Specification
Title of invention: Method for quantifying number of bacteria in sample
Technical field
[0001]
　The present invention relates to a method for rapidly and accurately quantifying the number of bacteria in a sample, particularly a blood sample, or quantifying the number of bacteria and identifying a bacterial species using the PCR method.
Background technology
[0002]
　Conventional test items used to determine the severity of sepsis include blood culture, endotoxin, procalcitonin, white blood cell count, CRP (C-reactive protein), blood pressure, body temperature, respiratory rate, and pulse rate. Preceptin was added to. Blood culture results are time consuming and difficult to feed back to early treatment. Since the white blood cell count and CRP are the defense reaction against infection on the host side, there is a time lag between the test value and the severity, and the value often deviates from the actual severity. Procalcitonin has difficulty in specificity and quantification and is difficult to use. Preceptin cannot be used in patients with impaired renal function. Thus, there is no reliable test item as an index that reflects the severity of infectious disease and the therapeutic effect in real time. If possible, it is most direct and reasonable to use the number of bacteria in a patient sample as a biomarker and to determine the severity of infectious disease and as an index for monitoring the therapeutic effect.
　At present, a standard quantitative analysis of the number of bacteria in a sample is performed by culturing a patient sample collected, but only a very rough quantification (only "1+", "2+", "3+" classifications) ). Although culture technology has been used for many years, it takes a long time (usually 2 to 3 days) to carry out the test, and it depends on the growth ability that differs depending on the bacterial species. The sex is low. Therefore, in order to accurately measure the number of bacteria, a measurement method that does not rely on culture is preferable. In recent years, a technique considered to be most versatile in methods other than culture is the quantitative PCR (real-time PCR) method.
　When attempting to quantify the pathogenic bacterium in a patient sample by real-time PCR, the pathogenic bacterium has not been identified at the start of the test, and mixed infections can often occur. It is a primer to be detected, and may be simply referred to as "universal primer" hereinafter). However, due to the often small amounts of pathogenic bacteria in patient samples, conventional real-time PCR may not provide sufficient sensitivity for accurate quantification. Further, even if sufficient sensitivity is obtained, there is a problem that contamination is easily detected in bacterial universal PCR (PCR that detects almost all bacteria), which makes it difficult to determine a pathogenic bacterium. As a result, although the quantitative test for the pathogenic bacterium in the patient sample is very useful for the treatment of infectious disease, it has not yet been put into practical use due to technically unsolved problems.
　Regarding the method of identifying the infectious disease-causing bacterium by the PCR method, in Patent Document 1, real-time PCR is performed using a plurality of specific primer sets using a nucleic acid derived from a sample, and melting temperatures of a plurality of amplification products obtained are obtained. A rapid identification method of an infectious disease-causing bacterium is disclosed that identifies a bacterium in a sample using a combination of (Tm value).
　Patent Document 2 discloses a thermostable DNA polymerase produced in a eukaryote capable of achieving improvement in detection sensitivity and a method for identifying a bacterial species by a PCR method using the thermostable DNA polymerase.
　Patent Document 3 discloses a large number of primer pairs for performing real-time PCR using a nucleic acid derived from a sample and using the melting temperature (Tm value) of the obtained amplification product to identify a bacterium in the sample. There is.
Prior art documents
Patent literature
[0003]
Patent Document 1: International Publication No. 2007/097323
Patent Document 2: International Publication No. 2010/082640
Patent Document 3: International Publication No. 2015/053293
Summary of the invention
Problems to be Solved by the Invention
[0004]
　In the current situation, the following problems still remain in the case of analyzing the number and species of the pathogenic bacteria contained in a trace amount in a blood sample in sepsis by the conventional PCR method. is there.
　Ordinary real-time PCR may not provide sufficient sensitivity to accurately quantify the number of pathogenic bacteria in patient samples. In particular, when the amount of the pathogenic bacterium is extremely small, accurate quantification by real-time PCR may not be possible.
　An object of the present invention is to provide a method that enables rapid and accurate quantification of the number of bacteria in a sample using the PCR method, or quantification of the number of bacteria and identification of bacterial species.
Means for solving the problem
[0005]
　One embodiment of the first quantification method for quantifying the number of bacteria in a sample according to the present invention is characterized by including the following steps.
(1) A first PCR step of obtaining a first amplification product by a PCR method using a universal nucleic acid pair for amplification of a bacterial 16S rRNA gene using a sample-derived nucleic acid as a template,
(2) the first PCR The second PCR step of obtaining the second amplification product by the nested PCR method using the primer pair for amplifying the internal sequence of the sequence of the first amplification product obtained by the step, and
(3) the bacterial species From the amount of the second amplification product obtained in the second PCR step, using the data for calibration showing the relationship between the amount of the known amplification product derived from the control bacterium and the number of the control bacterium, Bacteria count quantification process to determine the number of bacteria in a sample.
[0006]
　One embodiment of the first quantification method for quantifying the number of bacteria in a sample according to the present invention is characterized by including the following steps.
(A) a first PCR step of obtaining a first amplification product by a PCR method using a universal primer pair for amplification of a bacterial 16S rRNA gene using a nucleic acid derived from a sample as a template;
(B) the first PCR A second PCR step of obtaining a second amplification product by a nested PCR method using a primer pair for amplifying the internal sequence of the sequence of the first amplification product obtained by the step,
(C) bacterial species is known And a third PCR step of obtaining a third amplification product by a PCR method using a nucleic acid sample corresponding to a known number of bacteria of the control bacterium,
(D) the third amplification step obtained by the third PCR step A fourth PCR step of obtaining a fourth amplification product by a nested PCR method using the product;
(E) a step of creating calibration data from the known number of bacteria and the amount of the fourth amplification product; and
( F) A step of quantifying the number of bacteria in the sample using the data for calibration from the amount of the second amplification product obtained in the second PCR step.
[0007]
　One embodiment of the second quantification method for quantifying the number of bacteria in a sample according to the present invention is characterized by including the following steps.
(1) A first PCR step of obtaining a first amplification product by a PCR method using a universal nucleic acid pair for amplification of a bacterial 16S rRNA gene using a sample-derived nucleic acid as a template,
(2) the first PCR Second PCR step of obtaining a second amplification product by a nested PCR method using a primer pair for amplifying the internal sequence of the sequence of the first amplification product obtained by the step
(3) The bacterial species is known The amount of the second amplification product obtained in the second PCR step is used to calculate the amount of the amplification product derived from the control bacterium and the number of bacteria of the control bacterium using the calibration data. The step of quantifying the number
of bacteria in the sample , (4) the step of identifying the species of the bacteria in the sample, and
(5) the number of the temporary bacteria determined in the step of quantifying the number of bacteria, A step of correcting the number of bacteria to determine the number of bacteria in the sample by correcting based on the 16S rRNA operon copy number of the bacteria and the bacterial species identified in the bacterial species identifying step.
[0008]
　One embodiment of the second quantification method for quantifying the number of bacteria in a sample according to the present invention is characterized by including the following steps.
(A) a first PCR step of obtaining a first amplification product by a PCR method using a universal primer pair for amplification of a bacterial 16S rRNA gene using a nucleic acid derived from a sample as a template;
(B) the first PCR Second PCR step of obtaining a second amplification product by a nested PCR method using a primer pair for amplifying the internal sequence of the sequence of the first amplification product obtained by the step,
(C) bacterial species is known And a third PCR step of obtaining a third amplification product by a PCR method using a nucleic acid sample corresponding to a known number of control bacteria,
(D) the third amplification step obtained by the third PCR step. fourth PCR step, to obtain a fourth amplification product by nested PCR method using the product
step of generating data for calibration from the amount of (E) said known number of bacteria and the fourth amplification products,
(F ) A step of quantitatively determining the number of bacteria in the sample using the data for calibration from the amount of the second amplification product obtained in the second PCR step,
(G)
Based on the 16S rRNA operon copy number of the control bacteria and the bacterial species identified in the bacterial species identifying step, the provisional bacterial number obtained in the bacterial species identifying step of identifying the bacterial species, and (H) And correcting the number of bacteria in the sample to correct the number of bacteria.
[0009]
　The method for determining the presence or absence of contamination according to the present invention is a method of
　centrifuging a blood sample to separate it into a red blood cell fraction, a buffy coat fraction and a plasma fraction, and then sample A containing a supernatant plasma fraction and a buffy coat. And a step (a) of preparing a sample B containing a plasma fraction of the supernatant and not containing a buffy coat, and the
　following steps (2-1), (2-2) and (2-3) A step (b) of quantifying the number of bacteria of each of the sample A and the sample B by a method of quantifying the number of bacteria,
and
　comparing the number of bacteria of the sample A and the sample B in the blood sample. The
method is characterized by having a step (c) of determining the presence or absence of bacterial contamination .
(2-1) A first PCR step for obtaining a first amplification product by a PCR method using a nucleic acid derived from a sample as a template and using a universal primer pair for amplifying a bacterial 16S rRNA gene,
(2-2) A second PCR step of obtaining a second amplification product by a nested PCR method using a primer pair for amplifying the internal sequence of the sequence of the first amplification product obtained by the first PCR step, and
(2 -3) A step of quantifying the number of bacteria in which the provisional number of bacteria in the sample is obtained from the amount of the second amplification product obtained in the second PCR step using the data for calibration.
　The step (b) of quantifying the number of bacteria in the method for determining the presence or absence of contamination according to the present invention may further include the following steps (2-4) and (2-5).
(2-4) A bacterial species identifying step of identifying bacterial species of the bacteria in the sample.
(2-5) The bacterium in the sample is corrected by correcting the provisional bacterium count obtained in the bacterium number quantification step based on the 16S rRNA operon copy number of the control bacterium and the bacterium species identified in the bacterium species identification step. Bacteria count correction process to determine the number.
Effect of the invention
[0010]
　According to the present invention, it is possible to provide a method that enables rapid and accurate quantification of the number of bacteria in a sample using the PCR method, or quantification of the number of bacteria and identification of bacterial species.
Brief description of the drawings
[0011]
FIG. 1 shows the relationship and procedure of each step in the first embodiment.
FIG. 2 is a graph showing the numbers of bacteria in the upper half and the lower half after mild centrifugation of a bacterial dispersion at 100×g for 5 minutes.
[Fig. 3] Fig. 3 is a graph showing a comparison of the quantification by the conventional real-time PCR method (conventional PCR method) and the quantification by the nested PCR method (nested PCR method) according to the present invention.
FIG. 4 is a diagram showing detection results of host-bacterium-derived DNA remaining in thermostable DNA polymerases (commercial products and thermostable DNA polymerases prepared using eukaryote as a host).
FIG. 5 is a layout drawing of 16S rRNA of primers for the Tm mapping method.
FIG. 6 is a diagram showing an experimental result that enables accurate quantification of both primers by mixing equal amounts of primers differing by one base.
[Fig. 7] Fig. 7 is a diagram showing an example of a comparison of the quantification result of causative bacteria and the kinetics of other biomarkers before and after antimicrobial treatment.
