Sign In to Follow Application
View All Documents & Correspondence

Method For Synthesis Of Human Recombinant Insulin With Improved Process Efficiency

Abstract: The present invention relates to the method for synthesis of human recombinant insulin in E.coli through a recombinant plasmid construct having affinity tag. The affinity tag employed in the present invention is T7 tag having 11 amino acid residues. In the present invention with the use of T7 tag CNBr would not be required during the process for the removal of formyl methionine and hence there would be no associated toxicity of CNBr in the final recombinant human insulin.

Get Free WhatsApp Updates!
Notices, Deadlines & Correspondence

Patent Information

Application #
Filing Date
26 March 2004
Publication Number
00
Publication Type
INA
Invention Field
GENERAL ENGINEERING
Status
Email
Parent Application
Patent Number
Legal Status
Grant Date
2009-09-22
Renewal Date

Applicants

RELIANCE LIFE SCIENCES PVT LTD.
CHITRAKOOT, 2ND FLOOR, GANPATRAO KADAM NARG, SHREE RAM MILLS COMPOUND, LOWER PAREL, MUMBAI

Inventors

1. SONAL SETHI
CHITRAKOOT, 2NDFLOOR, GANPATRAO KADAM NARG, SHREE RAM MILLS COMPOUND, LOWER PAREL, MUMBAI-400 013
2. VENKATA RAMAN KONDIBOYINA
CHITRAKOOT, 2NDFLOOR, GANPATRAO KADAM NARG, SHREE RAM MILLS COMPOUND, LOWER PAREL, MUMBAI-400 013
3. ARNAB KAPAT
CHITRAKOOT, 2NDFLOOR, GANPATRAO KADAM NARG, SHREE RAM MILLS COMPOUND, LOWER PAREL, MUMBAI-400 013
4. DHANANJAY WADGOANKAR
CHITRAKOOT, 2NDFLOOR, GANPATRAO KADAM NARG, SHREE RAM MILLS COMPOUND, LOWER PAREL, MUMBAI-400 013
5. ASHISH GOYAL
CHITRAKOOT, 2NDFLOOR, GANPATRAO KADAM NARG, SHREE RAM MILLS COMPOUND, LOWER PAREL, MUMBAI-400 013

Claims

1. A method for synthesis of human recombinant insulin in E.coli through a recombinant plasmid construct having affinity tag, comprising steps of: i. construction of a synthetic gene encoding human proinsulin; ii. construction of plasmid pBINS; iii. construction of plasmid pTINS; iv. transformation of plasmid pTINS in E.coli host strain; v. expression of precursor of insulin having affinity tag; vi. purification of precursor insulin to yield pure insulin.

2. The method as claimed in claiml, wherein the affinity tag employed, is T7 tag having 11 amino acid residues.

3. The method as claimed in claiml, wherein the synthetic gene coding for human proinsulin is constructed by ligating 9 oligonucleotides designed based on the human proinsulin (for human insulin B chain, C peptide and A chain) after codon optimization for expression in E.coli and PCR amplification of ligation mix.

4. The method as claimed in claiml, wherein the construction of pBINS is carried out by cloning of human proinsulin gene into cloning vector, transforming proinsulin/cloning vector ligation mix into cells of suitable strain host thereby giving plasmid construct pBINS, screening and characterization of the plasmid 25 pBINS.

5. The method as claimed in claiml, wherein the construction of pTINS is carried out by digesting pBINS and expression vector separately, cloning cut plasmid insert into expression vector, transforming the proinsulin/expression vector ligation mix into cells of suitable host strain thereby giving plasmid construct pTINS, screening and characterization of the plasmid pTINS for right orientation.

6. The method as claimed in claiml, wherein the transformation of plasmid pTINS is carried out into E.coli cells of suitable strain by following standard transformation protocol, screening and characterization of transformants with respect to presence of proinsulin cDNA insert.

7. The method as claimed in claiml, wherein the expression of precursor of insulin with T7 tag is carried out by culturing one of the transformant into LB plus kanamycin liquid medium till OD600 reached 0.5 and inducing protein expression by IPTG and analyzing by SDS-PAGE.

8. The method as claimed in claiml, wherein the purification is carried out by harvesting cell mass by centrifugation, sonicating resultant pellet, purifying the inclusion bodies from the biomass and solubilizing, purifying proinsulin on ion exchange resin and further purifying on immuno-affinity column containing monoclonal antibodies against T7 tag, eluting protein, removing T7 tag, subjecting to proper folding and purifying by chromatography to give 26 recombinant human insulin.

9. The method as claimed in claiml, wherein the cloning vector employed for cloning proinsulin gene is selected from group comprising of pBS-KS, pUC-19, pGEM -T Easy, preferably it is pBS-KS.

10. The method as claimed in claiml, wherein the expression vector employed is selected from group comprising of pET 24 C, pET 11C, pET 3C, preferably it is pET 24 C having T7 affinity tag.

11. The method as claimed in claiml, wherein the E.coli strain used for transforming cloning vector/proinsulin mix is selected from the group comprising of TOP10F', XL lBlue, HB 101, DH 5 alpha,, preferably it is TOP10F'.

12. The method as claimed in claiml, wherein the E.coli strain used for transforming expressionvector/proinsulin mix is selected from the group comprising of BL 21 (DE3), BL 21 (DE3)codon plus, BL 21 (DE3)plysS, BL 21 (DE3) plys E, BL 21 (DE3) BLR, preferably it is BL 21 (DE3).

