Sign In to Follow Application
View All Documents & Correspondence

Method For Treating Non Small Cell Lung Cancer

Abstract: The present invention provides methods for treating a human patient afflicted with unresectable advanced or metastatic non small cell lung cancer comprising periodically administering to the human patient chemotherapy comprising an amount of docetaxel; and 640mg of an anti clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (SEQ ID NO: 1 ) wherein the anti clusterin oligonucleotide has a phosphorothioate backbone throughout has sugar moieties of nucleotides 1 4 and 18 21 bearing 2 0 methoxyethyl modifications has nucleotides 5 17 which are 2 deoxynucleotides and has 5 methylcytosines at nucleotides 1 4 and 19 thereby treating the human patient afflicted with unresectable advanced or metastatic non small cell lung cancer. The present invention also provides compositions and combinations packages and uses thereof for treating a human patient afflicted with unresectable advanced or metastatic non small cell lung cancer.

Get Free WhatsApp Updates!
Notices, Deadlines & Correspondence

Patent Information

Application #
Filing Date
05 December 2014
Publication Number
33/2015
Publication Type
INA
Invention Field
BIO-CHEMISTRY
Status
Email
Parent Application

Applicants

TEVA PHARMACEUTICAL INDUSTRIES LTD.
5 Basel Street P.O. Box 3190 Petach Tikva 49131

Inventors

1. DUKSIN Chen
5 Romema Street Tel Aviv 69419
2. TESSLER Shoshi
Hanotrim 24 Zichron Yaacov

Claims

10. The method of any one of claims 1 to 9 , wherein the anticlusterin oligonucleotide is administered to the human patient intravenously in an aqueous solution comprising sodium ions .

11. The method of claim 10, wherein the anti-clusterin oligonucleotide is administered to the human patient 3 times within a 5 to 9 day period before the first day of chemotherapy and then once weekly beginning on the first day of chemotherapy.

12. The method of any one of claims 1 to 11, wherein the lung cancer is nonresectable, advanced or metastatic non-small cell lung cancer.

13. The method of any one of claims 1 to 12, wherein the human patient has not received treatment for non-small cell lung cancer for at least 1 year.

14. The method of any one of claims 1 to 13, wherein the human patient has not received a chemotherapeutic agent for the treatment of non-small cell lung cancer for at least 1 year.

15. The method of any one of claims 1 to 14, wherein the human patient has before initiation of the periodic administration received a chemotherapeutic agent for the treatment of lung cancer.

16. The method of claim 15, wherein the che herapeuti agent was a platinum-based chemotherapeutic agent.

17. The method of any one of claims 1 to 16, wherein the human patient is afflicted with Stage IV non-small cell lung cancer.

18. The method of any one of claims 1 to 17, wherein the human patient is afflicted with non-small cell lung cancer of non-squamous histology.

19. The method of any one of claims 1 to 18, further comprising the steps of: i ) measuring the level of serum clusterin present in the blood of the human patient prior to the administration of the anti-clusterin oligonucleotide; ii) determining whether the level of serum clusterin present in the human patient is lower than a predetermined upper threshold level of baseline serum clusterin below which a human patient is likely to substantially benefit from anti-clusterin therapy; and iii) administering the anti-clusterin oligonucleotide only if the level of serum clusterin present in the blood of the human patient is lower than the predetermined upper threshold level of baseline serum clusterin.

20. The method of claim 19, wherein in step i ) the measuring is performed after initiation of the chemotherapy.

21. The method of claim 19, wherein the predetermined upper threshold level of baseline serum clusterin is 75pg/mL.

22. The method of any one of claims 1 to 21, further comprising the steps o : i ) administering to the human patient the ant iclusterin oligonucleotide in an initial dosage and treatment protocol; ii) thereafter testing the human patient to determine a level of serum clusterin after a period of treatment with the anti-clusterin oligonucleotide intended to reduce clusterin expression; iii) determining an adjusted dosage and treatment protocol based on the determined level of serum clusterin; and iv) administering to the human patient the anticlusterin oligonucleotide in accordance with the adjusted dosage and treatment protocol. The method of claim 22 , wherein the determined level of serum clusterin after a period of treatment with the anti-clusterin oligonucleotide intended to reduce clusterin expression is above a predetermined post anticlusterin oligonucleotide initiation threshold level . The method of claim 22 or 23, wherein the predetermined post anti-clusterin oligonucleotide initiation threshold level is 30 g/m . The method of any one of claims 22 to 24, wherein the adjusted dosage and treatment protocol comprises administration of the anti-clusterin oligonucleotide to the human patient two or three times per week. A combination for treating a human patient afflicted with unresectable, advanced or metastatic non-small cell lung cancer, comprising chemotherapy comprising docetaxel; and an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1), wherein the anticlusterin oligonucleotide has a phosphorothioate backbone throughout, has sugar moieties of nucleotides 1-4 and 18- 21 bearing 2 '-O-methoxyethyl modifications, has nucleotides 5-17 which are 2 'deoxynucleotides , and has 5- methylcytosines at nucleotides 1 , 4 , and 19. 27 . A composition for treating a human patient afflicted with unresectable, advanced or metastatic non-small cell lung cancer, comprising chemotherapy comprising docetaxel; and an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No. : 1), wherein the anticlusterin oligonucleotide has a phosphorothioate backbone throughout, has sugar moieties of nucleotides 1-4 and 18- 21 bearing 2 '-O-methoxyethyl modifications, has nucleotides 5-17 which are 2 'deoxynucleotides, and has 5- methylcytosines at nucleotides 1 , 4 , and 19.

28. A pharmaceutical composition for treating a human patient afflicted with unresectable, advanced or metastatic nonsmall cell lung cancer, the composition comprising chemotherapy comprising docetaxel; and an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No. : 1 ) , wherein the anti-clusterin oligonucleotide has a phosphorothioate backbone throughout, has sugar moieties of nucleotides 1-4 and 18- 21 bearing 2 '-O-methoxyethyl modifications, has nucleotides 5-17 which are 'deoxynucleotides, and has 5- methylcytosines at nucleotides 1 , 4 , and 19.

29. Use of a composition comprising chemotherapy comprising docetaxel; and an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1), wherein the anti-clusterin oligonucleotide has a phosphorothioate backbone throughout, has sugar moieties of nucleotides 1-4 and 18-21 bearing 2 '-O-methoxyethyl modifications, has nucleotides 5-17 which are 2'deoxynucleotides , and has 5-methylcytosines at nucleotides 1 , 4 , and 19, for treatment of a human patient afflicted with unresectable, advanced or metastatic non-small cell lung cancer.

30. Use of a composition comprising chemotherapy comprising docetaxel; and an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1), wherein the anti-clusterin oligonucleotide has a phosphorothioate backbone throughout, has sugar moieties of nucleotides 1-4 and 18-21 bearing 2 '-O-methoxyethyl modifications, has nucleotides 5-17 which are 2 'deoxynucleotides, and has 5-methylcytosines at nucleotides 1 , 4 , and 19, for preparation of a medicament for treatment of a human patient afflicted with unresectable, advanced or metastatic non-small cell lung cancer .

31. A package for use in the treatment of a human patient afflicted with unresectable, advanced or metastatic nonsmall cell lung cancer, comprising chemotherapy comprising docetaxel; and an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1), wherein the anti-clusterin oligonucleotide has a phosphorothioate backbone throughout, has sugar moieties of nucleotides 1-4 and 18- 21 bearing 2'-O-methoxyethyl modifications, has nucleotides 5-17 which are 'deoxynucleotides , and has 5- methylcytosines at nucleotides 1 , 4 , and 19, and instructions for the use of the chemotherapy in combination with the anti-clusterin oligonucleotide for the treatment of unresectable, advanced or metastatic non-small cell lung cancer.

32. A chemotherapy comprising docetaxel for use in combination with an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1), wherein the anti-clusterin oligonucleotide has a phosphorothioate backbone throughout, has sugar moieties of nucleotides 1-4 and 18-21 bearing 2 '-O-methoxyethyl modifications, has nucleotides 5-17 which are 2 'deoxynucleotides , and has 5-methylcytosines at nucleotides 1 , 4 , and 19, for treating of a human patient afflicted with unresectable, advanced or metastatic nonsmall cell lung cancer; or an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT !Seq. ID No.: 1), wherein the anti-clusterin oligonucleotide has a phosphorothioate backbone throughout, has sugar moieties of nucleotides 1-4 and 18- 21 bearing 2 '-O-methoxyethyl modifications, has nucleotides 5-17 which are 2 'deoxynucleotides , and has 5- methylcytosines at nucleotides 1 , 4 , and 19, for use in combination with a chemotherapy comprising docetaxel, for treating of a human patient afflicted with unresectable, advanced or metastatic non-small cell lung cancer.

