk 12 call be i~nputtedfr o111t lie respective
setisors illto the coi~troller5 4. 111 addition, tlie controller 54 is contiected to tlie baud Iteater
38 and tlie electro~nag~ietviacl ve 42 for controlli~lga cooli~igw ater cliatinel. Tlie controller
54 i~istructst he band heater 38 and the electro~nagneticv alve 42 for controlling a coolilig
water clia~ilielt o operate so as to control tlie te~iiperature,a s well as ilistructs tlie puoip 32 to
operate so as to control tlie pH, ill accordaoce wit11 the infor~nationfr o111t he respective
selisors.
21
[0062] In addition, tlle production apparatus 10 is provided with the substrate solution tank
48 and the ret~io\led-solitioit ank 56. Tlle substrate solutio~tia nk 48 and tlle
re~noved-solutiont ank 56 are provided wit11 balances 52 and 60, respectively. In tlie
substrate solutio~ta~n k 48, the substrate solutio~iis accommodated, and the substrate solutio~i
tank 48 is connected to the culture tank 12 via the pomp 50. The substrate solution is fed
from tlle substrate solotion tank 48 to the culture tank 12 via tlie ~ ~ I I5I0I. ~ T he nietl~odfo r
the feeding can be adapted to various feed controls such as chenlo stat and pH stat by the
setting of the controller 54, and the ~ L I I I5I0~ o perates based 011 a signal from the controller 54.
[0063] Tlle removed-solution tank 56 is cotulected to the culture tank 12 via the pomp 58.
Tl~ecu lture soliltion is ~ernovedf rom the culture tank 12 by operation of the pu~np5 8, and
introduced into the re~~~oved-soluttiaonnk 56, and accommodated. Tl~ere nioval port is fixed
at a fixed position in the culture tank, so that the liquid level in the culture tank is regolated to
be constant.
Water (trap liquid) llas bee11 filled into the trap tank 62, and iuaintai~ieda t a
prescribed tenlperature, for esa~i~p5l'Cc, for lique@ing vaporized isopropyl alcol~ol. The
isopropyl alcol~olv olatilized in tllr culture tank 12 due to aeration and stirring is introduced
from tile culture tank 12 into tlie trap tank 62 by the operation of the condenser 16, and
trapped ill tlie trap talk 62.
[0064] In the inve~ltionc, onti~luousc ultivatio~is~ perforn~ed1 111dear condition in which the
bacterial cells stably proliferate in at1 isopropyl alcol~olp roduction period wit11 tlle tlumber of
tlle cells thereof being rnai~~tai~tedT.l ~erefolzl,o ng-term production of isopropyl alcoliol is
enabled, and isopropyl alcollol can be produced \\,it11 a liigl~ere ficie~icyti la11t hat in the case
of pmductio~oi fisoplupyl alcol~olb y seu~ibatchc ultivation. Tl~eis opropyl alcollol
productio~e~ff icie~~cacyc ording to tlle inventiocl enables, for example, conti~~oocuusl tivation
, of 240 11 or lo~lgec In this case, it is possible to obtain, for exaniple, %p~'oductionspeedo f
0.7 gfL111 or highel; preferably a production speed of I .O glL1l1 or Iligliel:
EXAMPLES
[0065] Herei~laftet;c sa~llplesa ccording to tlie i~lventio~arle described. Mowevel; the
irtvetltion is 1101 limited thereto. The isopropyl alcohol-producing Eschericliicr coli is not
liniited to the bacterial cells used ill examples. Tl~eis opropyl alcoliol-produci~~Egs cl~ericl~i<~
coli is not particularly liniited as long as it is an Escl~ericl~icor li that produces isopropyl
alcollol.
Furtllel; "%" in tlle descriptiot~si s based on inass unless otl~erwises tated.
[0066] [Co~~slrnctioonf Isopropyl Alcohol-Producing Escl~ericl~iCcr'o li]
22

The entire base sequence of tlie genoniic DNA ofEscliericl~icao li MG1655 strain is
known (GenBank accessio~ln umber U00096), arid the base sequelice of a gene encoding CoA
transferase u subunit of Eschericl~iac oli MG1655 strain (hereinafter also abbreviated to atoD)
has also been reported. Specifically, atoD is described in 2321469 to 2322131 of the
genomic sequence of Escliericl~iac oli MG1655 strain described it1 GenBank accession
nu~nbeUr 00096.
[0067] Tlie protnoter sequence of glyceraldehyde 3-phosphate dehydrogenase (hereinafter
also referred to as GAPDH) frolorn Eschericl~ia coli described in 397-440 in the base sequence
infonnatio~o~f GenBauk accession number X02662 can be used as a base sequence of a
promoter necessary to allow tlie expressio~lo f the gene mentioned above. In order to obtain
the GAPDI-I proniotei; amplification by a PCR method was carried out using the geno~nic
DNA of Escliericliia coli MGI 655 strain as a tenlplate and using
cgctcaattgcaatgattgacacgattccg (SEQ ID No. 1) and acagaattcgctatttgttagtgaataaaagg (SEQ ID
No. 2). The DNA fragment obtained \\'as digested with restriction enzymes MfeI and EcoRI,
as a result of whicli a DNA fragment of about 100 bp encoding the GAPDH proliioter was
obtained. Tlie obtained DNA fragme~a~ntd a fragment obtained by digesting plastnid
pUC19 (GenBaoh accessioti number X02514) wit11 restriction enzyme EcoRl followed by
alkaline phospliatase treatment were mixed togetller, and ligated using a ligase. Thereafter,
competent cells of Eschevicl~ioc oli DFI5u strain (DNA-903, Toyobo Co., Lttl.) \\-ere
tratlsfornied \\,it11 t11e ligntio~ip roduct, and transfortna~ltst hat grew 011 an LB agar plate
containing 50 pg11nL a~npicillin\\ .ere obtai~ied.
[0068] Ten of tlie obtained colonies were individually cultured overnight at 37""C. in an LB
liquid culture medium containing 50 pg/~nLa uq~icillina, rid plasmids were recovered, and
. . plasn1itisfi;oni ivhicli the GAPDI-I jxomoter was not cut out w11eii digested with rebiriction
etlzymes EcoRI and Kpnl \\(ere selected. Further, tlie DNA sequence thereof \\,as cllecked,
and a plasmid i l l \\-11icl1t he GAPDFJ promoter \\!as properly inserted was named pUCgapP.
Tlle pUCgapP obtained was digested witli restrictiotl enzymes EcoRl and Kpnl.
LOO691 Furtllerniore, ill order to obtain atoD, amplification by a PCR metliod was carried out
using tlie geiioniic DNA of Esclrericlii~c~o li MG 1655 strail1 as a tenlplate and using
cgaattcgctggtggaacatatgiIaaacaaaattgatgacattacaagac (SEQ ID No. 3) and
gcggtaccttatttgctctcctgtgaaacg (SEQ ID No. 4). Tlte DNA fragment obtained \\,as digested
with restriction enzyuies EcoRI and KpnI, as a result of wiiicli an atoD fragment of about 690
bp was obtained. This DNA fragment \\:as inised witli pUCgapP that had previously been
digested \iri(Ii restrictio~e~ll zylnes EcoRl and Kpnl, and ligated using a ligase. Thereafiet;
1LJ1
colllpetent cells of Escherichia coli DH5u strain (DNA-903, Toyobo Co., Ltd.) were
traosfornied witli the ligatiot~p roduct, and tra~isfoniiantsth at grew on an LB agar plate
containing 50 pgImL atnpicilliti were obtained. A plasmid was recovered from the bacterial
cells obtained, and it was confirmed that atoD was properly inserted. This plasmid was
named pGAPatoD.
Here, Escl~erichinc oli MG1655 strain is available fro111 the American Type Culture
Collection.
[0070] As inentioned above, the base sequence of atoD in the genoniic DNA ofEsc11erichirr
coli MG1655 strain has also been reported. PCR was carried out nsing the genooiic DNA of
Escl~ericl~cinol i MGI 655 strain as a ten~platea nd using gctctagatgctgaaatccactagtcttgtc (SEQ
ID No. 5) and tactgcagcgttccagcaccttatcaacc (SEQ ID No. 6), wlticl~w ere prepared based on
tlie gene inforn~ationo f the 5' flanking region of atoD in Escl~e~iclc~oilai MG1655 strain, as a
result of \\4iicl1 a DNA fragiiient of about 1 .I kbp was aniplified.