13. The method as claimed in claiml, wherein the antibody used for characterization / identification of expressed protein is T7 tag antibody HRP conjugate. 27

14. A method as claimed in claim 1 to 13 and as substantially herein described in specification and illustrated with examples 1 to 5. Dated this day of March 2004. For RELIANCE LIFE SCIENCES PVT.LTD.. K.V.SUBRAMANIAM Sr. Executive Vice President To: The Controller of Patents The Patent Office Mumbai. 28 ABSTRACT The present invention relates to the method for synthesis of human recombinant insulin in E.coli through a recombinant plasmid construct having affinity tag. The affinity tag employed in the present invention is T7 tag having 11 amino acid residues. In the present invention with the use of T7 tag CNBr would not be required during the process for the removal of formyl methionine and hence there would be no associated toxicity of CNBr in the final recombinant human insulin. 29

Specification

COMPLATE AFTER PROVISIONAL
LEFT ON 2 8 MAR 2005
FORM 2
THE PATENTS ACT, 1970 (39 of 1970)
COMPLETE SPECIFICATION
(See Section 10; rule 13)
"Method for Synthesis of Human Recombinant Insulin "
RELIANCE LIFE SCIENCES PVT.LTD.
an Indian Company having its Registered office at
Chitrakoot, 2nd Floor,
Ganpatrao Kadam Marg,
Shree Ram Mills Compound,
Lower Parel, Mumbai 400 013,
Maharashtra, India

The following specification describes the nature of this invention: -



Field of the Invention
The present invention relates to the method for synthesis of human recombinant insulin in E.coli. More particularly the present invention relates to the method for synthesis of human recombinant insulin in E.coli through a recombinant plasmid construct having affinity tag.
Background of the Invention
Diabetes, a condition characterized by high blood sugar is a chronic, metabolic disorder associated with long-term complications that affect almost every part of the body and often leads to blindness, heart and blood vessel disease, strokes, kidney failure, amputations and nerve damage. The disease is widely recognized as a leading cause of death and disability in the developed world and is fast emerging as one in the developing world as well.
With the global burden of the disease being very high - an estimated 194 million adults have diabetes. Among these, type I diabetics, (insulin dependent or juvenile onset), the substitution of the lacking endocrine insulin secretion is the only possible therapy at present. In type II diabetics (non-insulin dependent or adult onset) the first line of treatment in diabetes is a class of drugs called oral hypoglycemic agents. Insulin is usually reserved as the last option. However recently there is a paradigm shift, which has come in with the new research that is increasingly getting acceptance from the medical fraternity suggests that even type II diabetics can be put on insulin therapy early, which could help avoid long-term complications and also there can be a cost saving resulting from diabetes complications if patients are put on insulin therapy early on, "Endocrinologists now know that if you give the
2

Some of the processes which use genetically engineered E. coli are by Chance, R. E., et al., Peptides: Synthesis-Structure-Function, pp 721-728(1981), in Proceedings of the Seventh American Peptide Symposium, ed. Rich, D. H. & Gross, E., Pierce Chemical Co., Rockford, 111., U.S.A.; Frank, B. H., et al., Peptides: Synthesis-Structure-Function, pp 729-738(1981), in Proceedings of the Seventh American Peptide Symposium, ed. Rich, D. H. & Gross, E., Pierce Chemical Co., Rockford, 111., U.S.A.; Gilbert et al., in United States patent no. 4338397 (July 6, 1982); and Goeddel et al, in European Patent no. EP0055945 (July 14, 1982).
The process reported by Chance et al. for preparing insulin involves reducing each of the A and B chains of insulin in the form of a fusion protein by culturing E. coli which carries a vector comprising a DNA encoding the fusion protein; cleaving the fusion protein with cyanogen bromide to obtain the A and B chains; sulfonating the A and B chains to obtain sulfonated chains; reacting the sulfonated B chain with an excess amount of the sulfonated A chain; and then, purifying the resultant to obtain insulin(Chance, R. E., et al., supra). However, this process has drawbacks in that it is cumbersome to operate two fermentation processes and the reaction step of the sulfonated A and B chains gives a low yield of insulin, making the process inherently impractical.
The process described by Frank et al. for preparing insulin, comprises: producing proinsulin in the form of a fusion protein by culturing E. coli which carries a vector comprising a DNA encoding the fusion protein; cutting the fusion protein with cyanogen bromide to obtain proinsulin; sulfonating proinsulin and separating the sulfonated proinsulin; refolding the sulfonated proinsulin to form correct disulfide
4

pancreatic cells rest by administering insulin, the cells function better and for a longer time, enabling patients to maintain better blood sugar control". The concept of putting type II patients also on to insulin early is gaining momentum because it has been found to improve the quality of life while reducing the risk of complications.
Thus there is an ever-increasing demand for Insulin; the global requirement of insulin exceeds several tons annually. Conventionally, insulin was produced from limited animal sources, mainly bovine and porcine pancreatic preparations, which differ from human insulin and may elicit an unfavorable effect. It is now also possible to produce the human insulin by recombinant DNA technology. However for the economical mass production of insulin, the development of newer improved techniques have been developed continuously.
The earlier approach using E. coli include enzymatic process wherein an alanine residue at the 30 position of the B-chain or porcine insulin is replaced with the threonine residue through a transpeptidation reaction using trypsin (Markussen, J., Proceedings 1st International symposium 'Neue Insuline', pp 38-44 (1982), ed. Peterson, K. G., et al., Freiburger Graphische Betriebe, Freiburg). However as the enzymatic process for producing human insulin from porcine insulin is limited by its high cost, further studies have been focused on processes for producing human insulin by genetic engineering techniques. Human insulin has been commercially synthesized by genetic engineering techniques using various approaches using E. coli or S. cerevisiae.
3