Specification

Throughout this application, various publications are referenced,
including referenced in parenthesis. Pull citations for publications
referenced in parenthesis may be found listed in alphabetical order
at the end of the specification immediately preceding the claims.
The disclosures of all referenced publications in their entireties
are hereby incorporated by reference into this application in order
to more fully describe the state of the art to which this invention
pertains.
Background of Invention
Lung cancer was the most commonly diagnosed cancer as well as a
leading cause of cancer death in males in 2008 globally. Among
females, it was the fourth most commonly diagnosed cancer and the
second leading cause of cancer death. Worldwide, lung cancer
accounted for 13% (1.6 million) of the total cases and 18% (1.4
million) of the cancer deaths in 2008. The majority of lung
neoplasms are non-small cell lung cancers (NSCLC) (Jemal et a .,
2011; D'Addario et al., 2010). First-line chemotherapy regimens for
NSCLC often comprise the platinum doublet, which means adding a
second chemotherapy drug (paclitaxel, pemetrexed, gemcitabine,
vinorelbine, etc.) to a platinum based drug (cisplatin or
carboplatin) (D'Addario et al., 2010,- National Comprehensive Cancer
Network Clinical Practice Guidelines in Oncology, Non-Small Cell
Lung Cancer, V .2 .2010). Reported median survival among these
doublets does not differ dramatically, and is in the range of
approximately 8-10 months (D'Addario et al., 2010; National
Comprehensive Cancer Network Clinical Practice Guidelines in
Oncology, Non-Small Cell Lung Cancer, V .2 .2010). Despite the
availability of several active chemotherapeutic agents, long-term
survival rates remain <15% in these patients (D'Addario et al., 2010;
National Comprehensive Cancer Network Clinical Practice Guidelines
in Oncology, Non-Small Cell Lung Cancer, V .2 .2010). Therefore,
treatments that significantly prolong the survival o f patients
afflicted with NSCLC are needed.
Clusterin is a secretable cytoprotective protein that is upregulated
in response to a number of tumor cell killing interventions,
specifically chemotherapy, hormone ablation therapy and radiation
therapy. As described in U.S. Patent Application Publication No.
2008/0119425, the contents of which are incorporated herein by
reference, clusterin is expressed in many malignancies including
NSCLC, as well as prostate cancer, bladder cancer, ovarian cancer,
renal cancer, melanoma, and pancreatic cancer.
Custirsen is a second-generation antisense oligonucleotide that
inhibits clusterin expression. Custirsen is designed specifically to
bind to a portion of clusterin m A , resulting in the inhibition of
the production of clusterin protein. The structure of custirsen is
available, for example, in U.S. Patent No. 6,900,187, the contents of
which are incorporated herein by reference. A broad range of studies
have shown that custirsen potently reduces the expression of
clusterin, facilitates apoptosis, and sensitizes cancerous human
prostate, breast, ovarian, lung, renal, bladder, and melanoma cells
to chemotherapy (Miyake et a . 2005), see also, U.S. Patent
Application Publication No. 2008/0119425 Al, the contents of which
are incorporated herein by reference.
Paclitaxel, Docetaxel and Carboplatin
Paclitaxel and docetaxel are mitotic inhibitors that are used as
chemotherapeutic agents in the treatment of cancer (Rowinsky et al.,
1990) . They belong to a class of drugs called taxanes, and act by
stabilizing microtubules, thus disrupting their function during cell
division (Kuriyama, 1986; Rowinsky et al., 1990).
Carboplatin is an alkylating agent that acts by interacting with DNA,
which interferes with cellular repair mechanisms, ultimately
resulting in cell death (Knox et al., 1986; Teicher et al., 1989).
Carboplatin belongs to a class of drugs called platinum-based
chemotherapeutics .
Combination Therapy
Clinical studies have described the combination of
carboplatin/paclitaxel with agents such as bevacizumab or cetuximab
for the treatment of NSCLC (Sandler et al ., 2006; Pirker et al.,
2009); however, treatment of NSCLC with a combination of
carboplatin/paclitaxel and an antisense oligonucleotide has not been
attempted. Furthermore, such a combination has not been described for
the treatment of populations consisting of patients with Stage IV
NSCLC or NSCLC of non- squamous histology.
The administration of multiple drugs to treat a given condition, such
as NSCLC, raises a number of potential problems. In vivo interactions
between multiple drugs are complex. The effects of any single drug
are related to its absorption, distribution, and elimination. hen
multiple drugs are introduced into the body, each drug can affect the
absorption, distribution, and elimination of the other and hence,
alter he effects of the other. For instance,, one drug may inhibit,
activate or induce the production of enzymes involved in a metabolic
route of elimination of another drug (Guidance for Industry, 1999) .
Thus, when two drugs are administered to treat the same condition, it
is unpredictable whether each will complement, have no effect on, or
interfere with, the therapeutic activity of the other in a human
patient .
Not only may the interaction between multiple drugs affect the
intended therapeutic activity of each drug, but the interaction may
increase the levels of toxic metabolites (Guidance for Industry,
1999) . The interaction may also heighten or lessen the side effects
of each drug. Hence, upon administration of two drugs to treat a
disease, it is unpredictable what change will occur in the negative
side profile of each drug.
Additionally, it is difficult to accurately predict when the effects
of the interaction between the multiple drugs will become manifest.
For example, metabolic interactions between drugs may become apparent
upon the initial administration of the second drug, after the two
have reached a steady-state concentration or upon discontinuation of
one of the drugs (Guidance for Industry, 1999) .
Thus, the success of one drug or each drug alone in an in vitro
model, an animal model, or in humans, may not correlate into
efficacy of the administration of a combination of the drugs
together .
S m ary of th Invention
The present invention provides a method of treating a human patient
afflicted with unresectable, advanced or metastatic non-small cell
lung cancer comprising periodically administering to the human
patient chemotherapy comprising an amount of a taxane, and 640mg of
an anti-clusterin oligonucleotide having the sequence
CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1), wherein the anti-clusterin
oligonucleotide has a phosphorothioate backbone throughout, has
sugar moieties of nucleotides 1-4 and 18-21 bearing 2'-0-
methoxyethyl modifications, has nucleotides 5-17 which are
2 'deoxynucleotides, and has -methyl cytosines at nucleotides 1 , 4 ,
and 19, thereby treating the human patient afflicted with
unresectable, advanced or metastatic non-small cell lung cancer.
The present invention also provides a combination for treating a
human patient afflicted with unresectable, advanced or metastatic
non-small cell lung cancer, comprising chemotherapy comprising a
taxane and an anti-clusterin oligonucleotide having the sequence
CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1), wherein the anti-clusterin
oligonucleotide has a phosphorothioate backbone throughout, has
sugar moieties of nucleotides 1-4 and 18-21 bearing 2'-0-
methoxyethyl modifications, has nucleotides 5-17 which are
'deoxynucleotides, and has 5-methylcytosines at nucleotides 1 , 4 ,
and 19. In some embodiments, the combination is for treating a human
patient afflicted with non-small cell lung cancer of non-squamous
histology or Stage IV non-small cell lung cancer.
The present invention also provides a composition for treating a
human patient afflicted with unresectable, advanced or metastatic
non-small cell lung cancer, comprising chemotherapy consisting of a
taxane and, optionally, a platinum-based Chemotherapeutic agent; and
an anti-clusterin oligonucleotide having the sequence
CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1), wherein the anti-clusterin
oligonucleotide has a phosphorothioate backbone throughout, has
sugar moieties of nucleotides 1-4 and 18-21 bearing 2'-0-
methoxyethyl modifications, has nucleotides 5-17 which are
2 'deoxynucieotides, and has 5-methylcytosines at nucleotides 1 , 4 ,
and 19. In some embodiments, the composition is for treating a human
patient afflicted with non-small cell lung cancer of non-squamous
histology or Stage IV non-small cell lung cancer.
The present invention also provides a pharmaceutical composition for
treating a human patient afflicted with unresectable, advanced or
metastatic non- small cell lung cancer, the composition comprising
chemotherapy comprising a taxane and, optionally, a platinum-based
chemotherapeutic agent, and an anti-clusterin oligonucleotide having
the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1), wherein the
anti-clusterin oligonucleotide has a phosphorothioate backbone
throughout, has sugar moieties of nucleotides 1-4 and 18-21 bearing
2 '-O-methoxyethyl modifications, has nucleotides 5-17 which are
2 'deoxynucieotides , and has 5-methylcytosines at nucleotides 1 , 4 ,
and 19. In some embodiments, the pharmaceutical composition is for
treating a human patient afflicted with non-small cell lung cancer
of non-squamous histology or Stage IV non-small cell lung cancer.
Some embodiments of the present invention relate to the use of a
composition comprising chemotherapy comprising a taxane and,
optionally, a platinum-based chemotherapeutic agent, and an anticlusterin
oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT
(Seq. ID No.: 1), wherein the anti-clusterin oligonucleotide has a
phosphorothioate backbone throughout, has sugar moieties of
nucleotides 1-4 and 18-21 bearing 2 '-O-methoxyethyl modifications,
has nucleotides 5-17 which are 'deoxynucieotides , and has 5-
methylcytosines at nucleotides 1 , 4 , and 19, for treatment of a
human patient afflicted with unresectable, advanced or metastatic
non-small cell lung cancer. In some embodiments, the use of the
composition is for the treatment of a human patient afflicted with
non-small cell lung cancer of non-squamous histology or Stage IV
non- small cell lung cancer.
Some embodiments of the present invention relate to the use of a
composition comprising chemotherapy comprising a taxane and,
optionally, a platinum-based chemotherapeutic agent, and an anticlusterin
oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT
(Seq. ID No.: 1), wherein the anti-clusterin oligonucleotide has a
phosphorothioate backbone throughout, has sugar moieties of
nucleotides 1-4 and 18-21 bearing 2 '-O-methoxyethyl modifications,
has nucleotides 5-17 which are 2'deoxynucleotides, and has 5-
methylcytosines at nucleotides 1 , 4 , and 19, for preparation of a
medicament for treatment of a human patient afflicted with
unresectable, advanced or metastatic non-small cell lung cancer. In
some embodiments, the use of the composition is for preparation of a
medicament for treatment of a human patient afflicted with
unresectable, advanced or metastatic non-small cell lung cancer. In
some embodiments, the use of the composition is for preparation of a
medicament for treatment of a human patient afflicted with non-small
cell lung cancer of non-squamous histology or Stage IV non-small
cell lung cancer.
The present invention also provides a package for use in the
treatment of a human patient afflicted with unresectable, advanced
or metastatic non-small cell lung cancer, comprising chemotherapy
comprising a taxane and, optionally, a platinum-based
chemotherapeutic agent, and an anti-clusterin oligonucleotide having
the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No. : 1), wherein the
anti-clusterin oligonucleotide has a phosphorothioate backbone
throughout, has sugar moieties of nucleotides 1-4 and 18-21 bearing
'-O-methoxyethyl modifications, has nucleotides 5-17 which are
2'deoxynucleotides, and has 5-methylcytosines at nucleotides 1 , 4 ,
and 19, and instructions for the use of the chemotherapy in
combination with the anti-clusterin oligonucleotide for the
treatment of unresectable, advanced or metastatic non-small cell
lung cancer. In some embodiments, the package is for use in the
treatment of a human patient afflicted with non-small cell lung
cancer of non-squamous histology or Stage IV non-small cell lung
cancer .
The present invention also provides a chemotherapy comprising a
taxane and, optionally, a platinum-based chemotherapeutic agent, for
use in combination with an anti-clusterin oligonucleotide having the
sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1), wherein the anticlusterin
oligonucleotide has a phosphorothioate backbone throughout,
has sugar moieties of nucleotides 1-4 and 18-21 bearing 2'-0-
methoxyethyl modifications, has nucleotides 5-17 which are
'deoxynucleotides, and has 5-methylcytosines at nucleotides 1 , 4 ,
and 19, for treating of a human patient afflicted with unresectable,
advanced or metastatic non-small cell lung cancer; or an anticlusterin
oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT
(Seq. ID No. : 1 ) , wherein the anti-clusterin oligonucleotide has a
phosphorothioate backbone throughout, has sugar moieties of
nucleotides 1-4 and 18-21 bearing '-O-methoxyethyl modifications,
has nucleotides 5-17 which are 'deoxynucleotides, and has 5-
methylcytosines at nucleotides 1 , 4 , and 19, for use in combination
