Abstract: The invention relates to a method for modifying genetic material in algal cells that includes the use of rare cutting endonuclease to target specific genomic sequences. In particular the invention relates to a method for modifying genetic material in algal cells wherein rare cutting endonuclease especially a homing endonuclease or a TALE Nuclease is expressed over several generations to efficiently modify said target genome sequences.
METHOD FOR TARGETED MODIFICATION OF ALGAE GENOMES
The invention relates to a method for modifying genetic material in algal
cells that includes the use of rare-cutting endonuclease to target specific
sequence. In particular, the invention relates to a method for modifying genetic
material in algal cells wherein rare-cutting endonuclease, especially a homing
endonuclease or a TALE-Nuclease, is expressed over several generations to
efficiently modify said target sequence.
BACKGROUND OF THE INVENTION
Although algae have been used as a food source by humans for centuries,
the significance of their biotechnological interest, especially of microalgae,
appeared only in recent decades. Applications of algal products range from simple
biomass production for food, feed and fuels to valuable products such as
cosmetics, pharmaceuticals, pigments, sugar polymers and food supplements.
Several algal species such as Dunaliella bardawil, Haematococcus pluvialis
and Chlorella vulgaris have already been exploited extensively in the past for
biotechnological purposes, especially as feed, as a source of pigments like b-
carotene or astaxanthin or as food supplements (Steinbrenner and Sandmann
2006; Mogedas, Casal et al. 2009). Most of these organisms are green algae that
belonging to a group more related to land plants than other algal groups (Palmer,
Soltis et al. 2004). Chromophytic algae on the other hand only recently moved into
the forefront and their biochemistry and genetics have been studied just in the
recent years. They comprise important groups like the brown algae, diatoms,
xanthophytes, eustigmatophytes and others, but also the colourless oomycetes
(Tyler, Tripathy et al. 2006). Research on chromophytic algae received a strong
boost after publication of several genomes including those of the diatoms
Thalassiosira pseudonana (Armbrust, Berges et al. 2004) and Phaeodactylum
tricornutum (Bowler, Allen et al. 2008).
Diatoms are one of the most ecologically successful unicellular phytoplankton on
the planet, being responsible for approximately 20% of global carbon fixation,
representing a major participant in the marine food web. There are two major
potential commercial or technological applications of diatoms. First, Diatoms are
able to accumulate abundant amounts of lipid suitable for conversion to liquid fuels
and because of their high potential to produce large quantities of lipids and good
growth efficiencies, they are considered as one of the best classes of algae for
renewable biofuel production. Second, Diatoms have a cell wall consisting of silica
(silica exoskeletons called frustules) with intricated and ornate structures on the
nano- to micro-scale. These structures exceed the diversity and the complexity
capable by man-made synthetic approaches, and Diatoms are being developed as
a source of materials mainly for nanotechnological applications (Lusic, Radonic et
al. 2006).
Although the genomes of several algal species have now been sequenced,
very few genetic tools to explore microalgal genetics are available at this time,
which considerably limits the use of these organisms for various biotechnological
applications. The ability to perform targeted genomic manipulations within algal
genome was recently facilitated by the use of homing endonuclease (WO
2012/017329). However, due to low transformation rates and the weak expression
of transgenes, this approach remains difficult to perform especially, in diatoms,
due to their particular silica cell wall comprising two separate valves (or shells).
Stable and transient transgene expression systems have been reported in algae -
for review see (Hallmann 2007) - as in most organisms, but in most cases,
transient expression is sought for the expression of DNA modifying enzymes due
to their potential genotoxicity.
As a particular group of microalgae, diatoms are the only major group of
eukaryotic phytoplankton with a diplontic life history, in which all vegetative cells
are diploid and meiosis produces short-lived, haploid gametes, suggesting an
ancestral selection for a life history dominated by a duplicated (diploid) genome.
Therefore, in order to create algae, such as diatoms, with new properties, it is
deemed necessary to target several alleles or homologous genes concomitantly to
cause phenotype effect.
SUMMARY OF THE INVENTION
Overcoming the above limitations, the inventors have induced bi-allelic or
multi-copy knock-out in diatoms by transfection and expression over several
generations of transgenes encoding rare-cutting endonucleases, especially
engineered endonucleases and TALE-Nucleases. Mosaic clones of such
transformed algae cells allowed to isolate a number of descendant cells, where
targeted modifications in multi-copy genes or multiple alleles was observed. This
new method and its achievements, open the way to the genetic engineering of
complex genomes in algae cells.
Thus, the present invention relates to a method for targeted modification of
the genetic material of an algal cell using rare-cutting endonucleases, especially
by expressing homing endonucleases and TALE-Nuclease over several
generations, in particular by stable integration of the transgenes encoding thereof
on the chromosome. This method allows inducing targeted insertion (knock-in) or
knock-out in several alleles or homologous genes in one experiment run and
therefore is facilitating gene stacking. The present invention also encompasses
genetically modified algae obtained by this method.
DESCRIPTION OF THE FIGURES
In addition to the preceding features, the invention further comprises other
features which will emerge from the description which follows, as well as to the
appended drawings. A more complete appreciation of the invention and many of
the attendant advantages thereof will be readily obtained as the same becomes
better understood by reference to the following Figures in conjunction with the
detailed description below.
Figure 1: Examples of mutagenic events induced by the PTRI20 meganuclease.
Figure 2: Mutagenesis induced by PTRI20 meganuclease in the presence of
single-chain TREX2 (SCTREX2). A-T7 endonuclease assays on PCR products
from the wild type Phaeodactylum tricornutum strain (condition 4) and clones
resulting from the transformations with the empty vector (Condition 3), the PTRI20
meganuclease alone (condition 2) and the PTRI20 meganuclease plus SCTREX2
(condition 1 clone A).
Figure 3: Examples of mutagenic events induced by the PTRI20 meganuclease in
the presence of SCTREX2.
Figure 4: Mutagenesis induced by PTRI02 meganuclease in the presence of
single-chain TREX2 (SCTREX2). Characterization of mutagenesis events are
characterized by deep sequencing. Genomic DNA of colony lysates from clones
derived from the transformation with the PTRI02 meganuclease and SCTREX2 (1-
5), and clones resulting from the transformation with the empty vector alone (6-8)
was analyzed. A PCR surrounding the PTRI02 specific target was performed and
the percentage of mutagenesis frequency induced by the meganuclease in
presence of SCTREX2 was determined by deep sequencing analysis of
amplicons.
Figure 5 : Examples of mutagenic events induced by the PTRI02 meganuclease in
the presence of SCTREX2.
Figure 6 : Frequency of mutagenesis induced by YFP_TALE-Nuclease. Genomic
DNA of the clones derived from transformations with TALE-Nuclease or from
transformations with the empty vector was extracted. A PCR surrounding the YFP
target was performed and the percentage of mutagenesis was determined by a
deep sequencing analysis of amplicons centered on the specific target. A sub¬
clone resulting from clone n°2 was also analyzed.
Figure 7 : Examples of mutagenic events induced by YFP_TALE-Nuclease.
Figure 8: Examples of a mutagenic event induced by TP07_TALE-Nuclease
Figure 9 : Example of a mutagenic event induced by TP1 5_TALE-Nuclease
Figure 10: Characterization of homologous gene targeting (HGT) events by deep
sequencing induced by PTRI02. Genomic DNA of 8 clones transformed with the
PTRI02 meganuclease and the DNA matrix (1-8), and clones transformed with
DNA matrix and the empty vector (9-10) was analyzed. The percentage of HGT
frequency induced by the meganuclease in presence of a DNA matrix was
determined by deep sequencing analysis of amplicons.
Figure 11: Characterization of homologous gene targeting (HGT) events by deep
sequencing induced by PTRI20. Genomic DNA of clones transformed with the
PTRI20 meganuclease and the DNA matrix (1-3), and clones transformed with
DNA matrix and the empty vector (4-5) was analyzed. The percentage of HGT
frequency induced by the meganuclease in presence of a DNA matrix was
determined by deep sequencing analysis of amplicons.
Figure 12: Molecular characterization of clones from the transformation of the
Phaeodactylum tricornutum (Pt) strain with the TALE-Nuclease targeting the
UGPase gene.
Figure 13: Molecular characterization of clones from the transformation of the
Phaeodactylum tricornutum (Pt) strain with the TALE-Nuclease targeting the
UGPase gene (experiment 1).
Figure 14: Molecular characterization of clones from the transformation of the
Phaeodactylum tricornutum (Pt) strain with the TALE-Nuclease targeting the
UGPase gene (experiment 2).
Figure 15: Example of a mutagenic event induced by the TALE-Nuclease
targeting the UDP glucose pyrophosphorylase gene.
Figure 16: Phenotypic characterization of Phaeodactylum tricornutum (Pt) strain
transformed with the TALE-Nuclease targeting the UGPase gene. Clone 37-7A1 :
100% mutated on the UGPase gene, clone 37-3B1 from transformation with the
empty vector and the Pt wild type strain were labeled with the lipid probe (Bodipy,
Molecular Probe). The fluorescence intensity was measured by flow cytometry.
The graphs represent the number of cells function of the fluorescence intensity for
3 independent experiments.
Figure 17: Mutagenesis induced by the TALE-Nuclease targeting the putative
elongase gene. Left panel: PCR realized on clone lysates from the transformations
with the empty vector and the putative elongase TALE-Nuclease were performed.
Right panel: T7 assay was assessed on 4 clones resulting from the transformation
with the putative elongase TALE-Nuclease and on 3 clones resulting from the
transformation with the empty vector. The clone 2 is positive for the T7 assay.
Figure 18: Example of a mutagenic event induced by the TALE-Nuclease
targeting the putative elongase gene.
Table 1: Mutagenesis induced by PTRI20 meganuclease.
Table 2: Number of clones obtained after transformation, the number of clones
that have integrated the PTRI020 meganuclease and SCTREX2 DNA sequences
and the number of clones tested in the T7 assay and Deep sequencing analysis.
DETAILED DESCRIPTION OF THE INVENTION
Unless specifically defined herein, all technical and scientific terms used
have the same meaning as commonly understood by a skilled artisan in the fields
of gene therapy, biochemistry, genetics, and molecular biology.
All methods and materials similar or equivalent to those described herein
can be used in the practice or testing of the present invention, with suitable
methods and materials being described herein. All publications, patent
applications, patents, and other references mentioned herein are incorporated by
reference in their entirety. In case of conflict, the present specification, including
definitions, will prevail. Further, the materials, methods, and examples are
illustrative only and are not intended to be limiting, unless otherwise specified.
The practice of the present invention will employ, unless otherwise
indicated, conventional techniques of cell biology, cell culture, molecular biology,
transgenic biology, microbiology, recombinant DNA, and immunology, which are
within the skill of the art. Such techniques are explained fully in the literature. See,
for example, Current Protocols in Molecular Biology (Frederick M. AUSUBEL,
2000, Wiley and son Inc, Library of Congress, USA); Molecular Cloning: A
Laboratory Manual, Third Edition, (Sambrook et al, 2001 , Cold Spring Harbor, New
York: Cold Spring Harbor Laboratory Press); Oligonucleotide Synthesis (M. J. Gait
ed., 1984); Mullis et al. U.S. Pat. No. 4,683,195; Nucleic Acid Hybridization (B. D.
Harries & S. J. Higgins eds. 1984); Transcription And Translation (B. D. Hames &
S. J. Higgins eds. 1984); Culture Of Animal Cells (R. I . Freshney, Alan R. Liss,
Inc., 1987); Immobilized Cells And Enzymes (IRL Press, 1986); B. Perbal, A
Practical Guide To Molecular Cloning (1984); the series, Methods In
ENZYMOLOGY (J. Abelson and M. Simon, eds.-in-chief, Academic Press, Inc.,
New York), specifically, Vols. 154 and 155 (Wu et al. eds.) and Vol. 185, "Gene
Expression Technology" (D. Goeddel, ed.); Gene Transfer Vectors For Mammalian
Cells (J. H. Miller and M. P. Calos eds., 1987, Cold Spring Harbor Laboratory);
Immunochemical Methods In Cell And Molecular Biology (Mayer and Walker, eds.,
Academic Press, London, 1987); Handbook Of Experimental Immunology,
Volumes l-IV (D. M. Weir and C. C. Blackwell, eds., 1986); and Manipulating the
Mouse Embryo, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.,
1986).
The present invention concerns the use of rare-cutting endonucleases to
allow efficient targeted genomic engineering of algal cells. In a preferred
embodiment, the present invention relates to a method for targeted modification of
the genetic material of an algal cell comprising one or several of the following
steps:
a) Selecting a nucleic acid target sequence in the genome of an algal
cell;
b) Designing a gene encoding a rare-cutting endonuclease to target this
sequence;
c) Transfecting said algal cell with vectors comprising said gene
encoding said rare-cutting endonuclease to obtain its expression within said cell
over several generations;
d) Selecting the cell progeny of said algal cell having a modified target
sequence.
Said modified target sequence can result from NHEJ events or homologous
recombination. The double strand breaks caused by said rare-cutting
endonucleases are commonly repaired through the distinct mechanisms of
homologous recombination or non-homologous end joining (NHEJ). Although
homologous recombination typically uses the sister chromatid of the damaged
DNA as a donor matrix from which to perform perfect repair of the genetic lesion,
NHEJ is an imperfect repair process that often results in changes to the DNA
sequence at the site of the double strand break. Mechanisms involve rejoining of
what remains of the two DNA ends through direct re-ligation (Critchlow and
Jackson 1998) or via the so-called microhomology-mediated end joining (Ma, Kim
et al. 2003). Repair via non-homologous end joining (NHEJ) often results in small
insertions or deletions and can be used for the creation of specific gene
knockouts. In one aspect of this embodiment, the present invention relates to a
method for targeted modification of the genetic material of an algal cell by
expressing rare-cutting endonuclease into algal cell to induce either homologous
recombination or NHEJ events.
Said rare-cutting endonuclease according to the present invention refers to
any wild type or variant enzyme capable of catalyzing the hydrolysis (cleavage) of
bonds between nucleic acids within a DNA or RNA molecule, preferably a DNA
molecule. Over the last 5 years, the use of homing endonuclease to successfully
induce gene targeting has been well documented starting from straightforward
experiments involving wild-type l-Scel to more refined work involving completely
re-engineered enzyme (Stoddard, Monnat et al. 2007; Marcaida, Prieto et al. 2008;
Galetto, Duchateau et al. 2009; Arnould, Delenda et al. 201 1 and
WO201 1/064736). The endonuclease according to the present invention
recognizes and cleaves nucleic acid at specific polynucleotide sequences, further
referred to as "nucleic acid target sequence".
The rare-cutting endonuclease according to the invention can for example
be a homing endonuclease also known as meganuclease (Paques and Duchateau
2007). Such homing endonucleases are well-known to the art (see e.g. (Stoddard,
Monnat et al. 2007). Homing endonucleases recognize a nucleic acid target
sequence and generate a single- or double-strand break.
Homing endonucleases are highly specific, recognizing DNA target sites
ranging from 12 to 45 base pairs (bp) in length, usually ranging from 14 to 40 bp in
length. The homing endonuclease according to the invention may for example
correspond to a LAGLIDADG endonuclease, to a HNH endonuclease, or to a GIYYIG
endonuclease. Examples of such endonuclease include l-Sce I , l-Chu I , l-Cre
I , l-Csm I , Pl-Sce I , Pl-Tli I , Pl-Mtu I , l-Ceu I , l-Sce II, l-Sce III, HO, Pl-Civ I , Pl-Ctr
I, Pl-Aae I , Pl-Bsu I , Pl-Dha I , Pl-Dra I, Pl-Mav I , Pl-Mch I , Pl-Mfu I , Pl-Mfl I , Pl-
Mga I , Pl-Mgo I , Pl-Min I , Pl-Mka I , Pl-Mle I , Pl-Mma I , Pl-Msh I , Pl-Msm I , Pl-Mth
I , Pl-Mtu I , Pl-Mxe I , Pl-Npu I , Pl-Pfu I , Pl-Rma I , Pl-Spb I , Pl-Ssp I , Pl-Fac I , Pl-
Mja I , Pl-Pho I , Pi-Tag I , Pl-Thy I , Pl-Tko I , Pl-Tsp I or l-Msol.