bonds; treating the refolded proinsulin with trypsin and carboxypeptidase B; and, then, purifying the resultant to obtain insulin (Frank et al, supra). However, the yield of the refolded proinsulin having correct disulfide bonds sharply decreases as the concentration of proinsulin increases. This is due to the misfolding and some degree of polymerization involved and hence the process entails the inconvenience of using laborious purification steps during the recovery of proinsulin.
The method by Gilbert et al., in US patent no. 4338397 describes synthesizing within a bacterial host like E.coli and secreting through the membrane of the host a selected mature protein or polypeptide such as eukaryotic cell protein e.g., proinsulin. The method however utilizes the signal sequence, which would lead to the periplasmic expression of the protein. The periplasmic expressions as known to those ordinary skilled in the art however would give lower yields and hence at an industrial level would not be feasible.
Goeddel V. et al., in EP0055945 discloses a microbial expression of a chimeric gene used to produce a polypeptide comprising the amino acid sequence of human proinsulin, or an analog thereof differing in the "C" chain portion. A polypeptide so produced contains a sequence of additional amino acid units sufficient in number to protect it from the bacterial proteases, and has a cleavage site, e.g. a methionine residue adjacent to the proinsulin sequence. A methionine unit at the N-terminal used to cleave the proinsulin from bacterially expressed chimeric protein requires cyanogen bromide for the said purpose. However it is known fact that cyanogen bromide has high acute toxicity and is severely irritating. The toxic effects of cyanogen bromide are similar to those of hydrogen cyanide like cyanosis, nausea,
5

dizziness, headache, lung irritation, chest pain, and pulmonary edema, which may be fatal. Hence such process with the use of cyanogen bromide would not be desirable.
The methods for insulin synthesis in Saccharomyces cerevisiae are reported by Thim, L., et al., Proc. Natl. Acad. Sci. U.S.A., 83, pp 6766-6770(1986); and Markussen, J., et al., Protein Engineering, 1, pp 205-213(1987)); Hadfield et al. in United States patent no. 6337194, (January 8, 2002).
The process reported by Thim et al. for producing insulin in Saccharomyces cerevisiae; and isolating insulin therefrom via a series of steps, i.e., purification, enzyme reaction, acid hydrolysis and another purification (Thim, L., et al., supra). This process however gives a low insulin yield, due to the intrinsically low. expression level of yeast system as compared to E. coli.
The method as described in US patent no. 6337194 by Hadfield et al, employs preparation of insulin by cleavage of a fusion protein and fusion proteins containing insulin A & insulin B chains with the general formula B- - Z - -A, wherein B and A are the two insulin polypeptide chains, and Z is a polypeptide comprising an affinity polypeptide tag for isolation and purification of the double chain product. The DNA sequence for the Z peptide is KR-Y-M. Wherein K is lysine, R is arginine, Y is an additional polypeptide of interest and M is methionine. The invention method comprises of the recovery step involving cleaving the recovered double chain insulin precursor at the methionine residue M with cyanogen bromide treatment. As already mentioned it is well known to those ordinary skilled in the art that the use of cyanogen bromide would not be desirable on account of its high toxicity. Moreover the invention method employs Saccharomyces cerevisiae as a host, which as already
6

known would give lower yield as compared to E. coli.
In view of the shortcomings of the previous methods for synthesizing insulin there have been constant endeavor to develop methods for synthesizing insulin, which are not very lengthy and provide improved yields to meet the ever-increasing demand.
The recent approach towards providing less cumbersome methods for better yields is by way of fusing N-terminal affinity tag system to the protein of interest. The affinity tag systems are believed to replace the multiple steps required for purification of protein with one step.
Recombinant proteins are typically purified from the host organisms employing many different purification steps to recover the biologically active protein with the high purity. Usually chromatographic techniques are widely used for purification of the proteins. A typical multistep chromatography purification process consists of product release and clarification steps, an initial purification step and different chromatographic purification steps. The first step is a capturing step to remove the bulk of impurities, such as host-cell proteins; nucleic acids and endotoxins, wherein the product binds to the adsorbent while the impurities do not. The product is often eluted with a step gradient, giving a high concentration of the product but a moderate degree of purification. Ion exchange chromatography and to some extent hydrophobic interaction chromatography, are frequently used as the first chromatographic steps. Following the capturing step typically high-resolution techniques such as hydrophobic interaction chromatography, ion exchange chromatography, reversed phase chromatography or affinity chromatography are
7

of human insulin, DNA encoding for these precursors, preparation and use of instant precursors and DNA, and a process for preparing human insulin or an insulin analog. The precursor of human insulin or insulin analog is of the formula Fus-B(l-30)-RDVP-Y.sub.n-A(l-21); wherein Fus is an optionally present fusion portion; B(l-30) is a B chain of human insulin, Y is an amino acid chain which terminates with a basic amino acid at the C terminus; n is from 2 to 50 and indicates the length of the amino acid chain Y; and A(l-21) is an A chain of human insulin. The optional fusion portion includes conventional fusion proteins well known in the art for example glutathione S-transferase system, the maltose binding protein system, the FLAG system and 6.His system.
However despite many advantages, the previously used affinity tag systems present several drawbacks. The GST tags and MBP tags have large sizes, for e.g., GST tag has size - 220 amino acids, such large size can both hinder the solubility of the expressed protein, leading to formation of inclusion bodies and thereby distort the proteins native confirmation, moreover purification requires that the GST domain be properly folded. Therefore the tags with the large size would not be preferable, as they tend to render the less solubility to the protein of interest. His tag, which contains six consecutive histidines, is more commonly used tag, however such shorter tag could involve problems like the lack of stability and incorrect refolding of the proteins.
Thus there is a need to search for and employ an affinity fusion tag system which besides avoiding the multiple steps of isolation or purification of peptide fusion proteins obviates the shortcomings associated with the previously used tag systems
9