with a chemotherapy comprising a taxane and, optionally, a platinumbased
chemotherapeutic agent, for treating of a human patient
afflicted with unresectable, advanced or metastatic non-small cell
lung cancer. In some embodiments, the chemotherapy in combination
with the anti-clusterin oligonucleotide is for treating a human
patient afflicted with non-small cell lung cancer of non- squamous
histology or Stage IV non-small cell lung cancer. in some
embodiments, the anti-clusterin oligonucleotide in combination with
the chemotherapy is for treating a human patient afflicted with nonsmall
cell lung cancer of non-squamous histology or Stage IV nonsmall
cell lung cancer.
The present invention also provides a method of treating a human
patient afflicted with non-small cell lung cancer of non-squamous
histology or Stage IV non-small cell lung cancer comprising
periodically administering to the human patient chemotherapy
consisting of an amount of paclitaxel and an amount of carboplatin;
and 640mg of an anti-clusterin oligonucleotide having the sequence
CAGCAGCAGAGTCTTCATCAT (Seq. ID No .: 1), wherein the anti-clusterin
oligonucleotide has a phosphorothioate backbone throughout, has
sugar moieties of nucleotides 1-4 and 18-21 bearing 2'-0-
methoxyethyl modifications, has nucleotides 5-17 which are
'deoxynucleotides, and has 5-methylcytosines at nucleotides 1 , 4 ,
and 19, thereby treating the human patient afflicted with non-small
ce lung cancer of non-sguamous histology or Stage IV non-small
cell lung cancer.
Some embodiments of the present invention provide a combination for
treating a human patient afflicted with non-small cell lung cancer
of non-sguamous histology or Stage IV non-small cell lung cancer,
comprising chemotherapy consisting of paclitaxel and carboplatin,
and an anti-clusterin oligonucleotide having the sequence
CAGCAGCAGAGTCTTCATCAT (Seq. ID No. : 1), wherein the anti-clusterin
oligonucleotide has a phosphorothioate backbone throughout, has
sugar moieties of nucleotides 1-4 and 18-21 bearing 2'-0-
methoxyethyl modifications, has nucleotides 5-17 which are
2 'deoxynucleotides , and has 5-methylcytosines at nucleotides 1 , 4 ,
and 19.
Some embodiments of the present invention provide a composition for
treating a human patient afflicted with non-small cell lung cancer
of non- squamous histology or Stage IV non-small cell lung cancer,
comprising chemotherapy consisting of paclitaxel and carboplatin,
and an anti-clusterin oligonucleotide having the sequence
CAGCAGCAGAGTCTTCATCAT (Seq. ID No. : 1), wherein the anti-clusterin
oligonucleotide has a phosphorothioate backbone throughout, has
sugar moieties of nucleotides 1-4 and 18-21 bearing 2'-0-
methoxyethyl modifications, has nucleotides 5-17 which are
'deoxynucleotides , and has 5-methylcytosines at nucleotides 1 , 4 ,
and 19.
Some embodiments of the present invention provide a pharmaceutical
composition for treating a human patient afflicted with non-small
cell lung cancer of non-squamous histology or Stage IV non-small
cell lung cancer, the composition comprising chemotherapy consisting
of paclitaxel and carboplatin, and an anti-clusterin oligonucleotide
having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1), wherein
the anti-clusterin oligonucleotide has a phosphorothioate backbone
throughout, has sugar moieties of nucleotides 1-4 and 18-21 bearing
'-O-methoxyethyl modifications, has nucleotides 5-17 which are
'deoxynucleotides, and has 5-methyl cytosines at nucleotides 1 , 4 ,
and 19.
Some embodiments of the present invention relate to the use of a
composition comprising chemotherapy consisting of paclitaxel and
carboplatin, and an anti-clusterin oligonucleotide having the
sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No. : 1), wherein the anticlusterin
oligonucleotide has a phosphorothioate backbone throughout,
has sugar moieties of nucleotides 1-4 and 18-21 bearing 2'-0-
methoxyethyl modifications, has nucleotides 5-17 which are
'deoxynucleotides, and has 5-methylcytosines at nucleotides 1 , 4 ,
and 19, for treatment of a human patient afflicted with non-small
cell lung cancer of non-squamous histology or Stage IV non-small
cell lung cancer.
Some embodiments of the present invention relate to the use of a
composition comprising chemotherapy consisting of paclitaxel and
carboplatin, and an anti-clusterin oligonucleotide having the
sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No. : 1), wherein the anticlusterin
oligonucleotide has a phosphorothioate backbone throughout,
has sugar moieties of nucleotides 1-4 and 18-21 bearing 2'-0-
methoxyethyl modifications, has nucleotides 5-17 which are
2 'deoxynucleotides , and has 5-methylcytosines at nucleotides 1 , 4 ,
and 19, for preparation of a medicament for treatment of a human
patient afflicted with non-small cell lung cancer of non-squamous
histology or stage IV non-small cell lung cancer.
Some embodiments of the present invention provide a package for use
in the treatment of a human patient afflicted with non-small cell
lung cancer of non-squamous histology or Stage IV non-small cell
lung cancer, comprising chemotherapy consisting of paclitaxel and
carboplatin, and an anti-clusterin oligonucleotide having the
sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No. : 1), wherein the anticlusterin
oligonucleotide has a phosphorothioate backbone throughout,
has sugar moieties of nucleotides 1-4 and 18-21 bearing 2'-0-
methoxyethyl modifications, has nucleotides 5-17 which are
'deoxynucleotides, and has 5-methylcytosines at nucleotides 1 , 4 ,
and 19, and instructions for the use of the chemotherapy in
combination with the anti-clusterin oligonucleotide for the
treatment of non-small cell lung cancer of non-squamous histology or
Stage IV non-small cell lung cancer.
Some embodiments of the present invention provide a chemotherapy
consisting of paclitaxel and carboplatin, for use in combination
with an anti-clusterin oligonucleotide having the sequence
CAGCAGCAGAGTCTTCATCAT (Seq. ID N o .: 1), wherein the anti-clusterin
oligonucleotide has a phosphorothioate backbone throughout, has
sugar moieties of nucleotides 1-4 and 18-21 bearing 2 '-0-
methoxyethyl modifications, has nucleotides 5-17 which are
2'deoxynucleotides, and has 5-methylcytosines at nucleotides 1 , 4 ,
and 19, for treating of a human patient afflicted with non-small
cell lung cancer of non-squamous histology or Stage IV non-small
cell lung cancer,- or an anti-clusterin oligonucleotide having the
sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1 ) , wherein the anticlusterin
oligonucleotide has a phosphorothioate backbone throughout,
has sugar moieties o f nucleotides 1-4 and 18-21 bearing 2'-0-
methoxyethyl modifications, has nucleotides 5-17 which are
2'deoxynucleotides, and has 5-methylcytosines at nucleotides 1 , 4 ,
and 19, for use in combination with a chemotherapy consisting of
paclitaxel and carboplatin, for treating of a human patient
afflicted with non-small cell lung cancer of non-squamous histology
or Stage IV non-small cell lung cancer.
The present invention also provides a method of treating a human
patient afflicted with unresectable, advanced or metastatic nonsmall
cell lung cancer comprising periodically administering to the
human patient chemotherapy comprising an amount of docetaxel; and
640ntg of an anti-clusterin oligonucleotide having the sequence
CAGCAGCAGAGTCTTCATCAT (Seq. ID N .: 1), wherein the anti-clusterin
oligonucleotide has a phosphorothioate backbone throughout, has
sugar moieties of nucleotides 1-4 and 18-21 bearing 2'-0-
methoxyethyl modifications, has nucleotides 5-17 which are
2'deoxynucleotides, and has 5-methylcytosines at nucleotides 1 , 4 ,
and 19, thereby treating the human patient afflicted with
unresectable, advanced or metastatic non-small cell lung cancer.
The present invention also provides a combination for treating a
human patient afflicted with unresectable, advanced or metastatic
non-small cell lung cancer, comprising chemotherapy comprising
docetaxel; and an anti-clusterin oligonucleotide having the sequence
CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1), wherein the anti-clusterin
oligonucleotide has a phosphorothioate backbone throughout, has
sugar moieties of nucleotides 1-4 and 18-21 bearing 2'-0-
methoxyethyl modifications, has nucleotides 5-17 which are
2'deoxymicleotides, and has 5-methylcytosines at nucleotides 1 , 4 ,
and 19. In some embodiments, the combination is for treating a human
patient afflicted with non-small cell lung cancer of non-squamous
histology or Stage IV non-small cell lung cancer.
The present invention also provides a composition for treating a
human patient afflicted with unresectable, advanced or metastatic
non-small cell lung cancer, comprising chemotherapy comprising
docetaxel; and an anti-clusterin oligonucleotide having the sequence
CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1}, wherein the anti-clusterin
oligonucleotide has a phosphorothioate backbone throughout, has
sugar moieties of nucleotides 1-4 and 18-21 bearing 2'-0-
methoxyethyl modifications, has nucleotides 5-17 which are
2 'deoxynucleotides , and has 5-methylcytosines at nucleotides 1 , 4 ,
and 19. In some embodiments, the composition is for treating a human
patient afflicted with non-small cell lung cancer of non-squamous
histology or Stage IV non-small cell lung cancer.
The present invention also provides a pharmaceutical composition for
treating a human patient afflicted with unresectable, advanced or
metastatic non-small cell lung cancer, the composition comprising
chemotherapy comprising docetaxel; and an anti-clusterin
oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID
No.: 1), wherein the anti-clusterin oligonucleotide has a
phosphorothioate backbone throughout, has sugar moieties of
nucleotides 1-4 and 18-21 bearing '-O-methoxyethyl modifications,
W
-13-
has nucleotides 5-17 which are 2 'deoxynucleotides , and has 5-
methylcytosines at nucleotides 1 , 4 , and 19. In some embodiments,
the pharmaceutical composition is for treating a human patient
afflicted with non-small cell lung cancer of non-squamous histology
5 or Stage IV non-small cell lung cancer.
Some embodiments of the present invention relate to the use of a
composition comprising chemotherapy comprising docetaxel; and an
anti-clusterin oligonucleotide having the sequence
10 CAGCAGCAGAGTCTTCATCAT (Seq. ID No .: 1), wherein the anti-clusterin
oligonucleotide has a phosphorothioate backbone throughout, has
sugar moieties of nucleotides 1-4 and 18-21 bearing 2'-0-
methoxyethyl modifications, has nucleotides 5-17 which are
2'deoxynucleotides, and has 5-methylcytosines at nucleotides 1 , 4 ,
15 and 19, for treatment of a human patient afflicted with unresectable,
advanced or metastatic non-small cell lung cancer. In some
embodiments, the use of the composition is for treatment of a human
patient afflicted with non-small cell lung cancer of non- squamous
histology or Stage IV non-small cell lung cancer.
20
Some embodiments of the present invention relate to the use of a
composition comprising chemotherapy comprising docetaxel; and an
anti-clusterin oligonucleotide having the sequence
CAGCAGCAGAGTCTTCATCAT (Seq. ID No .: 1), wherein the anti-clusterin
25 oligonucleotide has a phosphorothioate backbone throughout, has
sugar moieties of nucleotides 1-4 and 18-21 bearing 2'-0-
methoxyethyl modifications, has nucleotides 5-17 which are
'deoxynucleotides, and has 5-methylcytosines at nucleotides 1 , 4 ,
and 19, for preparation of a medicament for treatment of a human
30 patient afflicted with unresectable, advanced or metastatic nonsmall
cell lung cancer. In some embodiments, the use of the
composition is for preparation of a medicament for treatment of a
human patient afflicted with non-small cell lung cancer of nonsquamous
histology or Stage IV non-small cell lung cancer.
35
The present invention also provides a package for use in the
treatment of a human patient afflicted with unresectable, advanced
or metastatic non-small cell lung cancer, comprising chemotherapy
comprising docetaxel; and an anti-clusterin oligonucleotide having
the sequence CAGCAGCAGAGTCTTCATCAT (Se . ID No. : 1), wherein the
anti-clusterin oligonucleotide has a phosphorothioate backbone
throughout, has sugar moieties of nucleotides 1-4 and 18-21 bearing
'-0-methoxyethyl modifications, has nucleotides 5-17 which are
2 'deoxynucleotides, and has 5-methylcytosines at nucleotides 1 , 4 ,
and 19, and instructions for the use of the chemotherapy in
combination with the anti-clusterin oligonucleotide for the
treatment of unresectable, advanced or metastatic non-small cell
lung cancer. In some embodiments, the package is for use in the
treatment of a human patient afflicted with non-small cell lung
cancer of non-squamous histology or Stage IV non-small cell lung
cancer .
The present invention also provides a chemotherapy comprising
docetaxel for use combination with an anti-clusterin
oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID
No.: 1), wherein the anti-clusterin oligonucleotide has a
phosphorothioate backbone throughout, has sugar moieties of
nucleotides 1-4 and 18-21 bearing '-O-methoxyethyl modifications,
has nucleotides 5-17 which are 'deoxynucleotides , and has 5-
methylcytosines at nucleotides 1 , 4 , and 19, for treating of a human
patient afflicted with unresectable, advanced or metastatic nonsmall
cell lung cancer; or an anti-clusterin oligonucleotide having
the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1), wherein the
anti-clusterin oligonucleotide has a phosphorothioate backbone