[007 I] In addition, PCR was carried out using the expression vector pGAPatoD prepared
above as a template and using ggtctagagcaatgattgacacgattccg (SEQ ID No. 7) prepared based
on the sequence inforn~ationo f tlie GAPDH pluiiloter of Escl~er.icl~ciaol i MG1655 strain and
a primer of SEQ ID No. 4 prepared based on the sequence information of atoD of Esclle~icl~icr
coli h4Gl655 strain, as a resnlt of which a DNA fragment of about 790 bp having the GAPDH
proiiioter and atoD \\*as obtained.
[0072] Tlie fragtnents tlins obtained were digested wit11 restriction enzynles Pstl and XbaI,
and \\'it11 restriction enzynies Xbal ant1 KpnI, respectively, and the resultant fragments were
mixed with a fragment obtained by digesting a temperature-se~~sitivpela smid pTH 18cs I
(GenBank accession number AB019610) [Hasliitiioto-Gotoll, T., Gene, 241, 185-191 (2000)l
witli PstI and KpnI, and tlie tixixed fragnietits \\,ere ligated using a ligase. Tilereaftel; DH5a
sthi11 was transfornied \\.it11 the ligation prodnct, and transforniants that grew at 30°C oli~an , ,
LB agar plate containing 10 pgIn11 cl~lorat~iphenicwole re obtained. The obtained colonies
were ccultnred over~~igahtt 3 0°C in an LB liquid culture medium containing I0 pglml
clilorarnplie~iicola, nd a plasmid was recovered from tlie bacterial cells obtained.
E.sc11erichin coli B strain (ATCC 1 1303) \\,as transformed \vitl1 this plasmid, and cc~lturecl
overnight at 30°C on an LB agar plate containing 10 pglnll cI~lorampl~enicoaIs, a result of
whicll transformants were obtained. The obtained transformants were inoculated into an LB
liquid culture iiiediun~c ontaining I0 pdn11 cl~lora1i1pl1e1iicoa1n,d cultured overnight at 30°C.
Tl~ecu ltnred bacterial cells obtained were applied onto an LB agar plate contairiing 10 pgl~iil
chlorauiplie~iicol,a nd cultured at 42'C. as a result of whicli colonies \\,ere obtained. Tl~e
obtained colonies were cultured at 30°C for 2 hours in an antibiotic-free LB liquid culture
medium, and applied onto an antibiotic-free LB agar plate, as a result of which colo~~itehsa t
grew at 42'C were obtair~ed.
100731 From the colonies that appeared, 100 colonies were randomly pieked up, and each
individually grown on an antiboitic-free LB agar plate aud at1 LB agar plate containing 10
pg/mI cl~lorampl~e~~aicndo lc,l ~lora~~~pl~er~icol-senscilotliivees were selected. Further, a
fragment of about 790 bp that contained the GAPDH promoter and atoD was amplified, by
PCR, fro111 the cllromoso~nalD NAs of these clones, aud a strain in which at1 atoD promoter
region was replaced by the GAPDH promoter was selected. A clone satisfyillg the above
conditious was named Esclrericl~iac oli, B::atoDAB.
Here, Esclrericliin coli B strain (AKCI 1303) is available fro111 the A~nericanT ype
Culture Collectio~lw, hicll is a bank of cells, ~nicroorganis~nasn, d genes.
[0074]
An acetoacetate decarboxplase gene (adc) of Closiridirrnr bacteria is described in
GenBank accessio~n~um ber b155392, aud an isopropyl alcohol dehydrogenase gene (IPAtlh)
is described ill GettBank accession number AFI 57307.
The promoter sequeuce of glyceraldehyde 3-pl~ospl~adtee ltydmgenase (hereinafter
also referred to as GAPDH) from Eschericliin coli described if1 397-440 in the base sequence
i~~forrllatioonf Ge~lBanka ccession number X02662 cat1 be used as a base sequence of a
promoter necessary to allo~vth e expressio~lo f tile gene proc~pm elltio~leda bove.
[0075] 111 order to obtain the GAPDH promotzr, a~nplificatio~byt a PCR metllod was carried
out using the genotilic DNA of Eschericlri~rc oli MGI655 strain as a template and using
cgagctacatatgcaatgattgacacgattccg (SEQ ID No. 8) and cgcgcgcatgctatttgttagtgaataaaagg
(SEQ ID No. 9), aud the DNA frag~neoot btaiued \\.as digested \\'it11 restriction enzymes NdeT
aud SphI, as a result of wllicl~a DNA fragment of about I I0 bp corresponding to the GAPDH
pronloter was obtainetl. The obtai~ledD NA fragment was mixed ~vitlal fragment obtained
by digesting plasmid pBR322 (GenBauk accessio~1~1u 1nber3 01 749) with restrictio~le ozyntes
Ndel and Sphl, and the mixed fragments were ligated using a ligase. Thereafter, coinpete~~t
cells of Eschericliin coli DHju strain (DNA-903, Toyobo Co., Ltd.) \\?eret rausforlt~edw ith
the ligation pl.otluct, and trausfor~nantsi llat grew OII an LB agar plate co~ltai~~5i0n gpg /mL
a~npicillinw ere obtained. The obtained colo~liesw ere cultured overnight at 37°C in an LB
liquid culture itlledium contair~illg5 0 pg/nlL a~npicillina, nd plas~nidp BRgapP was recovered
ii.o~n the bacterial cells obtained.
[0076] In order to obtain a codon-~notlified isopl.opyl alcol~odl ellydrogenase gene (IPAdll'),
a codon-modified isopropyl alcoliol del~ydrogenaseg ene was designed based on the amino
acid sequence of the isopropyl alcohol dehydrogenase gene of Closividiltr~rb eijeviilckii NRRL
8-593, and the follwoing DNA fragri~ent( SEQ ID No. 10) was prepared by DNA synthesis.
The sequence thereof is shown below.
ATGAAAGGTTTTGCAATGCTGGGTATTAATAAGCTGGGCTGGATCGAAAAAGAGCG
CCCGGTTGCGGGmCGTATGATGCGATGTGCGCCCACTGGCCGTATCTCCGTGTAC
CTCAGATATCCATACCG?TTTTGAGGGAGCTCTTGGCGACCGCAAGAATATGAmT
AGGGCATGAAGCGGTGGGTGAAGTTGTGGAGGTAGGCAGTGAAGTGAAGGATm
CAAACCTGGTGACCGTGTTATCGTCCCTTGCACAACCCCGGATTGGCGGTCTITGG
AAGTTCAGGCTGGTmCAACAGCACTCAAACGGTATGCTCGCAGGATGGAAAm
TCCAACTTCAAGGATGGCGTC7TTGGTGAGTATmCATGTGAATGATGCGGATATG
AATCTTGCGATTCTGCCTAAAGACATGCCCCTGGAAAACGCTGTTATGATCACAGA
TATGATGACTACGGGCTTCCACGGAGCCGAACTTGCAGATATTCAGATGGGTTCAA
GTGTAGTGGTCATTGGCATTGGCGCGGTTGGCCTGATGGGGATAGCCGGTGCTAAA
TTACGTGGAGCAGGTCGGATCA'RGGCGTGGGGAGCCGCCCGATTTGTGTCGAGG
CTGCCAAATI'TACGGGGCCACCGACATTTTGAATTATAAAAATGGTCATATCGTTG
ATCAAG'TCATGAAAC'TGACGAACGGAAAAGGCGTTGACCGCGTGATI'ATGGCAGG
CGGTGGTAGCGAAACACTGl CCCAGGCCGTATCTATGGTCAAACCAGGCGGGATC
ATT I'CGAATATAAATTATCATGGAAGTGGCGATGCGT TATTGATCCCGCGTGTGGAA
TGGGGGTGCGGAATGGCTCACAAGACTATCAAAGGCGGTC'rGTCCCGGGGGAC
G ITTGAGAGCAGAGATGC'TGCGAGATGGTAGTAGTGTI\C~~ACCGTCTTGATCTCAGC
AAACTGGTCACGCATGTATATCATGGGTTCGATCACATCGAAGAAGCCCTGTTh\C'r
GATGAAAGACAAGCCAAAAGACCTGATTAAAGCAGTAGTTATATTATAA
[0077] Amplification by a PCR ~uetliodw as carried out usit~gth e prepared DNA fiagnlent as
a template and using acatgcatgcatgaaaggttttgcaatgctg (SEQ ID No. I I) and
acgcgtcgacttataatatanctactgctttaa (SEQ ID No. 12), and the DNA fragment obtained was
tligcsted witli restrictio~e~nz ymes Spl~aln d SalI, as a result of \vl~icla~ c odon-modified
isopropyl alcohol dehydrogenase fragment of about 1.1 kbp was obtained. The obtained
DNA fragment was mixed witli a fragment obtained by digesting plas~~p~UidC l I9 wit11
restriction e112y111eSsp l11 a11d Sail, and tlie 111isedf ,.ag~iientsw ere ligated using a ligase.