employed to purify protein to homogeneity.
The purification process for a recombinant protein expressed in E. coli most likely uses at least one liquid chromatography technique. But liquid chromatography frequently requires a considerable amount of optimization and usually involves several different chromatographic steps to get rid of the contaminants. However for better yield it is important to keep the number of steps as low as possible, since the total yield decreases rapidly with the increasing number of steps. The ideal technique would be the one step purification.
Recently since the first demonstration of the use of gene fusion for affinity purification reported in 1983 by Uhlen, M., Nilsson, B., Guss, B., Linerberg, M., Gatenbeck, and Phillipson, L. in Gene 23, 369-378 a large number of different affinity fusion systems are available and used. Filho, et al., in Unites States patent no. 6509452 (January 21, 2003) and Habermann et al., in United States patent no. 6534288 (march 18, 2003) employs the fusion affinity tag system for isolation and purification of insulin.
Filho, et al., in US patent no. 6509452 have disclosed a vector for expression of heterologous protein and methods for extraction recombinant protein and for purifying isolated recombinant insulin. The vector of the preferred embodiment of the invention include plasmid vectors containing a nucleic acid molecule encoding proinsulin and proinsulin with a His tag for isolation of pro-insulin.
Habermann et al, in US patent no. 6534288 (march 18, 2003) provides a precursor
8

like difficulty in solubilization due to the use of larger tag systems and lesser stability and incorrect refolding of the proteins which could be coupled with the use of shorter tag systems, thereby providing an improved method for synthesis of active human recombinant insulin, which also averts the use of hazardous and cumbersome cyanogens bromide treatment for the removal of formyl methionine from the N' terminus of the protein and confers the process safer, simpler and efficient.
Objects of the Invention
Accordingly the subject present invention provides the method for synthesis of human recombinant insulin in E.coli with improved process efficiency by using affinity tag system.
The subject invention provides the method for synthesis of active human recombinant insulin using affinity tag system, wherein the affinity tag system facilitates protein stabilization, protein detection/analysis and protein purification.
The subject invention provides the method for synthesis of active human recombinant insulin by expression of proinsulin in E. coli and its conversion to insulin.
The subject invention provides the method for synthesis of active human recombinant insulin wherein the active human recombinant insulin is released by enzymatic cleavage and is therefore devoid of the hazardous and cumbersome procedures.
10

Summary of the Invention
The present invention provides a method for synthesis of human recombinant insulin in E.coli through a recombinant plasmid construct having affinity tag.
In the most preferred embodiments the affinity tag employed, is T7 tag having 11 amino acid residues. The said affinity tag is believed to facilitate ease in protein purification, protein detection/analysis and protein stabilization.
In preferred embodiments of the present invention the method for synthesis of
insulin broadly comprises of:
construction of a synthetic gene encoding human proinsulin;
construction of plasmid pBINS;
construction of plasmid pTINS;
transformation of plasmid pTINS in E.coli host strain;
expression of precursor of insulin havingT7 tag;
purification.
In preferred embodiments of the present invention the synthetic gene coding for human proinsulin was constructed by ligating 9 olegonucleotides designed based on the human proinsulin (for human insulin B chain, C peptide and A chain) after codon optimization for expression in E.coli and PCR amplification of ligation mix.
In preferred embodiments the construction of pBINS was carried out by cloning of human proinsulin gene into cloning vector, transforming proinsulin/cloning vector
11

ligation mix into cells of suitable strain host, screening and characterization of the
plasmid.
In preferred embodiments the construction of pTINS was carried out by digesting
pBINS and expression vector separately, cloning cut plasmid insert into expression
vector, transforming the proinsulin/expression vector ligation mix into cells of
suitable host strain, screening and characterization of the plasmid for right
orientation.
In the preferred embodiments the plasmid pTINS was transformed into E.coli cells of suitable strain by standard transformation protocol, screening and characterization of transformants with respect to presence of pro insulin cDNA insert.
In preferred embodiments expression of precursor of insulin with T7 tag was carried out by culturing one of the transformant into LB plus kanamycin liquid medium till OD600 reached 0.5 and inducing protein expression by IPTG and analyzing by SDS-PAGE.
In preferred embodiments the purification was carried out by harvesting cell mass by centrifugation, sonicating resultant pellet, purifying the inclusion bodies from the biomass and solubilizing, purifying proinsulin on ion exchange resin and further purifying on immuno-affinity column containing monoclonal antibodies against T7 tag, eluting protein, removing T7 tag, subjecting to proper folding and purifying by chromatography to give recombinant human insulin.
It is the further feature of the preferred embodiments of the present invention that
12

the cloning vector employed for cloning proinsulin gene is selected from group comprising of pBS-KS, pUC-19, pGEM -T Easy, preferably it is pBS-KS.
It is the further feature of the preferred embodiments of the present invention that the expression vector employed is selected from group comprising of pET 24 C, pET 11C, pET 3C, preferably it is pET 24 C having T7 affinity tag.
It is the further feature of the preferred embodiments of the present invention that the E.coli strain used for transforming cloning vector/proinsulin mix is selected from the group comprising of TOP10F', XL lBlue, HB 101, DH 5 alpha, preferably it is TOPI OF'.
It is the further feature of the preferred embodiments of the present invention that the E.coli strain used for transforming expressionvector/proinsulin mix is selected from the group comprising of BL 21 (DE3), BL 21 (DE3)codon plus, BL 21 (DE3)plysS, BL 21 (DE3) plys E, BL 21 (DE3) BLR, preferably it is BL 21 (DE3).
In the most preferred embodiments the antibody used for characterization / identification of expressed protein is T7 tag antibody HRP conjugate.
It is the further aspect of the method for synthesis of active human recombinant insulin wherein the active human, recombinant insulin is released by enzymatic cleavage and is therefore devoid of the hazardous and cumbersome procedures.
13