throughout, has sugar moieties of nucleotides 1-4 and 18-21 bearing
2 '-O-methoxyethyl modifications, has nucleotides 5-17 which are
2 'deoxynucleotides, and has 5-methylcytosines at nucleotides 1 , 4 ,
and 19 , for use in combination with a chemotherapy comprising
docetaxel, for treating of a human patient afflicted with
unresectable, advanced or metastatic non-small cell lung cancer. In
some embodiments, the chemotherapy in combination with the anticlusterin
oligonucleotide is for treating a human patient afflicted
with non-small cell lung cancer of non-squamous histology or Stage
IV non-small cell lung cancer. In some embodiments, the anticlusterin
oligonucleotide in combination with the chemotherapy is
for treating a human patient afflicted with non-small cell lung
cancer of non-squamous histology or Stage IV non-small cell lung
cancer .
Brief Deacrlptloa of the Drawings
Figure 1. Treatment Design f r the Combination of Custirsen and
Paclitaxel/Carboplatin.
Figure 2 . Study Timeline for Clinical Trial Evaluating the Safety
and Efficacy of the Combination of Custirsen and
Paclitaxel/Carboplatin or the Combination of Custirsen
and Docetaxel, for the treatment of NSCLC.
Figure 3 . Treatment Scheme for Clinical Trial Evaluating the Safety
and Efficacy of the Combination of Custirsen and
Paclitaxel/Carboplatin for the treatment of Stage IV
NSCLC of Non-squamous Histology.
Figure 4 . Survival Curves for Low vs. High Baseline Clusterin in
patients with NSCLC. Survival Curves for Low vs. Hi h
Baseline Clusterin. The Figure shows Kaplan-Meier
survival curves for the N=55 subjects with at least one
post-baseline clusterin assessment. The subjects were
stratified by their baseline clusterin level: Low (£ 71
pg/mL) vs. High (> 71 pg/mL) . The log-rank test gave p =
0.0002.
Figure . Kaplan-Meier curves corresponding to the 71pg/mL cutpoint
for baseline clusterin and a 33 pg/mL cutpoint for
average clusterin in patients with NSCLC. The Figure
shows Kaplan-Meier survival curves for N=5 of the =55
subjects with both baseline and post-baseline clusterin
assessments. The subjects were stratified by their
baseline clusterin level (£ 71 pg/mL vs. >71 pg/mL) , and
also by AUCp, the time-weighted average of their postbaseline
clusterin levels (£ 33 pg/mL vs. >33 pg/mL) .
The log-rank test comparing the three curves gave p =
0.0003. (Please see Example 2 regarding the missing
subject .)
Figure 6 . Kaplan-Meier curves corresponding to the 71 pg/mL
cutpoint for baseline clusterin and a 30 pg/mL cutpoint
for minimum clusterin. The figure shows Kaplan-Meier
survival curves for N=53 of the N=55 subjects with both
baseline and post-baseline clusterin assessments. The
subjects were stratified by their baseline clusterin
level (£ 71 pg/mL vs. > 71 pg/mL) , and also by their
minimum on-study clusterin levels (£ 30 pg / L vs. > 30
pg/mL) . The log-rank test comparing the three curves
gave p = 0.0002. (Please see Example 2 regarding the two
missing subjects .)
Figure . Treatment Design for the Combination of Custirsen and
Docetaxel .
D tai e Description of th Invention
The present invention describes novel methods and compositions
effective for the treatment of lung cancer. In some embodiments, the
present invention describes novel methods and compositions effective
for the treatment of certain types of NSCLC, including, unresectable,
advanced or metastatic (Stage IV per AJCC 7th edition T M staging)
NSCLC and NSCLCL of non-squamous histology and Stage IV NSCLC.
The present invention provides a method of treating a human patient
afflicted with unresectable, advanced or metastatic non-small cell
lung cancer comprising periodically administering to the human
patient chemotherapy comprising an amount of a taxane, and 640mg of
an anti-clusterin oligonucleotide having the sequence
CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1), wherein the anti-clusterin
oligonucleotide has a phosphorothioate backbone throughout, has
sugar moieties of nucleotides 1-4 and 18-21 bearing 2 '-0-
methoxyethyl modifications, has nucleotides 5-17 which are
2 'deoxynucleotides , and has 5-methylcytosines at nucleotides 1 , 4 ,
and 19, thereby treating the human patient afflicted with
unresectable, advanced or metastatic non-small cell lung cancer.
The present invention provides a method of treating a human patient
afflicted with unresectable, advanced or metastatic (Stage IV per
AJCC 7th edition TNM staging) non-small cell lung cancer comprising
periodically administering to the human patient chemotherapy
comprising an amount of a taxane, and 640mg of an anti-clusterin
oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID
No. : 1 ) , wherein the anti-clusterin oligonucleotide has a
phosphorothioate backbone throughout, has sugar moieties of
nucleotides 1-4 and 18-21 bearing '-O-methoxyethyl modifications,
has nucleotides 5-17 which are 'deoxynucleotides, and has 5-
methylcytosines at nucleotides 1 , 4 , and 19, thereby treating the
human patient afflicted with unresectable, advanced or metastatic
(Stage IV per AJCC 7th edition TNM staging) non-small cell lung
cancer.
Some embodiments of the present invention provide a method of
treating a human patient afflicted with non-small cell lung cancer
of non-squamous histology or Stage IV non-small cell lung cancer
comprising periodically administering to the human patient
chemotherapy comprising an amount of a taxane, and 640mg of an anticlusterin
oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT
(Seq. ID No.: 1), wherein the anti-clusterin oligonucleotide has a
phosphorothioate backbone throughout, has sugar moieties of
nucleotides 1-4 and 18-21 bearing '-O-methoxyethyl modifications,
has nucleotides 5-17 which are 'deoxynucleotides , and has 5-
ethy c osines at nucleotides 1 , 4 , and 19, thereby treating the
human patient afflicted with non-small cell lung cancer of nonsquamous
histology or Stage IV non-small cell lung cancer.
In some embodiments, the taxane is paclitaxel.
In some embodiments, during the chemotherapy the amount of
paclitaxel administered is mg/m2 intravenously to the human
patient over a period of 3 hours .
In some embodiments, during the chemotherapy the amount of
paclitaxel administered is less than 200mg/m 2 intravenously to the
human patient.
In some embodiments, during the chemotherapy the paclitaxel is
administered to the human patient on the first day of each of up to
six three-week chemotherapy cycles.
In some embodiments, the taxane is other than paclitaxel.
In some embodiments, the taxane is docetaxel, baccatin III, baccatin
V , taxol B (cephalomannine) , taxol C , taxol D , taxol E , taxol F ,
taxol G , cabazitaxel, larotaxel, ortataxel (14 beta-hydroxydeacetyl
baccatin III), tesetaxol, 10-deacetyl baccatin III, 7-xylosyl-10-
deacetyl cephalomannine, 7-xylosyl-lO-deacetyl paclitaxel, 10-
deacetyl cephalomannine, 7-xylosyl-10-deacetyl taxol C , 10-deacetyl
paclitaxel, 7-xylosyl paclitaxel, 10-deacetyl taxol C , 10-deacetyl -
7-epi cephalomaunine, 7-xylosyl taxol C , 10-deacetyl-7-epipaclitaxel ,
7-epi cephalomaunine, 7-epi paclitaxel, 7-O-methylthiomethyl
paclitaxel, 7-deoxy docetaxel, taxanime M , PG-paclitaxel , or DHApaclitaxel
.
In some embodiments, the taxane is docetaxel.
In some embodiments, the chemotherapy the amount of docetaxel
administered is 75mg/m2 intravenously to the human patient over a
period of 1 hour.
In some embodiments, the chemotherapy the amount of docetaxel
administered is less than 75mg/m2 intravenously to the human patient.
In some embodiments, during the chemotherapy the docetaxel is
administered to the human patient on the first day of each threeweek
chemotherapy cycle.
In some embodiments, the taxane is cabazitaxel.
In some embodiments, the chemotherapy further comprises an amount of
a platinum-based chemotherapeutic agent.
In some embodiments, the platinum-based chemotherapeutic agent is
cisplatin, carboplatin (paraplatin) , nedaplatin, oxaliplatin,
triplatin tetranitrate, satraplatin, iproplatin, lobaplatin, or
picoplatin .
In some embodiments, the platinum-based chemotherapeutic agent is
carboplatin.
In some embodiments, during the chemotherapy the amount of
carboplatin administered is A0C 6mg/mL/min intravenously to the
human patient over a period of 30 minutes.
In some embodiments, during the chemotherapy the amount of
carboplatin administered is less than AUC 6mg/mL/min intravenously
to the human patient over a period of 30 minutes.
In some embodiments, during the chemotherapy the carboplatin is
administered to the human patient on the first day of each of up to
six three-week chemotherapy cycles .
n some embodiments, the platinum-based chemotherapeutic agent is
cisplatin.
In some embodiments, the platinum-based chemotherapeutic agent is
other than carboplatin.
In some embodiments, during the chemotherapy the platinum-based
chemotherapeutic agent is administered to the human patient on the
first day of each three-week chemotherapy cycle.
In some embodiments, during the chemotherapy the taxane is
administered to the human patient on the first day of each threeweek
chemotherapy cycle.
In some embodiments, the non-small cell lung cancer is stage IV lung
cancer .
In some embodiments, the non-small cell lung cancer is of nonsquamous
histology.
In some embodiments, the treating includes prolonging survival of
the human patient .
In some embodiments, the treating includes prolonging survival of
the human patient which prolonged survival is free of progression of
the non-small lung cancer.
In some embodiments, the human patient survives free of progression
of the lung cancer for at least 14 weeks.
In some embodiments, the human patient survives free of progression
of the non-small cell lung cancer for at least 14 weeks.
In some embodiments, the human patient survives free of progression
of the non-small cell lung cancer of non-squamous histology for at
least 14 weeks .
In some embodiments, the human patient suffers from chest pain,
pleural effusions, pulmonary edema, dyspnea, or hemoptysis.
n some embodiments, the lung cancer is lung adenocarcinoma or lung
large cell carcinoma.
n some embodiments, the non-small cell lung cancer is lung
adenocarcinoma or lung large cell carcinoma.
In some embodiments, the non-small cell lung cancer of non-squamous
histology is lung adenocarcinoma or lung large cell carcinoma.
In some embodiments, the anti-clusterin oligonucleotide is
administered to the human patient intravenously in an aqueous
solution comprising sodium ions.
in some embodiments, the anti-clusterin oligonucleotide is
administered to the human patient 3 times within a 5 to 9 day period
before the first day of chemotherapy and then once weekly beginning
on the first day of chemotherapy.
In some embodiments, the lung cancer is nonresectable, advanced or
metastatic non-small cell lung cancer.
In some embodiments, the lung cancer has been histologically or
cytologically confirmed and is, unresectable, advanced or metastatic
(Stage IV per AJCC 7th edition TNM staging) .
In some embodiments, the lung cancer is Stage IV disease (according
to the IASLC 7th edition TNM staging, including subjects with pleural
effusion who were previously classified as Stage I B ) that is not
amenable to either surgery or radiation therapy of curative intent.
n some embodiments, the human patient has not received treatment
for non-small cell lung cancer for at least 1 year.
In some embodiments, the human patient has not received a
chemotherapeutic agent for the treatment ,of non-small cell lung
cancer for at least 1 year.
In some embodiments, the human patient has before initiation of the
periodic administration received a chemotherapeutic agent for the
treatment of lung cancer.
In some embodiments, the chemo therapeutic agent was a platinum-based
chemotherapeutic agent.
In some embodiments, a method of the invention for treating a human
patient afflicted with non-small cell lung cancer of non-squamous
histology or Stage IV non-small cell lung cancer further comprises
the steps of:
i ) measuring the level of serum clusterin present in the blood
of the human patient prior to the administration of the anticlusterin
oligonucleotide;
ii) determining whether the level of serum clusterin present
in the human patient is lower than a predetermined upper
threshold level of baseline serum clusterin below which a
human patient is likely to substantially benefit from anticlusterin
therapy; and
iii) administering the anti-clusterin oligonucleotide only if
the level of serum clusterin present in the blood of the human
patient is lower than the predetermined upper threshold level
of baseline serum clusterin.
In some embodiments, in step i ) the measuring is performed after
initiation of the chemotherapy.
In some embodiments, the predetermined upper threshold level of
baseline serum clusterin is 75 g/m .
In some embodiments, a method of the invention for treating a human
patient afflicted with non-small cell lung cancer of non-sguamous
histology or Stage IV non-small cell lung cancer further comprises
the steps of:
i ) administering to the human patient the anti-clusterin
oligonucleotide in an initial dosage and treatment protocol;
ii) thereafter testing the human patient to determine a level
of serum clusterin after a period of treatment with the anticlusterin
oligonucleotide intended to reduce clusterin
expression;
iii) determining an adjusted dosage and treatment protocol
based on the determined level of serum clusterin; and
iv) administering to the human patient the anti-clusterin
oligonucleotide in accordance with the adjusted dosage and
treatment protocol .
In some embodiments, the determined level of serum clusterin after a