[Fig. 8] Fig. 8 is a diagram showing an example of a comparison of quantification results of causative bacteria and kinetics of other biomarkers before and after antibacterial drug treatment.
FIG. 9 is a diagram showing an example of comparison of quantification results of causative bacteria and kinetics of other biomarkers before and after antibacterial drug treatment.
FIG. 10 is a diagram showing an example of a comparison of the quantification result of causative bacteria and the kinetics of other biomarkers before and after antibacterial drug treatment.
FIG. 11 is a diagram showing an example of a comparison of the quantification result of causative bacteria and the kinetics of other biomarkers before and after antibacterial drug treatment.
FIG. 12 is a diagram showing an example of a comparison of the quantification result of causative bacteria and the kinetics of other biomarkers before and after antibacterial drug treatment.
FIG. 13 is a diagram showing an example of comparison of the quantification result of a pathogenic bacterium and the kinetics of other biomarkers before and after antibacterial drug treatment.
MODE FOR CARRYING OUT THE INVENTION
[0012]
　The first method for quantifying the number of bacteria in a sample of the present invention has the following steps.
(I) A first PCR step in which a first amplification product is obtained by a PCR method using a nucleic acid derived from a sample as a template and a universal primer pair for amplifying bacterial 16S rRNA gene.
(Ii) A second PCR step in which a second amplification product is obtained by a nested PCR method using a primer pair for amplifying the internal sequence of the sequence contained in the first amplification product obtained in the first PCR step.
(Iii) The second amplification obtained in the second PCR step using the data for calibration showing the relationship between the amount of the amplification product derived from the control bacterium of which the bacterial species is known and the number of the control bacterium. A process for quantifying the number of bacteria that determines the number of bacteria in a sample from the amount of product.
　The second method for quantifying the number of bacteria in a sample of the present invention has the following steps.
(I) A first PCR step in which a first amplification product is obtained by a PCR method using a nucleic acid derived from a sample as a template and a universal primer pair for amplifying bacterial 16S rRNA gene.
(II) A second PCR step of obtaining a second amplification product by a nested PCR method using a primer pair for amplifying the internal sequence of the sequence of the first amplification product obtained by the first PCR step.
(III) The second amplification obtained in the second PCR step using the data for calibration showing the relationship between the amount of the amplification product derived from the control bacterium of which the bacterial species is known and the number of the control bacterium. A process for quantifying the number of bacteria that determines the provisional number of bacteria in a sample from the amount of product.
(IV) Bacterial species identification step of identifying the bacterial species of the bacteria in the sample.
(V) Number of bacteria to determine the number of bacteria in the sample by correcting the provisional number of bacteria determined in the number of bacteria determination step based on the 16S rRNA operon copy number of the control bacteria and the number of bacterial species identified in the species identification step Correction process.
[0013]
　Hereinafter, an embodiment of a method for quantifying the number of bacteria in a sample according to the present invention will be described.
　First, the first PCR step, the second PCR step, and the bacterial count quantification step common to the first and second quantification methods for the number of bacteria in a sample according to the present invention will be described.
(Preparation of sample-derived nucleic acid sample) The
　sample-derived nucleic acid sample can be prepared by a conventional method.
　For the preparation of the sample-derived nucleic acid sample, it is preferable to use a method for collecting bacteria and a method for extracting nucleic acid, which does not cause a difference depending on the bacterial species, as in the method used in Examples described later.
　Not only blood, but also cerebrospinal fluid (bacterial meningitis), pericardial effusion (pericarditis), pleural effusion (pleurisy), ascites (peritonitis), joint capsule (postoperative infection of orthopedic surgery) , Aqueous humor (endophthalmitis), alveolar lavage fluid (pneumonia), urine (urinary tract infection), post-operative drainage (postoperative infection), CV catheter tip (catheter biofilm of long-term bed rest patients) Examples include specimens that can be expected to be used as indicators of severity of various infectious diseases such as sepsis), therapeutic effects, and indicators for risk management of infectious diseases.
(Primer pair for first PCR)
　The universal primer pair used in the first PCR step can be used for quantification, or can be used for quantification of 16S rRNA gene of bacterial species in a range that may be quantified. As long as the region can be amplified, known primer pairs, primer pairs selected from the nucleotide sequence information of the 16S rRNA gene of bacteria, and the like can be used without particular limitation.
　Quantitative accuracy when 1-base mismatch occurs when a primer of one base sequence is used when there are two base sequences that differ by 1 base in the sequence of 16S rRNA gene site to which the primer binds between different bacterial species May decrease. In such a case, it is preferable to use primers corresponding to both of these base sequences at the same time to expand the range of bacterial species that enables accurate quantification.
　That is, in the universal primer pair used in the first PCR step, it is preferable that one or both of the forward primer and the reverse primer are a mixture of two types of primers that differ by one base in equal amounts.
　Examples of such primer pairs include the following combinations of primer pairs.
Pattern 1:
Region 1 forward primer 1a: 5'-AGAGTTTGATCATGGCTCAG-3' (SEQ ID NO: 1)
Region 1 forward primer 1b: 5'-AGAGTTTGATCCTGGCTCAG-3' (SEQ ID NO
: 2) Region 7 reverse primer: 5'-CCGGGAACGTATTCACC-3 ′ (SEQ ID NO: 3)
　In the case of this pattern 1, it is preferable to use Region 1 forward primers 1a and 1b mixed in an equivalent ratio of 1:1. It is preferable to use one type of Region 7 reverse primer as it is. The first PCR step is preferably performed in 1 tube for each sample.
Pattern 2:
Region 1'forward primer 1a: 5'-AGAGTTTGATCATGGCTCAG-3' (SEQ ID NO: 1)
Region 1'forward primer 1b: 5'-AGAGTTTGATCCTGGCTCAG-3' (SEQ ID NO: 2)
Region 7'reverse primer 1a: 5'-AGACCCGGGAACGTATTC- 3'(SEQ ID NO: 4)
Region 7'reverse primer 1b: 5'-AGGCCCGGGAACGTATTC-3' (SEQ ID NO: 5)
　In the case of this pattern 2, Region 1'forward primers 1a and 1b are mixed in an equal ratio of 1:1. It is preferable to use. Similarly, Region 7'reverse primers 1a and 1b are preferably mixed and used in an equivalent ratio of 1:1. The first PCR step is preferably performed in 1 tube for each sample.
[0014]
(First PCR step) In
　the first PCR step, in order to obtain an amplification product amount corresponding to the amount of the nucleic acid used as a template in improving the accuracy of quantification, before the gene amplification reaches a plateau, for example, It is preferable to terminate the amplification when the amplification curve has a slope. The amplification rate of the amplification product can be controlled by the concentration of the PCR reagent, the activity of the PCR enzyme, the number of cycles for amplification, and the like. Gene amplification by controlling the amplification rate by setting the number of cycles that does not reach the plateau expected from the amount of nucleic acid contained in the nucleic acid sample or the number of cycles that does not reach the plateau based on the data obtained in advance from the experiment It is preferable to terminate the PCR before the plateau reaches the plateau.
　The first PCR step can be performed by a known method and device.
　The first PCR step is preferably performed in a reaction system in which nucleic acid derived from bacteria other than the nucleic acid derived from the sample is extremely little mixed or is free from such contamination. Such a reaction system can be prepared by treating a PCR reagent, an instrument, and an enzyme with a known method as disclosed in Patent Document 2. As the enzyme for amplifying nucleic acid, it is preferable to use a thermostable DNA polymerase genetically engineered using a eukaryote disclosed in Patent Document 2 as a host. By performing PCR without bacterial nucleic acid contamination other than sample-derived nucleic acid, the background due to amplification from nucleic acid derived from contaminating bacteria becomes zero or below the detection limit, and it is possible to accurately quantify even trace amounts of pathogenic bacteria. It will be possible.
[0015]
(Primer pair for second PCR)
　The second PCR step is performed by the nested PCR method using the amplification product obtained in the first PCR step.
　As the primer pair for the second PCR step, a nucleic acid fragment having an internal sequence of the base sequence of the amplification product of the first PCR step and having an internal sequence that can be used for quantifying the number of target bacteria can be amplified. Anything can be used without particular limitation. Known primer pairs or primer pairs obtained by selecting from the nucleotide sequences of bacterial 16S rRNA genes can be used.
　Preferred primer pairs for the second PCR step include the following primer pairs.
Pattern 1:
Region 1 forward primer: 5'-AGAGTTTGATCATGGCTCAG-3' (SEQ ID NO
: 1) Region 1 reverse primer: 5'-CGTAGGAGTCTGGACCGT-3' (SEQ ID NO
: 6) Region 2 forward primer: 5'-GACTCCTACGGGAGGCA-3' ( SEQ ID NO: 7)
Region 2 reverse primer: 5′-TATTACCGCGGCTGCTG-3′ (SEQ ID NO
: 8) Region 3 forward primer: 5′-AGCAGCCGCGGTAATA-3′ (SEQ ID NO
: 9) Region 3 reverse primer: 5′-GGACTACCAGGGTATCTAATCCT-3′ (SEQ ID NO: 10)
Region 4 forward primer: 5′-AACAGGATTAGATACCCTGGTAG-3′ (SEQ ID NO
: 11) Region 4 reverse primer: 5′-AATTAAACCACATGCTCCACC-3′ (SEQ ID NO
: 12) Region 5 forward primer: 5′-TGGTTTAATTCGATGCAACGC-3′ (SEQ ID NO: 13) )
Region 5 reverse primer: 5′-GAGCTGACGACAGCCAT-3′ (SEQ ID NO
: 14) Region 6 forward primer: 5′-TTGGGTTAAGTCCCGC-3′ (SEQ ID NO
: 15) Region 6 reverse primer: 5′-CGTCATCCCCACCTTC-3′ (SEQ ID NO: 13) 16)
Region 7 forward primer: 5′-GGCTACACACGTGCTACAAT-3′ (SEQ ID NO
: 17) Region 7 reverse primer: 5′-CCGGGAACGTATTCACC-3′ (SEQ ID NO
: 3) Pattern 2:
Region 1′ forward primer: 5′-GCAGGCTTAACACATGCAAGTCG- 3'(SEQ ID NO: 18)
Region 1'reverse primer: 5'-CGTAGGAGTCTGGACCGT-3' (SEQ ID NO: 6)
Region 2'forward primer: 5'-GTCCAGACTCCTACGGGAG-3' (SEQ ID NO: 19)
Region 2'reverse primer: 5'-CCTACGTATTACCGCGG-3' (SEQ ID NO: 20)
Region 3'forward primer: 5'-AGCAGCCGCGGTAATA-3' ( SEQ ID NO: 21)
Region 3'reverse primer: 5'-GGACTACCAGGGTATCTAATCCT-3' (SEQ ID NO: 10)
Region 4'forward primer: 5'-AACAGGATTAGATACCCTGGTAG-3' (SEQ ID NO: 11)
Region 4'reverse primer: 5'-AATTAAACCACATGCTCCACC -3' (SEQ ID NO: 12)
Region 5'forward primer: 5'-TGGTTTAATTCGATGCAACGC-3' (SEQ ID NO: 13)
Region 5'reverse primer: 5'-GAGCTGACGACAGCCAT-3' (SEQ ID NO: 14)
Region 6'forward primer: 5'-GTTAAGTCCCGCAACGAG-3' (SEQ ID NO: 22)
Region 6'reverse primer: 5'-CCATTGTAGCACGTGTGTAGCC-3' (SEQ ID NO: 23)
Region 7'forward primer: 5'-GGCTACACACGTGCTACAATGG-3' (SEQ ID NO: 24)
Region 7'reverse primer: 5'-AGACCCGGGAACGTATTC-3' (SEQ ID NO: 4) At
　least one primer selected from the group consisting of patterns 1 and 2 The pair can be used to perform the second PCR step. When a plurality of primer pairs are used, each of them is used individually to perform the second PCR step.
[0016]
(Second PCR Step)
　The second PCR step can be performed by a known method and device.
　The reaction solution containing the amplification product obtained in the first PCR step may be diluted as necessary in order to obtain the amount of amplification product that can be used for quantification in the second PCR step.
　The dilution rate is estimated from the concentration of the amplification product in the reaction solution obtained in the first PCR step, or the amount of the amplification product within the range in which the quantitativeness is ensured in the experiment conducted in advance is the second PCR step. Set to obtain in.
　The second PCR step is also preferably carried out in a reaction system in which nucleic acid derived from bacteria other than the nucleic acid derived from the sample is extremely small or free from such contamination. Such a reaction system can be prepared by treating a PCR reagent, an instrument, and an enzyme with a known method as disclosed in Patent Document 2. As the enzyme for amplifying nucleic acid, it is preferable to use a thermostable DNA polymerase genetically engineered using a eukaryote disclosed in Patent Document 2 as a host. By performing PCR without bacterial nucleic acid contamination other than sample-derived nucleic acid, the background due to amplification from nucleic acid derived from contaminating bacteria becomes zero or below the detection limit, and it is possible to accurately quantify even trace amounts of pathogenic bacteria. It will be possible.
[0017]
(Preparation of data for calibration) In the
　quantification step of bacteria, using the data for calibration showing the relationship between the amount of the amplification product derived from the control bacterium whose bacterium species is known and the number of the control bacterium, The number of bacteria can be calculated.
　The data for calibration is not particularly limited, and the amount of an amplification product derived from a known bacterium obtained by performing a PCR step using a nucleic acid sample corresponding to a known bacterial number of a control bacterium in which the bacterial species is known, It can be created from the relationship with the known number of bacteria. Data for calibration can be generated using a known bacterial count of a control bacterium alone or each of a plurality of different known bacterial counts of a control bacterium individually.