Tilereafter. coolpetent cells of ~scl~er.ichcioul i DHSu strain (DNA-903, Toyobo Co., Ltd.)
were transformetl with the ligation product, and tt.nnsforcnaots that grew on an LB agar plate
containing 50 pg111iLa ~npicillin\\ ,ere obtained. The obtained colonies were cultured
overnigl~at t 37°C in an LB liquid culture n~ediu~cnot ~taioing5 0 pg11nLa ~apicillin,a nd
plas~~lid\\s,e re r?covered from tlie bacterial cclls obtait~zda, nt1 it was co~~firmetthla t the
26
codon-modified IPAdh* was properly inserted: This plasmid was named pUC-I*.
[0078] An IPAdh*-containing eagment obtained by digesting plastnid pUC-I' with
restrictio~en~z ymes Splil and EcoRl was iiiised with a fragment obtained by digesting
plas~iiidp BRgapP with restriction enzymes SphI and EcoRI, and tlie mixed fragments were
ligated using a ligase. Thereafter, conipete~lct ells of Eschericlria coli DH5u strain
(DNA-903, Toyobo Co., Ltd.) mere transformed with the ligation product, and tratlsformants
that grew 011 at1 LB agar plate containing 50 pgIniL atiipicillitl were obtained. The obtained
colonies were cultured overnight at 37°C in an LB liqnid culture medium containing 50
pg1rnL am pic ill it^, and plasniids were recovered from tlie bacterial cells obtained, and it was
co~ifir~nethda t the codon-modified IPAdli* was properly inserted. This plasn~idw as named
pGAP-I*.
LO0791 In order to obtain a codon-modified acetoacetate decarbosylase gene (atlc*), a
codon-modified acetoacetate decarbosylase gene was designed based on tlie aliiit~oa cid
sequence of tlie acetoacetate decarbosylase gene of Clos/ri&orrr c~ce/obul~~IicArT~~CrCr8 24,
and the follo\vi~~DgN A fragment (SEQ ID No. 13) \\.as prepared by DNA syntliesis. The
sequence thereof is sl~o\vb~eil ow.
AECTGAAAGATGAAGTGATTAAACAGATTAGCACGCCATTAACTTCGCCTGCAW
TCCGCGCGGTCCGTATAAATTTC~~AATCGTGAATATT'~AACA~GT~~ACCGTACC
GATATGGACGCCCTGCGTAAAGTTGTGCCAGAGCCTCTGGAAATTGATGAGCCCTT
AGTCCGGTTCGAA.41CArGGCAATGCATGATACGAGTGGCCTGGGTTGCTATACAG
AKI'CAGGTCAGGCTATTCCCGTGI~GC'~TTAAI%GTGTTAAGGGCGACTACCTTCAC
ATGATGTATCTGGATAACGAGCCGGCAAT'rGCCGTAGGTCGGGAATTAAGTGCATA
CCCTAAAAAGCTCGGGTATCCAAAGCTGTTTGTGGATTCAGACACTCTGGTGGGCA
CGTTAGACTATGGAAAACTGCGTGTT.G C, ,G ACCGCGACAATGGGGTACAAACATAA
AGCCCTGGATGCTAATGAAGCAAAGGATCAAAmGTCGCCCGAACTATATGTTGA
AAATCKrCCCCAATTATGACGGCTCCCCTCGCATATGCGACAACGCGAAAA
TCACCGAT~rrAcCGTACATGAAGCTTGGACAGGACCGACTCGACTGCAGnATTc
GATCACGCTATGGCGCCACTGAATGACTTGCCGGTCAAAGAGATTGT'TTCTAGCTC
TCACATTCTTGCCGATATAATCTTGCCGCGCGCGGAAGTCATATACGATTATCTCAA
GT.4A
[OOSO] Amplificatioo by a PCR method \\;as carried out osiog the prepared DNA fragnient as
a template and using acgcgtcgacgctggttggtggaacatatgctgaaagataagtgatta (SEQ ID No. 14)
and gctctagattacttgagataatcgtatatga (SEQ ID No. I$), and the DNA fragment obtained was
digested witli restrictiot~ enzyllles SalI and Xbal, as a result ofwhicli a codon-modified
acetoacetate decarboxylase fragment of about 700 bp was obtained. The obtai~iedD NA
fragment was iiiixed witli a fragment obtained by digesting tlie plas~iiid pGAP-I' prepared
above \villi restriction enzymes Salt and XbaI, and tlie ~iiisedfr aglnents were ligated using a
ligase. Thereafter, competent cells of EscJtericl~inc oli DFI5a strain (DNA-903, Toyobo Co.,
Ltd.) were transfor~iiedw itli tlie ligation product, a~idtr atisforniants that grew on an LB agar
plate co~itaining5 0 kighiiL ampicillin were obtained. Tlie obtai~iedc olonies were cultured
overniglit at 37'C in an LB liquid culture iiiedioni containing 50 k~g11liLam picillin, and
plasmids were recovered froom the bacterial cells obtained, and it was confirmed that adc* was
properly inserted. Tliis plasmid was named p18a*.
[0081] Iii order to obtain a glucose 6 phosphate-1 -deliydrogetiase gene (zwf), amplification
by a PCR method was carried out using tlie genomic DNA ofEscltericltin coli B strain
(GeiiBaok Accessioti No. CP000819) as a template and using
gctctagacggagaaagtcttatggcggtaacgcnaacagcccg (SEQ ID No. 16) and
cgggatccttactcaaactcattccaggaacgac (SEQ ID No. 17), and tlie DNA fragment obtained \\?as
digested with restriction enzynies BamHI and XbaI, as a result ofwl~icha glucose 6
pliospliate I-deliydrogenase fragment of about 1500 bp was obtained. Tlie obtained DNA
fragn~enwt as inixed witli a fi.agment obtained by di~estingtl ie plasmid pl'a* prepared above
witli restriction enzynies Xbal and BatiiFII, and tl~eti iised fragments were ligated using a
ligase. Thereaftel; colnpetent cells ofEscl~e~icl~cioclri DH5o strain (DNA-903, Toyobo Co.,
Ltd.) were transformed \vitli tlie ligation product, and transforniants that grew on all LB agar
plate contai~ling5 0 yg11iiLa tiipicilli~\ii rere obtaitled. The obtained colonies \\'ere cultured
overniglit at 37'C on ao LB liquid culture tiiediuni containing 50 pdmL anipicillin, and
plas~ilidp I*a*zw as recovered from tlie bactel.in1 cells obtained.
[00S2] ~- ~ ... ~, .~ .
The entire base sequence of tlie genomic DNA of Escl~ericl?iccro li MGI 655 is know11
(GenBank accession number U00096), ant1 tlie base sequence of a geue encoding
pliospliogl~icose isomerase of E.sc/iericlricr coli (hereinafter also referred to as pgi) lias also
been reported (GenBank accession number XI 5 196). In order to clo~iea region flanking to
tlie base sequence of tlie gene encoding pgi (1,650bp), four types of oligonucleotide pri~iiers
represented by caggaattcgctatatctggctctgcacg (SEQ ID No. 1 S),
cagtctagagcaatactcttctgattttgag (SEQ ID No. 19), cagtctagatcatcgtcgatatgtaggcc (SEQ 1D No.