In a preferred embodiment, the homing endonuclease according to the
invention is a LAGLIDADG endonuclease such as l-Scel, l-Crel, l-Ceul, l-Msol,
and l-Dmol. In a most preferred embodiment, said LAGLIDADG endonuclease is ICrel.
Wild-type l-Crel is a homodimeric homing endonuclease that is capable of
cleaving a 22 to 24 bp double-stranded target sequence.
In the present application, l-Crel variants may be homodimers
(meganuclease comprising two identical monomers) or heterodimers
(meganuclease comprising two non-identical monomers). It is understood that the
scope of the present invention also encompasses the l-Crel variants per se,
including heterodimers (WO2006097854), obligate heterodimers
(WO2008093249) and single chain meganucleases (WO03078619 and
WO2009095793) as non limiting examples, able to cleave one of the sequence
targets in the algal genome. The invention also encompasses hybrid variant per se
composed of two monomers from different origins (WO03078619).
The invention encompasses both wild-type and variant endonucleases. In a
preferred embodiment, the endonuclease according to the invention is a "variant"
endonuclease, i.e. an endonuclease that does not naturally exist in nature and that
is obtained by genetic engineering or by random mutagenesis. The variant
endonuclease according to the invention can for example be obtained by
substitution of at least one residue in the amino acid sequence of a wild-type,
endonuclease with a different amino acid. Said substitution(s) can for example be
introduced by site-directed mutagenesis and/or by random mutagenesis. In the
frame of the present invention, such variant endonucleases remain functional, i.e.
they retain the capacity of recognizing and specifically cleaving a target sequence.
In a more preferred embodiment, nucleic acid encoding the homing
endonucleases used in the present invention comprise a part of nucleic acid
sequence selected from the group consisting of: SEQ ID NO: 1 and SEQ ID NO:
12.
The variant endonuclease according to the invention cleaves a target
sequence that is different from the target sequence of the corresponding wild-type
endonuclease. Methods for obtaining such variant endonucleases with novel
specificities are well-known in the art.
The present invention is based on the finding that such variant
endonucleases with novel specificities can be used to allow efficient targeted
modification of the genetic material of an algal cell, thereby considerably
increasing the usability of these organisms for various biotechnological
applications.
In another preferred embodiment, said rare-cutting endonuclease can be a
"TALE-nuclease" (TALE-Nuclease) resulting from the fusion of DNA binding
domain derived from a Transcription Activator like Effector (TALE) and one
nuclease domain able to cleave a DNA target sequence. TALE-NucleaseS are
used to stimulate gene targeting and gene modifications (Boch, Scholze et al.
2009; Moscou and Bogdanove 2009; Christian, Cermak et al. 2010, WO
201 1/146121).
Said Transcription Activator like Effector (TALE) corresponds to an
engineered TALE comprising a plurality of TALE repeat sequences, each repeat
comprising a RVD specific to each nucleotide base of a TALE recognition site. In
the present invention, each TALE repeat sequence of said TALE is made of 30 to
42 amino acids, more preferably 33 or 34 wherein two critical amino acids (the socalled
repeat variable dipeptide, RVD) located at positions 12 and 13 mediates the
recognition of one nucleotide of said TALE binding site sequence; equivalent two
critical amino acids can be located at positions other than 12 and 13 specially in
TALE repeat sequence taller than 33 or 34 amino acids long. Preferably, RVDs
associated with recognition of the different nucleotides are HD for recognizing C,
NG for recognizing T, Nl for recognizing A, NN for recognizing G or A, NS for
recognizing A, C, G or T, HG for recognizing T, IG for recognizing T, NK for
recognizing G, HA for recognizing C, ND for recognizing C, HI for recognizing C,
HN for recognizing G, NA for recognizing G, SN for recognizing G or A and YG for
recognizing T, TL for recognizing A, VT for recognizing A or G and SW for
recognizing A. In another embodiment, critical amino acids 12 and 13 can be
mutated towards other amino acid residues in order to modulate their specificity
towards nucleotides A, T, C and G and in particular to enhance this specificity. By
other amino acid residues is intended any of the twenty natural amino acid
residues or unnatural amino acids derivatives.
In another embodiment, said TALE of the present invention comprises
between 8 and 30 TALE repeat sequences. More preferably, said TALE of the
present invention comprises between 8 and 20 TALE repeat sequences; again
more preferably 5 TALE repeat sequences.
In another embodiment, said TALE comprises an additional single truncated
TALE repeat sequence made of 20 amino acids located at the C-terminus of said
set of TALE repeat sequences, i.e. an additional C-terminal half- TALE repeat
sequence. In this case, said TALE of the present invention comprises between 8.5
and 30.5 TALE repeat sequences, ".5" referring to previously mentioned half-
TALE repeat sequence (or terminal RVD, or half-repeat). More preferably, said
TALE of the present invention comprises between 8.5 and 20.5 TALE repeat
sequences, again more preferably, 15.5 TALE repeat sequences. In a preferred
embodiment, said half- TALE repeat sequence is in a TALE context which allows a
lack of specificity of said half- TALE repeat sequence toward nucleotides A, C, G,
T. In a more preferred embodiment, said half- TALE repeat sequence is absent. In
another embodiment, said TALE of the present invention comprises TALE like
repeat sequences of different origins. In a preferred embodiment, said TALE
comprises TALE like repeat sequences originating from different naturally
occurring TAL effectors. In another preferred embodiment, internal structure of
some TALE like repeat sequences of the TALE of the present invention are
constituted by structures or sequences originated from different naturally occurring
TAL effectors. In another embodiment, said TALE of the present invention
comprises TALE like repeat sequences. TALE like repeat sequences have a
sequence different from naturally occurring TALE repeat sequences but have the
same function and / or global structure within said core scaffold of the present
invention.
TALE-nuclease have been already described and used to stimulate gene
targeting and gene modifications ( ; Christian, Cermak et al. 2010). Such
engineered TAL-nucleases are commercially available under the trade name
TALEN™ (Cellectis, 8 rue de la Croix Jarry, 75013 Paris, France).
In particular embodiment, said TALE-Nuclease according to the invention
targets a sequence within a UDP-glucose pyrophosphorylase or a putative
elongase gene, preferably within sequence having at least 70%, more preferably
80%, 85%, 90%, 95% identity with SEQ ID NO: 4 1 or SEQ ID NO: 52. More
preferably, the TALE-nuclease targets a sequence having at least 70%, preferably
75%, 80%, 85%, 90%, 95% with the SEQ ID NO: 44 or 55.
The rare-cutting endonuclease according to the invention can also be for
example a chimeric Zinc-Finger nuclease (ZFN) resulting from the fusion of
engineered zinc-finger domains with the nuclease catalytic domain of a restriction
enzyme such as Fokl (Porteus and Carroll 2005) or a chemical endonuclease
(Eisenschmidt, Lanio et al. 2005 ; Arimondo, Thomas et al. 2006; Simon, Cannata
et al. 2008; Cannata, Brunet et al. 2008 ) .
By "nuclease catalytic domain" is intended the protein domain comprising
the active site of an endonuclease enzyme. Such nuclease catalytic domain can
be, for instance, a "cleavage domain" or a "nickase domain". By "cleavage domain"
is intended a protein domain whose catalytic activity generates a Double Strand
Break (DSB) in a DNA target. By "nickase domain" is intended a protein domain
whose catalytic activity generates a single strand break in a DNA target sequence.
The catalytic domain is preferably a nuclease domain and more preferably a
domain having endonuclease activity, like for instance l-Tev-l, Col E7, NucA and
Fok-I. In a more preferred embodiment, said rare-cutting endonuclease is a
monomeric TALE-Nuclease. A monomeric TALE-Nuclease is a TALE-Nuclease
that does not require dimerization for specific recognition and cleavage, such as
the fusions of engineered TAL repeats with the catalytic domain of l-Tevl
described in WO201 2138927.
The invention encompasses both wild-type and variant rare-cutting
endonucleases. It is understood that, rare-cutting endonuclease according to the
present invention can also comprise single or plural additional amino acid
substitutions or amino acid insertion or amino acid deletion introduced by
mutagenesis process well known in the art. In the frame of the present invention,
such variant endonucleases remain functional, i.e. they retain the capacity of
recognizing and specifically cleaving a target sequence.
Are also encompassed in the scope of the present invention rare-cutting
endonuclease variants which present a sequence with high percentage of identity
or high percentage of homology with sequences of rare-cutting endonuclease
described in the present application, at nucleotidic or polypeptidic levels. By high
percentage of identity or high percentage of homology it is intended 70%, more
preferably 75%, more preferably 80%, more preferably 85%, more preferably
90%, more preferably 95, more preferably 97%, more preferably 99% or any
integer comprised between 70% and 99%.
To efficiently modify a specific nucleic acid sequence with algal genome,
said rare-cutting endonuclease is expressed in an algal cell over several
generations, preferably, more than 102, more preferably more than 04, even more
preferably more than 106 generations. In some embodiments, said vectors
encoding rare-cutting endonuclease continue to be expressed during different
rounds of cell division. To maintain vector expression over several generations,
efficient transient gene expression can be realized using expression vectors which
require for example codon optimization and recruitment of strong promoter.
In particular embodiment, said vector encoding rare-cutting endonuclease
can be integrated into algae genome and express rare-cutting endonuclease over
several generations. Standard molecular biology techniques of recombinant DNA
and cloning known to those skilled in the art can be applied to carry out the
methods unless otherwise specified.
Finally, the cell progeny of said transfected algal cells having a modified
target sequence is selected. In preferred embodiment, the method according to
the present invention further comprises selecting transfected algae in which said
gene encoding said rare-cutting endonuclease has been integrated into the
genome. Said modified target sequence or presence of integrated gene encoding
rare-cutting endonuclease within genome can be for instance identified by PCR,
sequencing, southern blot assays, Northern blot and Western blot. In more
preferred embodiment, few days to few weeks after transfection, cells are spread
and grown on solid medium then different colonies are picked and analyzed for the
presence of targeted modification by PCR, sequencing, southern blot assays,
Northern blot and western blot as non limiting examples. The modification events
within target sequence can also be selected by the extinction of phenotypes or by
the identification of new phenotypes resulting from these modifications.
In a more preferred embodiment, the method according to the present
invention further comprises selecting the algal cells that display modifications in
multi-copy genes or in different alleles after one run of the method according to the
present invention. Multi-copy gene or multiple allele disruptions events can be
identified by PCR, sequencing, southern blot, northern blot and western blot
assays as non limiting examples. Multi-copy gene or multiple allele modification
can also be selected by the extinction of phenotypes or by the identification of new
phenotypes these multiple gene or allele modifications.
In a particular embodiment, the present invention relates to a method
comprising obtaining mosaic clones comprising cells in which said target
sequence has undergone different modifications. In a preferred embodiment,
mosaic clones are obtained after algal cell transfection with vectors encoding rarecutting
endonuclease and spread of said transfected algal cell on solid medium.
Each clone comprises different populations of cells in which said target sequence
has undergone NHEJ event or homologous recombination or is unmodified. These
populations result from the rare-cutting endonuclease expression during growth of
the colony. Therefore, different modifications of the target sequence can be
segregated from a single clone.
Transformation methods require effective selection markers to discriminate
successful transformants cells. The majority of the selectable markers include
genes with a resistance to antibiotics. Therefore, vectors according to the present
invention can further comprise selectable markers and said transfected algal cells
are selected under selective agent. Only few publications refer to selection
markers usable in Diatoms. (Dunahay, Jarvis et al. 1995; Zaslavskaia, Lippmeier
et al. 2001) report the use of the neomycin phosphotransferase II (nptll), which
inactivates G418 by phosphorylation, in Cyclotella cryptica, Navicula saprophila
and Phaeodactylum tricornutum species. Falciatore, Casotti et al. 1999 and
Zaslavskaia, Lippmeier et al. 2001 report the use of the Zeocin or Phleomycin
resistance gene (Sh ble), acting by stochiometric binding, in Phaeodactylum
tricornutum and Cylindrotheca fusiformis species. In Zaslavskaia, Lippmeier et al.
2001 , the use of N-acetyltransferase 1 gene (Natl) conferring the resistance to
Nourseothricin by enzymatic acetylation is reported in Phaeodactylum tricornutum
and Thalassiosira pseudonana. It is understood that use of the previous specific
selectable markers are comprised in the scope of the present invention and that
use of other genes encoding other selectable markers including, for example and
without limitation, genes that participate in antibiotic resistance. In a more
preferred embodiment, the vector encoding for selectable marker and the vector
encoding for rare-cutting endonuclease are different vectors.
In particular embodiments, the gene encoding a rare-cutting endonuclease
according to the present invention is placed under the control of a promoter.
Suitable promoters include tissue specific and/or inducible promoters. Tissue
specific promoters control gene expression in a tissue-dependent manner and
according to the developmental stage of the algae. The transgenes driven by
these type of promoters will only be expressed in tissues where the transgene
product is desired, leaving the rest of the tissues in the algae unmodified by
transgene expression. Tissue-specific promoters may be induced by endogenous
or exogenous factors, so they can be classified as inducible promoters as well. An
inducible promoter is a promoter which initiates transcription only when it is
exposed to some particular (typically external) stimulus. Particularly preferred for
the present invention are: a light-regulated promoter, nitrate reductase promoter,
eukaryotic metallothionine promoter, which is induced by increased levels of heavy
metals, prokaryotic lacZ promoter which is induced in response to isopropyl-b- -
thiogalacto-pyranoside (IPTG), steroid-responsive promoter, tetracyclinedependent
promoter and eukaryotic heat shock promoter which is induced by
increased temperature.
A variety of different methods are known for transfecting vectors into algal
cells nuclei or chloroplasts. In various embodiments, vectors can be introduced
into algae nuclei by, for example without limitation, electroporation,
magnetophoresis. The latter is a nucleic acid introduction technology using the
processes of magnetophoresis and nanotechnology fabrication of micro-sized
linear magnets (Kuehnle et al., U. S. Patent No. 6,706,394; 2004; Kuehnle et al.,
U. S. Patent No. 5,516,670; 1996) that proved amenable to effective chloroplast
engineering in freshwater Chlamydomonas, improving plastid transformation
efficiency by two orders of magnitude over the state-of the-art of biolistics
(Champagne et al., Magnetophoresis for pathway engineering in green cells.
Metabolic engineering V: Genome to Product, Engineering Conferences
International Lake Tahoe CA, Abstracts pp 76; 2004). Polyethylene glycol
treatment of protoplasts is another technique that can be used to transform cells
(Maliga 2004). In various embodiments, the transformation methods can be
coupled with one or more methods for visualization or quantification of nucleic acid
introduction to one or more algae. Direct microinjection of purified endonucleases
of the present invention in algae can be considered. Also appropriate mixtures
commercially available for protein transfection can be used to introduce
endonucleases in algae according to the present invention. More broadly, any
means known in the art to allow delivery inside cells or subcellular compartments
of agents/chemicals and molecules (proteins) can be used to introduce
endonucleases in algae according to the present invention including liposomal
delivery means, polymeric carriers, chemical carriers, lipoplexes, polyplexes,
dendrimers, nanoparticles, emulsion, natural endocytosis or phagocytose pathway
as non-limiting examples. In a more preferred embodiment, said transformation
construct is introduced into host cell by particle inflow gun bombardment or
electroporation.