　The use of a calibration curve as the data for calibration is not particularly limited, but the PCR step should be performed by individually using a plurality of nucleic acid samples corresponding to a plurality of known bacterial numbers of different control bacteria whose bacterial species are known. A calibration curve can be prepared from the relationship between the amount of the amplification product derived from a known bacterium obtained by the above and the number of the known bacterium.
　The data for calibration can be prepared in advance and used in the step of quantifying the number of bacteria.
　In order to further improve the quantification accuracy of the bacterial count by minimizing the error due to the operating state and operating environment of the PCR device, the process of creating the data for calibration is performed by a series of operations including the first PCR process and the second PCR process. It is preferable to carry out. Data for calibration at that time can be created by the following steps.
(C) a third PCR step of obtaining a third amplification product by a PCR method using a nucleic acid sample corresponding to a known number of bacteria of a control bacterium of which the bacterial species is known,
(D) a fourth PCR step in which a fourth amplification product is obtained by a nested PCR method using the third amplification product obtained in the third PCR step; and
(E) a known number of control bacteria and A step of creating calibration data from the amount of the amplification product of 4.
　The first PCR step and the third PCR step are performed in parallel in the same PCR device, and the second PCR step and the fourth PCR step are performed in parallel in the same PCR device. By doing so, it is possible to efficiently create data for calibration.
　When a calibration curve is used as the data for calibration, steps (C) and (E) can be performed by the following steps (C-1) and (E-1).
(C-1) A third PCR step in which a plurality of nucleic acid samples corresponding to a plurality of different known bacterial numbers of control bacteria whose bacterial species are known are individually used to obtain a third amplification product by a PCR method,
(E-1) A step of creating a calibration curve from the known number of bacteria and the amount of the fourth amplification product.
　As a plurality of nucleic acid samples used as a template in the third PCR step for preparing a calibration curve, a sample obtained by extracting a nucleic acid from each of a plurality of samples containing control bacteria at different known bacterial counts can be used. Alternatively, a nucleic acid sample obtained by extracting nucleic acid from a sample containing control bacteria in a known number of cells was diluted to a predetermined concentration to prepare a plurality of nucleic acid samples corresponding to a plurality of different known cell numbers, and obtained. Each nucleic acid sample may be independently used in the third PCR step.
　The control bacterium is not particularly limited as long as it can create a desired calibration curve. A control bacterium can be selected in consideration of handleability and compatibility with other bacterial species. From such a viewpoint, Escherichia coli can be preferably used as a control bacterium.
　The primer set used in the preparation of the calibration curve may be selected in relation to the first PCR step, the second PCR step, and the primer set when the PCR method is used to identify the bacterial species of the bacteria in the sample described below. preferable. For example, the primer set used in the first PCR step is used in the step (C), and the primer set used in the second PCR step (at least one of them when using a plurality of primer sets) is used in the step (D). Can be used. Also in the case of using the amplification product of the first PCR step to identify the bacterial species of the bacterium in the sample described below, similarly, the primer set used in the second PCR step (when using a plurality of primer sets, At least one of them) can be used in step (D).
[0018]
(Calculation of
　Bacterial Count ) In the bacterial count quantification step, the number of bacteria in the sample can be determined from the amount of the amplification product obtained in the second PCR step using calibration data such as a calibration curve. This number of bacteria can be used as the number of bacteria in the sample.
　In the second quantification method according to the present invention, the bacterium count obtained in the bacterium quantification step is used as the provisionally determined bacterium count.
[0019]
　The bacterial species identifying step and the bacterial count correcting step in the second quantification method according to the present invention will be described below. A bacterial species identification step may be added to the first quantification method according to the present invention. In that case, the bacteria in the sample can be identified using the first PCR step and the second PCR step in the first quantification method.
(Primer for Identifying Bacterial Species) In
　the second quantification method according to the present invention, the amplification product obtained in the first PCR step is used to identify the bacterial species of the bacterium in the sample.
　When the primer set of Pattern 1 is used for the identification of bacterial species in the Tm mapping method described later, it is preferable to use the following primer set.
-First PCR step (same as the primer set of the first PCR step of Pattern 1 of the Tm mapping method)
　Region 1 forward primers 1a and 1b are mixed and used in a 1:1 equivalent amount. For the Region 7 reverse primer, use one of the following as it is. Patient samples for 1st PCR are 1 tube per sample, at least one concentration is 1 tube for quantitative control, more preferably 3 concentrations are 3 tubes, and negative control is 1 tube.
Region 1 forward primer 1a: 5'-AGAGTTTGATCATGGCTCAG-3' (SEQ ID NO: 1)
Region 1 forward primer 1b: 5'-AGAGTTTGATCCTGGCTCAG-3' (SEQ ID NO: 2)
Region 7 reverse primer: 5′-CCGGGAACGTATTCACC-3′ (SEQ ID NO: 3)
Second PCR step (nested PCR): The
　following Region 3 forward primer and Region 3 reverse primer are used. The quantification by the 2nd nested PCR is carried out with 1 tube per sample, quantitative control with at least one concentration of 1 tube, more preferably 3 concentrations with 3 tubes, and negative control with 1 tube. However, for patient samples, the amplification results obtained with the Region 3 forward & reverse primer during the Tm mapping method are directly used for quantitative measurement (there is no need to perform PCR using a new tube for quantitative determination).
Region 3 forward primer: 5'- AGCAGCCGCGGTAATA -3' (SEQ ID NO
: 9) Region 3 reverse primer: 5'- GGACTACCAGGGTATCTAATCCT -3' (SEQ ID NO: 10)
　Tm mapping method using the primer set of pattern 2 to identify bacterial species When using, the following primer set is preferably used.
-First PCR step (same as the primer set of the first PCR step of Pattern 2 of the Tm mapping method)
　The following Region 1'forward primers 1a and 1b are mixed and used in an equivalent ratio of 1:1. Similarly, Region 7'reverse primers 1a and 1b are mixed and used in a 1:1 equivalent amount. One tube per 1st PCR sample, at least one tube for quantitative control, more preferably three tubes, and 3 tubes for negative control, and one tube for negative control.
Region 1'forward primer 1a: 5'-AGAGTTTGATCATGGCTCAG-3' (SEQ ID NO: 1)
Region 1'forward primer 1b: 5'-AGAGTTTGATCCTGGCTCAG-3' (SEQ ID NO: 2)
Region 7'reverse primer 1a: 5'-AGACCCGGGAACGTATTC- 3′ (SEQ ID NO: 4)
Region 7′ reverse primer 1b: 5′-AGGCCCGGGAACGTATTC-3′ (SEQ ID NO: 5)
Second PCR step ((nested PCR):
　Region 3'forward primer and Region 3'reverse primer are used. The quantification by the 2nd nested PCR is performed with 1 tube per sample, quantitative control with at least one concentration of 1 tube, more preferably 3 concentrations with 3 tubes, and negative control with 1 tube. However, for the sample, the amplification result of Region 3'forward & reverse primer at the time of Tm mapping method is directly used for quantitative measurement (it is not necessary to perform PCR using a new tube for quantitative determination).
Region 3'forward primer: 5'- AGCAGCCGCGGTAATA -3' (SEQ ID NO: 9)
Region 3'reverse primer: 5'- GGACTACCAGGGTATCTAATCCT -3' (SEQ ID NO: 10) The number
　of quantitative controls in each PCR step is particularly There is no limitation, and one tube may be used, or a plurality of tubes for quantitative control with two or more different concentrations may be used.
[0020]
(Identification of Bacterial Species in Specimen) For the identification of
　bacterial species, known methods such as the methods disclosed in Patent Documents 1 to 3 can be used.
　For example, a method of identifying the bacterial species by detecting the presence or absence of an amplification product specific to the bacterial species can be used. The following method can be used to detect the presence or absence of an amplification product specific to this bacterial species.
-A method for confirming the presence or absence of an amplification product by real-time PCR using an intercalator or probe having a fluorescent label for detection.
A method of measuring the Tm value of the amplification product by real-time PCR using an intercalator or probe having a fluorescent label for detection.
-A method for analyzing an amplification product in which the amplification product is developed and visualized by electrophoresis on a gel or the like.
A method for analyzing an amplification product by decoding the base sequence of the amplification product.
An analysis method in which the molecular weight of the amplification product is measured by a mass spectrometer.
　Furthermore, it is also possible to perform PCR using a plurality of primer pairs and identify the bacterial species using the Tm values ​​of the plurality of obtained amplification products.
　As a method of using this plurality of primer pairs, the nested PCR method using the primer sets of pattern 1 and pattern 2 mentioned in the second PCR step can be preferably used.
　Region 1 to 7 forward and reverse primer sets, or Region 1'to 7'forward and reverse primer sets were each subjected to PCR in 1 tube (total of 7 tubes per sample), and the 7 Tm values ​​obtained were used. It is preferable to rapidly identify the causative agent by the Tm mapping method described in Patent Document 1.
　Identification of a bacterial species by the Tm mapping method is performed, for example, according to the method disclosed in paragraph [0237] of Patent Document 1, Patent Document 2 or paragraphs [0111] to [0116] of Patent Document 3, or by appropriately using the method disclosed therein. It can be modified. In the identification of bacterial species by the Tm mapping method, a combination of Tm values ​​of a plurality of amplification products amplified by a plurality of specific primer pairs obtained from bacteria whose bacterial species are known, or a combination of differences between the plurality of Tm values Identification data for is used. A combination of Tm values ​​of amplification products obtained by the same multiple primer pairs from unknown bacterial cell samples collected from the sample, or a combination of differences between Tm values, is collated with an identification database to determine the agreement. , Identify unknown bacteria in the sample.
　One of the specific examples of the identification method is shown below.
[0021]
In
　order to identify the detection bacterium, the Tm value of the DNA fragment obtained from the detection bacterium can be used by using the primer set according to the present invention. In particular, a DNA fragment and its Tm value are obtained in advance by using a method similar to this method, in whole or in part, using 16S rRNA or 16S rDNA of multiple or many bacteria that may possibly be contained in the sample. Bacteria of unknown species in a sample can be identified by using the Tm value or the “relative value of Tm value” described below as a comparison data or database. As an algorithm for identification, not only the combination of the Tm values ​​described above, but also the identification using the combination of the differences between the Tm values, for example, the influence of the measurement error such as the measurement error at each trial of the device. Can be added.
　As a method of correcting the measurement error for each trial of the equipment described above, it is possible to calculate the “average value of Tm value combinations” and use the “combination of relative values” of each Tm value from the average value. I can. In other words, it is a method of identifying the arrangement of combinations of Tm values ​​as "shapes". The "shape" that shows the arrangement of combinations of Tm values ​​in two dimensions is not affected by measurement error. For example, a combination of Tm values ​​specific to the detected bacteria (n (n is an integer of 4 or more and 7 or less)) is defined as T1db to Tndb (db is a database), and relative values ​​from the average value thereof are d1db to dndb. Similarly, a combination of Tm values ​​of unknown detection target organisms obtained from the sample (n (n is an integer of 4 or more and 7 or less)) is set as T1ref to Tnref (ref is reference), and relative to the average value. The values ​​are d1ref to dnref, respectively. Then, the result is compared with the database, and "the one in which the combination of relative values ​​is approximate=the one in which the shape of the arrangement of the combination of Tm values ​​is close" is used as an identification algorithm.
　A specific calculation method is, for example, a method of calculating the distance between two points on the Euclidean space (Equation 1), but is not limited to this.
[0022]
[Number 1]