20) aiid gacctgcagatcatccgtcagctgtacgc (SEQ ID No. 21) were synthesized. Tlie prinier of
SEQ ID No. 18 lias an EcoRI recognition site at tlie 5'-terminal side tliereof, each of tlie
priiiiers of SEQ ID No. 19 and SEQ ID No. 20 lias a XbaI recognitio~is ite at tlie 5'-terminal
side thereof, and a primer of SEQ ID No. 21 has a PstI recognition site at tlte 5'-terniinal side
thereof.
[0083] The genolnic DNA of Eschericlrin coli MG1655 strain (ATCC700926) was prepared,
and PCR was carried out using the obtained genomic DNA as a template and using a pair of
prinlers of SEQ ID No. 18 and SEQ ID No. 19, as a result of wllicli a DNA fragment of about
1.0 kb (hereinafter also referred to as a "pgi-L fragment") was amplified. In addition, PCR
was also carried out using a pair of priniers of SEQ ID No. 20 and SEQ ID No. 21, as a result
of wllicl~a DNA fragment of about 1.0 kb (I~ereiaaftera lso referred to as pgi-R fragment) was
amplified. These DNA fragments were separated by agarose gel electrophoresis, and
collected. The pgi-L fragment was digested with EcoRI and XbaI, and the pgi-R fragment
was digested with XbaI and PstI. Tllese two types of digested fragments and a fragment
obtained by digesting a temperature-sensitive plasmid pTH18csl (GenBank accession number
ABO19610) with EcoRI and PstI were mised, and allowed to react usilig T4 DNA ligase.
Thereafter, colnpetent cells of Esclrerichiu coli DHSu (manufactured by Toyobo Co., Ltd.)
were transfor~ned\\ ,it11 the ligation product, and tra~~sformantthsa t grew at 30°C on an LB
agar plate containing 10 pglml ~I~lora~npl~enwiceroeI obtained. Plasmids \\.ere recovered
from tlle transformants obtained, and it was confinned that the two frag~uents- a
5'-opstreanl flanking region fiagmetit and a 3'-downstream flanking region fragtnetit of the
gene encoding pgi -were properly inserted in pTH18csl. Tlle plas~ilido btained \\,as
digested wit11 Xhal, and then subjected to blunting treatn,ent with T4 DNA polymerase. Tl~e
resultant DNA fr~gnlenwt as nlixed \\'it11 a DNA fragntent obtained by digesting pUC4K
plas~oid( GenBank accession nuniber XO6404) (Phannacia) with EcoRI and fin~hesru bjecting
tl~eo btained kanamyci~l-resistantg ene to blunting treatment wit11 T4 DNA polymerase, and
the mixed fragments \\.ere ligated i~singT 4 DNA ligase. Subsequently, competent cells of
Esclierichiu coli DI-15u were transformed wit11 the ligation 'product, aiid transformants that
grew at 30°C on an LB agar plate containing 10 pglml c11lora1i1p11enicol and 50 )tg/nil
ka~lan~ycwine re obtained. Plasmids \\,ere recovered fron~th e transfor~nantso btained, and it
was confirmed that the ka~~amycit~-resistgaennte was properly inserted between the
5'-upstream flanking region fragnient and the 3'-downstream flanking region fragment of the
pgi-encoding gene. Tlle plasmid obtained \\,as nanled pTH1 Scsl-pgi.
[OOS4]
Tile prepared Gcliericlria coli B strain, B::atoDAB, was transformed \\,it11 plasmid
pTH18csl-pgi, and cultured overnigl~at t 30°C on an LB agar plate co~itainingI 0 pghnl
cl~lora~npI~eniacnodI 50 {tgllnl kanacnycin, as a resc~lto f wl~ichtr ansformants were obtained.
Tlie obtained transformants were inoculated into an LB liquid culture niedium contaioing 50
pglml kana~iiycina, tid cultured overnight at 30°C. Tlietl, a portion of this culture solutioa
was applied onto an LB agar plate co~itaini~5lg0 11gIrnl katla~i~ycia~s la, result of wliicl~
colorlies that grew at 42'C were obtained. Tlie obtained colonies were cultured at 30°C for
24 llours in an LB liquid culture ~ilediumc ontainitig 50 pg/~iilk anamycin, and further applied
onto at1 LB agar plate contai~~i5~0l gpg /ml kanampcin, as a result of \vllich colollies that grew
at 42'"C were obtained.
[0085] Fro111 tlie colonies that appeared, 100 colonies were randonily picked up, and eacli
indivudually grown on an LB agar plate containing 50 ~iglnikl a~iamycina nd an LB agar plate
containing I0 pghnl clilora~iiplienicola, ~idcl iloramphenicol-sensitive clo~iestl iat grew only
011 the LB agar plate co~itaiui~kigan anlyciti were selected. Fortllerniore, tlie chro~nosomal
DNAs of tliese target clo~iesw ere ampliefied by PCR, and a strain fro111 wliicli a frag~iie~oift
about 3.3 kbp indicating replacement of the pgi gene \\,it11 the kaoampcin-resistant geue could
be aniplified \tias selected. The obtained strain \\.as named B strain atoD getlome
e~il~a~icetl-gpeguie deletion strain (hereinafter also abbreviated to B::atoDABApgi strain).
I-Iere,E scl~er.icl~cio~lri MG 1655 strail1 aud Escl~et.icl~cino li B strain are available
fro111t he A~liericaT~yl pe Culture Collection.
[0086]
?'l~ee ntire base sequence of tlie ge1io11licD NAof Eschcricl~icrc oli B strain is kno\v~l
(Ge~tBatlkA ccessio~lN o. CP000819). and tlie base sequence e~icodi~Gign tR is described in
3509 IS4 to 3510179 of tllc Escl~e~~icclotil~i rB strain getlo~nics equeuc, wliicli is described iri
GeuBa~ikA ccession No. CP000819. In order to clone a regiou flanking to a base sequence
encodittg GntR (gniR), four types of oligouucleotide primers represented by
ggaattcgggtcaattttcaccctctatc (SEQ ID No. 22), gtgggccgtcctgnaggtacaaaagagatagattctc (SEQ
, .
ID No. 23), ctcttttgtaccttcaggacggcccacaaatttgaag (SEQ ID No. 24) and
ggaattcccagccccgcaaggccgatEc (SEQ ID No. 25) were sy~lthesized. Each of tile prioiers of
SEQ ID No. 22 and 25 has an EcoKI recognition site at the 5'-ternlirtal side thereof.
[0087] Tlie ge~io~iiDicN A of Esclterichicr coli B strait1 (GeuBank Accession No. CP000819)
\\
In order to clone a region flanking to the base sequence of a gene encoding
pliospllogluconate deliydrogenase (g~id)f, our types of oligoriucleotide primers represeoted by
cgccatatgaatggcgcggcggggccggtgg (SEQ ID No. 26), tggagctctgtttactcctgtcagggggg (SEQ ID
No. 27), tggagctctctgatttaatcaacaataaaattg (SEQ ID No. 28) and
cgggatccaccaccataaccaaacgacgg (SEQ ID No. 29) \\?eres ynthesized. The pri~nero f SEQ ID
No. 26 has an Ndel recognition site at tlie 5'-terminal side thereof. and each oftlie primers of
SEQ ID No. 27 and SEQ ID No. 28 11as a SacI recognition site at tlie 5'-tertiiinal side tilereof.
111 addition, the pri~nero f SEQ ID No. 29 lias a BalnHI recognition site at the 5'-ternii1inls ide
thereof.