Endonucleolytic breaks are known to stimulate homologous recombination.
Therefore, in particular embodiments, the present invention relates to a method to
target sequence insertion (knock-in) into chosen loci of the genome.
In particular embodiments, the knock-in algae is made by transfecting said
algal cell with a rare-cutting endonuclease as described above, to induce a
cleavage within or adjacent to a nucleic acid target sequence, and with a donor
matrix containing a transgene to introduce said transgene by a knock-in event.
Said donor matrix comprises a sequence homologous to at least a portion of the
target nucleic acid sequence, such that homologous recombination occurs
between the target DNA sequence and the donor matrix. In particular
embodiments, said donor matrix comprises first and second portions which are
homologous to region 5' and 3' of the target nucleic acid, respectively. Said donor
matrix in these embodiments also comprises a third portion positioned between
the first and the second portion which comprises no homology with the regions 5'
and 3' of the target nucleic acid sequence. Following cleavage of the target nucleic
acid sequence, a homologous recombination event is stimulated between the
genome containing the target nucleic acid sequence and the donor matrix.
Preferably, homologous sequences of at least 50 bp, preferably more than 100 bp
and more preferably more than 200 bp are used within said donor matrix.
Therefore, the donor matrix is preferably from 200 bp to 6000 bp, more preferably
from 1000 bp to 2000 bp. Indeed, shared DNA homologies are located in regions
flanking upstream and downstream the site of the break and the DNA sequence to
be introduced should be located between the two arms.
In particular embodiments, said donor matrix can comprise a positive
selection marker between the two homology arms and eventually a negative
selection marker upstream of the first homology arm or downstream of the second
homology arm. The marker(s) allow(s) the selection of algae having inserted the
sequence of interest by homologous recombination at the target site. Depending
on the location of the targeted genome sequence wherein DSB event has
occurred, such template can be used to knock-out a gene, e.g. when the template
is located within the open reading frame of said gene, or to introduce new
sequences or genes of interest. This technology further increases the exploitation
potential of algae by conferring them commercially desirable traits for various
biotechnological applications. Sequence insertions by using such templates can
be used to modify a targeted existing gene, by correction or replacement of said
gene (allele swap as a non-limiting example), or to up- or down-regulate the
expression of the targeted gene (promoter swap as non-limiting example), said
targeted gene correction or replacement conferring one or several commercially
desirable traits.
According to a particularly advantageous embodiment, the donor matrix
comprising sequences sharing homologies with the regions surrounding the
targeted genomic nucleic acid cleavage site in algae as defined above is included
in the vector encoding said rare-cutting endonuclease. Preferably, homologous
sequences of at least 50 bp, preferably more than 100 bp and more preferably
more than 200 bp are used within said donor matrix. Therefore, the donor matrix is
preferably from 200 bp to 6000 bp, more preferably from 1000 bp to 2000 bp.
Alternatively, the vector encoding for a rare-cutting endonuclease and the vector
comprising the donor matrix are different vectors.
In a particular embodiment of the methods envisaged herein the
mutagenesis is increased by transfecting the cell with a further transgene coding
for a catalytic domain. In a particular embodiment, the present invention provides
improved methods for ensuring targeted modification in the genetic modification of
an algal cell and provides a method for increasing mutagenesis at the target
nucleic acid sequence to generate at least one DNA cleavage and a loss of
genetic information around said target nucleic acid sequence thus preventing any
scarless re-ligation by NHEJ. In a more preferred embodiment, said catalytic
domain is a DNA end-processing enzyme. Non limiting examples of DNA endprocessing
enzymes include 5-3' exonucleases, 3-5' exonucleases, 5-3' alkaline
exonucleases, 5' flap endonucleases, helicases, hosphatase, hydrolases and
template-independent DNA polymerases. Non limiting examples of such catalytic
domain comprise a protein domain or catalytically active derivate of the protein
domain selected from the group consisting of hExol (EX01_HUMAN), Yeast Exol
(EX01_YEAST), E.coli Exol, Human TREX2, Mouse TREX1 , Human TREX1 ,
Bovine TREX1 , Rat TREX1 , TdT (terminal deoxynucleotidyl transferase) Human
DNA2, Yeast DNA2 (DNA2_YEAST). In a more preferred embodiment, said
catalytic domain has an exonuclease activity, in particular a 3'-5' exonuclease
activity. In a more preferred embodiment, said catalytic domain has TREX
exonuclease activity, more preferably TREX2 activity. In another preferred
embodiment, said catalytic domain is encoded by a single chain TREX
polypeptide. In a particular embodiment, said catalytic domain is fused to the Nterminus
or C-terminus of said rare-cutting endonuclease. In a more preferred
embodiment, said catalytic domain is fused to said rare-cutting endonuclease by a
peptide linker. Said peptide linker is a peptide sequence which allows the
connection of different monomers in a fusion protein and the adoption of the
correct conformation for said fusion protein activity and which does not alter the
specificity of either of the monomers for their targets. Peptide linkers can be of
various sizes, from 3 amino acids to 50 amino acids as a non limiting indicative
range. Peptide linkers can also be structured or unstructured. It has been found
that the coupling of the enzyme SCTREX2 with an endonuclease such as a
meganuclease ensures high frequency of targeted mutagenesis in algal cells, such
as diatoms.
In another embodiment, the present invention relates to a method for
modifying target nucleic acid sequence in the plastid genome of an algal cell,
comprising expressing in said algal cell, a gene encoding a rare-cutting
endonuclease fused to a plastid targeting sequence required for targeting the gene
product into plastid compartment. Plastid targeting sequences correspond to
presequences consisting of a signal peptide followed by a transit peptide-like
domain as described in Gruber, Vugrinec et al. 2007. In a more preferred
embodiment, said plastid targeting sequences comprise a conserved motif namely
ASAF or AFAP (Kilian and Kroth 2005). As non limiting examples, said plastid
targeting sequences are selected from the group consisting of SEQ ID NO: 60 to
SEQ ID NO: 140.
The present invention also encompasses a method to generate a safe algal
cell that no longer carries rare-cutting endonuclease transgene in its genome after
gene targeting. More particularly, in certain embodiments, the method according to
the present invention comprises a further step of inactivating the gene encoding
the rare-cutting endonuclease present in the genome of the modified progeny
cells, in particular by cultivation of the cells without selection pressure. This loss of
gene function can be correlated to loss, rearrangement, or modification of the
foreign DNA sequences in the genome.
In the frame of the present invention, "algae" or "algae cells" refer to
different species of algae that can be used as host for genomic modification using
the rare-cutting endonuclease of the present invention. Algae are mainly
photoautotrophs unified primarily by their lack of roots, leaves and other organs
that characterize higher plants. Term "algae" groups, without limitation, several
eukaryotic phyla, including the Rhodophyta (red algae), Chlorophyta (green
algae), Phaeophyta (brown algae), Bacillariophyta (diatoms), Eustigmatophyta and
dinoflagellates as well as the prokaryotic phylum Cyanobacteria (blue-green
algae). The term "algae" includes for example algae selected from : Amphora,
Anabaena, Anikstrodesmis, Botryococcus, Chaetoceros, Chlamydomonas,
Chlorella, Chlorococcum, Cyclotella, Cylindrotheca, Dunaliella, Emiliana, Euglena,
Hematococcus, Isochrysis, Monochrysis, Monoraphidium, Nannochloris,
Nannnochloropsis, Navicula, Nephrochloris, Nephroselmis, Nitzschia, Nodularia,
Nostoc, Oochromonas, Oocystis, Oscillartoria, Pavlova, Phaeodactylum,
Playtmonas, Pleurochrysis, Porhyra, Pseudoanabaena, Pyramimonas,
Stichococcus, Synechococcus, Synechocystis, Tetraselmis, Thalassiosira, and
Trichodesmium.
In a more preferred embodiment, algae are diatoms. Diatoms are unicellular
phototrophs identified by their species-specific morphology of their amorphous
silica cell wall, which vary from each other at the nanometer scale. Diatoms
includes as non limiting examples: Phaeodactylum, Fragilariopsis, Thalassiosira,
Coscinodiscus, Arachnoidiscusm, Aster omphalus, Navicula, Chaetoceros,
Chorethron, Cylindrotheca fusiformis, Cyclotella, Lampriscus, Gyrosigma,
Achnanthes, Cocconeis, Nitzschia, Amphora, and Odontella.
In another aspect, also encompassed in the scope of the present invention,
a genetically modified algal cell is provided obtained or obtainable by the methods
described above. In particular embodiments, such genetically modified algal cells
are characterized by the presence of a sequence encoding a rare-cutting
endonuclease transgene and a modification in a targeted gene.
Particularly, is comprised in the scope of the invention, a genetically
modified algal cell characterized in that its genome comprise a targeted
modification in more than one allele and/or in multiple copy or homologous genes.
More particularly, is comprised in the scope of the present invention, a genetically
modified algal cell characterized in that its genome comprise transgenes encoding
a TALE-Nuclease, a TALE-Nuclease and a TREX exonuclease or a
meganuclease and a TREX exonuclease. The present invention also relates a
genetically modified algal cell characterized in that its genome comprises a TALENuclease-
induced targeted modification. In a particular embodiment, genetically
modified algal cells are provided of which the genome includes a gene encoding a
rare-cutting endonuclease which expression is under control of inducible promoter.
Using the method described above, the inventor succeeded to generate
diatoms in which endogenous genes were inactivated using TALE-nuclease. By
inactivated, it is meant, that the gene encodes a non-functional protein or does not
express the protein. Inactivating a gene can be the consequence of a mutation in
the gene, for instance a deletion, a substitution, or an addition of at least one
nucleotide. The gene can also be inactivated by the insertion of a transgene in the
gene of interest, particularly, by homologous recombination. The transgene can
encode for a non functional form of the protein.
Two genes involved in lipid metabolism: UDP-glucose pyrophosphorylase
(UGPase) and putative elongase gene were inactivated in diatom strains using
specific TALE-nuclease to increase lipid content. The UDP-glucose
pyrophosphorylase gene encodes for an enzyme involved in lipid metabolism,
particularly in the metabolic pathway leading to the accumulation of energy-rich
storage compounds, such as chrysolaminarin (b- 1, 3-glucan). The putative
elongase gene is an enzyme involved in the carbon length of the fatty acids.
Thus, the present invention relates to a genetically modified algal cell in
which UDP-glucose pyrophosphorylase (UGPase) gene is inactivated, particularly
the UDP-glucose pyrophosphorylase gene has at least 70%, preferably 75%, 80%,
85%, 90%, 95% identity with the sequence SEQ ID NO: 4 1. In a more particular
embodiment, the genetically modified algal cell in which UGPase is inactivated has
been obtained using TALE-nuclease, preferably TALE-nuclease which targets a
sequence within the UGPase gene, more particularly a target sequence SEQ ID
NO: 44.
In another aspect, the present invention relates to a genetically modified
algal cell in which putative elongase gene is inactivated, particularly the putative
elongase gene has at least 70%, preferably 75%, 80%, 85%, 90%, 95% identity
with the sequence SEQ ID NO: 52. In a more particular embodiment, the
genetically modified algal cell in which putative elongase is inactivated has been
obtained using TALE-nuclease, preferably TALE-nuclease which targets a
sequence within the putative elongase gene, more particularly a target sequence
SEQ ID NO: 55.
In particular embodiment, said genetically modified algal cell is a diatom,
more preferably a Phaeodactylum tricornutum or a Thalassiosira pseudonana. In a
particular embodiment, said genetically modified diatoms are Phaeodactylum
tricornutum strains deposited within the Culture Collection of Algae and Protozoa
(CCAP, Scottish Marine Institute, Oban, Argyll PA34 1QA, Scotland), on May 29th,
2013, under depositor's strain numbers pt-37-7A1 and pt-42-1 1B5. These strains
have received acceptance numbers CCAP 1055/12 with respect to pt-37-7A1 and
CCAP 1055/13 with respect to pt-42-1 1B5.
Definitions:
By "gene" it is meant the basic unit of heredity, consisting of a segment of
DNA arranged in a linear manner along a chromosome, which codes for a specific
protein or segment of protein. A gene typically includes a promoter, a 5'
untranslated region, one or more coding sequences (exons), optionally introns and
a 3' untranslated region. The gene may further be comprised of terminators,
enhancers and/or silencers.
By "genome" it is meant the entire genetic material contained in a cell such
as nuclear genome, chloroplastic genome, mitochondrial genome.
As used herein, the term "locus" is the specific physical location of a DNA
sequence (e.g. of a gene) on a nuclear, mitochondria or choloroplast genome. As
used in this specification, the term "locus" usually refers to the specific physical
location of an endonuclease's target sequence. Such a locus, which comprises a
target sequence that is recognized and cleaved by an endonuclease according to
the invention, is referred to as "locus according to the invention".
By "target sequence" is intended a polynucleotide sequence that can be
processed by a rare-cutting endonuclease according to the present invention.
These terms refer to a specific DNA location, preferably a genomic location in a
cell, but also a portion of genetic material that can exist independently to the main
body of genetic material such as plasmids, episomes, virus, transposons or in
organelles such as mitochondria or chloroplasts as non-limiting examples. The
nucleic acid target sequence is defined by the 5' to 3' sequence of one strand of
said target.
As used herein, the term "transgene" refers to a sequence inserted at in an
algal genome. Preferably, it refers to a sequence encoding a polypeptide.
Preferably, the polypeptide encoded by the transgene is either not expressed, or
expressed but not biologically active, in the algae or algal cells in which the
transgene is inserted. Most preferably, the transgene encodes a polypeptide
useful for increasing the usability and the commercial value of algae. Also, the
transgene can be a sequence inserted in an algae genome for producing an
interfering RNA.
By "homologous" it is meant a sequence with enough identity to another
one to lead to homologous recombination between sequences, more particularly
having at least 95% identity, preferably 97% identity and more preferably 99%.
"Identity" refers to sequence identity between two nucleic acid molecules or
polypeptides. Identity can be determined by comparing a position in each
sequence which may be aligned for purposes of comparison. When a position in
the compared sequence is occupied by the same base, then the molecules are
identical at that position. A degree of similarity or identity between nucleic acid or
amino acid sequences is a function of the number of identical or matching
nucleotides at positions shared by the nucleic acid sequences. Various alignment
algorithms and/or programs may be used to calculate the identity between two
sequences, including FASTA, or BLAST which are available as a part of the GCG
sequence analysis package (University of Wisconsin, Madison, Wis.), and can be
used with, e.g., default setting.
By "phenotype" it is meant an algae's or a algae cell's observable traits. The
phenotype includes viability, growth, resistance or sensitivity to various marker
genes, environmental and chemical signals, etc...
By "vector" is intended to mean a nucleic acid molecule capable of
transporting another nucleic acid to which it has been linked. A vector which can
be used in the present invention includes, but is not limited to, a viral vector, a
plasmid, a RNA vector or a linear or circular DNA or RNA molecule which may
consists of a chromosomal, non chromosomal, semi-synthetic or synthetic nucleic
acids. Preferred vectors are those capable of autonomous replication (episomal
vector) and/or expression of nucleic acids to which they are linked (expression
vectors). Large numbers of suitable vectors are known to those skilled in the art
and commercially available. Some useful vectors include, for example without
limitation, pGEM13z. pGEMT and pGEMTEasy {Promega, Madison, Wl); pSTBIuel
(EMD Chemicals Inc. San Diego, CA); and pcDNA3.1 , pCR4- TOPO, pCR-TOPOII,
pCRBIunt-ll-TOPO (Invitrogen, Carlsbad, CA). Preferably said vectors are
expression vectors, wherein the sequence(s) encoding the rare-cutting
endonuclease of the invention is placed under control of appropriate transcriptional
and translational control elements to permit production or synthesis of said rarecutting
endonuclease. Therefore, said polynucleotide is comprised in an
expression cassette. More particularly, the vector comprises a replication origin, a
promoter operatively linked to said polynucleotide, a ribosome-binding site, an
RNA-splicing site (when genomic DNA is used), a polyadenylation site and a
transcription termination site. It also can comprise an enhancer. Selection of the
promoter will depend upon the cell in which the polypeptide is expressed.