[0023]
　According to the calculation method according to Formula 1, the Dist. value obtained by this calculation formula that is closest to 0 (zero) is identified as the detected bacterial species. However, due to the measurement error of the PCR equipment used, depending on the temperature control specifications of the equipment and the number of primers, the allowable range of the Dist. value is 0 to 0.37, preferably 0 to 0.30. is there.
　The above algorithm can be used as database type identification software on a computer.
The
　identifiable microorganisms can be mechanically detected and identified if they correspond to bacteria in classification.
　The number of primer pairs and the nucleotide sequences of the primer pairs can be selected according to the detection range of bacterial species and the like.
　As the nucleic acid sample used in the nested PCR, the amplification product obtained in the first PCR step is used after diluting it as necessary. As the primer set at that time, the combination of the primer set of pattern 1 mentioned for the first PCR step and the primer set of pattern 1 mentioned for the second PCR step, and the one for the first PCR step were mentioned. It is preferable to use a combination of the pattern 2 primer set and the pattern 2 primer set mentioned in the second PCR step.
[0024]
(Correction of Provisional Bacterial Count) When
　analyzing the bacterial count of a causative bacterium contained in a small amount in a sample such as a blood sample in sepsis by the first quantification method according to the present invention, the causative bacterial is determined by bacterial universal PCR. The result of quantification is the converted value for the bacterial species of the quantitative control, and may differ from the true bacterial count of the pathogenic bacterium itself.
　In the second quantification method according to the present invention, if the bacterium in the sample is of the same species as the control bacterium, based on the identification result of the bacterium in the sample, the previously obtained provisional number of bacteria is determined as the quantification result. On the other hand, according to the identification result of the bacteria in the sample, when the bacteria in the sample are heterologous to the control bacteria, the ratio of the 16S ribosomal RNA operon copy number of the identified bacteria to the control bacteria 16S ribosomal RNA operon copy number The number of bacteria corrected for the provisional number is confirmed as the quantitative result.
[0025]
(Kit for identification and quantification) Using
　at least one of the above-mentioned primer sets, a database used for identification in the Tm mapping method, a thermostable DNA polymerase free of bacterial DNA contamination, a positive control, a negative control, etc. A kit can be made for the quantification of, or for the identification and quantification of bacteria in a sample.
[0026]
(Method of judging presence/absence of contamination) When
　quantifying the number of bacteria in a blood sample, or both quantifying the number of bacteria and identifying the bacteria, between the sampling of the sample and the first or second PCR step. When bacteria other than the sample-derived bacteria are mixed in, the accuracy of quantification of the target number of bacteria and the identification of bacteria including false-positive results may decrease. Therefore, by confirming the presence or absence of contamination of the sample for PCR of the bacteria other than such a specimen, it is possible to further improve the reliability of the quantification of the target number of bacteria and the identification result of the bacteria. it can.
　The method for determining the presence or absence of contamination according to the present invention is a method in which a
　blood sample is centrifuged to separate a red blood cell fraction, a buffy coat fraction and a plasma fraction, and then a sample A containing a supernatant plasma fraction and a buffy coat. And a step (1) of preparing a sample B containing a plasma fraction of the supernatant and not containing buffy coat, and the
　following steps (2-1), (2-2) and (2-3) A step (2) of quantifying the number of bacteria in each of the sample A and the sample B by a method for quantifying the number of bacteria,
and
　comparing the number of bacteria in the sample A and the sample B in the blood sample. The
method is characterized by including a step (3) of determining the presence or absence of bacterial contamination .
(2-1) A first PCR step of obtaining a first amplification product by a PCR method using a nucleic acid derived from a sample as a template and using a universal primer pair for amplification of a bacterial 16S rRNA gene,
(2-2) A second amplification product obtained by a nested PCR method using a primer pair for amplifying the internal sequence of the sequence of the first amplification product obtained by the first PCR step PCR step, and
(2-3) a step of quantifying the number of provisional bacteria in the sample from the amount of the second amplification product obtained in the second PCR step using the data for calibration.
　Steps (2-1) to (2-3) can be performed using the first quantification method according to the present invention.
　The step (b) of quantifying the number of bacteria may further include the following steps (2-4) and (2-5).
(2-4) A bacterial species identifying step of identifying bacterial species of the bacteria in the sample.
(2-5) The bacterium in the sample is corrected by correcting the provisional number of bacteria determined in the quantification step of the number of bacteria based on the 16S rRNA operon copy number of the control bacterium and the bacterial species identified in the bacterial species identification step. Bacteria count correction process to determine the number.
　Steps (2-1) to (2-5) can be performed using the second quantification method according to the present invention.
　By centrifuging the blood sample, the red blood cell fraction, the buffy coat (white blood cell) fraction, and the plasma fraction can be separated in this order from the lower layer to the upper layer according to the specific gravity of the components contained in the blood.
　By comparing the number of bacteria obtained by the quantification method according to the present invention from a sample containing only the plasma fraction (without buffy coat) and a sample containing the plasma fraction and buffy coat (having buffy coat) It is possible to determine whether or not bacteria other than those derived from the sample are mixed.
　With buffy coat, leukocytes that phagocytosed the pathogenic bacterium in the patient's body were included, and without buffy coat, only plasma did not contain phagocytosed leukocytes. In fact, no infection has occurred in the patient or patient sample, and if bacterial DNA derived from skin-resident bacteria at the time of blood sampling, work environment, or contamination on the device is detected, these bacteria are phagocytosed by leukocytes. No, there is no difference in the number of bacteria depending on the presence or absence of buffy coat. On the other hand, if the bacteria to be detected are causative bacteria, they will be phagocytosed by leukocytes in the blood of the patient, and the number of bacteria will be much higher with buffy coat than without buffy coat. Should be. That is, the following determination can be made.
[0027]
　First, when bacteria are not present in a blood sample, the number of bacteria is not measured in both samples with and without buffy coat.
　When bacteria are not present in the blood sample and bacteria other than the sample-derived bacteria are mixed in the blood sample, the mixed bacteria are not phagocytosed by leukocytes, and there is no difference in the number of bacteria depending on the presence or absence of buffy coat. Become. The fact that there is no difference in the number of bacteria is an indicator that contamination of bacteria other than the sample has occurred, and the bacteria identified at this time have low reliability that they are causative bacteria, and the number of bacteria is It also shows that the reliability is low as it reflects the actual number of bacteria in the blood.
　If the blood is from a patient who has developed an infection and bacteria are present in the blood sample, and if there is no contamination of the blood sample with bacteria other than the sample, then it is possible to obtain the results without buffy coat and with buffy coat. The number of bacteria that can be obtained is higher with the buffy coat. Since there are differences in the number of bacteria, it is highly reliable that the results of the obtained number of bacteria reflect the actual number of bacteria in blood, and the bacteria identified at this time were also detected. It means that the bacterium is highly reliable.
　It is blood from a patient who developed an infection, and when bacteria are present in the blood sample, and when bacteria other than the sample are mixed in the blood sample, there is no buffy coat and there is a buffy coat. Increase the apparent number of bacteria obtained from. In particular, when bacteria other than the specimen-derived bacteria are mixed only during the processing of the sample without the buffy coat, the difference between them is reduced. When the amount of bacteria derived from infection in blood is very small, or when the amount of mixed bacteria is very large, the difference in the number of bacteria obtained between without buffy coat and with buffy coat is small. On the other hand, when the amount of bacteria derived from infection is very large or when the amount of mixed bacteria is extremely small, the difference in the number of bacteria obtained with and without buffy coat becomes large. In this way, the difference in the number of bacteria can be used to determine the possibility of contamination of blood samples with bacteria other than those derived from the sample. If the difference is small, it can be determined that the result has low reliability.
　In the step (c) for determining the presence or absence of contamination, due to contamination of the sample that originally does not contain bacteria due to the equipment used or working environment, or due to an error in the quantitative value in real-time PCR, etc. , How much bacteria can be detected, that is, considering the range of error in the actual measurement work, it is possible to determine the presence or absence of contamination from the difference between the number of bacteria without buffy coat and the number of bacteria with buffy coat. preferable. As this error range, as shown in Example 3 to be described later, a negative control test in which sterilized water without contamination is regarded as a sample under the actual equipment used and working environment is within the common sense of those skilled in the art. It is preferable to carry out a plurality of times and determine the range. The error range is ±0 bacteria/ml in an ideal environment in which no contamination occurs at all and there is no error in real-time PCR, but ±100 bacteria/ml described in Example 3 is a constant reference value.
　In the step of determining the presence or absence of contamination, in addition to comparing the results of real-time PCR in each test section with the number of bacteria digitized based on the calibration curve obtained from the results of quantitative control, real-time PCR It is also possible to compare by the Ct value (Threshold cycle) obtained in.
[0028]
　According to the method of the present invention, the quantification of bacteria in a sample can be performed with higher accuracy than in conventional biochemical property testing methods.
　Further, compared to the conventional biochemical property testing method which generally requires about 2 days after blood collection, rapid quantification such as about 3.5 hours after blood collection is possible.
　Conventional biochemical characterization methods may not be identifiable at the bacterial species level or may not be culturable for special bacterial species, but according to the method of the present invention, the 16S rRNA gene Quantification is possible for bacteria whose sequence is registered in the database and whose 16S rRNA operon copy number is known.
　Further, the negative determination time is generally about one week in the conventional biochemical property test method, but in the method according to the present invention, it is rapid, such as about 3.5 hours after blood collection. A decision can be made.
　Furthermore, when the number of bacteria in a sample is a new indicator of the severity of infectious disease, and when the change over time in the number of bacteria in a sample is a new index of the therapeutic effect, the number of bacteria may approach zero infinitely. The present invention can provide an extremely useful technique for quantifying bacteria in a sample, which can be used as an index when stopping an antibacterial drug and when the definition of sepsis is changed to one using the number of bacteria as an index.
　Furthermore, even when the number of bacteria in the sample is quantified and the bacterial species in the sample is identified at the same time, the same effect as described above can be obtained.
Example
[0029]
　The present invention will be further described below with reference to examples. Unless otherwise specified, known reagents, known instruments, and commercially available PCR devices were used to perform PCR and various treatments by various conventional methods.
(Embodiment 1)
　FIG. 1 shows the relationship and procedure of each step in this embodiment.
(Step 1: Bacterial collection and DNA extraction method that does not cause a difference depending on the bacterial species)
　First, in the bacterial collection from a blood sample, whole blood was gently centrifuged at 100 xg for 5 minutes to separate blood cells, and then obtained. The supernatant (including buffy coat) is pelleted by strong centrifugation at 20,000 xg for 10 minutes to collect the cells. In this step, the fraction of bacteria in plasma does not change, and there is no difference in the collection efficiency depending on the bacterial species.
　For this confirmation, E. coli (E. coli ATCC25922), Staphylococcus aureus (S. aureus ATCC29213), Klebsiella pneumoniae (K. pneumoniae NBRC3512), Pseudomonas aeruginosa (P. aeruginosa ATCC27853) were dissolved in physiological saline, After light centrifugation at 100×g for 5 minutes, CFU was measured by plating the upper half and the lower half of the liquid containing the cells in the centrifuge tube on the medium.
　The above-mentioned E. coli ATCC25922, Staphylococcus aureus ATCC29213, and P. aeruginosa ATCC27853 are American Type Culture Collection: 10801 University Boulevard. , Manassas (VA), 20110-2209 USA), and Klebsiella pneumoniae (K. pneumoniae NBRC3512) is a biotechnology center (NBRC) of the National Institute for Product Evaluation Technology (NITE) (address: 292-0818). , 2-5-8 Kazusa Kamafoot, Kisarazu City, Chiba Prefecture).
　The result is shown in FIG. From this result, there was no change in the number of bacteria in the upper half and the lower half after centrifugation. That is, there was no difference in the collection efficiency between these bacterial species under the above centrifugation conditions.
　Moreover, in the DNA extraction, the collected bacteria were thoroughly crushed by protease treatment and physical crushing with beads to prevent the difference in DNA extraction efficiency depending on the bacterial species.
[0030]
(Step 2: Nested PCR that enables highly sensitive and accurate quantification using a thermostable DNA polymerase that is free of bacterial DNA contamination) The
　respiratory pathogen DNA obtained from the blood sample by the method of Step 1 is used as a PCR template. As the following, nested PCR is performed under the conditions of 1st PCR: 30 cycles → 100-fold dilution → 2nd PCR: 30 to 35 cycles. Since the number of pathogenic bacteria in a patient sample is wide ranging from very small amount to large amount, it is difficult to accurately quantify in one PCR, so the nested PCR method is combined. However, when performing quantification by nested PCR, it is desirable to perform nested PCR under conditions in which gene amplification does not plateau in 1st PCR, for example, 1st PCR for 30 cycles or less.
　FIG. 3 is a graph showing a comparison between the quantification by the ordinary real-time PCR method (conventional PCR method) (indicated by □) and the quantification by the nested PCR method according to the present invention (indicated by ○). Is.
　For reference, the specific implementation conditions are described.
　In performing nested PCR, after heating at 95°C for 5 minutes with the reaction solution composition 1 shown below, 94°C for 10 seconds, 57°C to 62°C for 10 seconds, 72°C for 30 seconds, 82°C for 2 seconds were repeated 30 times. It was (1 St PCR).