Detailed Description of the Invention
The present invention provides a method for synthesis of human recombinant insulin in E.coli through a recombinant plasmid construct having affinity tag. In the most preferred embodiments the affinity tag employed, is T7 tag having 11 amino acid residues. The said affinity tag is believed to facilitate ease in protein purification, protein detection/analysis and protein stabilization.
The fusion affinity tag system that is employed in the present invention is T7 tag which has 11 amino acid residues, which is fused to proinsulin. In accordance with the present invention T7 tag can be replaced by any other suitable affinity fusion tag system having the desirable attributes so as to facilitate in providing protein stabilization, protein detection/analysis and protein purification.
The advantage of the affinity fusion tag system is that the T7 tag is believed to offer a better stability to the protein, as tagged protein would be more stable in the host cell than proinsulin itself. The presence of T7 tag facilitates the isolation and purification process, since the tagged protein then can be identified or isolated by virtue of the specific tag, thus making the purification and analysis simpler. The use of T7 tag in accordance with the present invention helps in detection by western blot analysis using the antibody against T7 like Anti T7 HRP conjugate. Furthermore due to the presence of T7 tag, purification procedures are relatively simple as compared to conventional chromatographic method for purification of final protein without having any affinity fusion tag, thus making the process faster and economical. The use of T7 tag could improve the recovery of the protein.
14

Also with the use of affinity tag system in accordance with the present invention, the conventional cleavage procedure such as a CNBr method to cleave the formyl methionine would not be required. Usually during the protein translation formyl methionine is added at the N' terminus of the peptide by the E.coli host. During further processing this formyl methionine needs to be removed from the mature protein using CNBr treatment leading to the residual CNBr. As CNBr is known to be toxic it would be desirable to avoid such use of CNBr during the process. In the present invention with the use of T7 tag CNBr would not be required during the process for the removal of formyl methionine and hence there would be no associated toxicity of CNBr in the final recombinant human insulin.
Synthesis of active human recombinant insulin by expression of proinsulin in E. coli with the improved efficiency according to the present invention was carried out as per the method set forth below.
a. synthesizing human proinsulin gene;
b. cloning of human proinsulin gene into desired cloning vector;
c. transforming the host cells with recombinant plasmid pBINS containing the
cloned human proinsulin gene;
d. cloning of proinsulin gene from recombinant plasmid pBINS into an
expression vector containing T7 tag;
e. transforming the host cells with the recombinant plasmid pTINS;
f. characterizing the recombinant clones for proper orientation with respect to the
T7 promoter;
g. cultivating E.coli cells containing recombinant proinsulin gene in fermentor of
15

suitable size in presence of production medium under controlled parameter for
a predetermined period;
h. detecting, identifying and quantifying proinsulin in cultivation sample of
E.coli;
i. isolating expressed human proinsulin in the form of inclusion body from E.coli
in a suitable lysis buffer solution;
j. washing the inclusion body with low concentration of denaturing agent and
low concentration of detergent followed by distilled water;
k. solubilizing the inclusion body by addition of protein solubilizing agent to a
final concentration of 4-8 M;
1. clarifying the protein after diluting the above to the final concentration of 0.1
- 0.4 M solubilizing agent and stirring for 10-20 hours at 4° C;
m. adsorbing the protein on ion exchange resin and eluting insulin with alkali
chloride;
n. purifying further on immuno-affinity column containing monoclonal
antibodies against T7 tag and eluting proinsulin;
o. subjecting the purified protein to treatment with trypsin to remove T7 tag and
convert proinsulin to insulin;
p. further purifying with reverse phase chromatography under optimized
conditions yielding purified insulin.
For synthesizing human proinsulin gene in accordance with the present invention method oligonucleotides were designed from the amino acid sequences of the human proinsulin (for human insulin B chain, C peptide and A chain) after codon optimization for expression in E.coli, followed by synthesis of proinsulin gene by
16

ligation of the synthesized oligonucleotides and PCR amplification of the ligation mix.
For cloning of human proinsulin gene into desired cloning vector, the cloning vector was restriction digested to give blunt end vector. The vectors that may be employed in accordance with present invention can be selected from vector pBS-KS, pUC-19, pGEM -T Easy, or the like. The preferable vector is pBS-KS. Proinsulin DNA was ligated with blunt end vector, transformed into host cells followed by, screening and characterization of clones resulting in recombinant construct pBINS, which has proinsulin gene. Recombinant construct pBINS was used as a template for PCR amplification of proinsulin gene. The expression vector was restriction digested followed by Klenow treatment to get blunt ends. The expression vector employed in the present invention can be selected from vectors like pET 24C, pET 3C, pET 11C, preferably it is pET 24c having affinity tag T7. Insert as prepared earlier was ligated with the expression vector, transformed into host cells followed by screening and characterization of the clones for proper orientation with respect to T7 promoter resulting in recombinant construct pTINS. Host cells with the sequenced construct pTINS were allowed to produce proinsulin, which was detected for confirmation.
The preferred host used in accordance with the present invention is Escherichia coli. E. coli has many advantages as a host for production of recombinant proteins. E.coli is the most widely used and convenient system for the production of therapeutic proteins of interest. The advantages of this system comprise the ease of gene manipulation; the ease of producing the proteins with high yield, the availability of reagents including gene expression vectors, speed and the high adaptability of the
17

system to express protein of interest. Furthermore proinsulin in E. coli is produced in inclusion bodies. The formation of inclusion bodies normally protects the gene product from host cell proteases. The product is inactive and cannot harm the host cell, often giving high expression level. Furthermore, the dense inclusion bodies can be readily recovered by centrifugation and a relatively high purity and degree of concentration of the gene product are thus normally obtained after solubilization (Rudolph, R. (1996) in Protein Engineering : Principles and practice (Cleland, J. L. and Craik, C. S., eds.), pp. 283-298, Wiely-Liss, New York.
E.coli strains which maybe employed in accordance with the present invention for cloning can be selected from Topl0F', XL1 blue, HB101, DH5 alpha, preferably it is Top10F'.
E.coli strains which maybe employed in accordance with the present invention for expression can be selected from BL 21 (DE 3), BL 21 (DE 3)codon plus, BL 21 (DE 3) pLysS, BL 21 (DE 3) pLysE, BL 21 (DE3) BLR, preferably it is BL 21 (DE 3)codon plus.
The present invention expression vector was chosen based on the two important criteria: protein yield and ease of purification. The pre pET 24c employed in the present invention has an advantage that unlike other E.coli system with promoters for e.g. lac or tac uses the bacetriophage T7 promoter to direct the expression of target genes. Since E.coli RNA polymerase does not recognize the T7 promoter, there is virtually no transcription of the target gene in the absence of a source of T7 RNA polymerase and the cloning step is thus effectively uncoupled from the expression step. In accordance with the present invention characterization of the
18