Preferably, when said rare-cutting endonuclease is a heterodimer, the two
polynucleotides encoding each of the monomers are included in two vectors to
avoid intraplasmidic recombination events. In another embodiment the two
polynucleotides encoding each of the monomers are included in one vector which
is able to drive the expression of both polynucleotides, simultaneously. In some
embodiments, the vector for the expression of the rare-cutting endonucleases
according to the invention can be operably linked to an algal-specific promoter. In
some embodiments, the algal-specific promoter is an inducible promoter. In some
embodiments, the algal-specific promoter is a constitutive promoter. Promoters
that can be used include, for example without limitation, a Pptcal promoter (the
C02 responsive promoter of the chloroplastic carbonic anyhydrase gene, ptcal ,
from P. tricornutum), a NITI promoter, an AMTI promoter, an AMT2 promoter, an
AMT4 promoter, a RHI promoter, a cauliflower mosaic virus 35S promoter, a
tobacco mosaic virus promoter, a simian virus 40 promoter, a ubiquitin promoter, a
PBCV-I VP54 promoter, or functional fragments thereof, or any other suitable
promoter sequence known to those skilled in the art. In another more preferred
embodiment according to the present invention the vector is a shuttle vector,
which can both propagate in E. coli (the construct containing an appropriate
selectable marker and origin of replication) and be compatible for propagation or
integration in the genome of the selected algae.
The term "promoter" as used herein refers to a minimal nucleic acid
sequence sufficient to direct transcription of a nucleic acid sequence to which it is
operably linked. The term "promoter" is also meant to encompass those promoter
elements sufficient for promoter-dependent gene expression controllable for celltype
specific expression, tissue specific expression, or inducible by external
signals or agents; such elements may be located in the 5' or 3' regions of the
naturally-occurring gene.
By "inducible promoter" it is mean a promoter that is transcriptionally active
when bound to a transcriptional activator, which in turn is activated under a
specific condition(s), e.g., in the presence of a particular chemical signal or
combination of chemical signals that affect binding of the transcriptional activator,
e.g., CO2 or N0 2, to the inducible promoter and/or affect function of the
transcriptional activator itself.
The term "transfection" or "transformation" as used herein refer to a
permanent or transient genetic change, preferably a permanent genetic change,
induced in a cell following incorporation of non-host nucleic acid sequences.
The term "host cell" refers to a cell that is transformed using the methods of the
invention. In general, host cell as used herein means an algal cell into which a
nucleic acid target sequence has been modified.
By "catalytic domain" is intended the protein domain or module of an
enzyme containing the active site of said enzyme; by active site is intended the
part of said enzyme at which catalysis of the substrate occurs. Enzymes, but also
their catalytic domains, are classified and named according to the reaction they
catalyze. The Enzyme Commission number (EC number) is a numerical
classification scheme for enzymes, based on the chemical reactions they catalyze
(http://www.chem.qmul.ac.uk/iubmb/enzyme/).
By "mutagenesis" is understood the elimination or addition of at least one
given DNA fragment (at least one nucleotide) or sequence, bordering the
recognition sites of rare-cutting endonuclease.
By "NHEJ" (non-homologous end joining) is intended a pathway that repairs
double-strand breaks in DNA in which the break ends are ligated directly without
the need for a homologous template. NHEJ comprises at least two different
processes. Mechanisms involve rejoining of what remains of the two DNA ends
through direct re-ligation (Critchlow and Jackson 1998) or via the so-called
microhomology-mediated end joining (Ma, Kim et al. 2003) that results in small
insertions or deletions and can be used for the creation of specific gene
knockouts.
The term "Homologous recombination" refers to the conserved DNA
maintenance pathway involved in the repair of DSBs and other DNA lesions. In
gene targeting experiments, the exchange of genetic information is promoted
between an endogenous chromosomal sequence and an exogenous DNA
construct. Depending of the design of the targeted construct, genes could be
knocked out, knocked in, replaced, corrected or mutated, in a rational, precise and
efficient manner. The process requires homology between the targeting construct
and the targeted locus. Preferably, homologous recombination is performed using
two flanking sequences having identity with the endogenous sequence in order to
make more precise integration as described in WO901 1354.
By "Mosaic clone" is intended clone that comprises cells in which said
target sequence has undergone different modifications. Each clone comprises
different populations of cells in which said target sequence has undergone NHEJ
event or homologous recombination or is unmodified. These populations result
from the rare-cutting endonuclease expression during growth of the colony.
Therefore, different modifications of the target sequence can be segregated from a
single clone.
The above written description of the invention provides a manner and
process of making and using it such that any person skilled in this art is enabled to
make and use the same, this enablement being provided in particular for the
subject matter of the appended claims, which make up a part of the original
description.
As used above, the phrases "selected from the group consisting of",
"chosen from" and the like include mixtures of the specified materials.
Where a numerical limit or range is stated herein, the endpoints are
included. Also, all values and sub-ranges within a numerical limit or range are
specifically included as if explicitly written out.
The above description is presented to enable a person skilled in the art to
make and use the invention, and is provided in the context of a particular
application and its requirements. Various modifications to the preferred
embodiments will be readily apparent to those skilled in the art, and the generic
principles defined herein may be applied to other embodiments and applications
without departing from the spirit and scope of the invention. Thus, this invention is
not intended to be limited to the embodiments shown, but is to be accorded the
widest scope consistent with the principles and features disclosed herein.
Having generally described this invention, a further understanding can be
obtained by reference to certain specific examples, which are provided herein for
purposes of illustration only, and are not intended to be limiting unless otherwise
specified.
EXAMPLES
Example 1: Increase of targeted mutagenesis frequency at endogenous
locus using the PTRI20 meganuclease.
To investigate the ability of one meganuclease to increase the targeted
mutagenesis frequency at diatom endogenous locus, one engineered
meganuclease, called PTRI20 encoded by the pCLS17038 plasmid (SEQ ID NO:
1) designed to cleave the DNA sequence 5'- GTTTTACGTTGTACGACGTCTAGC
- 3' (SEQ ID NO: 2) was created. The meganuclease encoding plasmid was cotransformed
with plasmid encoding selection gene (Natl) (SEQ ID NO: 3) into
diatoms. The mutagenesis rate was measured by deep sequencing on individual
clones resulting from transformations.
Materials and methods
Culture conditions
Phaeodactylum tricornutum Bohlin clone CCMP2561 was grown in filtered
Guillard's f/2 medium without silica (40 °° w/v Sigma Sea Salts S9883),
supplemented with 1X Guillard's f/2 marine water enrichment solution (Sigma
G01 54) in a Sanyo incubator (model MLR-351) at a constant temperature (20 +/-
0.5 °C). The incubator is equipped with white cold neon light tubes that produce an
illumination of about 120 mihoI photons m 2 s 1 and a photoperiod of 12h light : 12h
darkness (illumination period from 9AM to 9PM). Liquid cultures were made in
ventilated cap flasks put on an orbital shaker (Polymax 1040) at a frequency of 30
revolutions min and an angle of 5°.
Genetic transformation
5.10 cells were collected from exponentially growing liquid cultures (concentration
about 106 cells/ ml) by centrifugation (3000 rpm for 10 minutes at 20°C). The
supernatant was discarded and the cell pellet resuspended in 500m I of fresh f/2
medium. The cell suspension was then spread on the center one-third of a 0 cm
1% agar plate containing 20 °° sea salts supplemented with f/2 solution without
silica. Two hours later, transformation was carried out using the biolistic
technology (Biolistic PDS-1000/He Particle Delivery System (BioRad)). The
protocol is adapted from Apt, Kroth-Pancic et al. 1996 and Falciatore, Casotti et al.
1999 with minor modifications. Briefly, M17 tungstene particles ( 1 .1 m diameter,
BioRad) were coated with 9 g of total amount of DNA containing 3 g of
meganuclease encoding plasmid (pCLS17038), 3mg natl selection plasmid
(PCLS16604) (SEQ ID NO: 3) and 3pg of empty vector (pCLS0003) (SEQ ID NO:
4) using 1.25M CaCI2 and 20mM spermidine according to the manufacturer's
instructions. As negative control, beads were coated with a DNA mixture
containing 3 g Natl selection plasmid (pCLS16604) and 6 g empty vector
(pCLS0003). Agar plates with the diatoms to be transformed were positioned at
7.5cm from the stopping screen within the bombardment chamber (target shelf on
position two). A burst pressure of 1550 psi and a vacuum of 25Hg/in were used.
After bombardment, plates were incubated for 48 hours with a 12h light: 12h dark
photoperiod.
Selection
Two days post transformation, bombarded cells were gently scrapped with 700m I
of f/2 medium without silica and spread on two 10 cm 1% agar plates (20 °° sea
salts supplemented with f/2 medium without silica) containing 300 g ml 1
nourseothricin (Werner Bioagents). Plates were then placed in the incubator under
a 12h light: 12h darkness cycle for at least three weeks. 3 to 4 weeks later, on
average, emerging clones resulting from the stable transformation were restreaked
on fresh 10 cm 1% agar plates containing 300 g ml 1 nourseothricin.
Characterization
Measure of the mutagenesis frequency by Deep sequencing
Resistant colonies were picked and dissociated in 20m I of lysis buffer ( 1% TritonX-
100, 20mM Tris-HCI pH8, 2mM EDTA) in an eppendorf tube. Tubes were vortexed
for at least 30 sec and then kept on ice for 15 min. After heating for 10 min at
85°C, tubes were cooled down at RT and briefly centrifuged to pellet cells debris.
Supernatants were used immediately or stocked at 4°C. 5m I of a 1:5 dilution in
milliQ H20 of the supernatant, were used for PCR reactions. The PTRI20 target
was amplified using specific primers flanked by adaptators needed for HTS
sequencing on the 454 sequencing system (454 Life Sciences) using the primer
PTRI20_For1 5'- CCATCTCATCCCTGCGTGTCTCCGACTCAG-TAGCGGTTGTCATGGATAGCGGAGC
-3' (SEQ ID NO: 5) and PTRI20_Rev1 5'-
CCTATCCCCTGTGTGCCTTGGCAGTCTCAGCCCCAGACGATTCGAAGTCGTCC
-3'(SEQ ID NO: 6). The PCR products were
purified on magnetic beads (Agencourt AMPure XP, Beckman Coulter). 5000 to
0 000 sequences per sample were analyzed.
Results
Several weeks after the transformation of diatoms with meganuclease PTRI20
(condition 1), few clones are obtained. One clone was selected to measure the
mutagenesis frequency induced by the PTRI20 meganuclease, a lysis of this clone
was done and the mutagenesis frequency was determined by deep sequencing
(Tablel ) . In parallel, we analyzed 2 clones resulting from the transformation with
the empty vector (condition 2). Whereas, we observed 0.032% (3/9446) of PCR
fragments carrying a mutation in the sample corresponding to the clone
transformed with PTRI20, we did not detected any mutagenic event when the
diatoms were transformed with the empty vector. Examples of mutagenic events
found in the sample corresponding to PTRI20 conditions are presented in Figure
1.
Thus, the PTRI20 meganuclease was able to induce targeted mutagenesis events
at the endogenous locus in diatoms.
Table 1: Mutagenesis-induced by PTRI20 meganuclease.
A lysis of the clones resulting from the transformation with the meganuclease
(condition 1) or from transformation with the empty vector (condition 2) was done.
A PCR surrounding the PTRI20 target was performed and the percentage of the
mutagenesis frequency induced by the PTRI20 meganuclease was determined by
deep sequencing analysis of amplicons surrounding the specific target.
Example 2: High targeted mutagenesis frequency at endogenous locus of
diatoms using the combination of SCTREX2 and PTRI20 meganuclease.
To investigate the ability of the DNA processing enzyme single chain TREX2
(SCTREX2) to increase the targeted mutagenesis frequency induced by a
meganuclease, one engineered meganuclease, called PTRI20 encoded by the
pCLS17038 plasmid (SEQ ID NO: 1) designed to cleave the DNA 5'-
GTTTTACGTTGTACGACGTCTAGC - 3' (SEQ ID NO: 2) was used. This
meganuclease was co-transformed with a plasmid encoding selection gene (Natl)
(NAT) (SEQ ID NO: 3) and with a plasmid encoding a DNA processing enzyme,
called SCTREX2 encoded by the pCLS18296 (SEQ ID NO: 7). The mutagenesis
rate was visualized by T7 assay and measured by Deep sequencing on individual
clones resulting from transformation.
Materials and methods
Phaeodactylum tricornutum Bohlin clone CCMP2561 was grown and transformed
according to the method described in example 1 with M17 tungstene particles
(1 . 1 m diameter, BioRad) coated with 9 g of total amount of DNA containing 3 g
of meganuclease encoding plasmid (pCLS 17038), 3 g SCTREX2 (pCLS 18296)
and 3pg Natl selection plasmid (pCLS16604) (SEQ ID NO: 3) (Condition 1) using
1.25M CaCI2 and 20mM spermidine according to the manufacturer's instructions.
As negative controls, beads were coated with a DNA mixture containing 3 g of
meganuclease encoding plasmid pCLS17038, 3 g Nat selection plasmid
(pCLS16604) and 3 g empty vector (pCLS0003) (Condition 2) or 3 ig Natl
selection plasmid (pCLS16604) and 6 g empty vector (pCLS0003) (SEQ ID NO:
4) (Condition 3).
Characterization
A-Colony screening
After selection, resistant colonies were picked and dissociated according to the
method described in example 1. Supematants were used for each PCR reaction.
Specific primers for meganuclease screen: meganuclease_For1 5'-
TTAACAATTGAATCTCGCCTATTCATGGTG-3' (SEQ ID NO: 8) and
meganuclease_Rev1 5'- TAGCGCTCGAGTTACTAAGGAGAGGACTTTTTCTT- 3'
(SEQ ID NO: 9), for SCTREX2 screen SCTREX2_For1 5'-
AATCTCGCCTATTCATGGTG - 3' (SEQ ID NO: 10) and SCTREX2_Rev1 5 -
CCAGACCGGTCTGTGGAGGAG - 3' (SEQ ID NO: 11).
B-Measure of the mutagenesis frequency by T7 endonuclease assay
PCR amplification of the PTRI20 locus was obtained with Deep sequencing
primers (see list of forward and reverse primer sequences below) and genomic
DNA from the colony extracts. PCR amplicons were centered on the nuclease
targets and 400-500bp long, on average.
The PCR products were purified on magnetic beads (Agencourt AMPure XP,
Beckman Coulter) and quantified with a NanoDrop 1000 spectrophotometer
(Thermo Scientific). 50ng of the amplicons were denatured and then annealed in
10m I of annealing buffer (10mM Tris-HCI pH8, 100mM NaCI, 1mM EDTA) using an
Eppendorf MasterCycle gradient PCR machine. The annealing program is as
follows: 95°C for 0 min; fast cooling to 85°C at 3°C/sec; and slow cooling to 25°C
at 0.3°C/sec. The totality of the annealed DNA was digested for 15 min at 37°C
with 0.5m I of the T7 Endonuclease I (IOU/ m I) (M0302 Biolabs) in a final volume of
20m I (1X NEB buffer 2, Biolabs). 0m I of the digestion were then loaded on a 10%
polyacrylamide MiniProtean TBE precast gel (BioRad). After migration the gel was
stained with SYBRgreen and scanned on a Gel Doc XR+ apparatus (BioRad).