　　Template 2 μL
　　10x Buffer for rTaq or 10x Thunder Taq buffer 2 μL
　　25mM MgCl 2　1.6-1.8μL
　　Yeast production Taq DNA polymerase 1Unit
　　2mM CleanAmp-dNTP
　　2μL EvaGreen 1μL
　　10μM Region 1 forward primer 1a, 1b Equal amount 0.8-1.2μL
　　10μM Region 7 reverse primer 0.6-1.2μL (Pattern 2) In this case, Region 7 reverse primers 1a and 1b were added in equal amounts, 1.2 　　μL )
　　Sterilized water Appropriate amount
Total 20 μL
　After completion of PCR, the reaction solution was recovered and diluted 100 times with DNA-free ultrapure water. The diluted solution as a template, at a reaction solution composition 2 shown below (2 nd PCR). Regarding the PCR method, after heating at 95°C for 5 minutes, 94°C for 10 seconds, 57°C for 10 seconds, 72°C for 10 seconds, and 82°C for 10 seconds were repeated 35 times. As the forward primer and reverse primer used in this step, the forward primer and reverse primer of each of the pattern 1 and regions 1 to 7 for the second PCR step described above were used as a primer pair.

　　Template 10 μL
　　Taq buffer 2 [mu] L 10XThunder
　　25 mM MgCl 2　2 [mu] L
　　yeast production DNA polymerase Unit is defined Taq
　　2 mM CleanAmp-dNTPs or normal 2 [mu] L dNTPs
　　EvaGreen 1 [mu] L
　　10 [mu] M forward primer 0.6MyuL
　　10 [mu] M reverse primer 0.6MyuL
　　sterile water qs
　　Total 20 [mu] L
[0031]
　Incidentally, as a normal real-time PCR method, the 1 st PCR is not performed, the 2 nd Reaction was carried out extended to 60 times the repeat count under the same conditions as PCR. In addition, the results for the region 3 primer pair, which had the highest quantitativeness, are shown in FIG. 3 for comparison.
　Although can not quantify the normal real-time PCR in the low concentration region, 1 st by performing nested PCR with the number of cycles gene amplified by PCR is not a plateau, the calibration curve to the low concentration region showed linearity, high It enables sensitive and accurate quantification and identification of causative bacteria. It was confirmed that the quantitativeness of this method was as high as 1 to 400,000 in E. coli per PCR tube.
　In the relationship between the E. coli concentration and the threshold value of the PCR cycle number shown by □ in FIG. 3, the linearity in these relationships is lost in the low concentration region of 10 cells/ml or less. It can be seen that does not maintain the quantitative property in the low concentration region.
　In addition, eukaryote-made Taq DNA polymerase produced according to Patent Document 2 is used to carry out bacterial universal PCR without bacterial DNA contamination. As a result, the background due to bacterial contamination becomes zero, and even minute amounts of causative bacteria can be accurately quantified (it can be said that it is zero when sterile). To confirm this, PCR was performed using the bacterial universal primer with or without E. coli DNA as a template, and then the PCR amplification product was electrophoresed on an agarose gel. As a result, bacterial DNA remained in the commercially available thermostable DNA synthase, but no bacterial DNA was observed in eukaryote-made Taq DNA polymerase (produced using yeast or plant cells as a host) (Fig. 4).
[0032]
(Step 3: Rapid identification of causative bacteria by Tm mapping method (simultaneous parallel with Step 4)) Using
　the DNA obtained in Step 1 as a template, the causative bacteria are identified by Tm mapping method under the PCR conditions of Step 2. ..
　The layout of each primer in this Tm mapping method (FIG. 5) and the primer sequences used in this example are shown below.
　Primer sequences used in this example
1st PCR: The
　following Region 1'forward primers 1a and 1b are mixed and used in a 1:1 equivalent amount.
　Similarly, Region 7'reverse primers 1a and 1b are mixed and used in a 1:1 equivalent amount.
　Perform 1st PCR with 1 tube for each sample.
Region 1'forward primer 1a: 5'-AGAGTTTGATCATGGCTCAG-3' (SEQ ID NO: 1)
Region 1'forward primer 1b: 5'-AGAGTTTGATCCTGGCTCAG-3' (SEQ ID NO: 2)
Region 7'reverse primer 1a: 5'-AGACCCGGGAACGTATTC- 3'(SEQ ID NO: 4)
Region 7'reverse primer 1b: 5'-AGGCCCGGGAACGTATTC-3' (SEQ ID NO: 5)
2nd (nested) PCR:
　PCR is performed on each of the following forward and reverse primer sets of Regions 1'to 7'in 1 tube (total of 7 tubes per sample) to obtain 7 Tm values. Then, the causative bacteria are rapidly identified by the Tm mapping method.
Region 1'forward primer: 5'-GCAGGCTTAACACATGCAAGTCG-3' (SEQ ID NO: 18)
Region 1'reverse primer: 5'-CGTAGGAGTCTGGACCGT-3' (SEQ ID NO: 6)
Region 2'forward primer: 5'-GTCCAGACTCCTACGGGAG-3' ( SEQ ID NO: 19)
Region 2'reverse primer: 5'-CCTACGTATTACCGCGG-3' (SEQ ID NO: 20)
Region 3'forward primer: 5'-AGCAGCCGCGGTAATA-3' (SEQ ID NO: 21)
Region 3'reverse primer: 5'-GGACTACCAGGGTATCTAATCCT -3' (SEQ ID NO: 10)
Region 4'forward primer: 5'-AACAGGATTAGATACCCTGGTAG-3' (SEQ ID NO: 11)
Region 4'reverse primer: 5'-AATTAAACCACATGCTCCACC-3' (SEQ ID NO: 12)
Region 5'forward primer: 5'-TGGTTTAATTCGATGCAACGC-3' (SEQ ID NO: 13)
Region 5'reverse primer: 5'-GAGCTGACGACAGCCAT-3' (SEQ ID NO: 14)
Region 6'forward primer: 5'-GTTAAGTCCCGCAACGAG-3' (SEQ ID NO: 22)
Region 6'reverse primer: 5'-CCATTGTAGCACGTGTGTAGCC-3' ( SEQ ID NO: 23)
Region 7'forward primer: 5'-GGCTACACACGTGCTACAATGG-3' (SEQ ID NO: 24)
Region 7'reverse primer: 5'-AGACCCGGGAACGTATTC-3' (SEQ ID NO: 4)
[0033]
(Step 4: Quantitative method for causative bacteria that does not cause differences depending on bacterial species (simultaneous with Step 3)) For the
　purpose of drawing a calibration curve for quantification, DNA extracted from bacteria with known bacterial numbers is used. A dilution series with three different DNA concentrations is prepared as a quantitative control. The method for preparing the quantitative control is shown below.
(A) A DNA extract was prepared from bacteria whose number of bacteria was known in advance
. (1) The E. coli ATCC25922 strain was sprayed on a regular agar medium and then cultured in an incubator for 12 hours.
(2) A suspension (McFarland 0.5) was prepared using physiological saline.
(3) The cells were further diluted 1000 times and the number of bacteria was counted using BD cell viability kit, BD FACS Canto II.
(4) Total was measured 3 times, and the average value was used as the number of bacteria (140605 cells/ml).
(5) DNA was extracted from 100 μl (14061 pieces) of the above-mentioned diluted solution, and finally 100 μl of AVE (DNA extract solution of DNA extraction kit from QIAGEN) was prepared (140 pieces/μl).
(B) A large amount of DNA extract for quantitative control was prepared
(1) E. coli ATCC25922 strain was sprayed on ordinary agar medium and then cultured in an incubator for 12 hours.
(2) A suspension (McFarland 0.5) was prepared using physiological saline.
(3) DNA was extracted from 1 ml of the above suspension to finally prepare a 100 μl AVE DNA extract.
(C) Use a DAN extract from a bacterium whose number is known in advance and correct the number of large amount of DNA extract in
item (B) (1) AVE the DNA extract prepared in item (B) Diluted. The diluted one was counted for the number of bacteria by the calibration curve of item (A).
(2) Finally, a large amount of 5000/μl DNA extract was prepared.
(3) 15 μl of the DNA extract was divided into 1.5 ml tubes and stored at -80°C.
(4) When used in a quantitative test, the aliquot of the DNA extract was diluted 10 times, 100 times, and 1000 times with AVE and used. As a result, 500 pieces/μl (1000 pieces/PCR tube), 50 pieces/μl (100 pieces/PCR tube), 5 pieces/μl (10 pieces/PCR tube) of DNA extraction liquid were obtained. I drew.
[0034]
　Next, nested PCR was performed under the PCR conditions of Step 2 along with quantitative control, using the pathogenic fungal DNA of Step 1 as a template. For quantitative 1st PCR and 2nd PCR, the following bacterial universal primer (primer for detecting almost all bacteria) was used. The target region of the bacterial universal primer is the bacterial conserved region of 16S ribosomal RNA gene (base sequence region common to almost all bacteria). If a specific bacterium is to be quantified, it can be quantified by using a bacterium species-specific primer, but a causative bacterium has not been identified in the early stage of sepsis, and a bacterium species-specific primer cannot be used. Therefore, it is impossible to detect unidentified bacteria unless the bacterial universal primer is used.
　However, even if there is a single base mismatch between the primer and the target region, it affects the quantification result (measured less). The bacterial conserved region does not necessarily have a completely identical base sequence in all bacteria, and there may be, for example, two conserved sequences differing by one base. In that case, if a primer that completely matches one of the sequences is used, the quantification result will be small in bacteria with a single base mismatch. In order to solve this problem, in the present invention, an equal amount of a primer that perfectly matches each of the sequences that differ by one base was mixed to enable accurate quantification of both. Below, the results of an experiment in which an exact quantification of the two types of primers can be performed by mixing equal amounts of the two types of completely matched primers are shown (FIG. 6).
[0035]
・Explanation of the experiment in FIG. 6:
　Regarding the bacterial conserved region of the 16S ribosomal RNA gene of bacteria, for example, when the Tm mapping method uses a primer set of pattern 1, the target sequence of the 1st PCR forward primer is mainly AGAGTTTGATCATGGCTCAG in all bacterial species. (SEQ ID NO: 1) or AGAGTTTGATCCTGGCTCAG (SEQ ID NO: 2) are divided into two types that differ by one base.
　Therefore, we used the following three types of 1st PCR forward primer (reverse primer is common), E. coli (target sequence of forward primer: AGAGTTTGATCATGGCTCAG: SEQ ID NO: 1) as a template, and made a dilution series to obtain a standard curve. Created.
・1st PCR forward primer with no mismatch against E.coli (AGAGTTTGATCATGGCTCAG: SEQ ID NO: 1)
・1st PCR forward primer with one mismatch against E.coli (AGAGTTTGATCCTGGCTCAG: SEQ ID NO: 2)
・a mix of both 1 st PCR forward primers (no mismatch: one mismatch = 1: 1)
　As a result, 1 stIn the PCR using the PCR forward primer with one mismatch, the quantification result decreased to about 75% as compared with the case using the 1st PCR forward primer with no mismatch. However, a mix of both 1st PCR forward primers (no mismatch: one mismatch = 1: 1) In the case of, quantitative results 1 St was almost the same as PCR forward primer with no mismatch.
　In other words, if it is a mixture of both 1st PCR forward primers (no mismatch: one mismatch = 1:1), both of AGAGTTTGATCATGGCTCAG (SEQ ID NO: 1) or AGAGTTTGATCCTGGCTCAG (SEQ ID NO: 2) will be equally accurate. It was shown that it can be quantified.
　The PCR primer set for quantification used in this example is shown below.
・1st PCR: The
　following Region 1'forward primers 1a and 1b are mixed in a 1:1 equivalent amount and used.
　Similarly, Region 7'reverse primers 1a and 1b are mixed and used in a 1:1 equivalent amount.
Region 1'forward primer 1a: 5'-AGAGTTTGATCATGGCTCAG-3' (SEQ ID NO: 1)
Region 1'forward primer 1b: 5'-AGAGTTTGATCCTGGCTCAG-3' (SEQ ID NO: 2)
Region 7'reverse primer 1a: 5'-AGACCCGGGAACGTATTC-3' (SEQ ID NO: 4)
Region 7'reverse primer 1b: 5'-AGGCCCGGGAACGTATTC- 3′ (SEQ ID NO: 5)
·2nd (nested) PCR; the
　following Region 3′ forward primer and Region 3′ reverse primer are used.
Region 3'forward primer: 5'- AGCAGCCGCGGTAATA -3' (SEQ ID NO: 21)
Region 3'reverse primer: 5'- GGACTACCAGGGTATCTAATCCT -3' (SEQ ID NO: 10)
　or more, E. coli DNA at a known concentration of 3 concentrations Was used as a quantitative control, a calibration curve was drawn at the three concentrations of the quantitative control, and the number of causative bacteria of bacterial DNA extracted from the patient sample was quantified. By obtaining the number of bacteria as a value converted as the number of E. coli bacteria used as a quantitative control, the number of bacteria in the sample can be quantified more easily, quickly and accurately.
　The above Step 1 to Step 4 are one embodiment of the first quantification method according to the present invention.
[0036]
(Step 5: Correction of bacterial count by 16S ribosomal RNA operon copy number using rapid identification result of causative organism) The
　quantitative result was calculated as the bacterial count of E. coli used as a quantitative control in Step 4. The target gene for quantification is the 16S ribosomal RNA gene. As shown in Table 1 for the diversity of the 16S ribosomal RNA operon copy number in the bacterial genome, the operon copy number of the 16S ribosomal RNA gene differs depending on the bacterial species. The converted value of .coli does not represent the number of other bacterial species.
[0037]
[table 1]