period of treatment with the anti-clusterin oligonucleotide intended
to reduce clusterin expression is above a predetermined post anticlusterin
oligonucleotide initiation threshold level ,
In some embodiments, the predetermined post anti-clusterin
oligonucleotide initiation threshold level is 30ug/mL.
In some embodiments, the adjusted dosage and treatment protocol
comprises administration of the anti-clusterin oligonucleotide to
the human patient two or three times per week.
The present invention also provides a combination for treating a
human patient afflicted with unresectable, advanced or metastatic
non-small cell lung cancer, comprising chemotherapy comprising a
taxane and an anti-clusterin oligonucleotide having the sequence
CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1), wherein the anti-clusterin
oligonucleotide has a phosphorothioate backbone throughout, has
sugar moieties of nucleotides 1-4 and 18-21 bearing 2'-0-
methoxyethyl modifications, has nucleotides 5-17 which are
2 'deoxynucleotides , and has 5-methylcytosines at nucleotides 1 , 4 ,
and 19. In some embodiments, the combination is for treating a human
patient afflicted with non-small cell lung cancer of non-squamous
histology or Stage IV non-small cell lung cancer.
The present invention also provides a composition for treating a
human patient afflicted with unresectable, advanced or metastatic
non-small cell lung cancer, comprising chemotherapy consisting of a
taxane and, optionally, a platinum-based chemotherapeutic agent; and
an anti-clusterin oligonucleotide having the sequence
CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1), wherein the anti-clusterin
oligonucleotide has a phosphorothioate backbone throughout, has
sugar moieties of nucleotides 1-4 and 18-21 bearing 2'-0-
methoxyethyl modifications, has nucleotides 5-17 which are
2 'deoxynucleotides, and has 5-methylcytosines at nucleotides 1 , 4 ,
and 19. In some embodiments, the composition is for treating a human
patient afflicted with non-small cell lung cancer of non-squamous
histology or Stage IV non-small cell lung cancer.
The present invention also provides a pharmaceutical composition for
treating a human patient afflicted with unresectable, advanced or
metastatic non-small cell lung cancer, the composition comprising
chemotherapy comprising a taxane and, optionally, a platinum-based
chemotherapeutic agent, and an anti-clusterin oligonucleotide having
the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1), wherein the
anti-clusterin oligonucleotide has a phosphorothioate backbone
throughout, has sugar moieties of nucleotides 1-4 and 18-21 bearing
'-o-raethoxyethyl modifications, has nucleotides 5-17 which are
'deoxynucleotides , and has 5-methylcytosines at nucleotides 1 , 4 ,
and 19. In some embodiments, the pharmaceutical composition is for
treating a human patient afflicted with non-small cell lung cancer
of non-squamous histology or Stage IV non-small cell lung cancer.
Some embodiments of the present invention relate to the use of a
composition comprising chemotherapy comprising a taxane and,
optionally, a platinum-based chemotherapeutic agent, and an anticlusterin
oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT
(Seq. ID No. : 1 ) , wherein the anti-clusterin oligonucleotide has a
phosphorothioate backbone throughout, has sugar moieties of
nucleotides 1-4 and 18-21 bearing '-O-methoxyethyl modifications,
has nucleotides 5-17 which are 2 'deoxynucleotides , and has 5-
methylcytosines at nucleotides 1 , 4 , and 19, for treatment of a
human patient afflicted with unresectable, advanced or metastatic
non-small cell lung cancer. In some embodiments, the use of the
composition is for treating a human patient afflicted with non-small
cell lung cancer of non-squamous histology or Stage IV non-small
cell lung cancer.
Some embodiments of the present invention relate to the use of a
composition comprising chemotherapy comprising a taxane and,
optionally, a platinum-based chemotherapeutic agent, and an anticlusterin
oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT
(Seq. ID No.: 1), wherein the anti-clusterin oligonucleotide has a
phosphorothioate backbone throughout, has sugar moieties of
nucleotides 1-4 and 18-21 bearing 2 '-O-methoxyethyl modifications,
has nucleotides 5-17 which are 'deoxynucleotides, and has 5-
methylcytosines at nucleotides 1 , 4 , and 19, for preparation of a
medicament for treatment of a human patient afflicted with
unresectable, advanced or metastatic non-small cell lung cancer. In
some embodiments, the use of the composition is for preparation of a
medicament for treatment of a human patient afflicted with
unresectable, advanced or metastatic non-small cell lung cancer, in
some embodiments, the use of the composition is for preparation of a
medicament for treatment of a human patient afflicted with non-small
cell lung cancer of non-squamous histology or Stage IV non-small
cell lung cancer.
The present invention also provides a package for use in the
treatment of a human patient afflicted with unresectable, advanced
or metastatic non-small cell lung cancer, comprising chemotherapy
comprising a taxane and, optionally, a platinum-based
chemotherapeutic agent, and an anti-clusterin oligonucleotide having
the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No..- 1), wherein the
anti-clusterin oligonucleotide has a phosphorothioate backbone
throughout, has sugar moieties of nucleotides 1-4 and 18-21 bearing
2 '-O-methoxyethyl modifications, has nucleotides 5-17 which are
2'deoxynucleotides , and has 5-methyl cytosines at nucleotides 1 , 4 ,
and 19, and instructions for the use of the chemotherapy in
combination with the anti-clusterin oligonucleotide for the
treatment of unresectable, advanced or metastatic non-small cell
lung cancer. In some embodiments, the package is for use in the
treatment of a human patient afflicted with non-small cell lung
cancer of non-squamous histology or Stage IV non-small cell lung
cancer .
The present invention also provides a chemotherapy comprising a
taxane and, optionally, a platinum-based chemotherapeutic agent, for
use in combination with an anti-clusterin oligonucleotide having the
sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No. : 1), wherein the anticlusterin
oligonucleotide has a phosphorothioate backbone throughout,
has sugar moieties of nucleotides 1-4 and 18-21 bearing 2'-0-
methoxyethyl modifications, has nucleotides 5-17 which are
2 'deoxynucleotides, and has 5-methylcytosines at nucleotides 1 , 4 ,
and 19, for treating of a human patient afflicted with unresectable,
advanced or metastatic non-small cell lung cancer; or an anticlusterin
oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT
(Seq. ID No. : 1 ) , wherein the anti-clusterin oligonucleotide has a
phosphorothioate backbone throughout, has sugar moieties of
nucleotides 1-4 and 18-21 bearing 2 '-O-methoxyethyl modifications,
has nucleotides 5-17 which are 'deoxynucleotides , and has 5-
methylcytosines at nucleotides 1 , 4 , and 19, for use in combination
with a chemotherapy comprising a taxane and, optionally, a platinumbased
chemotherapeutic agent, for treating of a human patient
afflicted with unresectable, advanced or metastatic non-small cell
lung cancer. In some embodiments, the chemotherapy in combination
with the anti-clusterin oligonucleotide is for treating a human
patient afflicted with non-small cell lung cancer of non-squamous
histology or Stage IV non-small cell lung cancer. In some
embodiments, the anti-clusterin oligonucleotide in combination with
the chemotherapy is for treating a human patient afflicted with nonsmall
cell lung cancer of non-squamous histology or Stage IV nonsmall
cell lung cancer.
The present invention provides a method of treating a human patient
afflicted with non-small cell lung cancer of non-squamous histology
or Stage IV non-small cell lung cancer comprising periodically
administering to the human patient chemotherapy consisting of an
amount of paclitaxel and an amount of carboplatin; and 640mg of an
anti-clusterin oligonucleotide having the sequence
CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1), wherein the anti-clusterin
oligonucleotide has a phosphorothioate backbone throughout, has
sugar moieties of nucleotides 1-4 and 18-21 bearing 2'-0-
methoxyethyl modifications, has nucleotides 5-17 which are
'deoxynucleotides , and has 5-methylcytosines at nucleotides 1 , 4 ,
and 19, thereby treating the human patient afflicted with non-small
cell lung cancer of non-squamous histology or Stage IV non-small
cell lung cancer.
In some embodiments, the treating includes prolonging survival of
the human patient.
In some embodiments, the treating includes prolonging survival of
the human patient which prolonged survival is free of progression of
the non-small cell lung cance .
In some embodiments, the human patient survives with a lower rate of
progression of the non-small cell lung cancer of non-squamous
histology for at least 14 weeks.
In some embodiments, the human patient survives free of progression
of the non-small cell lung cancer of non-squamous histology for at
least 8 weeks.
In some embodiments, the human patient survives free of progression
of the non-small cell lung cancer of non-squamous histology for at
least 14 weeks.
In some embodiments, the human patient survives free of progression
of the non-small cell lung cancer of non-squamous histology for at
least 20 weeks.
In some embodiments, the human patient survives free of progression
of the non-small cell lung cancer of non-squamous histology for at
least 26 weeks.
In some embodiments, the human patient survives with a lower rate of
progression of the non-small cell lung cancer for at least 14 weeks.
n some embodiments, the human patient survives free of progression
of the non-small cell lung cancer for at least 8 weeks.
In some embodiments, the human patient survives free of progression
of the non-small cell lung cancer for at least 14 weeks.
In some embodiments, the human patient survives free of progression
of the non-small cell lung cancer for at least 20 weeks.
In some embodiments, the human patient survives free of progression
of the non-small cell lung cancer for at least 26 weeks.
In some embodiments, the human patient suffers from chest pain,
pleural effusions, pulmonary edema, dyspnea, or hemoptysis.
In some embodiments, the non-small cell lung cancer is lung
adenocarcinoma or lung large cell carcinoma.
In some embodiments, the non-small cell lung cancer of non-squamous
histology is lung adenocarcinoma or lung large cell carcinoma.
In some embodiments, during the chemotherapy the amount of
paclitaxel administered is 200mg/m2 intravenously to the human
patient over a period of 3 hours.
In some embodiments, during the chemotherapy the amount of
paclitaxel administered is less than 200mg/m2 intravenously to the
human patient.
In some embodiments, during the chemotherapy the paclitaxel is
administered to the human patient on the first day of each of up to
six three-week chemotherapy cycles.
In some embodiments, during the chemotherapy the amount of
carboplatin administered is AUC 6mg/mL/min intravenously to the
human patient over a period of 30 minutes.
n some embodiments, during the chemotherapy the amount of
carboplatin administered is less than AUC 6mg/mL/min intravenously
to the human patient over a period of 30 minutes.
In some embodiments, during the chemotherapy the carboplatin is
administered to the human patient on the first day of each of up to
six three-week chemotherapy cycles .
in some embodiments, the anti-clusterin oligonucleotide is
administered to the human patient intravenously in an aqueous
solution comprising sodium ions.
In some embodiments, the anti-clusterin oligonucleotide is
administered to the human patient 3 times within a 5 to 9 day period
before the first day of chemotherapy and then once weekly beginning
on the first day of chemotherapy.
In some embodiments, the human patient has not received treatment
for non-small cell lung cancer for at least 1 year.
In some embodiments, the human patient has not received a
chemotherapeutic agent for the treatment of non-small cell lung
cancer for at least 1 year.
In some embodiments, the human patient is afflicted with non-small
cell lung cancer of non- squamous histology.
In some embodiments, the human patient is afflicted with Stage IV
non- small cell lung cancer.
In some embodiments, the human patient is afflicted with Stage IV
non-small cell lung cancer of non-squamous histology.
In some embodiments, a method of the invention for treating a human
patient afflicted with non-small cell lung cancer of non-squamous
histology or Stage IV non- small cell lung cancer further comprises
the steps of:
i ) measuring the level of serum clusterin present in the
blood of the human patient prior to the administration of
the anti-clusterin oligonucleotide;
ii) determining whether the level of serum clusterin present
in the human patient is lower than a predetermined upper
threshold level of baseline serum clusterin below which a
human patient is likely to substantially benefit from
anti-clusterin therapy; and
iii) administering the anti-clusterin oligonucleotide only if
the level of serum clusterin present in the blood of the
human patient is lower than the predetermined upper
threshold level of baseline serum clusterin.
In some embodiments, in step i ) the measuring is performed after
initiation f the chemotherapy.
In some embodiments, the predetermined upper threshold level of
baseline serum clusterin is 75 g/mL .
In some embodiments, a method of the invention for treating a human