C-Measure of the mutagenesis frequency by Deep sequencing
The PTRI20 target was amplified with specific primers flanked by adaptator
needed for HTS sequencing on the 454 sequencing system (454 Life Sciences)
using the primer PTRI20_For1 5'- CCATCTCATCCCTGCGTGTCTCCGACTCAGTAG-
CGGTTGTCATGGATAGCGGAGC -3' (SEQ ID NO: 5) and PTRI20_Rev1 5'-
CCTATCCCCTGTGTGCCTTGGCAGTCTCAGCCCCAGACGATTCGAAGTCGTCC
-3TSEQ ID NO: 6). 5000 to 10 000
sequences per sample were analyzed.
Results
Few weeks after the transformation of diatoms with the PTRI20 meganuclease
and the SCTREX2 DNA processing enzyme, 9 clones were obtained (Condition
1). Among them, 2 were positive for the presence of the meganuclease DNA
sequence, 3 for the presence of the SCTREX2 only and one (called A) was
positive for both transgenes which represent a rate of co-transformation around
11%. In the same time, 14 clones resulting from the transformation with the
PTRI20 meganuclease alone were obtained (Condition 2). Among them, 1 were
positive for the presence of meganuclease DNA sequence. Finally, 7 clones
resulting from the transformation with the empty vector were obtained (Table 1)
(Condition 3). In order to measure the mutagenesis frequency induced by the
PTRI20 meganuclease in presence or absence of the SCTREX2 molecule, lysis
from positive clone was done and the mutagenesis was determined by T7 assay
and quantified by Deep sequencing (Figure 2).
The clone (A) corresponding to the positive clone for both meganuclease and
SCTREX2 DNA sequences was tested in T7 assay. In parallel, Phaeodactylum
tricornutum strain as well as the unique clone resulting from the transformation
with the empty vector were also tested (Figure2). The clone A was positive in T7
assay which reflects the presence of mutagenic events. Due to the lack of the
sensitivity of the T7 assay, no signal could be detected in the 2 clones
corresponding to the diatoms transformed with the PTRI20 meganuclease alone.
The mutagenesis frequency in the clone (A) was quantified by Deep sequencing
analysis. Whereas, in this clone 6.9% (183/2475) of PCR fragments carried a
mutation, we did not detect mutagenic event in 3 samples corresponding to
diatoms transformed with the empty vector. Some examples of mutagenic events
are presented in Figure 3.
Thus, the coupling of the DNA processing enzyme SCTREX2 with a
meganuclease (PTRI20) is able to cleave an endogenous target (see examplel),
enhances the targeted mutagenesis frequency in diatoms (up to 6.9%).
Table2: Number of clones obtained after transformation, number of
clones that have integrated the PTRI020 meganuclease and SCTREX2
DNA sequences and the number of clones tested in the T7 assay and
Example 3 : High targeted mutagenesis frequency at diatom endogenous
locus using the combination SCTREX2 and PTRI02 meganuclease.
To investigate the ability of the DNA processing enzyme SCTREX2 to increase the
targeted mutagenesis frequency induced by a meganuclease, one engineered
meganuclease, called PTRI02 encoded by the pCLS17181 plasmid (SEQ ID NO:
12) designed to cleave the DNA sequence 5' -
TTTTGACGTCGTACGGTGTCTCCG- 3' (SEQ ID NO: 13) was used. This
meganuclease encoding plasmid was co-transformed with plasmid encoding
selection gene (Natl) (SEQ ID NO: 3) and with a plasmid encoding the DNA
processing enzyme, SCTREX2 encoded by the pCLS18296 (SEQ ID NO: 7). The
mutagenesis rate was measured by Deep sequencing on individual clones
resulting from transformations.
Materials and methods
Phaeodactylum tricornutum Bohlin clone CCMP2561 was grown and transformed
according to the method described in example 1 with M17 tungstene particles
( 1 . 1 mhi diameter, BioRad) coated with 9 g of total amount of DNA containing 3 g
of meganuclease encoding plasmid (pCLS17181), 3 g SCTREX2 (pCLS1 8296)
and 3mg Natl selection plasmid (pCLS16604) (SEQ ID NO: 3) using 1.25M CaCI2
and 20mM spermidine according to the manufacturer's instructions. As negative
control, beads were coated with a DNA mixture containing 3 g Natl selection
plasmid (pCLS16604) and 6 g empty vector (pCLS0003) (SEQ ID NO: 4).
Characterization
A-Colony screening
After selection, resistant colonies were picked and dissociated according to the
method described in example 1. Supernatants were used for each PCR reaction.
Specific primers for meganuclease screen: meganuclease_For1 5'-
TTAACAATTGAATCTCGCCTATTCATGGTG-3' (SEQ ID NO: 8) and
meganuclease_Rev1 5'- TAGCGCTCGAGTTACTAAGGAGAGGACTTTTTCTT- 3'
(SEQ ID NO: 9), for SCTREX2 screen SCTREX2_For1 5'-
AATCTCGCCTATTCATGGTG - 3' (SEQ ID NO: 10) and SCTREX2_Rev1 5'-
CCAGACCGGTCTGTGGAGGAG - 3' (SEQ ID NO: 11).
B-Measure of the mutagenesis frequency by Deep sequencing
The PTRI02 target was amplified using a 1:5 dilution of the lysis colony with
specific primers flanked by specific adaptator needed for HTS sequencing on the
454 sequencing system (454 Life Sciences) using the primer PTRI02_For1 5'-
CCATCTCATCCCTGCGTGTCTCCGACTCAG-TAGTCAGCTCCATTGGAATGTTGGC
-3' (SEQ ID NO: 14) and PTRI02_Rev1 5'-
CCTATCCCCTGTGTGCCTTGGCAGTCTCAGCCCTCCGACCAGGGAACTTACTC
-3'(SEQ ID NO: 15). The PCR products were
purified on magnetic beads (Agencourt AMPure XP, Beckman Coulter). 5000 to
10 000 sequences per sample were analyzed.
Results
Few weeks after the transformation of diatoms with both the PTRI02
meganuclease and the SCTREX2 DNA processing enzyme encoding plasmids, 7
clones were obtained. Among them, 5 were positive in PCR for the presence of
both transgenes which represents a rate of co-transformation around 7 1%. In the
same time, 7 clones resulting from the transformation with the empty vector were
obtained. The mutagenesis frequency induced by the PTRI02 meganuclease in
the presence of the SCTREX2 molecule was measured by Deep sequencing
analysis of amplicons surrounding the PTRI02 specific target.
Results of the mutagenesis frequency induced by the meganuclease in presence
of SCTREX2 are presented in Figure 4. Whereas the samples corresponding to
the 5 positive clones (meganuclease and SCTREX2 positive) present 1.2, 2.5, 4.8,
8.3 and 14.9% of mutated PCR fragments respectively, we did not detected any
mutagenic event in the 3 samples tested corresponding to diatoms transformed
with the empty vector. Thus, the 5 analyzed clones present high rates of
mutagenic events. Some examples of mutagenic events are presented in Figure 5.
To conclude, the coupling of the DNA processing enzyme SCTREX2 with one
meganuclease able to cleave an endogenous target allows us to obtain high
frequency of targeted mutagenesis in diatoms (up to 14%).
Example 4: High targeted mutagenesis frequency induced using TALENuclease
targeting reporter gene stably integrated in diatom genome.
To investigate the ability of a TALE-Nuclease to induce targeted mutagenesis in
diatoms, one engineered TALE-Nuclease, called YFP_TALE-Nuclease encoded
by the pCLS17205 (SEQ ID NO: 16) and pCLS17208 (SEQ ID NO: 17) plasmids
designed to cleave the DNA sequence 5'
TGAACCGCATCGAGCTGaagggcatcgacTTCAAGGAGGACGGCAA- 3' (SEQ ID
NO: 18) were used. These TALE-Nuclease encoding plasmids were cotransformed
with a plasmid encoding selection gene (Natl) into a diatom strain
carrying the YFP reporter gene integrated stably in multiple copies in the genome.
The mutagenesis frequency induced by the designated TALE-Nuclease was
measured by Deep sequencing on individual clones resulting from
transformations.
Materials and methods
Phaeodactylum tricornutum Bohlin clone CCMP2561 was grown and transformed
according to the method described in example 1 with M17 tungstene particles
( 1. 1m t diameter, BioRad) coated with 9 g of total amount of DNA containing 3 g
of each monomer of TALE-Nucleases (pCLS17205 and pCLS17208) and 3 g
Natl (pCLS16604) (SEQ ID NO: 3) selection plasmid using 1.25M CaCI2 and
20mM spermidine according to the manufacturer's instructions. As negative
control, beads were coated with a DNA mixture containing 3 g Natl selection
plasmid (pCLS16604) and 6 g empty vector (pCLS0003) (SEQ ID NO: 4).
Characterization
Measure of the mutagenesis frequency by Deep sequencing
After selection, the genomic DNA was extracted using ZR genomic DNA (Zymo
Research) Kit and the mutagenesis frequency was determined by Deep
sequencing. The YFP target was amplified using a 1:7 dilution of genomic DNA,
with specific primers flanked by adaptators needed for HTS sequencing on the 454
sequencing system (454 Life Sciences) using the primers YFP_For 5'-
CCATCTCATCCCTGCGTGTCTCCGACTCAG-Tag-
CTGCACCACCGGCAAGCTGCC -3' (SEQ ID NO: 19) and YFP_Rev 5'-
CCTATCCCCTGTGTGCCTTGGCAGTCTCAG- CCTCGATGTTGTGGCGG -3'
(SEQ ID NO: 20). The PCR products were purified on magnetic beads (Agencourt
AMPure XP, Beckman Coulter). 5000 to 10 000 sequences per sample were
analyzed.
Results
Few weeks after transformation of diatoms 27 clones were obtained in the
condition corresponding to diatom transformed with TALE-Nuclease encoding
plasmids (condition 1) and 17 in the condition corresponding to diatoms
transformed with the empty vector (condition 2). 15 clones resulting from the
condition 1 and 5 resulting from condition 2 were tested for targeted mutagenic
events. For this purpose, genomic DNA was extracted and PCR surrounding the
specific target sequence was performed. The presence of mutagenic events was
measured by Deep sequencing analysis. Data are presented in the Figure 6 .
Among all the tested clones, 3 presented a high rate of mutagenesis 1.5, 3.2 and
23.4% respectively. These three clones correspond to diatoms transformed with
the TALE-Nuclease. While all other tested clones presented background levels of
mutagenesis (<0.04%). Some examples of mutated sequences are presented in
Figure 7 . One clone (n°2) was further sub-cloned, and 7 sub-clones were
analyzed. Among them, one presented 100% of mutated sequences.
Thus, TALE nuclease induces high frequency targeted mutagenesis (up to 23%).
Moreover TALE-Nuclease induces mutagenesis on multiple copies of the YFP
reporter gene stably integrated into the diatom genome.
Example 5: High targeted mutagenesis frequency induced using TALENuclease
targeting endogenous locus in the diatom Thalassiosira
pseudonana
To investigate the ability of a TALE-Nuclease to induce targeted mutagenesis in
diatoms, one engineered TALE-Nuclease, called TP07 TALE-Nuclease encoded
by the pCLS20885 (SEQ ID NO: 21) and pCLS20886 (SEQ ID NO: 22) plasmids
designed to cleave the DNA sequence 5'
TGACTTTCCTCCCATGTTAGGTCCAGTGACAAGAAGGAATGAGGATGCA- 3'
(SEQ ID NO: 23) witin a gene encoding for the protein ID: 2 11853 were used.
These TALE-Nuclease encoding plasmids were co-transformed with a plasmid
conferring resistance to nourseothricin (NAT) in the diatom Thalassiosira
pseudonana. The mutagenesis frequency induced by the designated TALENuclease
was measured by Deep sequencing on individual clones resulting from
the transformations.
Material and methods
Culture conditions
Thalassiosira pseudonana clone CCMP1335 was grown in filtered Guillard's f/2
medium with silica [407°° w/v Sigma Sea Salts S9883, supplemented with 1X
Guillard's f/2 marine water enrichment solution (Sigma G9903, 0.03 00 w/v
a2Si0 3.9H20)], in a Sanyo incubator (model MLR-351) at a constant temperature
(20 +/- 0.5 °C). The incubator is equipped with white cold neon light tubes that
produce an illumination of about 120 mhhoI photons m 2 s" and a photoperiod of
16h light : 8h darkness (illumination period from 9AM to 1AM). Liquid cultures were
made in vented cap flasks put on an orbital shaker (Polymax 1040, Heidolph) with
a rotation speed of 30 revolutions min and an angle of 5°.
Genetic transformation
108 cells were collected from exponentially growing liquid cultures (concentration
about 106 cells/ ml) by centrifugation (3000 rpm for 10 minutes at 20°C). The
supernatant was discarded and the cell pellet resuspended in 500m I of fresh f/2
medium with silica. The cell suspension was then spread on the center one-third of
a 10 cm 1% agar plate containing 40°/°° sea salts supplemented with f/2 solution
with silica. Two hours later, transformation was carried out using microparticle
bombardment (Biolistic PDS-1000/He Particle Delivery System, BioRad). The
protocol is adapted from Falciatore et al., ( 999) and Apt et al., (1999) with minor
modifications. Briefly, M17 tungsten particles ( 1. 1 m h diameter, BioRad) were
coated with 9 g of a total amount of DNA composed of 3 g of each monomer of
TALE-Nucleases (pCLS20885 and pCLS20886) and 3 g of the NAT (pCLS17714)
(SEQ ID NO: 24) selection plasmid using 1.25M CaCI2 and 20mM spermidin
according to the manufacturer's instructions. As a negative control, beads were
coated with a DNA mixture containing 3 g of the NAT selection plasmid
(pCLS17714) and 6pg of an empty vector (pCLS0003) (SEQ ID NO: 4). Agar
plates with the diatoms to be transformed were positioned at 7.5cm from the
stopping screen within the bombardment chamber (target shelf on position two). A
burst pressure of 1550 psi and a vacuum of 20Hg/in were used. Just after
bombardment, cells were gently scrapped with 1ml of f/2 medium supplemented
with silica and directly seeded in vented cap flasks containing 100ml of f/2 medium
with silica. The resulting cell cultures were placed for 24h in the incubator under a
16h light: 8h darkness cycle.
Selection
One day post transformations, cells were counted and a volume of culture
corresponding to 25. 106 cells was centrifugated at 3000rpm for 10min at 20°C. The
cell pellet was resuspended in 1,5ml of f/2 medium with silica and spread on five
10cm 1% agar plates (40 °° sea salts supplemented with f/2 medium with silica)
containing 200 g ml 1 nourseothricin (Werner Bioagents). Plates were then placed
in the incubator under a 16h light: 8h darkness cycle for at least three weeks. 3 to
4 weeks after transformation, on average, resistant colonies resulting from a stable
transformation were re-streaked on fresh 10cm 1% agar plates containing 200 g
ml 1 nourseothricin.
Characterization
Measure of the mutagenesis frequency by Deep sequencing
Resistant colonies were picked and dissociated in 20m I of lysis buffer ( 1% TritonX-
100, 20mM Tris-HCI pH8, 2mM EDTA) in an eppendorf tube. Tubes were vortexed
for at least 30 sec and then kept on ice for 15 min. After heating for 10 min at
85°C, tubes were cooled down at RT and briefly centrifuged to pellet cells debris.