[0089] The geno~nicD NA ofEscl~ericl~cioal i B strain (GetiBaok Accessio~Nl o. CP000819)
was prepared, and PCR was carried out using a pair of primers of SEQ ID No. 26 and SEQ ID
No. 27, as a result of wliicli a DNAfi.ag~iiento f about 1.0 kb (hereinafter also referred to as
gntl-L fragment) was amplified. In addition, PCR was carried out usiug a pair of primers of
SEQ ID No. 28 and SEQ ID No. 29, as a result of wllicll a DNA fiag~~leonft about 1.0 kb
(hereinafter also referred to as gnd-R fragfiient) was amplified. Tllese DNA fragciients were
separated by agarose gel electropl~oresisa, utl recovered. The gnd-L fragnient was digested
wit11 Ndel and Sacl, a~idtl ie gnd-R fragtiient was digested with SacI and BamHI. Tliese two
types of digested fragments were niixed wit11 a frag~iieuot btained by digesting a
teniperature-se~isitive plasmid pTH I Scsl (GenBank accession nunlber AB019610) with Ndel
arid BamHI, and tlie mixed fragments were allowed to react using T4 DNA ligase.
Tl~eleaftelc: onipetent cells of Esc11er.iclticr coli DHSu (~naoufacturedb y Toyobo Co., Ltd.)
\\.ere transfornled with the ligation product: and transfomiants that grew at 30°C 011 all LB
3 1
agar plate containing 10 pg/~iilc liloramphenicol were obtained. Plasmids were recovered
from tlie transforma~itso btained, and it was confirmed that the two fragments of a
5'-upstream flanking region fragmei~at nd a 3'-downstream fla~ikiugr egion fragment of the
gnd-encoding gene were properly inserted in pTH18csI. The plasmid obtained was nanied
pTHl Xcs I - g ~ ~ d .
[0090]
The prepared Escl~ericl~icao li B strain, B::atoDABApgi strait?, was transformed with
plasmid pTH18csi-gnd, and cultured overnight at 30°C on an LB agar plate containing 10
pg/tnl chlorampl~enicoIa, s a result of which transfor~nantsw ere obtained. The obtained
tra~lsfonnantsw ere inoculated iuto an LB liquid culh~rem edium containing I0 pglml
cl~lora~nphenicoaln, d cultured overtiiglit at 30°C. Nest, a portion of this culture solutioii
was applied onto an LB agar plate containic~g1 0 pg/~nlk ana~l~yccinh loramphenicol, as a
result of wl~ichc olonies that grew at 42'C were obtained. The obtai~iedc olonies were
cultured at 30°C for 24 l~otlrsin an LB liquid culture rnediorn, and furtl~ear pplied onto an LB
agar plate, as a result of wllich cololiies that gretv at 42°C were obtait~cd.
[0091] From tlie colonies that appeared, 100 colonies were ra~~domplyic ked up, aud each
individually gro\vn on an I,B agar plate and at1 LB agar plate containing 10 pghnl
cl~lora~~?pl~aen~d~ cihcloorIa~m pl~e~~icol-sei~sciltoivre~ esw ere selected. Furtl~ermoret, he
cl~ro~~~osoDmNaAls of these target cloues \\!ere amplified by PCR, and a strain froin wliich a
fraguieut of about 2.0 kbp indicating deletion of the gild gene could be amplified was selected.
The obtait~eds trait? was natiied B::atoDABApgiAgi~ds train.
[0092]
Con~petenct ells of the prepared B::atoDABApgiAgnd strain was transformed with
plasmitl pTH18csl -gntR, and cultured over~~ight3a0t° C on an LB agar plate contaioing 10
pg111il cl~loramplienicol,a s a result of which transforma~~wtse re obtained. The obtained
tra~~sforcnanwtse re i~~oculateindt o ail LB liquid culture iinediom containing I0 pglml
cl~loramplienicoI,a nd cultured overnight at 30°C. Theii, a portion of this culture solution
was applied onto an LB agar plate containing 10 pg/ml kaoan~pcinc l~lora~~~pl~eansi ac ol,
result of wl~iclci olo~iiesth at grew at 42°C \vcle obtained. The obtained colo~~iwese re
cultured at 30°C for 24 hours in all LB liquid culture n~ediuma, nd filrtl~era pplied onto an LB
agar plate, as a rcsolt of which colonies that grew at 42°C were obtained.
From the colonies that appeared, 100 colonies were ratido~nly picked up, and each
iildividually g r o \ \ ~oi l ail LB agar plate and an LR agar plate contaiuiug 10 pg/ml
clilorampl1enico1. and clilorai~i~>liei~icol-se~~scitloivie~ esw ere selected. Furtl~er~norteh,e
32
chro~~~osorDnNalA s of these target clones were amplified by PCR, and a strain from ~vl~ica h
fragment of about 2.0 kbp it~dicatit~dge letion of the gntR gene could be a~nplifiedw as
selected. The obtained strain was nauned B::atoDABApgiAgndAgntR strain.
[0093] g n t ~
Competent cells of the prepared Esc11er.ichirr coli B strain,
B::atoDABApgiAg~~dAgtltsRtr ain, were transfor~nedw it11 plasn~idp Iba*z,a nd cultured at
37°C overoight on an LB Broth, Miller agar plate containing 50 ~cg11nLam picillin, as a result
of whiclt Escller.icl1in coli B strain, pI*a*dB::atoDABApgiAgndAgntRst rain was obtained.
[0094] [Example I] Co~~tinuoCusu ltivation of Isopropyl Alcohol

An LB culture 111edium (Difco (trademark)LB Blutll Miller) was added into an
Erlenu~eyerf lask in an amount that is 115 of the volu~neo f the flask, and sterilization was
perforined at 121°C for 15 minutes using an autoclave. On the culture medium after the
autoclave sterilizatio~iE, scl~ericl~cino li pGAPIaaa1B strain described in WO 20091008377
was inoculated in an amount of 0.1 vol%. Shaking cttltivatio~lw as perfor~neda t 3S°C in a
tl~ern~ostatcicl ~a~ubfeorr 16 hr, thereby allo\ving the seed bacterial cells to proliferate.
[0095]
l'llen, isopropyl alcohol was p~.oclocedu sing the productio~a~pp aratus 10 s11o\v11i n
Fig. I . The culture tank 12 used had a volume of 5 L, ant1 eacll of the snbstrate solution tank
48 and the re~ltoved-solutiot~an~k 56 llad a volunle of20 L. 20 L ofwater \\!as added into
the trap tank 62, and 111ai11tai11eadt 5°C.
38 inL ofthe precnlture solution \\'as inoculated into the culture tank in \vIiich 750
OILo f an autoclave-sterilized culture mediu111h aving the co~i~positisoh~oiw n in Table I was
co~~taioed. Cultivation was controlled at ordinary pressure, a stirring rotation rate of 700
rpm, an air aeration volu~neo f 1.0 vvm, a cultivatiot~t emperature of 30°C, and a pH of 7.0
(adjusted wit11 a~nmoniaw ater).
A substrate solation having the co~upositios~hlo wn in Table 2 was fed at I I gill until
8 hours after the the start of cultivatio~a~n,d thereafter fed at a feeding rate of 22.5 g/li. The
rate at \vlliclt the culture solution in tl~ecu lture tank 12 \\,as rer~lovedw as set to be equal to the
feeding rate, and the a n ~ o uo~f ~tlt~ ccu lture solution in the culture tank 12 was controlled to be
750 IIIL. The specific gravity of the substrate solutio~\l\ ,as I g/c~n3a, nd the specific glu\\,tl~
rate in the steady state was 0.03111.
I-lere, tlle 48th hour after the the start ofcultivation was judged to be an isopropyl
alcohol production period since the notnber of bacterial cells as measured by the turbidity in
ter~ilso f OD660 got into a constant state at this point of time.
[a0961 Table 1
I I I
Balance: Water
Co~iiponent
Corn Steep Liquor (Manufactured
by NIHON SHOKUHIN KAKO
CO., LTD.)
K2Hp0.1
KFI~PO.,
(NH42s0.1
5.00
0.20
0.20
0.20
[0098] Tlie concentration of isopropyl alcol~olin tile obtained culture solution was measured
[a0971 Table 2
accordi~igto the standard inethod using gas chromatography. Tlie co~~centratoiof t~h~e
Compone~lt
Glucose
CSL,
bacterial cells \\'as i~~easureadt a wavele~~gtolfi 660 tim using a spectrophotometer. The
%
15
5
co~lcentratioo~fi the bacterial cells was calculated, assuming that I OD660 = 0.3 g-dry celllL.