patient afflicted with non-small cell lung cancer of non-sqruamous
histology or Stage IV non-small cell lung cancer further comprises
the steps of:
i ) administering to the human patient the anti-clusterin
oligonucleotide in an initial dosage and treatment
protocol ;
ii) thereafter testing the human patient to determine a level
of serum clusterin after a period of treatment with the
anti-clusterin oligonucleotide intended to reduce
clusterin expression;
iii) determining an adjusted dosage and treatment protocol
based on the determined level of serum clusterin; and
iv) administering to the human patient the anti-clusterin
oligonucleotide in accordance with the adjusted dosage
and treatment protocol .
n some embodiments, the determined level of serum clusterin after a
period of treatment with the anti-clusterin oligonucleotide intended
to reduce clusterin expression is above a predetermined post anticlusterin
oligonucleotide initiation threshold level.
n some embodiments, the predetermined post anti-clusterin
oligonucleotide initiation threshold level is 3C^g/mL.
In some embodiments, the adjusted dosage and treatment protocol
comprises administration of the anti-clusterin oligonucleotide to
the human patient two or three times per week.
Some embodiments of the present invention provide a combination for
treating a human patient afflicted with non-small cell lung cancer
of non-squamous histology or Stage IV non-small cell lung cancer,
comprising chemotherapy consisting of paclitaxel and carboplatin,
and an anti-clusterin oligonucleotide having the sequence
CAGCAGCAGAGTCTTCATCAT (Seq. ID No. : 1), wherein the anti-clusterin
oligonucleotide has a phosphorothioate backbone throughout, has
sugar moieties of nucleotides 1-4 and 18-21 bearing 2 '-0-
irtethoxyethyl modifications, has nucleotides 5-17 which are
'deoxynucleotides, and has 5-methylcytosines at nucleotides 1 , 4 ,
and 19.
Some embodiments of the present invention provide a composition for
treating a human patient afflicted with non-small cell lung cancer
of non-squamous histology or Stage IV non-small cell lung cancer,
comprising chemotherapy consisting of paclitaxel and carboplatin,
and an anti-clusterin oligonucleotide having the sequence
CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1), wherein the anti-clusterin
oligonucleotide has a phosphorothioate backbone throughout, has
sugar moieties of nucleotides 1-4 and 18-21 bearing 2 '-0-
methoxyethyl modifications, has nucleotides 5-17 which are
'deoxynucleotides, and has 5-methylcytosines at nucleotides 1 , 4 ,
and 19.
Some embodiments of the present invention provide a pharmaceutical
composition for treating a human patient afflicted with non-small
cell lung cancer of non-squamous histology or Stage IV non-small
cell lung cancer, the composition comprising chemotherapy consisting
of paclitaxel and carboplatin, and an anti-clusterin oligonucleotide
having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No. : 1), wherein
the anti-clusterin oligonucleotide has a phosphorothioate backbone
throughout, has sugar moieties of nucleotides 1-4 and 18-21 bearing
2 '-O-methoxyethyl modifications, has nucleotides 5-17 which are
'deoxynucleotides , and has 5-methylcytosines at nucleotides 1 , 4 ,
and 19.
Some embodiments of the present invention relate to the use of a
composition comprising chemotherapy consisting of paclitaxel and
carboplatin, and an anti-clusterin oligonucleotide having the
sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1), wherein the anticlusterin
oligonucleotide has a phosphorothioate backbone throughout,
has sugar moieties of nucleotides 1-4 and 18-21 bearing 2'-0-
methoxyethyl modifications, has nucleotides 5-17 which are
'deoxynucleotides, and has 5-methylcytosines at nucleotides 1 , 4 ,
and 19, for treatment of a human patient afflicted with non-small
cell lung cancer of non-squamous histology or Stage IV non-small
cell lung cancer.
Some embodiments of the present invention relate to the use of a
composition comprising chemotherapy consisting of paclitaxel and
carboplatin, and an anti-clusterin oligonucleotide having the
sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No. : 1), wherein the anticlusterin
oligonucleotide has a phosphorothioate backbone throughout,
has sugar moieties of nucleotides 1-4 and 18-21 bearing 2'-0-
methoxyethyl modifications, has nucleotides 5-17 which are
'deoxynucleotides, and has 5-methylcytosines at nucleotides 1 , 4 ,
and 19, for preparation of a medicament for treatment of a human
patient afflicted with non-small cell lung cancer of non-squamous
histology or Stage IV non-small cell lung cancer.
Some embodiments of the present invention provide a package for use
in the treatment of a human patient afflicted with non-small cell
lung cancer of non-squamous histology or Stage IV non-small cell
lung cancer, comprising chemotherapy consisting of paclitaxel and
carboplatin, and an anti-clusterin oligonucleotide having the
sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1), wherein the anticlusterin
oligonucleotide has a phosphorothioate backbone throughout,
has sugar moieties of nucleotides 1-4 and 18-21 bearing 2'-0-
methoxyethyl modifications, has nucleotides 5-17 which are
'deoxynucleotides, and has -methyl cytosines at nucleotides 1 , 4 ,
and 19, and instructions for the use of the chemotherapy in
combination with the anti-clusterin oligonucleotide for the
treatment of non-small cell lung cancer of non-squamous histology or
Stage IV non-small cell lung cancer.
Some embodiments of the present invention provide a chemotherapy
consisting of paclitaxel and carboplatin, for use in combination
with an anti-clusterin oligonucleotide having the sequence
CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1), wherein the anti-clusterin
oligonucleotide has a phosphorothioate backbone throughout, has
sugar moieties of nucleotides 1-4 and 18-21 bearing 2'-0-
methoxyethyl modifications, has nucleotides 5-17 which are
2 'deoxynucleotides , and has 5-methyl cytosines at nucleotides 1 , 4 ,
and 19, for treating of a human patient afflicted with non-small
cell lung cancer of non-squamous histology or Stage IV non-small
cell lung cancer or an anti-clusterin oligonucleotide having the
sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No. : 1), wherein the anticlusterin
oligonucleotide has a phosphorothioate backbone throughout,
has sugar moieties of nucleotides 1-4 and 18-21 bearing 2 '-0-
methoxyethyl modifications, has nucleotides 5-17 which are
2 'deoxynucleotides, and has 5-methyl cytosines at nucleotides 1 , 4 ,
and 19, for use in combination with a chemotherapy consisting of
paclitaxel and carboplatin, for treating of a human patient
afflicted with non-small cell lung cancer of non-squamous histology
or Stage IV non-small cell lung cancer.
n some embodiments, treatment encompasses the human patient being
free of progression of NSCLC of non-squamous histology. In some
embodiments, treatment encompasses the human patient being
substantially free of progression of NSCLC of non-squamous histology.
In some embodiments, the human patient is free of progression of
measurable disease. In some embodiments, the human patient is free
of progression of non-measurable disease. In some embodiments,
treatment of the human patient encompasses the prevention or
amelioration of a symptom of NSCLC of non-squamous histology.
In some embodiments, treatment encompasses the human patient being
free of progression of Stage IV NSCLC . in some embodiments, treatment
encompasses the human patient being substantially free of progression
of Stage IV NSCLC . In some embodiments, treatment of the human
patient encompasses the prevention or amelioration of a symptom of
stage v NSCLC .
In some embodiments, the time to progression of NSCLC is increased.
In some embodiments, the cells of the lung cancer comprise an
epidermal growth factor (EGFR) mutation. In some embodiments, the
cells of the lung cancer comprise a v-Ki-ras2 Kirsten rat sarcoma
viral ongocene homolog (KRAS) mutation.
In some embodiments, the human patient has histologically or
cytologically confirmed, unresectable advanced or metastatic NSCLC.
In some embodiments, the human patient has a life expectancy of at
least 12 weeks from the initiation of treatment.
In some embodiments, the human patient has received at least one
prior line of platinum-based systemic anticancer therapy for advanced
or metastatic NSCLC.
In some embodiments, the human patient has documented radiological
disease progression during first-line therapy.
n some embodiments, the human patient has documented radiological
disease progression after first-line therapy.
In some embodiments, the human patient has adequate electrolyte
values, bone marrow, renal and liver functions within 1 , 2 , 3 , 4 , 5 ,
6 , 7 , 8 , 9 , 10, 11 or 12 weeks of treatment initiation as defined
below:
• Absolute neutrophil count A C ) ³ 1.5 x 109/L
• Platelets ³ 100 x 109/L
• Hemoglobin ³ 9 g/dL
• Serum creatinine £ 1.5 x upper limit of normal ( )
• Total Bilirubin < 1.0 x ULN (unless elevated secondary to benign
conditions such as Gilbert's disease)
• AST and ALT £ 1.5 x ULN
• Alkaline phosphatase £ 2.5 ULN
• Electrolyte values (sodium, potassium and magnesium) ³ 1 x LLN
and £ 1 x ULN. Patients with corrected electrolyte values are
eligible.
The present invention also provides a method of treating a human
patient afflicted with unresectable, advanced or metastatic nonsmall
cell lung cancer comprising periodically administering to
the human patient chemotherapy comprising an amount of docetaxel;
and 640mg of an anti-clusterin oligonucleotide having the sequence
CAGCAGCAGAGTCTTCATCAT (Seq. ID No. : 1), wherein the anti-clusterin
oligonucleotide has a phosphorothioate backbone throughout, has
sugar moieties of nucleotides 1-4 and 18-21 bearing 2'-0-
methoxyethyl modifications, has nucleotides 5-17 which are
2'deoxynucleotides, and has -methyl cytosines at nucleotides 1 , 4 ,
and 19, thereby treating the human patient afflicted with
unresectable, advanced or metastatic non-small cell lung cancer.
In some embodiments, the treating includes prolonging survival of
the human patient.
n some embodiments, the treating includes prolonging survival of
the human patient which prolonged survival is free of progression of
the non-small cell lung cancer.
In some embodiments, the human patient survives free of progression
of the non-small cell lung cancer for at least 14 weeks.
In some embodiments, the human patient survives free of progression
of the non-small cell lung cancer of non-squamous histology for at
least 14 weeks .
In some embodiments, the human patient suffers from chest pain,
pleural effusions, pulmonary edema, dyspnea, or hemoptysis.
In some embodiments, the non-small cell lung cancer is lung
adenocarcinoma or lung large cell carcinoma.
In some embodiments, the non-small cell lung cancer of non-squamous
histology is lung adenocarcinoma or lung large cell carcinoma.
in some embodiments, during the chemotherapy the amount of docetaxel
administered is 75mg/m2 intravenously to the human patient over a
period of 1 hour.
In some embodiments, during the chemotherapy the amount of docetaxel
administered is less than 75mg/m2 intravenously to the human patient.
In some embodiments, during the chemotherapy the docetaxel is
administered to the human patient on the first day of each of at
least one three-week chemotherapy cycle.
n some embodiments, the anti-clusterin oligonucleotide is
administered to the human patient intravenously in an aqueous
solution comprising sodium ions.
In some embodiments, the anti-clusterin oligonucleotide is
administered to the human patient 3 times within a 5 to 9 day period
before the first day of chemotherapy and then once weekly beginning
on the first day of chemotherapy.
n some embodiments, the lung cancer is nonresectable, advanced or
metastatic non-small cell lung cancer.
In some embodiments, the lung cancer has been histologically or
cytologically confirmed and is, unresectable, advanced or metastatic
(Stage IV per A CC 7th edition TNM staging) .
In some embodiments, the lung cancer is Stage IV disease (according
to the IASLC 7th edition TNM staging, including subjects with pleural
effusion who were previously classified as Stage IIIB) that is not
amenable to either surgery or radiation therapy of curative intent.
In some embodiments, the human patient has not received treatment
for non-small cell lung cancer for at least 1 year.
In some embodiments, the human patient has not received a
chemotherapeutic agent for the treatment of non-small cell lung
cancer for at least 1 year.
In some embodiments, the human patient has before initiation of the
periodic administration received a chemotherapeutic agent for the
treatment of lung cancer.
In some embodiments, the chemotherapeutic agent was a platinum-based
chemotherapeutic agent.
In some embodiments, the human patient is afflicted with non-small
cell lung cancer of non-squamous histology.
In some embodiments, the human patient is afflicted with Stage IV
non-small cell lung cancer of non-squamous histology.
In some embodiments, a method of the invention for treating a human
patient afflicted with non-small cell lung cancer of non-squamous
histology or Stage IV non-small cell lung cancer further comprises
the steps of:
i ) measuring the level of serum clusterin present in the
blood of the human patient prior to the administration of the
anti-clusterin oligonucleotide;
ii) determining whether the level of serum clusterin present
in the human patient is lower than a predetermined upper