Supernatants were used immediately or stocked at 4°C. 5m I of a 1:5 dilution in
milliQ H2O of the supernatants, were used for each PCR reaction. The TP07
target was amplified using 1:5 dilution of the lysis colony, with specific primers
flanked by specific adaptator needed for HTS sequencing on the 454 sequencing
system (454 Life Sciences) using the primer TP07_For 5'-
CCATCTCATCCCTGCGTGTCTCCGACTCAG-Tag-GGAAGTGAGTTGCAAACAC
3' (SEQ D NO: 25) and TP07_Rev 5'-
CCTATCCCCTGTGTGCCTTGGCAGTCTCAG-CTTCAAGATGATATGAACTT -3'
(SEQ ID NO: 26). The PCR products were purified on magnetic beads (Agencourt
AMPure XP, Beckman Coulter). 5000 to 10 000 sequences per sample were
analyzed.
Results
Three weeks after the plating of the transformed diatoms on the nourseothricin
selective medium, one clone were obtained under the condition corresponding to
the diatoms transformed with the TALE-Nuclease encoding plasmids (condition 1)
and three under the condition corresponding to the diatoms transformed with the
empty vector (condition 2). One clone resulting from the condition 1 and one
resulting from condition 2 were tested for targeted mutagenic events. For this
purpose, genomic DNA was extracted and PCR surrounding the specific target
sequence was performed. The presence of mutagenic events was measured by
Deep sequencing analysis. Among the tested clones, one presents a mutagenic
event on 1,800 sequences analyzed (i.e. 0.05%). This clone corresponds to the
diatoms transformed with the TALE-Nuclease. While all other tested clones
present no mutagenic event. The mutated sequence identified is presented in
Figure 8 .
Thus, TALE nuclease induces targeted mutagenesis at an endogenous locus
(0.05%).
Example 6: High targeted mutagenesis frequency induced using TALENuclease
(TP15) targeting endogenous locus in the diatom Thalassiosira
pseudonana.
To investigate the ability of a TALE-Nuclease to induce targeted mutagenesis in
diatoms, one engineered TALE-Nuclease, called TP15_TALE-Nuclease encoded
by the pCLS20726 (SEQ ID NO: 27) and pCLS20727 (SEQ ID NO: 28) plasmids
designed to cleave the DNA sequence 5'
TTGGGTCTTGAAGGGATGTTGTCGGGAACCACGTTGGCCATGGAGTGGA- 3'
(SEQ ID NO: 29) were used. These TALE-Nuclease encoding plasmids were cotransformed
with a plasmid conferring resistance to nourseothricin (NAT) in the
diatom Thalassiosira pseudonana. The mutagenesis frequency induced by the
designated TALE-Nuclease was measured by Deep sequencing on individual
clones resulting from the transformations.
Materials and methods
Thalassiosira pseudonana clone CCMP1335 was grown and transformed
according to the method described in example 5 with M17 tungstene particles
( 1. m diameter, BioRad) coated with 9 g of a total amount of DNA composed of
3pg of each monomer of TALE-Nucleases (pCLS20726 and pCLS20727) and 3pg
of the NAT (pCLS17714) (SEQ ID NO: 24) selection plasmid using 1.25M CaCI2
and 20mM spermidin according to the manufacturer's instructions.
Characterization
Measure of the mutagenesis frequency by Deep sequencing
After selection, resistant colonies were picked and dissociated according to the
method described in example 5. Supernatants were used for each PCR reaction.
The TP15 target was amplified using 1:5 dilution of the lysis colony, with specific
primers flanked by specific adaptator needed for HTS sequencing on the 454
sequencing system (454 Life Sciences) using the primer TP1 5_For 5'-
CCATCTCATCCCTGCGTGTCTCCGACTCAG -Tag-
AATGCCCAAAGTATACACTGT-3' (SEQ ID NO: 30) and TP15_Rev 5'
CCTATCCCCTGTGTGCCTTGGCAGTCTCAG -AATTCATTATCTCCGACTCTC -
3' (SEQ ID NO: 31). The PCR products were purified on magnetic beads
(Agencourt AMPure XP, Beckman Coulter). 5000 to 10 000 sequences per sample
were analyzed.
Results
Three weeks after the plating of the transformed diatoms on the nourseothricin
selective medium one clone was obtained under the condition corresponding to
the diatoms transformed with the TALE-Nuclease encoding plasmids (condition 1)
and one under the condition corresponding to the diatoms transformed with the
empty vector (condition 2). One clone resulting from the condition 1 and one
resulting from the condition 2 were tested for targeted mutagenic events. For this
purpose, genomic DNA was extracted and PCR surrounding the specific target
sequence was performed. The presence of mutagenic events was measured by
Deep sequencing analysis. Among the tested clones, one presents a mutagenic
event on 7,192 sequences analyzed (i.e. 0.014%). This clone corresponds to
diatoms transformed with the TALE-Nuclease. While all other tested clones
present no mutagenic event. The mutated sequence identified is presented in
Figure 9 .
Thus, TALE nuclease induces targeted mutagenesis at an endogenous locus
(0.014%).
Example 7 : Gene targeting induced by an engineered meganuclease
(PTRI02) in Phaeodactylum tricornutum
To investigate the ability of a rare-cutting endonuclease to induce gene targeting
frequency into diatoms, one engineered meganuclease, called PTRI02 encoded
by the pCLS17181 (SEQ ID NO: 12) plasmids designed to cleave the DNA
sequence 5' -TTTTGACGTCGTACGGTGTCTCCG- 3' (SEQ ID NO: 13) was
used. This meganuclease was co-transformed with a plasmid conferring
resistance to nourseothricin (NAT) and a DNA matrix plasmid pCLS19635 (SEQ
ID NO: 32) composed of two arms homologous to the targeted sequence
separated by a heterologous fragment, in a wild type diatom strain. The individual
clones resulting from the transformation were screened by PCR for the presence
of gene targeting events and the homologous recombination frequency was
measured by Deep sequencing.
Materials and methods
Phaeodactylum tricornutum Bohlin clone CCMP2561 was grown and transformed
according to the methods described in example 1 with M17 tungstene particles
( 1 . 1 mhh diameter, BioRad) coated with 9 g of a total amount of DNA composed of
3pg of meganuclease pCLS17181 (SEQ ID NO: 12), 3pg of the NAT selection
plasmid (pCLS16604) (SEQ ID NO: 3) and of the DNA matrix plasmid
(pCLS19635) (SEQ ID NO: 32) using 1.25M CaCI2 and 20mM spermidin
according to the manufacturer's instructions. As negative control, beads were
coated with a DNA mixture containing 3 g of the NAT selection plasmid
(pCLS16604), 3 g of the DNA matrix plasmid (pCLS19635) (SEQ ID NO: 32) and
3pg of an empty vector (pCLS0003) (SEQ ID NO: 4).
Characterization
A-Colony screening
After selection, resistant colonies were picked and dissociated according to the
methods of example 1. Supernatants were used for each PCR reaction. Specific
primers for meganuclease screen: Meganuclease_For 5'-
TTAACAATTGAATCTCGCCTATTCATGGTG-3' (SEQ ID NO: 8) and
Meganuclease_Rev 5'- TAGCGCTCGAGTTACTAAGGAGAGGACTTTTTCTT- 3'
(SEQ ID NO: 9).
B-ldentification of homologous gene targeting event
The detection of targeted integration is performed by specific PCR amplification
using a primer located within the heterologous insert of the DNA repair matrix and
one located on genomic sequence outside of the homology arm. 1/20 of the lysis
colony was used for PCR screening.
For the screen left, PTRI02_HGT_Left_For (located outside of the homology): 5'-
CCGGCCAGAGTCGAATTGGCCACGTGG-3' (SEQ ID NO: 33) and
lnsert_HGT_Left_Rev (located in the heterologous insert): 5'-
AATTGCGGCCGCGGTCCGGCGC-3' (SEQ ID NO: 34). For the screen right,
PTRI02_HGT_Right_For (located in the heterologous insert): 5 -
TTAAGGCGCGCCGGACCGCGGC -3' (SEQ ID NO: 35) and
PTRI02_HGT_Right_Rev (located outside of the homology): 5'-
GACGACGACGAAAACGTCTTGCGTCCG -3' (SEQ ID NO: 36).
C-Measure of the homologous gene targeting frequency by Deep sequencing
In order to measure the homologous recombination frequency induced by the
PTRI02 meganuclease, two successive PCR were performed. The first PCR
(locus specific) was performed using the primers PTRI02_HGT_Left_For: 5'-
CCGGCCAGAGTCGAATTGGCCACGTGG-3'(SEQ ID NO: 33) and
PTRI02_HGT_Right_Rev: 5'-GACGACGACGAAAACGTCTTGCGTCCG -3' (SEQ
ID NO: 36). The PCR product was then purified on gel and an aliquot (1/60 of the
elution) was used for the nested PCR using the primers PTRI02_For 5'-
CCATCTCATCCCTGCGTGTCTCCGACTCAG-TAGTCAGCTCCATTGGAATGTTGGC
-3' (SEQ ID NO: 14) and PTRI02_Rev 5'-
CCTATCCCCTGTGTGCCTTGGCAGTCTCAGCCCTCCGACCAGGGAACTTACTC
-3'(SEQ ID NO: 15). PTRI02_For and
PTRI02_Rev2are flanked by specific adaptator needed for HTS sequencing on the
454 sequencing system (454 Life Sciences). The PCR products were purified on
magnetic beads (Agencourt AMPure XP, Beckman Coulter).5000 to 10 000
sequences per sample were analyzed.
Results
Three weeks after the transformation of the diatoms, 23 clones were obtained in
the condition corresponding to the transformation performed with the
meganuclease PTRI02 and the DNA matrix encoding plasmids (condition 1).
Among them, 8/28 (i.e. 28.5%) were positive for both the presence of
meganuclease encoding plasmid and HGT events. Finally, 2 1 clones resulting
from the transformation with the DNA matrix and the empty vector were obtained
(condition 2). None of them were positive for the presence of HGT events.
The homologous gene targeting frequency was determined by Deep sequencing
on the 8 clones positive for HGT events and 2 clones from condition 2 negative for
HGT, used here as negative control. Whereas the samples corresponding to the 8
positive clones (condition 1) present 0; 0.01 , 0.079; 0.213; 0.238; 0.949 ;1 .042 ;
2.277 of HGT positive PCR fragments, this percentage is zero in the 2 samples
corresponding to the condition 2, negative for HGT event screening (Figure 10).
To conclude, the use of one meganuclease able to cleave an endogenous target
in combination with a DNA matrix homologous to the targeted sequence allows
homologous gene targeting events in diatoms (up to 2%).
Example 8 : Gene targeting induced by an engineered meganuclease
(PTRI20) in Phaeodactylum tricornutum
To investigate the ability of a rare-cutting endonuclease to induce gene targeting
frequency into diatoms, one engineered meganuclease, called PTRI20 encoded
by the pCLS17038 (SEQ ID NO: 1) plasmids designed to cleave the DNA
sequence 5' -GTTTTAC GTTGTAC GACGTCTAG C- 3' (SEQ ID NO: 2) was used.
This meganuclease was co-transformed with a plasmid conferring resistance to
nourseothricin (NAT) and a DNA matrix plasmid pCLS19773 (SEQ ID NO: 37)
composed of two arms homologous to the targeted sequence separated by a
heterologous fragment, in a wild type diatom strain. The individual clones resulting
from the transformation were screened by PCR for the presence of gene targeting
events and the homologous recombination frequency was measured by Deep
sequencing.
Materials and methods
Phaeodactylum tricornutum Bohlin clone CCMP2561 was grown CCMP2561 was
grown and transformed according to the methods described in example 1 with
M17 tungstene particles ( 1 . 1 m diameter, BioRad) coated with 9 g of a total
amount of DNA composed of 3 g of meganuclease pCLS17038 (SEQ ID NO: 1),
3pg of the NAT selection plasmid (pCLS16604) (SEQ ID NO: 3) and 3 g of the
DNA matrix plasmid (pCLS19773) (SEQ ID NO: 37) using 1.25M CaCI2 and
20mM spermidin according to the manufacturer's instructions. As negative control,
beads were coated with a DNA mixture containing 3 g of the NAT selection
plasmid (pCLS16604), 3 g of the DNA matrix plasmid (pCLS19773) (SEQ ID NO:
37) and 3 i g of an empty vector (pCLS0003) (SEQ ID NO: 4).
Characterization
A-Colony screening
After selection, resistant colonies were picked and dissociated according to the
methods of example 1. Supernatants were used for each PCR reaction. Specific
primers for meganuclease screen: Meganuclease_For 5'-
TTAACAATTGAATCTCGCCTATTCATGGTG-3' (SEQ ID NO: 8) and
Meganuclease_Rev 5'- TAGCGCTCGAGTTACTAAGGAGAGGACTTTTTCTT- 3'
(SEQ ID NO: 9).
B-ldentification of homologous gene targeting event
The detection of targeted integration is performed by specific PCR amplification
using a primer located within the heterologous insert of the DNA repair matrix and
one located on genomic sequence outside of the homology arm. 1/20 of the lysis
colony was used for PCR screening.
For the screen left, PTRI20_HGT_Left_For (located outside of the homology): 5'-
GCAGCGTACGCAGCCATAGTCCGGAACG -3' (SEQ ID NO: 38) and
lnsert_HGT_Left_Rev (located in the heterologous insert): 5'-
AATTGCGGCCGCGGTCCGGCGC -3' (SEQ ID NO: 34). For the screen right,
PTRI20_HGT_Right_For (located in the heterologous insert): 5'-
TGTTTTACGTTGTTTAAGGCGCGCCG -3' (SEQ ID NO: 39) and
PTRI20_HGT_Right_Rev (located outside of the homology): 5'-
CCGCATCTCAATCACGTCTTGTTGAAGC -3' (SEQ ID NO: 40).
C-Measure of the homologous gene targeting frequency by Deep sequencing
In order to measure the homologous recombination frequency induced by the
PTRI20 meganuclease, two successive PCR were performed. The first PCR
(locus specific) was performed using the primers PTRI20_HGT_Left_For: 5'-
GCAGCGTACGCAGCCATAGTCCGGAACG -3' (SEQ ID NO: 38) and
PTRI20_HGT_Right_Rev: 5'- CCGCATCTCAATCACGTCTTGTTGAAGC -3' (SEQ
ID NO: 40). The PCR product was then purified on gel and an aliquot (1/60 of the
elution) was used for the nested PCR using the primers PTRI20_For 5'-
CGGTTGTCATGGATAGCGGAGC -TAG-TCAGCTCCATTGGAATGTTGGC -3'
(SEQ ID NO: 5) and PTRI20_Rev 5'- CCCCAGACGATTCGAAGTCGTCC -
CCCTCCGACCAGGGAACTTACTC -3' (SEQ ID NO: 6). PTRI20_For and
PTRI20_Rev are flanked by specific adaptator needed for HTS sequencing on the
454 sequencing system (454 Life Sciences). The PCR products were purified on
magnetic beads (Agencourt AMPure XP, Beckman Coulter).5000 to 10 000
sequences per sample were analyzed.
Results
Three weeks after the transformation of the diatoms, 11 clones were obtained in
the condition corresponding to the transformation performed with the
meganuclease PTRI20 and the DNA matrix encoding plasmids (condition 1).
Among them, 9 were screened for the presence of the meganuclease encoding
plasmid and HGT events and 3 were positive for both (i.e. 33%). Finally, 16 clones
resulting from the transformation with the DNA matrix and the empty vector were
obtained (condition 2). Among them, 12 were tested for the presence of HGT
events and none of them were positive for HGT event.