Tlie conce~~tratioonf the bacterial cells was multiplied by the liquid volun~e[ L] ill tlie culture
Bnlaiice: Water
tank to obtain the bacterial inass [g-diy cell]. The results are ssliow~in~ Fig. 2, Fig. 3 atld
Table 3.
I00991
Column temperature: 35'C, 7 ininutes,
temperature elevatation at 12°C/min,
240°C for 5 minutes,
detector temperature: 240°C,
detector: FID.
carrier gas: nitrogen,
flow rate: 6 mL/~nin,
splitless
[OIOO] [Comparative Example I] Sennibatch Cultivation of Isopropyl Alcoliol
Cultivation was perfornied in tlne same liianlier as that in Exatnple I , except that the
the punnp 58 in Fig. 1 was stopped so as not to reniove tlne culture solution. The aunount of
tlne culture solutio~ai t the 144tln hot~rw as 3.8 L. The isopropyl alcohol concentration atid
[0102] 111 Figs. 2 and 3, the black circle represents Example I, and tlie white circle
represents Connparative Example I. From Fig. 2, it is understood that, in tlne seuiibatcln
cniiivatio~i( Comparative Example I), the bacterial Inass in the culture tank is constant fro111
tlne 48th liour on\vards, indicating that tlie bacterium did not proliferate from tlie 48th hour
on\vards. In contrast, it1 the continuous cultivation (Exa~nple I). the bacterial inass in the
cultl~reta nk from the 48th liour onwards is constant althougln the cultare solution was
continl~ouslyr e~iiovedf, ro111w lnich it is clearly u~nderstoodt hat tlie growth of the bacterial
cells reaclied tlie steady state. As a result thereof, as slio\~nin Fig. 3, tlne productiotn of
isoplal)yl alcohol in tlie seniibatcli cultivation (Comparative Example I ) nearly stopped at tlne
96th Inout; and the isoprop)'l alcohol production amoutnt was 55 g196 h. In the case oftlne
contitnuous cultivation (Example I), tlne isopropyl alcohol productio~n aniount \\.as 76.6 g/96 In,
wliicli is higher than that ill tlne semibatch cultivation. In tlne case of~ t.h. e continuous
tlne bacterial mass in tlie culture solution were obtained in the saline manner as that in Example
1. The results are slno\vn in Fig. 2, Fig. 3 and Table 3.
[0101] Table3
Continuous Operati011 Time
[Ill
0
24
30
48
96
120
144
1 174
Example I
Isopropyl Alcolnol
Production Aoioutnt [g]
0.0
9.9
19.0
37.5
76.6
96.7
108.7
125.0
Comparative Example 1
Isopropyl Alcol~ol
Production Amoont [g]
0.0
9.0
18.0
27.0
55.2
57.2
55.5
cultivatioli (Example I ) , the production of isopropyl alcoliol continued even at the 174th haul;
and the isopropyl alcol~ol productiotl amoont was 125 g1174 11. Froni the above, it is clear
that tlie continuous cultivation allows stable prodt~ctiono f isopropyl alcoliol for a long time,
as compared to tlie se~nibatclic ultivation.
[0103] [Example 21 Using tlie pI*a'z/~::atoDABApgiAgndAgnts~t rain described in tlie
[Preparatiot~o f isopropyl alcoliol-producing Eschericllin coli] above, precolture was
perfor~iied in tlie same manner as tliat in Exaniple 1. Then, isopropyl alcollol was produced
using the production apparatus 10 sl~owtii n Fig. 1 . The culture tank 12 used had a volnn~e
of I L, and each of the substrate solution tank 48 and tlie removed-solution tank 56 used had a
volume of 4 L. 4 L of water was added into the trap tank 62, and maintained at S°C.
[0104] 25 mL o f t l ~per eculture solutio~lw as inoculated into tlie culture tank in wliicl~5 00
IIILo fa n autoclave-sterilized culture medium llavi~lgt he conlposition shown in Table I was
colltai~ied. Tlle cultivation mas co~ltrolleda t ordina~yp ressure, a stirring rotation rate of 900
41111, an air aeratiou volume of 2.0 vvni, a cultivation telnperatore of 30°C and a pH of 7.0
(adjusted wit11 ammonia water). Here, tlte amount oft he culture solutio~l\\ ,as controlled to
be 500 niL.
Asobstrate solution having the conlposition sl~ownin Table 4 was fed at 5 g111 until 8
hoors after the the start of cultivatioo, and tllereafter fed at a feeding rate of 60.6 gill. Tile
specific gravity of the substrate solution was I g/cm3, and the specific gro\\,tIi rate ill the
steady state was 0.1212/11. Tlle concentration of isopropyl alcohol and the bacterial Itlass in
the culture solution \\.ere obtained in the sanie inallncr as tllat in Esa~l~pl1e. Tlle results are
shown in Fig. 4, Fig. 5, Table 5 and Table 6.
In order to investigate the loss ratio of the plasmid, LB Broth agar culture nledit~ni I ,
and LB Brat11 agar culture 1nediunl2c ontaining 100 pL/mL a~ilpicillinw, ere prepared. A
solutio~io btained by diluting the culture solutio~ii n tile the cultore tank was applied to the
cultt~lrm edia, and maintained at 30°C. l'lte nomber of the coloilies after 24 Ilours \\,as
counted. It is know11t hat an Rscller.icl~ic~o li l~arbot~~a.i p~llagsm id having ampicillin
resista~lcec an grow on an a~npicillin-co~itaininaga r culture medium, but an Esc11er.iclriac oli
that lost the plastnid canllot grow 011a ll an11)icillin-coutai~li~algg ar culture mediu~n. Based
on tllis k~lowledgct,h e loss ratio of the plasmid was calc~~lateatlc,c ording to the follo\vi~lg
Equation 3, from the number ofcolot~ieos n each oft he agar culture media. The results are
sllown in Fig. 6.
(Equation 3)
Loss ratio of plas~llid= [(Numbero fc olo~lieso n agar culture nledium 1) - (Number
of colonies on agar culture ~nedium2 )]/0\lumber of colonies on agar culture medium 1)
I01 051 Table 4
Colnpotlent
Glucose
Balnnce: Water
[01061 [Example 31
Continuous cultivation was performed in the same manner as that ia Example 2,
except that the feeding rate frotom the 8th hoor onwards \vas changed to 23.5 glh. In this case,
the specific growth rate it1 the steady state was 0.047011i. The conce~itrationo f isopropyl
alcoliol and the bacterial nlass in the culture solution were obtained in the same tnaluner as
that in Example 1, and the loss ratio of the plasmid was obtait~edin the sauile nianner as that in
Exanlple 2. The results are sllo\\'n in Fig. 4, Fig. 5, Fig. 6, Table 5 and Table 6.
[0 1071 [Example 41
Continuous cttlti\,ation was perfomled in tlle satlie olatlner as that in Exaniple 2,
except that tlie feeding rate froni tlie 8th flour onwards was clianged to 12.4 glh. In tliis case,
tlie specific gro\\-th rate ill tlle steady state was 0.0247111. The concentration of isopropyl
alcol~ola rid the bacterial mass in the culture solution were obtained in tlie same manner as
that in Exanlple I , and tlie loss ratio of tlle plasmid \\'as obtained ill the same manner as that in
Example 2. The resu\ts are shown in Fig. 4, Fig. 5, Fig. 6, Table 5 and Table 6.
[O 1 OS] [Comparative Exan~ple2 1
Continuous cultivatiot~w as perfomled in tlie saaie manner as that in Example 2,
except that tlie feeding rate fro111 tl~e8 th 11our onwards was clianged to 7.4 glli. I11 this case,
tlie specific growtll rate calculated from Eqr~atiorl I was 0.0147/11. The concentration of
isopropyl alcollol and the bacterial mass ill the culture solution were obtained in tlle same
manner as that in Example 1. and {lie loss ratio of tlie plasn~idw as obtained in tlle sanle
man~iera s that in Exa~iiple2 . Tlle results are sliown in Fig. 4, Fig. 5, Fig. 6, Table 5 and
Table 6.