[0038]
　Therefore, for more accurate quantification of bacteria, it is necessary to correct the operon copy number for each bacterial species. Since the causative bacteria are identified and quantified in parallel in Step 3 and Step 4, the correct bacterial count can be calculated by correcting the bacterial count with the 16S ribosomal RNA operon copy number of the identified causative bacteria.
　For example, when a calibration curve is created using Escherichia coli as a control bacterium and the bacterium identified from the sample is Bacillus cereus, the bacterium count is corrected by the formula of corrected bacterium count=temporary bacterium count×(7/13) To do.
　The above Step 1 to Step 5 are one embodiment of the second quantification method according to the present invention.
[0039]
(Example 2)
　By Step 1 to Step 4 of Example 1, a rapid quantitative test for a causative organism was carried out using a sepsis patient specimen (EDTA blood collection tube 2 mL). Three cases were suspected of sepsis at Toyama University Hospital, and blood culture test became positive after that. Blood sampling is performed before antibacterial treatment (pretreatment), 24 hours (after 24 hrs.), and 72 hours (after 72 hrs.) after administration of the antibacterial agent. At the 3 points, body temperature and white blood cells are measured along with rapid quantitative analysis of the causative agent. Number, CRP, preceptin and IL-6 were measured. In addition, blood-collecting specimens before the antimicrobial treatment were used to identify the causative bacteria by blood culture and to carry out a drug sensitivity test. The outline of each case is as follows.
　Case 1:
76-year-old woman, sepsis associated with urinary tract infection
, blood culture, urine culture: Escherichia coli
, antibiotics: meropenem (susceptible)
　Case 2:
88-year-old woman, with obstructive cholangitis associated with end-stage pancreatic cancer Accompanied sepsis
and blood culture: Klebsiella oxytoca, Haemophilus influenzae, Streptococcus pneumoniae
and antibiotics: cefepime (K. oxytoca and H. influenzae are susceptible. S. pneumoniae is intermediate.)
　Case 3:
94-year-old woman, urinary tract infection Associated Sepsis
, Blood Culture, Urine Culture: Escherichia coli
-Antibiotics: Tazobactam/piperacillin (susceptible)
　The test results in each case are shown in Tables 2 to 4 and FIGS. 7 to 9. The symbols in FIGS. 7 to 9 indicate the following measurement items, and the measurement values ​​at the position of “◯” shown in each figure are shown in each table.
a: Pathogen: Number of causative bacteria measured by the method of the present invention
b: WBC: White blood cell count [×100/μL]
c: CRP: C-reactive protein [mg/L]
d: BT: Body temperature (Body temp.) [°C]
e:Presepsin: Preceptin [ng/mL]
f:IL-6: Interleukin-6 [pg/mL]
[0040]
[Table 2]