recombinant clones for proper orientation with respect to the T7 promoter was carried out using restriction enzymes and PCR based techniques.
The production medium for cultivating recombinant E.coli containing proinsulin gene in the present invention method is any suitable complex or chemically defined medium for example it is LB medium. The production medium can be as reported in the literature which can be used as it is or with modification for the synthesis of active human recombinant insulin. The production medium can be a completely new medium formulated in order to obtain the improved production level of recombinant proinsulin.
The optimum parameters for culturing the cloned proinsulin are pH 6 to 8, temperature of 28 -38° C, p02 about 20 - 40 %, for period of 18 - 60 hours.
Harvesting of the cell mass in accordance with the present invention method are carried out by with a suitable technique like centrifugation at 5000 - 8000rpm for 15 - 60 minutes.
The detection of insulin is carried out in harvested cell mass by running the sample on SDS PAGE gel. The protein bands are visualized using coomassie stain and the identity of proinsulin is confirmed by western blot analysis using antibodies against insulin and/or the T7 tag. For quantification scanning or video densitometry can be used.
For the present invention the lysis buffer solution used for isolating inclusion body
19

is 50 mM Tris buffer or phosphate buffer comprising of sodium chloride 50 mM, Triton X100 0.1%, chelating agent and any suitable additional agent.
The detergent employed in the present invention for denaturing can be Triton XI00 0.1-1%.
Solubilizing agent in accordance with the present invention is any suitable solubilizing agent like urea or guanidine hydrochloride in the range of 4 - 8 M concentration or sarkosyl in the range of 0!5 - 2 %.
The refolded insulin obtained after dilution is subjected to chromatographic purification process to yield recombinant human insulin.
The present invention provides the method for synthesis of active human recombinant insulin with improved process efficiency by using affinity tag system. The affinity fusion tag system used in accordance with the present invention is such that it can offer advantage like, stability to protein, ease of isolation / purification by virtue of the specific tag, making the purification and analysis simpler thereby providing better yields of the protein and thus improving the process efficiency.
The present invention is illustrated by the non-limiting following examples. It is to be understood that the particular examples, materials, amounts procedures are to be interpreted broadly in accordance with the scope and spirit of the invention as set forth herein.
EXAMPLES
20

Example 1
Construction of synthetic human proinsulin gene:
The following 9 oligonucleotide were used in the synthesis of proinsulin:
TPG-2 GAGGAGGCTGAGGCTGAGGCTGAGCCAAAG
TPG-3TTCGTCAACCAACACCTGTGTGGTTCCCAC
TPG-4
CTGGTCGAGGCTCTGTACCTGGTCTGTGGTGAGAGAGGTTTCTTCTACAC
CCCAA
TPG-5
AGGCTGCTAAGGGTATCGTCGAGCAATGTTGTACCTCCATCTGTTCCCT
TPG-6 GTACCAACTGGAGAACTACTGTAACTAAGAATTCACCA
TPG-7 TGGTGAATTCTTAGTTACAGTAGTTCTCCAGT
TPG-9 CAGCCTTTGGGGTGTAGAAGAAACCTCTCTCACCACAGACC
AG GTACAGAGCCTC
TPG-10 GACCAGGTGGGAACCACACAGGTGTTGGTT
TPG-11 GACGAACTTTGGCTCAGCCTCAGCCTCAGCCTCCTC
These oligonucleotides were ligated together in a volume of 15 ^tl by mixing 1 /xl of each oligo, 1.5 ml of 10X T4DNA ligase buffer, and 3.5 \i\ of sterile water. The reaction mixture was heated to 90° C, and contents were stirred on a magnetic stirrer for uniform cooling. It took a period of 75 minutes to come to room temperature. 1 /xl DNA ligase was added and incubated at 4° C for 16 hours.
PCR amplification: Proinsulin was amplified from the annealed reaction mixture by following procedure:
21

The reaction mixture comprising of TPG-2 2.5 ml, TPG 7, 2.5 ml, template 0.5 /xl, deoxy nucleotide triphosphate and water 34.1 ml was amplified using Pfu enzyme, which was added in a volume of 5 ml, which contained 0.5 /d of 10X Pfu buffer, Pfu 0.4 ml and water 4.1 ml. The resultant amplified product was run on a 2% agarose gel to get 202 base pair band.
Example 2
Construction of plasmid pBINS by cloning of proinsulin gene into cloning vector:
The 202 bp band was excised from the gel, cleaned using Qiagen kit and it was ligated to pBS -KS which was digested with Smal enzyme. The ligated mix was transformed into competent XL 1 E. coli strain by known protocol for transformation (Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989). Molecular Cloning - A Laboratory Manual. 2nd edn. Cold Spring Harbor Press, Cold Spring Harbor, New York) and the transformants were plated on IPTG with X-gal plates containing ampicilin. The plates were incubated at 37°C overnight. White colonies were selected for screening of inserts. A colony PCR was done using insulin forward primer and insulin reverse primer to detect the presence of an insert. A colony with the right orientation of insert in a recombinant plasmid was selected for expression; the selected recombinant plasmid will be referred hereafter as pBINS.
Example 3
Construction of plasmid pTINS by cloning of proinsulin gene in pET 24C: Proinsulin was PCR amplified from pBINS using Pfu polymerase and insulin forward and reverse primers and the PCR product was run on a 2% agarose gel and
22