threshold level of baseline serum clusterin below which a
human patient is likely to substantially benefit from anticlusterin
therapy; and
iii) administering the anti-clusterin oligonucleotide only if
the level of serum clusterin present in the blood of the human
patient is lower than the predetermined upper threshold level
of baseline serum clusterin.
In some embodiments, in step i ) the measuring is performed after
initiation of the chemotherapy.
In some embodiments, the predetermined upper threshold level of
baseline serum clusterin is 75 g /mL .
In some embodiments, a method of the invention for treating a human
patient afflicted with non-small cell lung cancer of non-squamous
histology or Stage IV non-small cell lung cancer further comprises
the steps of:
i ) administering to the human patient the anti-clusterin
oligonucleotide in an initial dosage and treatment protocol;
ii) thereafter testing the human patient to determine a level
of serum clusterin after a period of treatment with the anticlusterin
oligonucleotide intended to reduce clusterin
expression;
iii) determining an adjusted dosage and treatment protocol
based on the determined level of serum clusterin; and
iv) administering to the human patient the anti-clusterin
oligonucleotide in accordance with the adjusted dosage and
treatment protocol.
n some embodiments, the determined level of serum clusterin after a
period of treatment with the anti-clusterin oligonucleotide intended
to reduce clusterin expression is above a predetermined post anticlusterin
oligonucleotide initiation threshold level.
In some embodiments, the predetermined post anti-clusterin
oligonucleotide initiation threshold level is 30 g/m .
In some embodiments, the adjusted dosage and treatment protocol
comprises administration of the anti-clusterin oligonucleotide to
the human patient two or three times per week.
The present invention also provides a combination for treating a
human patient afflicted with unresectable, advanced or metastatic
non-small cell lung cancer, comprising chemotherapy comprising
docetaxel; and an anti-clusterin oligonucleotide having the sequence
CAGCAGCAGAGTCTTCATCAT (Seq. ID No. : 1), wherein the anti-clusterin
oligonucleotide has a phosphorothioate backbone throughout, has
sugar moieties of nucleotides 1-4 and 18-21 bearing 2'-0-
methoxyethyl modifications, has nucleotides 5-17 which are
'deoxynucleotides, and has 5-methylcytosines at nucleotides 1 , 4 ,
and 19. In some embodiments, the combination is for treating a human
patient afflicted with non-small cell lung cancer of non-squamous
histology or Stage IV non-small cell lung cancer.
The present invention also provides a composition for treating a
human patient afflicted with unresectable, advanced or metastatic
non-small cell lung cancer, comprising chemotherapy comprising
docetaxel; and an anti-clusterin oligonucleotide having the sequence
CAGCAGCAGAGTCTTCATCAT (Seq. ID No .: 1), wherein the anti-clusterin
oligonucleotide has a phosphorothioate backbone throughout, has
sugar moieties of nucleotides 1-4 and 18-21 bearing 2'-0-
methoxyethyl modifications, has nucleotides 5-17 which are
'deoxynucleotides, and has 5-methylcytosines at nucleotides 1 , 4 ,
and 19. In some embodiments, the composition is for treating a human
patient afflicted with non-small cell lung cancer of non-squamous
histology or Stage IV non-small cell lung cancer.
The present invention also provides a pharmaceutical composition for
treating a human patient afflicted with unresectable, advanced or
metastatic non-small cell lung cancer, the composition comprising
chemotherapy comprising docetaxel; and an anti-clusterin
oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID
No. : 1 ) , wherein the anti-clusterin oligonucleotide has a
phosphorothioate backbone throughout, has sugar moieties of
nucleotides 1-4 and 18-21 bearing 2 '-O-methoxyethyl modifications,
has nucleotides 5-17 which are 2 'deoxynucleotides, and has 5-
methylcytosines at nucleotides 1 , 4 , and 19. In some embodiments,
the pharmaceutical composition is for treating a human patient
afflicted with non-small cell lung cancer of non-squamous histology
or Stage IV non-small cell lung cancer.
Some embodiments of the present invention relate to the use of a
composition comprising chemotherapy comprising docetaxel; and an
anti-clusterin oligonucleotide having the sequence
CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1), wherein the anti-clusterin
oligonucleotide has a phosphorothioate backbone throughout, has
sugar moieties of nucleotides 1-4 and 18-21 bearing 2'-0-
methoxyethyl modifications, has nucleotides 5-17 which are
2 'deoxynucleotides, and has 5-methylcytosines at nucleotides 1 , 4 ,
and 19, for treatment of a human patient afflicted with unresectable,
advanced or metastatic non-small cell lung cancer. In some
embodiments, the use of the composition is for treatment of a human
patient afflicted with non-small cell lung cancer of non-squamous
histology or Stage IV non-small cell lung cancer.
Some embodiments of the present invention relate to the use of a
composition comprising chemotherapy comprising docetaxel; and an
anti-clusterin oligonucleotide having the sequence
CAGCAGCAGAGTCTTCATCAT (Seq. ID No. : 1), wherein the anti-clusterin
oligonucleotide has a phosphorothioate backbone throughout, has
sugar moieties of nucleotides 1-4 and 18-21 bearing 2'-0-
methoxyethyl modifications, has nucleotides 5-17 which are
2 'deoxynucleotides , and has 5-methylcytosines at nucleotides 1 , 4 ,
and 19, for preparation of a medicament for treatment of a human
patient afflicted with unresectable, advanced or metastatic nonsmall
cell lung cancer. In some embodiments, the use of the
composition is for preparation of a medicament for treatment of a
human patient afflicted with non-small cell lung cancer of nonsquamous
histology or Stage IV non-small cell lung cancer.
The present invention also provides a package for use in the
treatment of a human patient afflicted with unresectable, advanced
or metastatic non-small cell lung cancer, comprising chemotherapy
comprising docetaxel; and an anti-clusterin oligonucleotide having
the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No. : 1), wherein the
anti-clusterin oligonucleotide has a phosphorothioate backbone
throughout, has sugar moieties of nucleotides 1-4 and 18-21 bearing
'-O-methoxyethyl modifications, has nucleotides 5-17 which are
'deoxynucleotides, and has 5-methylcytosines at nucleotides 1 , 4 ,
and 19, and instructions for the use of the chemotherapy in
combination with the anti-clusterin oligonucleotide for the
treatment of unresectable, advanced or metastatic non-small cell
lung cancer, in some embodiments, the package is for use in the
treatment of a human patient afflicted with non-small cell lung
cancer of non- squamous histology or Stage IV non-small cell lung
cancer .
The present invention also provides a chemotherapy comprising
docetaxel for use in combination with an anti-clusterin
oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID
No. : 1 ) , wherein the anti-clusterin oligonucleotide has a
phosphorothioate backbone throughout, has sugar moieties of
nucleotides 1-4 and 18-21 bearing 2 '-O-methoxyethyl modifications,
has nucleotides 5-17 which are 'deoxynucleotides , and has 5-
methylcytosines at nucleotides 1 , 4 , and 19, for treating of a human
patient afflicted with unresectable, advanced or metastatic nonsmall
cell lung cancer; or an anti-clusterin oligonucleotide having
the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1), wherein the
anti-clusterin oligonucleotide has a phosphorothioate backbone
throughout, has sugar moieties of nucleotides 1-4 and 18-21 bearing
2 '-O-methoxyethyl modifications, has nucleotides 5-17 which are
'deoxynucleotides, and has 5-methylcytosines at nucleotides 1 , 4 ,
and 19, for use in combination with a chemotherapy comprising
docetaxel, for treating of a human patient afflicted with
unresectable, advanced or metastatic non-small cell lung cancer. In
some embodiments, the chemotherapy in combination with the anticlusterin
oligonucleotide is for treating a human patient afflicted
with non-small cell lung cancer of non-squamous histology or Stage
IV non-small cell lung cancer. In some embodiments, the anticlusterin
oligonucleotide in combination with the chemotherapy is
for treating a human patient afflicted with non-small cell lung
cancer of non-squamous histology or Stage IV non-small cell lung
cancer .
It is understood that where a parameter range is provided, all
integers within that range, and tenths thereof, are also provided by
the invention. For example, "0.2-5 mg/kg/day" is a disclosure of 0.2
mg/kg/day, 0.3 mg/kg/day, 0.4 mg/kg/day, 0.5 mg/kg/day, 0.6 mg/kg/day
etc. up to 5.0 mg/kg/day.
Taxanes
Taxanes are a class of chemotherapeutic including paclitaxel,
docetaxel, baccatin III, baccatin V , taxol B (cephalomannine) , taxol
C , taxol D , taxol E , taxol F , taxol G , cabazitaxel, larotaxel,
ortataxel (14 beta-hydroxydeacetyl baccatin III), tesetaxol, 10-
deacetyl baccatin III, 7-xylosyl-10-deacetyl cephalomannine, 7-
xylosyl - 0-deacetyl paclitaxel, 10-deacetyl cephalomannine, 7-
xylosyl-10-deacetyl taxol C , 10-deacetyl paclitaxel, 7-xylosyl
paclitaxel, 10-deacetyl taxol C , 10-deacetyl-7-epi cephalomaunine, 7-
xylosyl taxol C , 10-deacetyl-7-epipaclitaxel, 7-epi cephalomaunine,
7-epi paclitaxel, 7-O-methylthiomethyl paclitaxel, 7-deoxy docetaxel,
taxanime M , PG-paclitaxel, DHA-paclitaxel .
Taxanes have been approved by the FDA including paclitaxel (e.g., for
NSCLC, AlDS-related Kaposi sarcoma, breast cancer and ovarian cancer) ,
cabazitaxel (e.g., for prostate cancer), and docetaxel (e.g., for
NSCLC, breast cancer, gastric (stomach) cancer, prostate cancer,
squamous cell carcinoma of the head and neck) .
Taxanes also include derivatives of these compounds, particularly
ester and ether derivatives and pharmaceutically acceptable salts
thereof . Taxanes may also include any drug or derivative of a drug
which has a carbon framework substantially identical to the framework
of the above taxanes.
Without being bound to any particular theory, taxanes may achieve
their therapeutic effect by interfering with cell division by
stabilizing tubulin in the microtubule. Taxanes may be naturally
occurring, semi-synthetic, or synthetic compounds. Semi-synthetic
taxanes may be prepared by modification of a known or naturally
occurring taxane. The taxanes may be prepared as a fatty acid-bound,
peptide-bound, albumin-bound or other protein-bound suspension or
dissolved in a solution, such as polyoxyl 35 or polysorbate 80 .
Paclitaxel
Paclitaxel is sold under the brand names Taxol and Abraxane*, and has
been used for the treatment of NSCLC (Taxol Package Insert, Bristol-
Myersw Squibb Company (Princeton, NJ, USA); D'Addario et al ., 2010 ;
National Comprehensive Cancer Network Clinical Practice Guidelines in
Oncology, Non-Small Cell Lung Cancer, v . . 2010 ) .
Paclitaxel is known to cause several side effects. Neutropenia, the
most frequent side effect, is profound but generally of short
duration. Peripheral neuropathy, myalgia, and arthralgia are usually
noted with the administration of higher doses of paclitaxel ( 175
mg/m 2) for several cycles. Paclitaxel can cause rapid and complete
alopecia. Other toxicities include: mild to moderate nausea,
vomiting, diarrhea, and mucositis.
For paclitaxel therapy, standard steroid premedication to prevent
severe hypersensitivity reactions and antiemetics may be given
according to institutional practice. According to the package insert,
the recommended premedication consists of dexamathasone 20 mg p.o.
administered twice, approximately 12 and 6 hours before paclitaxel,
diphenhydramine {or its equivalent) 50 mg i.v./.p.o. 30 to 60
minutes prior to paclitaxel, and cimetidine (300 mg) or ranitidine
(50 mg) i.v./p.o. 30 to 60 minutes prior to paclitaxel.
Docetaxel
Docetaxel is sold under the brand name Taxotere® and has been used
for second-line treatment of NSCLC (Taxotere® Prescribing
Information, Sanof i-Aventis LLC, May 2010, (Bridgewater, NJ, USA).
Docetaxel has also been used as treatment for metastatic breast
cancer, early-stage breast cancer and metastatic androgen
independent prostate cancer.
Docetaxel is known to cause several side effects, the most common of
which are infections, neutropenia, anemia, febrile neutropenia,
hypersensitivity, thrombocytopenia, neuropathy, dysgeusia, dyspnea,
constipation, anorexia, nail disorders, fluid retention, asthenia,
pain, nausea, diarrhea, vomiting, mucositis, alopecia, skin
reactions and myalgia.
Neutropenia (<2,000 neutrophils/mm3 ) occurs in virtually all
patients given 60-100 mg/m 2 of Docetaxel and grade 4 neutropenia
(<500 cells/mm 3) occurs in 85% of patients given 100 mg/m 2 and 75% of
patients given
60 mg/m 2 .
The incidence of treatment-related mortality associated with
Docetaxel therapy is increased in patients with abnormal liver
function, in patients receiving higher doses, and in patients with
non-small cell lung carcinoma and a history of prior treatment with
platinum-based chemotherapy who receive Taxotere® as a single agent
at a dose of 100 mg/m 2.
Patients may be premedicated with corticosteroids, such as
dexamethasone, to each Docetaxel administration to reduce the
incidence of and severity of fluid retention.
Docetaxel may be prescribed as a one-hour infusion every three weeks
or as weekly administration (John D . Hainsworth, "Practical Aspects
of Weekly Docetaxel Administration Schedules" September 2004, vol. 9 ,
no. 5 , 538-545)
Platinum-based Chemotherapeutic Agents