[0041]
[Table 3]

[0042]
[Table 4]

[0043]
(Example 3)
　According to Step 1 to Step 5 of Example 1, a causative bacterium rapid identification/quantitative test was performed using a sepsis patient sample (EDTA blood collection tube 2 mL). Four cases were suspected of sepsis at Toyama University Hospital, and blood culture test became positive after that. Blood sampling is performed before antimicrobial treatment (pretreatment), 24 hours (after 24 hrs.) and 72 hours (after 72 hrs.) after administration of the antimicrobial agent. , White blood cell count, CRP, preceptin and IL-6 were measured. In addition, blood-collecting specimens before the antimicrobial treatment were used to identify the causative bacteria by blood culture and to carry out a drug sensitivity test. The outline of each case is as follows.
　Case 4:
- 76-year-old woman, sepsis caused by urinary tract infection
, Tm mapping method: Escherichia coli (Dist value = 0.29.)
, Blood culture, urine culture: Escherichia coli
- Antibiotics: meropenem (with sensitivity)
　Case 5:
- 94-year-old woman, sepsis associated with urinary tract infection
-Tm mapping method: Escherichia coli (Dist. value = 0.19)-Blood
culture-Urine culture: Escherichia coli
-Antibiotics: Tazobactam/piperacillin (susceptible)
　Case 6:
84 years old Woman, sepsis associated with wound infection after anterior lumbar fusion
・Tm mapping method: Streptococcus dysgalactiae (Dist. value=0.28)
・Blood culture: Streptococcus dysgalactiae
・Antibiotics: Tazobactam/piperacillin (susceptibility is not a criterion)
　Case 7:
・81-year-old woman, sepsis associated with urinary tract infection
・Tm mapping method: Enterobacter aerogenes (Dist. value=0.48)-Blood
culture-Urine culture: Enterobacter aerogenes (mutant strains 2 types)-Antibiotics
: Tazobactam/piperacillin (susceptible)
　Tables 5-8 and figures showing test results in each case 10 to 13 show. The symbols in FIGS. 7 to 10 indicate the following measurement items, and the measurement values ​​at the position of “◯” shown in each figure are shown in each table.
a: Pathogen: Number of causative bacteria measured by the method of the present invention
b: WBC: White blood cell count [×100/μL]
c: CRP: C-reactive protein [mg/L]
d: BT: Body temperature (Body temp.) [°C]
e:Presepsin: Preceptin [ng/mL]
f:IL-6: Interleukin-6 [pg/mL]
[0044]
[Table 5]

[0045]
[Table 6]

[0046]
[Table 7]

[0047]
[Table 8]

[0048]
(Example 4)
　Steps 1 to 4 of Example 1 were used to perform rapid identification/quantitative test of causative bacteria using a blood sample of a patient suspected of sepsis and 2 mL of EDTA blood collection tube. However, one of the two blood samples collected was centrifuged at 100 xg for 5 minutes to separate blood cells, and the resulting supernatant, including the buffy coat, was collected and vortexed. The mixture was uniformly mixed with a mixer, and 500 μL thereof was recovered, and the recovered liquid was pelletized and collected by centrifugation at 20,000×g for 10 minutes. For the other of the two, after separating blood cells as described above, 500 μL of the resulting supernatant was collected so that it did not contain buffy coat, and this was pelleted and collected by strong centrifugation at 20,000 xg for 10 minutes. Bacteria were manipulated.
　With buffy coat contains phagocytic white blood cells, and without buffy coat only plasma without phagocytic white blood cells. In fact, no infection has occurred in the patient or patient sample, and if bacterial DNA that is derived from skin indigenous bacteria at the time of blood sampling, work environment, or contamination on the device is detected, these bacteria are phagocytosed by leukocytes. No, there is no difference in the number of bacteria depending on the presence or absence of buffy coat. On the other hand, if the bacteria to be detected are pathogenic bacteria, they will be phagocytosed by white blood cells in the blood of the patient, and the number of bacteria will always be significantly higher with buffy coat than without buffy coat. Should be.
　An example of the results obtained from each sample is shown in Tables 9 to 13.
[0049]
[Table 9]

[0050]
[Table 10]

[0051]
[Table 11]

[0052]
[Table 12]

[0053]
[Table 13]

[0054]
　The results for the samples of Tables 9 and 10 showed that the number of bacteria with buffy coat was large and the number of bacteria without buffy coat was significantly higher. From these facts, it can be determined that the bacteria identified by Tm Mapping are the causative bacteria with a very high probability. Also, in these samples, the same bacteria or bacterial species were remarkably detected in the blood culture carried out simultaneously with the identification and quantification of the bacteria by this method.
　The specimens in Table 11 had a large number of bacteria with buffy coat and were expected to be infected. However, the difference in the number of bacteria with and without buffy coat was smaller than that in Tables 9 and 10, and it was assumed that contamination or accidental quantification error occurred in the test section with buffy coat.
　Therefore, sterilized water was used as a sample, and after sampling the blood collection tube, through Step 1 to Step 4 of Example 1, quantification of the number of bacteria in the sample corresponding to the negative control was performed multiple times. As a result, it was found that in our test environment, a number corresponding to 100 bacteria/ml in E. coli conversion may be detected without being derived from the original sample.
　That is, even if the causative bacteria do not exist in the patient sample, a quantified value of 100 bacteria/ml can be obtained as an error from each of the samples with and without the buffy coat. In addition, even if there is a difference in the number of bacteria between with and without buffy coat, if the difference is 100 bacteria/ml or less, it may be due to an error.
　Interpreting the results in Table 11 based on this result makes the following determinations.
　Specimen number 84 is a number that exceeds the error range of 100 bacteria/ml with and without buffy coat, but since there is no difference between the two, there is no phagocytosis by leukocytes, and the detected bacteria are not causative bacteria. To be judged.
　Sample number 89 was calculated to be 87.5 bacteria/ml with buffy coat, which is a large number compared to without buffy coat, but it is within the error range, and the number of detected bacteria and the number of bacteria are not the causative bacteria. It cannot be judged without being cut.
　Specimen Nos. 16, 54, 56, 66, 78, 98, 133, 137 have buffy coat of each specimen, and the number of bacteria larger than the error range is calculated, and the difference in the number of bacteria with no buffy coat is also larger than the error range. It is a number, and the detected bacteria are likely to be causative bacteria.
　It is possible to make such a judgment within 4 to 5 hours earlier than the result obtained by the culture which is a conventional bacterial identification method (after several days).
[0055]
　As a result, the number of bacteria in the blood fluctuated more dramatically than any other biomarker in the short time after treatment. From this result, it was suggested that the bacterial count is a new excellent biomarker of sepsis. And, we believe that this test method, which can provide clinical data of bacterial count for the first time in the world, will be extremely useful in the medical treatment of infectious diseases in the future.
The scope of the claims
[Claim 1]
　A method for quantifying the number of bacteria in a sample, which comprises the following steps:
(1) A nucleic acid derived from the sample is used as a template and a universal primer pair for amplification of the bacterial 16S rRNA gene is used to perform a second PCR method. A first PCR step for obtaining an amplification product of No. 1,
(2) by a nested PCR method using a primer pair for amplifying the internal sequence of the sequence of the first amplification product obtained by the first PCR step Using the second PCR step for obtaining the second amplification product, and
(3) calibration data showing the relationship between the amount of the amplification product derived from the control bacterium of which the bacterial species is known and the number of the control bacterium. A quantification step of the number of bacteria in which the number of bacteria in the sample is determined from the amount of the second amplification product obtained in the second PCR step.
[Claim 2]