Here, tile integrated Inass of isopropyl alcol~olit 1 Table 6 is tlie suln total of tlle
isopropyl alcol~olp roduction amount per u~iitli quid volume produced until tlle operation time
noted, namely a value obtained by dividing tlle sum total of the total Inass of isopropyl
alcohol contained in tlle cultore solution ill tlle culture tank, tlle removed culture solution, and
the trap tank, by the amount of tlle culture solution (0.5 L in tlle present case) in the cultnre
tank nt tlie operatio11t ime noted. Tlle p~otluctiotls peed is an average isopropyl alcoliol
3 7
production speed calculated from tlie integrated mass of isoproppl alcoliol. The satlie sllall
apply liereitlaftei..
[OI 1 I] In Fig. 4, Fig. 5 and Fig. 6, the black circle represents Exaulple 2, the white circle
represents Example 3, the black triangle represents Exaulple 4, and the wllite triangle
represents Counparative Example 2.
In Comparative Exainple 2 (specific growth rate: 0.0 147[11-~])t,h e number of tlie
bacterial cells in tlie culture tauk was not inaintaiiied or proliferated fro111 the 48th hour
on\vartls (Fig. 4), and did tiat reach the steady state. 111 addition, it \\,as found Illat the
production of isopropyl alcollol stopped at the 96th llour (Fig. 5). It is clear frooi Fig. 6 that
tlle loss ratio ofthe plasmid in this case is 80% or Iligher (see Fig. 6).
In contrast. ill Exa~ilples2 to 4, ill \vliicli the cultivatiotl was performed it1 a co~iditio~i
ill wllich the specitic growtll rate \\.as lligller tha~0l .01 47[11-'], the gt.o\vtll of bacterial cells
reacllrd the steady state, long-term continuous operation was possible, aud isopropyl alcohol
could be stably produced.
[O 1 121 [Example 51
Co~~tinuocuusl tivatioo was performed in the salne manner as that in Exauiple 2,
except that the co~npositiono ftlle substrate solution \\,as cllauged to the co~tlpositios~1l1 ow11
in Table 7, and that the stirring rotati011r ate was clia~igedto 500 rpnl.
In calculatior~o f the OUR, tlle value of the massflow meter 14 was adopted as tlie air
flotv rate at the air inlet, and the value oftlie ~llasstlo\\tn~e ter 14 \\.as also atlopted as the air
flo\v rate at the outlet, asst~nli~tlhga t tllat the reduction a~nounbt y co~lsoinptioiol f oxyge~iis
witlli~la tlegligible range. Similar to the above, the value ofthe tank iuternal pressure gauge
18 \\,as adopted as bat11 the air pressure at the air inlet aud tlle air pressure at tlie air outlet.
111 addition. tlie value of the temperature sensor 22 ill tile tank was adopted as both the
absolute temperature at the air inlet ant1 tlle absolute teolperature at the air outlet. Tlie ~nolar
fraction of oxygen at tlle air itilet \\,as assunled to be 0.209, atid the value of the exl~ausgt as
ailalyzer 20 was adopted as tlie molar fractiou of osy_een at the outlet. Tlie value of the
dissolved osygeil sensor in the tank 24 \\,as atlopted as 111s concei~tratioiol f dissolved osygeu.
40
[0110] Table 6
Example 2
Example 3
Exal~~p4l e
Co~nparative
Example 2
Specific Growth
Rate [lil]
0.1212
0.0470
0.0247
0.0147
Integrated Mass of
lsopropyl Alcol~ol
481 g/L/28711
328 glL126711
176 glL126711
64 glL19611
Productiotl Speed
[&fill
1.7
1.2
0.7
0.7
[0113] I11 this example, the air flow rate at tlie air inlet and tlie air outlet was set to 1.0 L/~iiin,
the air pressure at the air inlet and the air outlet was set to ordinary pressure, and the
te~nperattlrea t tl~eai r inlet arid tlie air outlet \\,as set to 30°C. An average value over the
steady state period from tlie 24th hour onwards of the value calculated according to tlie
above-described Equatioti 2 fiunl tlie respective paratneters recorded evely minute was used
as tlie OUR. The calculated OUR it1 this exaniple was 50 m1i1olILM1. In addition, in the
sanie manner as tliat in Exa~nple 1, the concentration of isopropyl alcoliol ill the culture
solution was obtained, and the yield of isopropyl alcol~olr elative to tlie calculated OUR and
the isopropyl alcohol production speed were obtained. The results are sliown in Fig. 7, Fig.
8, Fig. 9, Fig. 10, Table 8 aud Table 9. The specific growtli rate was 0.1200/1i.
[0 1 141 Table 7
Compo~ient
Glucose
I
CSL 15
Balance: Water
[0 1 153 [Example 61
Conti~iuoosc ultivation was performed in tlie same ~nanuera s that in Esa~nple5 ,
except that tl~es tirring rotati011 rate was cl~atigedt o 600 rpm.
In this case, the calculated OUR was 107 ~nmol/L/h. In addition, tlie concentration
OF isoproppl alcoliol ill tlie ciilti~t.es ol~tio\~\'ais obtained ill tile saiiir mantler as that in
Exan~ple5 , and the yield of isopropyl alcol~olr elative to tlie calculated OUR and the
isopropyl alcol~olp rodilction speed were obtnined. Tlle results are shown in Fig. 7, Fig. 8
and Table 8. Tl~esp ecific growtli rate in the steady state was 0.1203/1i.
[OIL61 [Exainple 71
Contieuous colti\~ationw as performed in tlie same n~annera s that in Exa~liple5 ,
except that tlie stirring rotati011 rate was cliaoged to 700 rpm. 111 this case, tlie calculated
OUR \\'as 153 ~iiniol/L/h. I11 addition, the concentration of isopropyl alcol~olin tlie culture
solotion \\,as obtained in the same inatlner as tliat it1 Exan~ple5 , and tlie yield of isopropyl
alcol~olr elative to the calculated OUR and tlie isopropyl alcoliol production speed \\,ere
obtaitied, and the co~icentratiotio f dissolved oxygen \\,as also obtained. T11e results are
shown ill Fig. 7: Fig. 8, Fig. 9, Fig. I I , Table 8 and Table 9. Tlie specific growth rate in tl~e
steady state was 0.1200/h.
[01 171 [Exaiiiple S]
Coillinuous cultivation \\as perfornied in tlie same n~a~i~ais etrl~ aitn Exan~ple5 ,
4 1
except that the stirring rotati011 rate was changed to 800 rpm. 111 this case, the calculated
OUR was 187 mtnol/L/11. In addition, the co~lceritratioloi f isopropyl alcol~olin the culture
solution was obtained in the same manner as that in Example 5, ant1 the yield of isopr'opyl
alcohol relative to tlie calculated OUR and the isopropyl alcohol production speed \\,ere
obtained. Tlie rest~ltsa re shown in Fig. 7, Fig. 8 and Table 8. Tlie specific growth rate it1
the steady state was 0.121 0111.
[0118] [Example 91
Contiouous cultivation was performed in the same manner as tltat in Example 5,
except that the stirring rotation rate was changed to 900 rpm. In this case, the calculated
OUR was 196 mmol/L/I~. In addition, tlie con cent ratio^^ of isopropyl alcol~olin the culture
solution was obtained it1 tlie same manlier as that in Example 5, and the yield of isopropyl
alcol~olr elative to the calculated OUR and the isopropyl alcoliol production speed were
obtained, and tlie concetitration of dissolved oxygell was also obtained. The results are
show11 ill Fig. 7, Fig. 8, Fig. 9, Fig. 12, Table 8 and Table 9. The specific growtli rate in the
steady state \\'as 0.121 0111.