insulin band was excised and cleaned from the gel using the Qiagen kit. Vector pET 24C was digested with Bam HI enzyme, klenowed and then ligated to insulin derived from pBINS. The ligation mix was transformed into competent TOP 10 F' strain of E. coli and the transformants were incubated at 37° C overnight. A colony PCR was done of the transformants generated using T7 universal primers to detect the presence of insert and orientation of insert in a recombinant plasmid. A clone showing the right orientation was selected for expression, which is herein after referred to as pTINS.
Example 4
Transformation of pTINS into BL21(DE3):
pTINS as obtained in Example 3 was transformed into E.coli host strain BL21(DE3) by standard transformation protocol (Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989). Molecular Cloning - A Laboratory Manual. 2nd edn. Cold Spring Harbor Press, Cold Spring Harbor, New York). The transformants were plated on LB plus kanamycin plates and incubated at 37°C overnight. Transformant colonies were picked up the next day, reisolated and a masterplate was made of these transformants. One such transformant IB was chosen for further characterization.
Example 5
Expression and purification of proinsulin
A single colony of IB was inoculated into 5 ml LB plus kanamycin (30 /xg/ml) in liquid medium and incubated overnight at 37 ° C. 1 ml of this overnight culture was
23

inoculated into 50 ml LB plus kanamycin in a 250 ml flask and grown till the OD600 reached 0.5. The culture was induced with 1 mM IPTG and incubation continued. Samples were collected at 1 hr, 2 hr, 3 hr, 5 hr and overnight after induction. Cells were pelleted at 4° c, 4000 rpm for 3 minutes and processed for SDS PAGE analysis.
Characterization of transformant IB:
SDS PAGE analysis was done of the lysates made as above mentioned and simultaneously it was blotted onto nitrocellulose and probed by T7 tag antibody HRP conjugate which revealed the band of interest.
Purification:
Cell mass was harvested by centrifugation at 5000 rpm for 15 minutes. At 4°C and the pellets were stored at -20°C. The pellets were thawed on ice 15 minutes and the cells were sonicated in lysis buffer containing 1 mM PMSF. Inclusion bodies were purified from the biomass using Triton X100. 8 M guanidium hydrochloride was used to solubilize the inclusion bodies. The protein was clarified after diluting the above to the final concentration of 0.1 - 0.4 M solubilizing agent and stirring for 10-20 hours at 4° C. The protein was adsorbed on ion exchange resin and proinsulin was eluted with potassium chloride. Proinsulin was further purified on immuno-affinity column containing monoclonal antibodies against T7 tag and eluted at pH 2.2. T7 neutralization buffers was included to limit protein exposure to low pH. T7 tag was removed by treating with trypsin to give purified protein.
24

We claim:
1. A method for synthesis of human recombinant insulin in E.coli through a
recombinant plasmid construct having affinity tag, comprising steps of:
i. construction of a synthetic gene encoding human proinsulin;
ii. construction of plasmid pBINS;
iii. construction of plasmid pTINS;
iv. transformation of plasmid pTINS in E.coli host strain;
v. expression of precursor of insulin having affinity tag;
vi. purification of precursor insulin to yield pure insulin.
2. The method as claimed in claiml, wherein the affinity tag employed, is T7 tag having 11 amino acid residues.
3. The method as claimed in claiml, wherein the synthetic gene coding for human proinsulin is constructed by ligating 9 oligonucleotides designed based on the human proinsulin (for human insulin B chain, C peptide and A chain) after codon optimization for expression in E.coli and PCR amplification of ligation mix.
4. The method as claimed in claiml, wherein the construction of pBINS is carried out by cloning of human proinsulin gene into cloning vector, transforming proinsulin/cloning vector ligation mix into cells of suitable strain host thereby giving plasmid construct pBINS, screening and characterization of the plasmid
25

pBINS.
5. The method as claimed in claiml, wherein the construction of pTINS is carried out by digesting pBINS and expression vector separately, cloning cut plasmid insert into expression vector, transforming the proinsulin/expression vector ligation mix into cells of suitable host strain thereby giving plasmid construct pTINS, screening and characterization of the plasmid pTINS for right orientation.
6. The method as claimed in claiml, wherein the transformation of plasmid pTINS is carried out into E.coli cells of suitable strain by following standard transformation protocol, screening and characterization of transformants with respect to presence of proinsulin cDNA insert.
7. The method as claimed in claiml, wherein the expression of precursor of insulin with T7 tag is carried out by culturing one of the transformant into LB plus kanamycin liquid medium till OD600 reached 0.5 and inducing protein expression by IPTG and analyzing by SDS-PAGE.
8. The method as claimed in claiml, wherein the purification is carried out by harvesting cell mass by centrifugation, sonicating resultant pellet, purifying the inclusion bodies from the biomass and solubilizing, purifying proinsulin on ion exchange resin and further purifying on immuno-affinity column containing monoclonal antibodies against T7 tag, eluting protein, removing T7 tag, subjecting to proper folding and purifying by chromatography to give
26

recombinant human insulin.
9. The method as claimed in claiml, wherein the cloning vector employed for cloning proinsulin gene is selected from group comprising of pBS-KS, pUC-19, pGEM -T Easy, preferably it is pBS-KS.
10. The method as claimed in claiml, wherein the expression vector employed is selected from group comprising of pET 24 C, pET 11C, pET 3C, preferably it is pET 24 C having T7 affinity tag.
11. The method as claimed in claiml, wherein the E.coli strain used for transforming cloning vector/proinsulin mix is selected from the group comprising of TOP10F', XL lBlue, HB 101, DH 5 alpha,, preferably it is TOP10F'.
12. The method as claimed in claiml, wherein the E.coli strain used for transforming expressionvector/proinsulin mix is selected from the group comprising of BL 21 (DE3), BL 21 (DE3)codon plus, BL 21 (DE3)plysS, BL 21 (DE3) plys E, BL 21 (DE3) BLR, preferably it is BL 21 (DE3).
13. The method as claimed in claiml, wherein the antibody used for characterization / identification of expressed protein is T7 tag antibody HRP conjugate.
27