The homologous gene targeting frequency was determined by Deep sequencing
on the 3 clones positive for HGT events and 2 clones from condition 2 negative for
HGT, used here as negative control. Whereas the samples corresponding to the 3
positive clones (condition 1) present 0; 0.06 and 0.197% of HGT positive PCR
fragments, this percentage is zero in the 2 samples corresponding to the condition
2 , negative for HGT event screening (Figure 1).
To conclude, the use of one meganuclease able to cleave an endogenous target
in combination with a DNA matrix homologous to the targeted sequence allows
homologous gene targeting events in diatoms (up to 0.19%).
Example 9 Targeted mutagenesis induced by a TALE-Nuclease targeting
UDP-glucose pyrophosporylase (UGPase) gene.
In order to determine the ability of a TALE-Nuclease to induce targeted
mutagenesis in UGPase gene (SEQ ID NO: 41) in diatoms, one engineered TALENuclease,
called UGP TALE-Nuclease encoded by the pCLS19745 (SEQ ID NO:
42) and pCLS19749 (SEQ ID NO: 43) plasmids designed to cleave the DNA
sequence 5'
TGCCGCCTTCGAGTCGACCTATGGTAGTCTCGTCTCGGGTGATTCCGGAA- 3'
(SEQ ID NO: 44) were used. These TALE-Nuclease encoding plasmids were cotransformed
with a plasmid conferring resistance to nourseothricin (NAT) in a wild
type diatom strain. The individual clones resulting from the transformation were
screened for the presence of mutagenic events which lead to UGPase gene
inactivation.
Materials and methods
Phaeodactylum tricornutum Bohlin clone CCMP2561 was grown and transformed
according to the method described in example 1 with M17 tungstene particles
( 1 . 1 m diameter, BioRad) coated with 9 g of a total amount of DNA composed of
1.5 g (experiment 2) or 3 g (experiment 1) of each monomer of TALE-Nucleases
(pCLS19745 and pCLS19749), 3 i g of the NAT selection plasmid (pCLS16604)
(SEQ ID NO: 3) and 3pg of an empty vector (pCLS0003) (SEQ ID NO: 4) using
1.25M CaCI2 and 20mM spermidin according to the manufacturer's instructions.
As a negative control, beads were coated with a DNA mixture containing 3mg of
the NAT selection plasmid (pCLS16604) and 6 g of an empty vector (pCLS0003)
(SEQ ID NO: 4).
Characterization
A-Colony screening
After selection, resistant colonies were picked and dissociated according to
method described in example 1. Supernatants were used for each PCR reaction.
Specific primers for TALE-Nuclease screens: TALE-Nuclease_For 5'-
AATCTCGCCTATTCATGGTG-3' (SEQ ID NO: 49) and HA_Rev 5'-
TAATCTGGAACATCGTATGGG-3' (SEQ ID NO: 50) and TALE-Nuclease_For 5 -
AATCTCGCCTATTCATGGTG - 3' (SEQ ID NO: 49) and STag_Rev 5'-
TGTCTCTCGAACTTGGCAGCG - 3 (SEQ ID NO: 51).
B-ldentification of mutagenic events
The UGPase target was amplified using a 1:5 dilution of the colony lysates with
sequence specific primers flanked by adaptators needed for HTS sequencing on a
454 sequencing system (454 Life Sciences) and the two following primers:
UGP_For 5'- CCATCTCATCCCTGCGTGTCTCCGACTCAG-Tag-
GTTGAATCGGAATCGCTAACTCG-3' (SEQ ID NO: 45) and UGP_Rev 5'-
CCTATCCCCTGTGTGCCTTGGCAGTCTCAG
GACTTGTTTGGCGGTCAAATCC-3' (SEQ ID NO: 46).
The PCR products were purified on magnetic beads (Agencourt AMPure XP,
Beckman Coulter) and quantified with a NanoDrop 1000 spectrophotometer
(Thermo Scientifioc). 50ng of the amplicons were denatured and then annealed in
10m I of the annealing buffer (10mM Tris-HCI pH8, 100mM NaCI, 1mM EDTA)
using an Eppendorf MasterCycle gradient PCR machine. The annealing program
is as follows: 95°C for 10 min; fast cooling to 85°C at 3°C/sec; and slow cooling to
25°C at 0.3°C/sec. The totality of the annealed DNA was digested for 15 min at
37°C with 0.5m I of the T7 Endonuclease I (IOU/ m I) (M0302, Biolabs) in a final
volume of 20m I (1X NEB buffer 2 , Biolabs). 10m I of the digestion were then loaded
on a 10% polyacrylamide MiniProtean TBE precast gel (BioRad). After migration
the gel was stained with SYBRgreen and scanned on a Gel Doc XR+ apparatus
(BioRad).
C-Measure of the mutagenesis frequency by Deep sequencing
The UGPase target was amplified with specific primers flanked by adaptators
needed for HTS sequencing on the 454 sequencing system (454 Life Sciences)
using the primer UGP_For 5'- GTTGAATCGGAATCGCTAACTCG-3' (SEQ ID NO:
47) and UGP_Rev 5'- GACTTGTTTGGCGGTCAAATCC -3' (SEQ ID NO: 48).
5000 to 10 000 sequences per sample were analyzed.
D- Phenotypic characterization of UDP KO clones by Bodipy labeling
Cells were re-suspended at the density of 5.105 cells/ml and washed twice in
culture medium (filtered Guillard's f/2 medium without silica). The bodipy labeling
was performed with 10mM of final concentration of Bodipy 493/503 (Molecular
Probe) in presence of 0% of DMSO during 10 minutes at room temperature in the
dark. The fluorescence intensity was measured by flow cytometry at 488nM
(MACSQuant Analyzer, Miltenyi Biotec).
Results
Three independent experiments were performed using the TALE-Nuclease
targeting the UGPase gene. For each of them, the presence of mutagenic events
in the clones obtained three weeks after diatoms transformation was analyzed.
For the first experiment, 8 clones were obtained in the condition corresponding to
diatoms transformed with TALE-Nuclease encoding plasmids (condition 1). Finally,
6 clones resulting from the transformation with the empty vector were obtained
(condition 2). The UGPase target amplification was performed on 12 clones
obtained in the condition 1 and 2 clones obtained in the condition 2 . On the 12
clones tested, 4 present a PCR band higher than expected showing a clear
mutagenic event, 1 presents no amplification of the UGPase target, 7 present a
band at the wild type size. A T7 assay was assessed on these 12 clones (Figure
12). One clone among them was positive in T7 assay which reflects the presence
of mutagenic events (Figure 13). As expected no signal was detected in the 2
clones from the condition corresponding to empty vector (condition 2).
For the second experiment, 62 clones were obtained in the condition
corresponding to diatoms transformed with TALE-Nuclease encoding plasmids
(condition 1). Among them, 36 were tested for the presence of the DNA
sequences encoding both TALE-Nuclease monomers. 11/36 (i.e. 30.5%) were
positive for both TALE-Nuclease monomers DNA sequences. Finally, 38 clones
resulting from the transformation with the empty vector were obtained (condition
2). The UGPase target amplification was performed on 1 clones obtained in the
condition 1 and 2 clones obtained in the condition 2 . On the 11 clones tested, 5
present no amplification of the UGPase target, 6 present a band at the wild type
size (Figure 14).
In order to identify the nature of the mutagenic event in the 4 clones displaying a
higher PCR amplification product from experiment 1 (Figure 12), we sequenced
these fragments. All of them present an insertion of 261 bp (37-5A3), 228bp (37-
7A1), 55bp (37-7B2) and 330bp (37-1 6A1), respectively leading to the presence of
stop codon in the coding sequence. The clone 37-3B4 presenting a positive signal
for T7 assay was characterized by Deep sequencing. The mutagenesis frequency
in this clone was 86% with several type of mutagenic event (either insertion or
deletion). An example of mutated sequences is presented in Figure 15.
To investigate the impact of UGPase gene inactivation on lipid content, a Bodipy
493/503 labeling (Molecular Probe) was performed on one clone harboring a
mutagenic event in the UGPase target (37-7A1 - CCAP 1055/12). In parallel, the
Phaeodactylum tricornutum wild type strain and one clone resulting from the
transformation with the empty vector were tested. The results are presented in
Figure 16. We observed an increase of the fluorescence intensity in the clone
presenting an inactivation of the UGPase gene compared to the two control
strains. This experiment was reproduced 3 times and a shift in the fluorescence
intensity was observed at each time. As Bodipy labeling reflects the lipid content of
the cells, these results demonstrated a robust and reproducible increase of the
lipid content of the mutated strains.
Thus, a TALE nuclease targeting the UGPase gene induces a reproducible (2
independent experiments), and at high frequency, targeted mutagenesis (up to
100%). Moreover, the inactivation of the UGPase gene leads to a strong and
reproducible increase of lipid content in bodipy labeling.
Example 10: Targeted mutagenesis induced by a TALE-Nuclease targeting a
putative elongase gene.
In order to investigate the ability of a TALE-Nuclease to induce targeted
mutagenesis in the putative elongase gene (SEQ ID NO: 52) in diatoms, one
engineered TALE-Nuclease, called elongase_TALE-Nuclease encoded by the
PCLS19746 (SEQ ID NO: 53) and pCLS19750 (SEQ ID NO: 54) plasmids
designed to cleave the DNA sequence 5'
TCTTTTCCCTCGTCGGCatgctccggacctttCCCCAGCTTGTACACAA - 3' (SEQ ID
NO: 55) was used. Although this TALE-nuclease targets a sequence coding a
protein with unknown function, this target present 86% of sequence identity with
the mRNA of the fatty acid elongase 6 (ELOVL6) in Taeniopygia guttata, and 86%
of sequence identity with the elongation of very long chain fatty acids protein 6-like
(LOC 100542840) in meleagris gallopavo.
These TALE-Nuclease encoding plasmids were co-transformed with a plasmid
conferring resistance to nourseothricin (NAT) in a wild type diatom strain. The
individual clones resulting from the transformation were screened for the presence
of mutagenic events which lead to elongase gene inactivation.
Materials and methods
Phaeodactylum tricornutum Bohlin clone CCMP2561 was grown and transformed
according to the methods described in example 1 with M 7 tungstene particles
( 1 . 1 m diameter, BioRad) coated with 9 g of a total amount of DNA composed of
1.5 g of each monomer of TALE-Nucleases (pCLS19746 (SEQ ID NO: 53) and
pCLS19750 (SEQ ID NO: 54)), 3 g of the NAT selection plasmid (pCLS16604)
(SEQ ID NO: 3) and 3 g of an empty vector (pCLS0003) (SEQ ID NO: 4) using
1.25M CaCI2 and 20mM spermidin according to the manufacturer's instructions.
Characterization
A-Colony screening
After selection, resistant colonies were picked and dissociated according to the
method described in example 1. Supernatants were used were used for each PCR
reaction. Specific primers for TALE-Nuclease screens: TALE-Nuclease_For 5'-
AATCTCGCCTATTCATGGTG-3' (SEQ ID NO: 49) and HA_Rev 5'-
TAATCTGGAACATCGTATGGG-3' (SEQ ID NO: 50). TALE-Nuclease_For 5'-
AATCTCGCCTATTCATGGTG - 3' (SEQ ID NO: 49) and S-Tag_Rev 5'-
TGTCTCTCGAACTTGGCAGCG - 3' (SEQ ID NO: 51).
B-ldentification of mutagenic event
The elongase target was amplified using a 1:5 dilution of the lysis colony with
sequence specific primers flanked by adaptators needed for HTS sequencing on
the 454 sequencing system (454 Life Sciences) and the two following primers:
elongase_For 5'- CCATCTCATCCCTGCGTGTCTCCGACTCAG-Tag-
AAGCGCATCCGTTGGTTCC-3' (SEQ ID NO: 56) and elongase_Rev 5'-
CCTATCCCCTGTGTGCCTTGGCAGTCTCAG
TCAATGAGTTCACTGGAAAGGG -3' (SEQ ID NO: 57).
The PCR products were purified on magnetic beads (Agencourt AMPure XP,
Beckman Coulter) and quantified with a NanoDrop 1000 spectrophotometer
(Thermo Scientifioc). 50ng of the amplicons were denatured and then annealed in
0m I of annealing buffer (10mM Tris-HCI pH8, 100mM NaCI, 1mM EDTA) using an
Eppendorf MasterCycle gradient PCR machine. The annealing program is as
follows: 95°C for 10 min; fast cooling to 85°C at 3°C/sec; and slow cooling to 25°C
at 0.3°C/sec. The totality of the annealed DNA was digested for 15 min at 37°C
with 0.5 m I of the T7 Endonuclease I (IOU/ m I) (M0302 Biolabs) in a final volume of
20m I (1X NEB buffer 2 , Biolabs). 10m I of the digestion were then loaded on a 10%
polyacrylamide MiniProtean TBE precast gel (BioRad). After migration the gel was
stained with SYBRgreen and scanned on a Gel Doc XR+ apparatus (BioRad).
C-Measure of the mutagenesis frequency by Deep sequencing
The elongase target was amplified with sequence specific primers flanked by
adaptators needed for HTS sequencing on the 454 sequencing system (454 Life
Sciences) using the primer elongase_For 5'- AAGCGCATCCGTTGGTTCC -3'
(SEQ ID NO: 58) and Delta 6 elongase_Rev 5'- TCAATGAGTTCACTGGAAAGGG
-3' (SEQ ID NO: 59). 5000 to 10 000 sequences per sample were analyzed.
Results
Three weeks after the transformation of the diatoms, 62 clones were obtained in
the condition corresponding to the transformation performed with the TALENuclease
encoding plasmids (condition 1). Among them, 35 were tested for the
presence of both TALE-Nuclease monomers DNA sequences. 11/27 (i.e. 40.7%)
were positive for both TALE-Nuclease monomers DNA sequences. Finally, 38
clones resulting from the transformation with the empty vector were obtained
(condition 2).
The 1 clones, positive for both TALE-Nuclease monomers DNA sequences were
tested with the T7 assay. The Phaeodactylum tricornutum strain, as well as four
clones resulting from the transformation with the empty vector, were tested in
parallel. Four clones presented no amplification. Because the amplification of
another locus is possible, the quality of the lysates is not questioned. So the
absence of amplification could suggest the presence of a large mutagenic event at
the elongase locus. One clone showed in equal proportions a PCR product at the
expected size and another one with a higher weight, actually demonstrating a
clear mutagenic event (Figure 17). One clone was positive in the T7 assay, which
reflects the presence of mutagenic events and 9 clones presented no signal in the
T7 assay. As expected no signal was detected in the condition corresponding to
the empty vector or the Phaeodactylum tricornutum wild type strain.
In order to identify the nature of the mutagenic event in the clone displaying a
higher PCR amplification product, we sequenced this fragment. An insertion of 83
bp was detected leading to presence of stop codon in the coding sequence. The
clone presenting a positive T7 signal was characterized by Deep sequencing. The
mutagenesis frequency in this clone was 5.9% with one type of mutation (deletion
of 22bp). An example of mutated sequences is presented in Figure 18.
REFERENCES:
Apt, K. E., P. G. Kroth-Pancic, et al. ( 1996). "Stable nuclear transformation of the
diatom Phaeodactylum tricornutum." Mol Gen Genet 252(5) : 572-9.
Arimondo, P. B., C. J. Thomas, et al. (2006). "Exploring the cellular activity of
camptothecin-triple-helix-forming oligonucleotide conjugates." Mol Cell Biol
26(1) : 324-33.
Armbrust, E. V., J . A. Berges, et al. (2004). "The genome of the diatom Thalassiosira
pseudonana: ecology, evolution, and metabolism." Science 306(5693): 79-86.