[OI 191 [Exaniple 101
Conti~~uoocus lti\~atiowt~a s perfor~~ieind tlic same maliner as that ill Example 5,
except that the stirring rotation rate w s changed to 400 rpln. In this case, the calculated
OUR \\,as 20 mmol/L/11. In addition, tlie conce~~tratioonf isopropyl alcol~olin tlie culture
soltitio~\\~(a s obtained in the same 111a111iears that ia Example 5, aud the yield of isopropyl
alcol~orle lative to the calculated OUR atld tlie isopropyl alcol~opl roduction speed \Irere
obtai~ied. The results are shown in Fig. 7, Fig. 8, and Table 8. The specific growth rate in
tlie steady slate was 0.1200/11.
[Of211 Table 9
[0122] Wit11 a low OUR, there is a tendency toward generation of lactic acid, which is a
by-prodt~cta, nd tlie isopropyl alcollol productiot~s peed tends to tlecrease. With a 11igl1O UR,
tlie proportion of glucose used for complete osidatio~te~n ds to illcrease, and thus the yield of
isopropyl alcol~otle nds to decrease.
From Fig. 7 and Table 8, it is ul~derstoodth at adjustnlet~to f the OUR to a value
witl~ioa range of from 20 ~li~nol/Lt/oli 2 00 m1nol/L/11f i~rtlicri llcreases tlie yield of isopropyl
alcol~ol. In addition, fro111 Fig. 8 and Table 8, it \:,as found that adjostnent of the OUR to a
value \\tithin a range of from 20 1i1mol/L/11to 200 mmol/L/l~f ~~rtliicnrc reases the isopropyl
alcol~olp roductio~s~p eed.
Although not shown in tlle figures, the acetic acid production speed ill each of
Exatilples 5 to 10 was 0.6 g/L/11 or lo~vel;a nd the etllano productiol~s peed was 0.1 g/Lh or
[0123] A change over time of the integrated 111ass of isoproppl alcoliol is shown in Fig. 9.
In Fig. 9, the black circle represents Exa~~~5p, ltiele black diamond represents Esan~ple7 , and
the black triangle represents Example 9,
As clear from the results of each Example, it is understood that isopropyl alcohol can
be co~~tinuousplyro duced \\,itliout a decrease in the production speed, even in the case of
co~~tinuouopse ration for 11 days.
The clia~igeo ver times of the concentration of dissolved oxygen in the culture tank in
Exa~nple5 is sliow~iln Fig. 10, the clla~~govee r times of the concentration of dissolvetl
oxygen in the culture tank in Example 7 is shown in Fig. 11, and change over times of the
concentration of dissolved oxygen in the culture tank in Exau~ple9 is slio\\~ni n Fig. 12.
From these results, it is understood that even in a case in wl~icltih e concentration of dissolved
oxygen in the culture tank is 0 ppm, or in a case in \vIiic11 the concentration of dissolved
oxygetl chat~gesw ithill a range of fro111 about 0 pp~nto about I ppm, the acetic acid
production speed is low, the isopropyl alcollol production speed is maintained high, and
production of by-products can be suppressed without employing a coulplicated coutrol
liietl~ods uch as, ill particular, the DO-Stat method or Balanced DO-stat method tliat controls
the concentration of dissolved oxygen.
Altl~ouglin ot slio\vn in the figures, in Examples 5 to 10, the bacterial mass in the
culture tank was constant since fro111 the 24th hour onwards, aud reacl~edth e steady state.
[0124] [Exanlple 1 I]
Tile con~positiono f the substrate solutio~w~a s clia~igedt o that sho\\711 in Table 10, aud
the substrate solution \\'as fed at 5 glli uutil 8 l~oursa fter the the start of cultivatiotl, aud
thereafter the substrate solution was fed at an average feeding rate of 42 glli. In this exa~nple,
in order to minimize the outflow of the substrate to tlie removed solution. pH stat metllod was
adopted. Co~tti~luocuus ltivatio~w~a s performed in the same manner as that in Example 2,
escept tl~ech arlgcs described above. 111 this case, the OUR u;ns 200 1~111lollLlh. 111 addition.
the con cent ratio^^ of isopropyl alcol~oal nd the bacterial inass ill the culture solution \irere
obtained in tl~esa me manner as that ill Example I , and the loss ratio of the plasmid was
obtained in tl~esa me tllalllier as that in Exatnple 2. Tile results are shown in Fig. 13, Fig. 14,
Table I I and Gble 12. Tl~esp ecific gro\\,th rate was 0.083Jh.
[0125] Table 10
Co~npo~lent
Glucose
CSL
-
O/o
15
5
Balance: \Vatel'
[0127] Table 12
I Cotltinuoos Operation Titne ( Isopmpyl Alcollol Production I
101281 Fro111 Fig. 13, tlie bacterial inass in tlie culture tank was constalit from the 24th lloor
onwards, and the average cotlcentration of the bacterial cells froin the 24th llour to the 840th
l i o ~w~ars 12 g-d~yce ll/L. From Fig. 14, it is understood that contin~touso peration for 35
days is enabled by opti~imizatio~ozf the fer~nentationc o~lditions. Here, from Table I I, the
integrated mass of isopropyl alcol~olw as 13 15 g/L/840 11, ant1 tlle production speed was 1.57
-I L I FIII-the!; the pluductio~sp~e ed was so lligh as to provide a value of2.40 gL/h for a
47
period until the 6th day, and a value of 2.15 glL111 for a period until the IOtll day. In addition,
it was found fro111 Fig. 15 that the plasmid loss ratio of tile reco~nbinnnEt schericliia coli was
so low as to provide a ratio of 20% or lower 1111til the 27111 day, a ratio of 47% oo 29th d a ~ :
aud a ratio of 77% on 35th day, demonstrating that the plasmid was retained for a long tiole.
[0129] As described above, accordir~gto tl~ein vention, isopropyl alcollol can be stably
prodoced for a loug time in a simple aud co~lve~liemnta nner with high production eficie~~cy
through continuous cultivation using at1 isopropyl alcol~ol-producingE scl~evichiac oli.
[0130] The disclosure of Japanese Patent Application No. 201 1-176402, filed August 11,
201 1, is incorporated herein by reference in its entirety.
All publicatio~ls,p atent applications, and tecl~nicasl taudards mentioned in this
specificatio~a~re herein incorporated by referet~ceto tl~esa me extent as if each individual
publication, patent application, or technical standard was specifically and individually
indicated to be i~lcorporatedb y reference.
CLAIMS
1. A metliod of producitlg isopropyl alcohol, comprising:
culturing an isopropyl alcol~ol-producingE selre~.iclrioc oli under a bacterial cell
gro\\,tli condition in wliich the Esclrerichin coli stably proliferates in an isopropyl alcohol
production l~eriodw hile continuously supplying a substrate solution to a culture tank and
continuously removing a CU~~LsoIlIu-teio n from tlie cult~~traen k, the substrate solution
containing a plant-derived raw material, tlie culhlre solutio~co~n taining a protluct, the iluntber
of cells of the isopropyl alcohol-producing E.~clrericlrircr oli in the cl~ltureta nk being
maintained duritig the cultorit~ga, nd the isopropyl alcol~ol-producil~Egs cher-icliin coli 11aving
isopropyl alcohol p~.oductio~abi ility introduced or modifietl by get~cticr ecombitiatio~~;
bringing the isopropyl-alcohol-11sod11citlgE sclrer-iclrirr coli into contact \\,it11 (lie
plant-derived raw material it1 the culture tank to produce isopropyl alcol~ol;a nd
recovering the isopropyl alcol~olp roduced by tlie isopropyl alcoliol-producing
Esclrericlricr coli fiom the culhlre solution that cotitaitis the product and that has been removetl
from the culture tal~k.
2. Thc method of producing isopropyl alcoliol according to claim 1. \vhe~.einti le
bacterial cell gro~vtlci ootlition is a coiltlition \\~hiclpi rovides a specific growth rate o f 0.015/11
or liigl~en
3. Thc method of producing isopropyl alcohol according to claim 1 or claiti~2 . whereiri
the culturing is perforn~eda t ail osysen uptake rate oFfrom 10 mniollL/I~to 250 mnioliLlh.
4. The method of producitig isopropyl alcol~ola ccol.tling to any one of claitits 1 to 3,
wherein the bacterial cell growth cotlditioti is a col~ditionw liich provides a specific growth
rate of 0.02111 or higlicn