14. A method as claimed in claim 1 to 13 and as substantially herein described in specification and illustrated with examples 1 to 5.
Dated this day of March 2004.
For RELIANCE LIFE SCIENCES PVT.LTD..
K.V.SUBRAMANIAM
Sr. Executive Vice President
To:
The Controller of Patents
The Patent Office
Mumbai.
28

ABSTRACT
The present invention relates to the method for synthesis of human recombinant insulin in E.coli through a recombinant plasmid construct having affinity tag. The affinity tag employed in the present invention is T7 tag having 11 amino acid residues. In the present invention with the use of T7 tag CNBr would not be required during the process for the removal of formyl methionine and hence there would be no associated toxicity of CNBr in the final recombinant human insulin.
29

Documents

Application Documents

# Name Date
1 370-mum-2004-form 13(23-10-2008).pdf 2008-10-23
2 370-MUM-2004-FORM 5(19-12-2008).pdf 2008-12-19
3 370-MUM-2004-FORM 3(19-12-2008).pdf 2008-12-19
4 370-mum-2004-form 1(19-12-2008).pdf 2008-12-19
5 370-MUM-2004-CORRESPONDENCE(19-12-2008).pdf 2008-12-19
6 370-MUM-2004-SPECIFICATION(AMENDED)-(5-4-2005).pdf 2018-08-09
7 370-mum-2004-specification(amanded)-(6-11-2008).pdf 2018-08-09
8 370-mum-2004-marked copy(6-11-2008).pdf 2018-08-09
9 370-mum-2004-form-3.pdf 2018-08-09
10 370-mum-2004-form-2-provisional.pdf 2018-08-09
12 370-mum-2004-form-2-complete.pdf 2018-08-09
14 370-mum-2004-form-18.pdf 2018-08-09
15 370-mum-2004-form-1.pdf 2018-08-09
16 370-mum-2004-form 5(6-11-2008).pdf 2018-08-09
17 370-mum-2004-form 5(5-4-2005).pdf 2018-08-09
18 370-mum-2004-form 3(6-11-2008).pdf 2018-08-09
19 370-mum-2004-form 3(5-4-2005).pdf 2018-08-09
20 370-mum-2004-form 3(28-3-2005).pdf 2018-08-09
21 370-mum-2004-form 3(26-3-2004).pdf 2018-08-09
22 370-mum-2004-form 2(title page)-(provisional)-(26-3-2004).pdf 2018-08-09
23 370-mum-2004-form 2(title page)-(granted)-(22-9-2009).pdf 2018-08-09
24 370-mum-2004-form 2(title page)-(complete)-(28-3-2005).pdf 2018-08-09
25 370-mum-2004-form 2(title page)-(28-3-2005).pdf 2018-08-09
26 370-mum-2004-form 2(provisional)-(26-3-2004).pdf 2018-08-09
27 370-mum-2004-form 2(granted)-(22-9-2009).pdf 2018-08-09
28 370-mum-2004-form 2(complete)-(28-3-2005).pdf 2018-08-09
29 370-mum-2004-form 18(6-11-2008).pdf 2018-08-09
30 370-MUM-2004-FORM 13(6-11-2008).pdf 2018-08-09
31 370-MUM-2004-FORM 1(6-11-2008).pdf 2018-08-09
32 370-mum-2004-form 1(28-3-2005).pdf 2018-08-09
33 370-mum-2004-form 1(26-3-2004).pdf 2018-08-09
34 370-mum-2004-description(provisional)-(26-3-2004).pdf 2018-08-09
35 370-mum-2004-description(granted)-(22-9-2009).pdf 2018-08-09
36 370-mum-2004-description(complete)-(28-3-2005).pdf 2018-08-09
37 370-mum-2004-descripiton (provisional).pdf 2018-08-09
38 370-mum-2004-descripiton (complete).pdf 2018-08-09
39 370-mum-2004-correspondence-received.pdf 2018-08-09
40 370-mum-2004-correspondence(ipo)-(7-11-2007).pdf 2018-08-09
41 370-mum-2004-correspondence(ipo)-(23-9-2009).pdf 2018-08-09
42 370-mum-2004-correspondence(6-11-2008).pdf 2018-08-09
43 370-mum-2004-correspondence(26-2-2009).pdf 2018-08-09
44 370-MUM-2004-CORRESPONDENCE(15-4-2009).pdf 2018-08-09
45 370-mum-2004-claims-complete.pdf 2018-08-09
47 370-mum-2004-claims(granted)-(22-9-2009).pdf 2018-08-09
48 370-mum-2004-claims(complete)-(28-3-2005).pdf 2018-08-09
49 370-mum-2004-cancelled pages(6-11-2008).pdf 2018-08-09
50 370-mum-2004-abstract-complete.pdf 2018-08-09
52 370-mum-2004-abstract(granted)-(22-9-2009).pdf 2018-08-09
53 370-mum-2004-abstract(complete)-(28-3-2005).pdf 2018-08-09
54 370-mum-2004-abstract(6-11-2008).pdf 2018-08-09

ERegister / Renewals

3rd: 09 Nov 2009

From 26/03/2006 - To 26/03/2007

4th: 09 Nov 2009

From 26/03/2007 - To 26/03/2008

5th: 09 Nov 2009

From 26/03/2008 - To 26/03/2009

6th: 09 Nov 2009

From 26/03/2009 - To 26/03/2010

7th: 17 Dec 2009

From 26/03/2010 - To 26/03/2011

8th: 28 Dec 2010

From 26/03/2011 - To 26/03/2012

9th: 11 Jan 2012

From 26/03/2012 - To 26/03/2013