A 　method for quantifying the number of bacteria in a sample according to claim 1, which comprises the following steps: (A) A universal primer pair for amplification of a bacterial 16S rRNA gene using a sample-derived nucleic acid as a template A first PCR step for obtaining a first amplification product by a PCR method using
(B) a primer pair for amplifying an internal sequence of the sequence of the first amplification product obtained by the first PCR step Second PCR step to obtain second amplification product by nested PCR method,
(C) Third amplification step by PCR method using nucleic acid sample corresponding to known bacterial number of control bacteria of known bacterial species A third PCR step for obtaining a product,
(D) a fourth PCR step for obtaining a fourth amplification product by a nested PCR method using the third amplification product obtained by the third PCR step,
(E) A step of preparing data for calibration from the known number of bacteria and the amount of the fourth amplification product, and (F) a step of preparing the calibration data from the amount of the second amplification product obtained in the second PCR step. A step of quantifying the number of bacteria for determining the number of bacteria in the sample using the data.
[Claim 3]
　The method for quantifying the number of bacteria in a sample according to claim 2, wherein the steps (C), (E) and (F) are performed by the following steps.
(C-1) A third PCR step of obtaining a third amplification product by a PCR method by individually using a plurality of nucleic acid samples corresponding to a plurality of different known bacterial numbers of control bacteria whose bacterial species are known,
(E-1) a step of creating a calibration curve from the known number of bacteria and the amount of the fourth amplification product, and
(F-1) amount of the second amplification product obtained in the second PCR step From the step of quantifying the number of bacteria, the number of bacteria in the sample is obtained using the above calibration curve.
[Claim 4]
　The number of bacteria in a specimen according to any one of claims 1 to 3, wherein the first PCR step is carried out at a cycle number at which the gene amplification in the first PCR step does not plateau. Method.
[Claim 5]
　The number of bacteria in the specimen according to any one of claims 1 to 4, further comprising a dilution step of diluting a reaction solution containing the first amplification product and subjecting it to the second PCR step. How to quantify.
[Claim 6]
　The first PCR step and the third PCR step are performed in parallel in the same PCR device, and the second PCR step and the fourth PCR step are performed in parallel in the same PCR device. The method for quantifying the number of bacteria in a specimen according to any one of claims 2 to 5, which is performed.
[Claim 7]
　The second PCR step is performed using a plurality of primer pairs individually, and based on a combination of melting temperatures (Tm values) of a plurality of amplification products amplified by each primer pair or a combination of differences between Tm values, The method for quantifying the number of bacteria in a sample according to any one of claims 1 to 6, further comprising the step of identifying the bacterial species of the bacteria in the sample.
[Claim 8]
　The fourth PCR step is performed using at least one of the plurality of primer pairs for the second PCR step (however, when using a plurality of primer pairs, a plurality of primer pairs are used individually for each of the plurality of primer pairs). 4) is performed), The method for quantifying the number of bacteria in a sample according to claim 7.
[Claim 9]
　The method for quantifying the number of bacteria in a sample according to claim 1, wherein the control bacterium is Escherichia coli.
[Claim 10]
　10. The universal primer pair used in the first PCR step, wherein one or both of a forward primer and a reverse primer is a mixture of two types of primers that differ by one base in equal amounts. A method for quantifying the number of bacteria in a sample according to the item.
[Claim 11]
　A method for quantifying the number of bacteria in a sample, which comprises the following steps:
(1) A PCR method using a universal primer pair for amplification of a bacterial 16S rRNA gene using a sample-derived nucleic acid as a template. A first PCR step for obtaining an amplification product of No. 1,
(2) by a nested PCR method using a primer pair for amplifying the internal sequence of the sequence of the first amplification product obtained by the first PCR step A second PCR step for obtaining a second amplification product,
(3) using calibration data showing the relationship between the amount of the amplification product derived from a control bacterium of which the bacterial species is known and the number of the control bacterium, Quantifying the bacterial count in the specimen from the amount of the second amplification product obtained in the second PCR step,
(4) Identifying the bacterial species of the bacterium in the specimen And
(5) the tentative number of bacteria determined in the number-of-bacteria determination step is corrected based on the 16S rRNA operon copy number of the control bacterium and the number of the strains identified in the strain identification step, and the bacterium in the sample is corrected. Bacteria count correction process to determine the number.
[Claim 12]
　The method for quantifying the number of bacteria in a sample according to claim 11, which comprises the following steps:
(A) A universal primer pair for amplification of a bacterial 16S rRNA gene using a sample-derived nucleic acid as a template A first PCR step for obtaining a first amplification product by a PCR method using
(B) a primer pair for amplifying an internal sequence of the sequence of the first amplification product obtained by the first PCR step Second PCR step of obtaining a second amplification product by nested PCR using
(C) Third amplification by PCR using a nucleic acid sample corresponding to a known bacterial number of control bacteria of known bacterial species A third PCR step for obtaining a product,
(D) a fourth PCR step for obtaining a fourth amplification product by a nested PCR method using the third amplification product obtained by the third PCR step,
(E) Data for calibration from the known number of bacteria and the amount of the fourth amplification product,
(F) Data for calibration from the amount of the second amplification product obtained in the second PCR step And (H)
a microbial species identification step of identifying the bacterial species of the bacterium in the sample, and
(H) a tentative bacterium obtained in the bacterial number quantification step. The number-correcting step of determining the number of bacteria in the sample by correcting the number based on the 16S rRNA operon copy number of the control bacteria and the bacterial species identified in the bacterial species identifying step.
[Claim 13]
　The method for quantifying the number of bacteria in a sample according to claim 12, wherein the steps (C), (E) and (F) are performed by the following steps.
(C-1) A third PCR step for obtaining a third amplification product by a PCR method using a plurality of nucleic acid samples corresponding to a plurality of known numbers of different bacteria of control bacteria whose bacterial species are known, respectively.
(E-1) a step of creating a calibration curve from the known number of bacteria and the amount of the fourth amplification product, and
(F-1) amount of the second amplification product obtained in the second PCR step From the step of quantifying the number of bacteria, the provisional number of bacteria in the sample is obtained by using the calibration curve.
[Claim 14]
　14. The quantification of the number of bacteria in a sample according to claim 11, wherein the first PCR step is performed with a cycle number at which the gene amplification in the first PCR step does not plateau. Method.
[Claim 15]
　The number of bacteria in the specimen according to any one of claims 11 to 14, which comprises a dilution step of diluting a reaction solution containing the first amplification product and subjecting it to the second PCR step. How to quantify.
[Claim 16]
　The first PCR step and the third PCR step are performed in parallel in the same PCR device, and the second PCR step and the fourth PCR step are performed in parallel in the same PCR device. The method for quantifying the number of bacteria in a sample according to any one of claims 12 to 15, which is performed.
[Claim 17]
　In the bacterial species identification step, the second PCR step is performed individually using a plurality of primer pairs, and a combination of melting temperatures (Tm values) of a plurality of amplification products amplified by each primer pair or between Tm values ​​is used. The method for quantifying the number of bacteria in a sample according to any one of claims 11 to 16, comprising the step of identifying the bacterial species of the bacteria in the sample based on a combination of differences.
[Claim 18]
　The fourth PCR step is performed using at least one of the plurality of primer pairs for the second PCR step (however, when using a plurality of primer pairs, a plurality of primer pairs are used individually for each of the plurality of primer pairs). The PCR step of 4) is performed).
[Claim 19]
　The method for quantifying the number of bacteria in a sample according to any one of claims 11 to 18, wherein the control bacterium is Escherichia coli.
[Claim 20]
　20. The universal primer pair used in the first PCR step, wherein one or both of a forward primer and a reverse primer is a mixture of two types of primers that differ by one base in equal amounts. A method for quantifying the number of bacteria in a sample according to the item.
[Claim 21]
　After centrifuging a blood sample to separate it into a red blood cell fraction, a buffy coat fraction and a plasma fraction, a sample A containing the plasma fraction of the supernatant and buffy coat, and a buffy coat containing the plasma fraction of the supernatant were separated. The sample A and the sample A are prepared by
　a method for quantifying the number of bacteria in a sample, which has a step (a) of preparing a sample B not containing the sample, and the following steps (2-1), (2-2) and (2-3). A step (b) of quantifying the number of bacteria in each of the samples B,
and
　a step (c) of determining the presence or absence of bacterial contamination in the blood sample by comparing the numbers of the bacteria in the samples A and B.
A method for determining the presence or absence of contamination, including.
(2-1) A first PCR step in which a first amplification product is obtained by a PCR method using a nucleic acid derived from a sample as a template and a universal primer pair for amplification of a bacterial 16S rRNA gene,
(2-2) A second PCR step of obtaining a second amplification product by a nested PCR method using a primer pair for amplifying the internal sequence of the sequence of the first amplification product obtained by the first PCR step, and
(2 -3) A step of quantifying the number of bacteria, in which the provisional number of bacteria in the sample is obtained from the amount of the second amplification product obtained in the second PCR step using the data for calibration.
[Claim 22]
　The method for determining the presence or absence of contamination according to claim 21, wherein the step (b) of quantifying the number of bacteria further includes steps (2-4) and (2-5).
(2-4) the bacterial species identifying step of identifying the bacterial species of the bacteria in the sample, and
(2-5) the provisional bacterial number obtained in the bacterial number quantifying step in the control bacterial species and the bacterial species identifying step. A step of correcting the number of bacteria for correcting the number of 16S rRNA operon of the identified bacterial species to determine the number of bacteria in the sample.
[Claim 23]
　The determination of the presence or absence of contamination according to claim 21 or 22, wherein in the step (c) of determining the presence or absence of contamination, the determination is made in consideration of the difference in the number of bacteria of the sample A and the sample B and the error range. Method.