Arnould, S., C. Delenda, et al. (201 1). "The l-Crel meganuclease and its engineered
derivatives: applications from cell modification to gene therapy." Protein Eng
Des Se 24(1-2): 27-31 .
Baulcombe, D. (2004). "RNA silencing in plants." Nature 431 (7006): 356-63.
Boch, J., H. Scholze, et al. (2009). "Breaking the code of DNA binding specificity of
TAL-type III effectors." Science 326(5959): 1509-12.
Bowler, C , A. E. Allen, et al. (2008). "The Phaeodactylum genome reveals the
evolutionary history of diatom genomes." Nature 456(7219): 239-44.
Cannata, F., E. Brunet, et al. (2008 ) . "Triplex-forming oligonucleotideorthophenanthroline
conjugates for efficient targeted genome modification."
Proc Natl Acad Sci U S A 105(28): 9576-81 .
Christian, M., T. Cermak, et al. (2010). "Targeting DNA double-strand breaks with
TAL effector nucleases." Genetics 186(2) : 757-61 .
Critchlow, S. E. and S. P. Jackson (1998). "DNA end-joining: from yeast to man."
Trends Biochem Sci 23(10): 394-8.
Depicker, A. and M. V. Montagu (1997). "Post-transcriptional gene silencing in
plants." Curr Opin Cell Biol 9(3): 373-82.
Dunahay, T. G., E. E. Jarvis, et al. (1995). "Genetic transformation of the diatoms
Cyclotella Cryptica and Navicula Saprophila." Journal of Phvcology 3 1(6):
1004-1012.
Eisenschmidt, K., T. Lanio, et al. (2005 ) . "Developing a programmed restriction
endonuclease for highly specific DNA cleavage." Nucleic Acids Res 33(22):
7039-47.
Falciatore, A., R. Casotti, et al. (1999). "Transformation of Nonselectable Reporter
Genes in Marine Diatoms." Mar Biotechnol (NY) 1(3): 239-251 .
Galetto, R., P. Duchateau, et al. (2009). "Targeted approaches for gene therapy and
the emergence of engineered meganucleases." Expert Opin Biol Ther 9(10):
1289-303.
Gruber, A., S. Vugrinec, et al. (2007). "Protein targeting into complex diatom plastids:
functional characterisation of a specific targeting motif." Plant Mol Biol 64(5):
519-30.
Hallmann, A. (2007). "Algal transgenics and biotechnology." Transgenic Plant
Journal, Global Science Boks.
Kilian, O. and P. G. Kroth (2005). "Identification and characterization of a new
conserved motif within the presequence of proteins targeted into complex
diatom plastids." Plant J 4 1(2): 175-83.
Lusic, I., V. Radonic, et al. (2006). "Is C-reactive protein a better predictor of
recurrent carotid disease following carotid endarterectomy than established
risk factors for atherosclerosis?" Vasa 35(4): 221-5.
Ma, J . L , E. M. Kim, et al. (2003). "Yeast Mre1 1 and Rad1 proteins define a Kuindependent
mechanism to repair double-strand breaks lacking overlapping
end sequences." Mol Cell Biol 23(23): 8820-8.
Maliga, P. (2004). "Plastid transformation in higher plants." Annu Rev Plant Biol 55:
289-31 3.
Marcaida, M. J., J. Prieto, et al. (2008). "Crystal structure of l-Dmol in complex with
its target DNA provides new insights into meganuclease engineering." Proc
Natl Acad Sci U S A 105(44): 16888-93.
Marenkova, T. V. and E. V. Deineko (2010). "[Transcriptional gene silencing in
plants]." Genetika 46(5): 581-92.
Mogedas, B., C. Casal, et al. (2009). "beta-carotene production enhancement by UVA
radiation in Dunaliella bardawil cultivated in laboratory reactors." J Biosci
Bi en 108 (1) : 47-51 .
Moscou, M. J. and A. J. Bogdanove (2009). "A simple cipher governs DNA
recognition by TAL effectors." Science 326 (5959): 1501 .
Palmer, J. D., D. E. Soltis, et al. (2004). "The plant tree of life: an overview and some
points of view." Am J Bot 91( 10): 1437-45.
Paques, F. and P. Duchateau (2007). "Meganucleases and DNA double-strand
break-induced recombination: perspectives for gene therapy." Curr Gene Ther
7(1): 49-66.
Porteus, M. H. and D. Carroll (2005). "Gene targeting using zinc finger nucleases."
Nat Biotechnol 23(8): 967-73.
Potvin, G. and Z. Zhang (2010). "Strategies for high-level recombinant protein
expression in transgenic microalgae: a review." Biotechnol Adv 28(6): 910-8.
Simon, P., F. Cannata, et al. (2008). "Sequence-specific DNA cleavage mediated by
bipyridine polyamide conjugates." Nucleic Acids Res 36(11): 3531-8.
Steinbrenner, J. and G. Sandmann (2006). "Transformation of the green alga
Haematococcus pluvialis with a phytoene desaturase for accelerated
astaxanthin biosynthesis." Appl Environ Microbiol 72(12): 7477-84.
Stoddard, B. L , R. J. Monnat, et al. (2007). "Advances in engineering homing
endonucleases for gene targeting : ten years after structures." Progress in
Gene Therapy: Autologous : 135-167.
Tyler, B. M., S. Tripathy, et al. (2006). "Phytophthora genome sequences uncover
evolutionary origins and mechanisms of pathogenesis." Science 313 (5791):
1261-6.
Zaslavskaia, L. A., J. C. Lippmeier, et al. (2001). "Trophic conversion of an obligate
photoautotrophic organism through metabolic engineering." Science
292 (5524): 2073-5.
CLAIMS
1. A method for targeted modification of the genetic material of an algal cell
comprising the steps of:
a) selecting a nucleic acid target sequence in the genome of an algal cell;
b) designing a gene encoding a rare-cutting endonuclease to target this
sequence;
c) transfecting algal cells with one or more vectors comprising said gene
encoding said rare-cutting endonuclease to obtain its expression within said
cell over several generations;
d) selecting the cell progeny of said algal cells having a modified target
sequence.
2 . A method for targeted modification according to claim 1, wherein said method
further comprises:
selecting the transfected algae in which said gene encoding said
endonuclease has been stably integrated into the genome
3. A method of claim 1 or 2 wherein said method further comprises:
obtaining mosaic clones comprising cells in which said target sequence
contains different types of modifications.
4 . A method for targeted modification according to any one of claims 1 to 3,
wherein said method comprises transfecting said algal cell with a donor matrix
containing a transgene.
5. A method according to claim 4 , wherein said modification is a knock-in event
of said transgene introduced by homologous recombination with the donor matrix.
6 . The method according to any one of claims 1 to 5, wherein said rare-cutting
endonuclease is a homing endonuclease.
7. The method of claim 6 wherein said homing endonuclease is an engineered ICrel.
8. The method according to any one of claims 1 to 5 wherein said rare-cutting
endonuclease is an engineered nucleic acid binding domain fused to an
endonuclease.
9. The method of claim 8, wherein said engineered binding domain is a TAL
effector-like domain or a zinc finger domain.
0 . The method of claim 9, wherein said endonuclease is selected from the group
consisting of: Fokl, l-Tevl, NucA and ColE7.
11. The method according to any one of claims 1 to 5, wherein said rare-cutting
endonuclease is a monomeric TALE-Nuclease.
12. The method according to any one of claims 1 to 11, wherein said one or more
vectors used in step c) further comprises a selectable marker and said method
further comprises selection of transfected algal cells under pressure of a selective
agent.
13. The method according to any one of claims 1 to 1, wherein said one or more
vectors used in step c) further comprises a selectable marker included on a different
vector and said method further comprises selection of transfected algal cells under
pressure of a selective agent
14. The method of claim 12 or 13, wherein said selectable marker is Nacetyltransferase
1 gene (Natl) conferring the resistance to Nourseothricin.
5. The method of claim 12 or 13, wherein said selectable markers are selected
from the group consisting of: Zeocin/Phleomycin and blastidicidin resistance gene.
16. The method according to any one of claims 1 to 15, wherein said gene
encoding said rare-cutting endonuclease is placed under control of an inducible
promoter.
17. The method according to any one of claims 1 to 16, wherein said algal cell is
transformed by a method selected from the group consisting of: electroporation and
bombardment methods.
18. The method according to any one of claims 17 wherein algae are selected
from the group consisting of Anabaena, Anikstrodesmis, Botryococcus,
Chlamydomonas, Chlorella, Chlorococcum, Dunaliella, Emiliana, Euglena,
Hematococcus, Isochrysis, Monochrysis, Monoraphidium, Nannochloris,
Nannnochloropsis, Nephrochloris, Nephroselmis, Nodularia, Nostoc, Oochromonas,
Oocystis, Oscillartoria, Pavlova, Playtmonas, Pleurochrysis, Porhyra,
Pseudoanabaena, Pyramimonas, Stichococcus, Synechococcus, Synechocystis,
Tetraselmis, and Trichodesmium.
9. The method of claim according to any one of claims 1 to 16, wherein the algae
are diatoms.
20. The method of claim 19, wherein diatoms are selected from the group
consisting of: Phaeodactylum, Fragilariopsis, Thalassiosira, Coscinodiscus,
Arachnoidiscusm, Aster omphalus, Navicula, Chaetoceros, Chorethron,
Cylindrotheca fusiformis, Cyclotella, Lampriscus, Gyrosigma, Achnanthes,
Cocconeis, Nitzschia, Amphora, and Odontella.
2 1. The method according to any one of claims 1 to 20, wherein the mutagenesis
is increased by transfecting the cell with a transgene coding for a catalytic domain
having exonuclease activity.
22. The method of claim 2 1, wherein said catalytic domain has 3'-5' exonuclease
activity.
23. The method of claim 2 1, wherein said catalytic domain has TREX exonuclease
activity.
24. The method of claim 2 1, wherein said catalytic domain has TREX2 activity.
25. The method of claim 24, wherein said catalytic domain is encoded by a single
chain TREX2 polypeptide.
26. The method according to any one of claims 2 1 to 25, wherein said additional
catalytic domain is fused to said rare-cutting endonuclease, optionally by a peptide
linker.
27. The method according to claims 1 to 26, which comprises a further step of
inactivating the gene encoding the rare-cutting endonuclease in the modified progeny
cells.
28. The method according to claims 1 to 27, which comprises selecting the algal
cells that display modifications in the target gene, in multi-copy genes or more than
one allele.
29. A genetically modified algal cell obtained by the method of any one of claims 1
to 28.
30. A genetically modified algal cell of claim 29 in which a UDP-glucose
pyrophosphorylase gene is inactivated.
3 1. The genetically modified algal cell of claim 30 wherein said UDP-glucose
pyrophosphorylase gene has at least 80% identity sequence with SEQ ID NO: 4 1.
32. The genetically modified algal cell of claim 30 or 3 1 obtained using a TALEnuclease.
33. The genetically modified algal cell of claim 32, wherein the TALE-nuclease
targets a sequence of SEQ ID NO: 44.
34. The genetically modified algal cell of claim 33, which is a Phaeodactylum
tricornutum strain as deposited within the Culture Collection of Algae and Protozoa
(CCAP, Scottish Marine Institute, Oban, Argyll PA34 1QA, Scotland) on May 29th,
2013 under CCAP 1055/12 and depositor's strain number pt-37-7A1 .
35. The genetically modified algal cell of claim 29 in which a putative elongase
gene is inactivated.
36. The genetically modified algal cell of claim 35, wherein said putative elongase
gene has at least 80% identity sequence with SEQ ID NO: 52.
37. The genetically modified algal cell of claim 35 or 36 obtained using a TALEnuclease.
38. The genetically modified algal cell of claim 37, wherein the TALE-nuclease
targets a sequence of SEQ ID NO: 55.
39. A genetically modified algal cell of claim 38 which is a phaeodactylum
tricornutum as deposited within the Culture Collection of Algae and Protozoa (CCAP,
Scottish Marine Institute, Oban, Argyll PA34 1QA, Scotland) on May 29th, 2013 under
CCAP 1055/13 and depositor's strain number pt-42-1 1B5.
40. A genetically modified algal cell, characterized in that its genome comprises
targeted modification in several alleles or homologous genes.
4 1. A genetically modified algal cell, characterized in that its genome comprises a
transgene encoding a TALE-Nuclease.
42. A genetically modified algal cell, characterized in that its genome comprises
transgenes encoding a TALE-Nuclease and a TREX exonuclease.
43. A genetically modified algal cell, characterized in that its genome comprises
transgenes encoding a meganuclease and a TREX exonuclease.
44. A genetically modified algal cell, characterized in that its genome comprises a
TALE-Nuclease-induced targeted modification.
45. The genetically modified algal cell according to any one of claims 29 to 34,
wherein its genome includes a gene encoding a rare-cutting endonuclease which
expression is under control of inducible promoter.
| # | Name | Date |
|---|---|---|
| 1 | Form 5.pdf | 2015-05-18 |
| 2 | Form 3.pdf | 2015-05-18 |
| 3 | Form 2, Description and Abstract.pdf | 2015-05-18 |
| 4 | Drawings.pdf | 2015-05-18 |
| 5 | 418289WOSequenceListing.txt | 2015-05-18 |
| 6 | 4148-DELNP-2015.pdf | 2015-05-20 |
| 7 | 4148-delnp-2015-PCT-(22-05-2015).pdf | 2015-05-22 |
| 8 | 4148-delnp-2015-Correspondence Others-(22-05-2015).pdf | 2015-05-22 |
| 9 | 4148-delnp-2015-GPA-(13-08-2015).pdf | 2015-08-13 |
| 10 | 4148-delnp-2015-Form-1-(13-08-2015).pdf | 2015-08-13 |
| 11 | 4148-delnp-2015-Correspodence Others-(13-08-2015).pdf | 2015-08-13 |
| 12 | 4148-delnp-2015-Form-3-(16-10-2015).pdf | 2015-10-16 |
| 13 | 4148-delnp-2015-Correspondence Others-(16-10-2015).pdf | 2015-10-16 |
| 14 | Power of Attorney [18-11-2015(online)].pdf | 2015-11-18 |
| 15 | Form 6 [18-11-2015(online)].pdf | 2015-11-18 |
| 16 | Assignment [18-11-2015(online)].pdf | 2015-11-18 |
| 17 | 4148-delnp-2015-GPA-(19-11-2015).pdf | 2015-11-19 |
| 18 | 4148-delnp-2015-Form-5-(19-11-2015).pdf | 2015-11-19 |
| 19 | 4148-delnp-2015-Form-2-(19-11-2015).pdf | 2015-11-19 |
| 20 | 4148-delnp-2015-Form-1-(19-11-2015).pdf | 2015-11-19 |
| 21 | 4148-delnp-2015-Correspondence Others-(19-11-2015).pdf | 2015-11-19 |
| 22 | 4148-delnp-2015-Copy Form-6-(19-11-2015).pdf | 2015-11-19 |
| 23 | 4148-delnp-2015-Assignment-(19-11-2015).pdf | 2015-11-19 |
| 24 | Other Document [08-11-2016(online)].pdf | 2016-11-08 |
| 25 | Marked Copy [08-11-2016(online)].pdf | 2016-11-08 |
| 26 | Form 18 [08-11-2016(online)].pdf | 2016-11-08 |
| 27 | Form 13 [08-11-2016(online)].pdf | 2016-11-08 |
| 28 | Description(Complete) [08-11-2016(online)].pdf | 2016-11-08 |
| 29 | 4148-DELNP-2015-FER.pdf | 2019-11-16 |
| 1 | search_07-11-2019.pdf |