Platinum-based chemotherapeutic agents are a class of chemotherapydrugs.
Platinum-based chemotherapeutic agents include cisplatin,
carboplatin (also known as paraplatin) , nedaplatin, oxaliplatin,
triplatin tetranitrate, satraplatin, iproplatin, lobaplatin,
picoplatin and combinations thereof. Platinum-based chemotherapeutic
agents are approved by the FDA and include cisplatin (NSCLC, bladder
cancer, cervical cancer, malignant mesothelioma, ovarian cancer,
squamous cell carcinoma of the head and neck, and testicular cancer) ,
oxaliplatin (colorectal cancer and stage III colon cancer) , and
carboplatin (NSCLC and ovarian cancer) are approved by the FDA.
Platinum-based chemotherapeutic agents also include derivatives of
these compounds, particularly ester and ether derivatives and
pharmaceutically acceptable salts thereof. Platinum-based
chemotherapeutic agents may also include any drug or derivative of a
drug which has a carbon framework substantially identical to the
framework of the above platinum-based chemotherapeutic agents.
Without being bound to any particular theory, platinum-based
chemotherapeutic agents can be classified as alkylating or
alkylating-like agents because they interact with DNA irreversibly
through cross-linking and platinum-DNA adduct forming reactions
which prevent DNA repair or replication and result in apoptosis of
cells.
Common side-effects of platinum-based chemotherapeutic agents
include nephrotoxicity, neurotoxicity, nausea and vomiting,
ototoxicity, electrolyte disturbance, myelotoxicity, and hemolytic
anemia .
Carboplatin
Carboplatin is sold under the brand name Paraplatin ® , and has been
used for the treatment of NSCLC (Carboplatin Package Insert, Bedford
Labs (Bedford, OH, USA); D'Addario et al., 2010; National
Comprehensive Cancer Network Clinical Practice Guidelines in
Oncology, Non-Small Cell Lung Cancer, V .2 .2010).
Bone marrow suppression is the major dose-limiting toxicity of
carboplatin. Nausea, vomiting, and loss of appetite are usually mild
to moderate. Less common adverse events includes ototoxicity,
nephrotoxicity, neurotoxicity, hypomagnesemia, edema, alopecia,
amenorrhea, CNS toxicity (dizziness, blurred vision) , hypercalcemia,
abnormal liver function tests, allergic reactions, and veno-occlusive
disease. For full safety information, please refer to the carboplatin
package insert, a copy of which is incorporated herein by reference.
Terms
As used herein, and unless stated otherwise, each of the following
terms shall have the definition set forth below.
As used herein, ant i- lus er n therapy" is therapy which reduces the
expression of clusterin. An anti-clusterin therapy may be an anticlusterin
oligonucleotide.
Antisense oligonucleotides (ASOs) are stretches of single-strand
deoxyribonucleic acid (DNAS complementary to messenger ribonucleic
acid (mKNA) regions of a target gene. Because cellular ribosomal
machinery translates RNA into proteins, expression of specific
proteins can be reduced by blocking or reducing this translation.
As used herein, "anti-clusterin oligonucleotide" refers to an
antisense oligonucleotide which reduces clusterin expression, and
comprises a nucleotide sequence that is complementary to clusterinencoding
mKNA. An example of an anti-clusterin oligonucleotide is
custirsen.
As used herein, "custirsen" refers to an anti-clusterin
oligonucleotide having nucleotides in the sequence
CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1), wherein the anti-clusterin
oligonucleotide has a phosphorothioate backbone throughout, has sugar
moieties of nucleotides 1-4 and 18-21 bearing 2 '-O-methoxyethyl
modifications, has nucleotides 5-17 which are 'deoxynucleotides, and
has -methyl cytosines at nucleotides 1 , 4 , and 19. Custirsen can be
in the form of Custirsen Sodium.
As used herein, "a human patient afflicted with" a condition, e.g.
non-small cell lung cancer, means a human patient who was been
affirmatively diagnosed to have the condition.
As used herein, a cancer with "non-squamous histology" is a cancer
that is not predominantly of squamous histology as determined by
histological methods known in the art. Subtypes of NSCLC of nonsquamous
histology include but are not limited to lung adenocarcinoma,
and lung large cell carcinoma. As used herein, "squamous" means
derived from, originating from, and/or consisting of a stratified
epithelium that predominantly comprises squamous cells.
As used herein, "predominantly of squamous histology" means >50% of
squamous histology as determined by histological methods known in the
art.
As used herein, a cancer with "squamous histology" is a cancer
with >50 squamous histology as determined by histological methods
known in the art. A non-limiting example of a lung cancer which has
squamous histology is squamous cell lung cancer, which is a type of
non-small cell lung cancer.
Aspects of the invention may be applied to the treatment of NSCLC
that has metastasized, or is metastasizing through various routes,
including, but not limited to the lymph nodes.
As used herein, "taxane/platinum-based chemotherapeutic agent" means
a taxane and a platinum-based chemotherapeutic agent.
As used herein, "paclitaxel/carboplatin" means paclitaxel and
carboplatin.
As used herein, "docetaxel/platinum-based chemotherapy" means
docetaxel and a platinum-based chemotherapeutic agent .
"Combination" means either at the same time and frequency, or more
usually, at different times and frequencies as custirsen, as part of
a single treatment plan. Aspects of the invention include the
administration of custirsen before, after, and/or during the
administration of the taxane and/or a platinum-based chemotherapeutic
agent. Furthermore, aspects of the invention include the
administration of custirsen before, after, and/or during the
administration of carboplatin. A taxane and a platinum- ased
chemotherapeutic agent may therefore be used, in combination with
custirsen according to the invention, but yet be administered at
different times, different dosages, and at a different frequency,
than custirsen and/or each other. Aspects of the invention also
include the administration of custirsen before, after, and/or during
the administration of a taxane and/or a platinum-based
chemotherapeutic agent. A taxane and/ or a platinum-based
chemotherapeutic agent may therefore be used, in combination with
custirsen according to the invention, but yet be administered at
different times, different dosages, and at a different frequency,
than custirsen and/or each other. For example, paclitaxel and
carboplatin may be used, in combination with custirsen according to
the invention, but yet be administered at different times, different
dosages, and at a different frequency, than custirsen and/or each
other. As another example, docetaxel may be used, in combination with
custirsen according to the invention, but yet be administered at
different times, different dosages, and at a different frequency,
than custirsen and/or each other.
As used herein, "lung adenocarcinoma" encompasses any malignant
epithelial NSCLC which has glandular and/or duct differentiation, and
excludes any NSCLC that is not predominantly non-squamous . Nonlimiting
examples of subdivisions of the lung adenocarcinoma subtype
of NSCLC are acinar, papillary, BAC, and solid adenocarcinoma with
mucin production. One of skill in the art will recognize that lung
adenocarcinomas comprising combinations of two or more of these or
other subdivisions are common.
As used herein, "lung large cell carcinoma" means a NSCLC of nonsquamous
histology that is not lung adenocarcinoma.
One of skill in the art will realize that NSCLC, as well as its
subtypes, including lung adenocarcinoma and lung large cell carcinoma,
are heterogeneous with multiple histological variants. Therefore, the
term "non-small cell lung cancer of non- squamous histology"
encompasses all types and subdivisions of NSCLC that are
predominantly non- squamous .
As used herein, "Stage IV non-small cell lung cancer" means NSCLC
comprising a tumor, wherein i ) the NSCLC has metastasized to another
region of the body outside the lungs or to a contralateral lobe of
the lungs, and/or ii) there is malignant pleural effusion, malignant
pericardial effusion, and/or a pleural nodule.
A s used herein, "lesion" means a NSCLC growth or tumor.
The finding of a "new lesion" should be unequivocal, i.e. not
attributable to difference in scanning technique, change in imaging
modality, or findings thought to represent something other than
cancer growth (e.g. some new bone lesions may be simply healing or a
flare of pre-existing lesions; or necrosis of a liver lesion may be
reported on a CT scan report as a "new" cystic lesion without being a
"new lesion" as used herein) .
As used herein, "measurable disease" means having a NSCLC tumor with
at least one dimension (longest diameter to be recorded) of at least
10mm by CT scan, M or caliper measurement, or a malignant lymph
node ³ 15mm in short axis by CT scan, MRI or caliper measurement.
All other NSCLC lesions, including small tumors (longest diameter
<10mm or pathological lymph nodes with 10 to <15mm short axis) are
considered "non-measurable disease" as used herein. Lesions
considered truly non-measurable include: leptomeningeal disease,
malignant ascites, malignant pleural or pericardial effusion,
inflammatory breast disease, lymphangitic involvement of skin or lung,
abdominal masses/abdominal organomegaly identified by physical exam
that is not measurable by reproducible imaging techniques . Bonelesions:
Bone scan, PET scan or plain films are not considered
adequate imaging techniques to measure bone lesions. However, these
techniques can be used to confirm the presence or disappearance of
bone lesions.
As used herein, "progression of measurable disease" will have
occurred if there is an increase of at least 20% in the sum of the
longest diameter(s) of all measurable lesion(s), taking as reference
the smallest su recorded since the beginning of treatment ibaseline
or nadir) , wherein the sum has an absolute increase of at least 5mm,
or there is an appearance of one or more new soft tissue (visceral or
nodal) measurable lesions after treatment has begun. These criteria
should be met on chest, abdomen, or pelvic CT scan(s) or MRI, unless
otherwise specified, such as by caliper measurement.
As used herein, "progression of non-measurable disease" will have
occurred if there is an appearance of one or more new lesions that
does not qualify as progression of measurable disease.
As used herein, "metastasis involving lymph nodes" means having a
malignant lymph node that was not previously irradiated and is >15mm
in short axis when assessed by CT scan, MRI, or caliper measurement.
As used herein, "time to progression" of measurable disease is the
amount of time between the beginning of treatment and the progression
of measurable disease. "Time to progression" of non-measurable
disease is the amount of time between the beginning of treatment and
the progression non-measurable disease.
As used herein, "free of progression of measurable disease" means
that there has not been is an increase of at least 20% in the sum of
the longest diameter(s) of all measurable lesion(s), taking as
reference the smallest sum recorded since the beginning of treatment
(baseline or nadir) , wherein the sum has an absolute increase of at
least 5mm, and there has not been an appearance of one or more new
soft tissue (visceral or nodal) tumor lesions after treatment has
begun, as determined by chest, abdomen, or pelvic CT scan(s) or MRI,
unless otherwise specified, such as by caliper measurement.
As used herein, "free of progression of non-measurable disease" means
that there has been no appearance of one or more new lesions that are
considered non-measurable.
As used herein, "free of progression of the non-small cell lung
cancer" means free of progression of both measurable and nonmeasurable
disease.
As used herein, "rate of progression of the non-small cell lung
cancer" means the frequency at which progression of measurable
disease and/or non-measurable disease is observed over the course of
two or more time points following an initial, baseline observation.
Progression of measurable disease and/or non-measurable disease may
be determined at various time points, including weekly, monthly,
and/or at any other time point and/or points indicated. Non-limiting
examples of time points at which measurable and/or non-measurable
disease may be determined include any week which is 1-26 weeks after
the initiation of treatment with custirsen and a taxane, or
custirsen and a taxane and a platinum-based chemotherapeutic agent,
or custirsen and/or paclitaxel/carboplatin, or custirsen and
docetaxel, or custirsen and docetaxel, such as at 8 , 14, 20, and/ or
26 weeks.
As used herein, "substantial progression of measurable disease" will
have occurred if there is an increase of at least 30% in the sum of
the longest diameter(s) of all measurable lesion(s), taking as
reference the smallest sum recorded since the beginning of treatment
(baseline or nadir) , wherein the sum has an absolute increase of at
least 7.5mm after treatment has begun. These criteria should be met
on chest, abdomen, or pelvic CT scan(s) or MRI, unless otherwise
specified.
As used herein, an "amount" or "dose" of custirsen as measured in
milligrams refers to the milligrams of custirsen present in a
preparation, regardless of the form of the preparation.
As used herein, "effective" when referring to an amount of a taxane,
a platinum-based chemotherapeutic agent, custirsen, paclitaxel,
docetaxel, or carboplatin, or any combination thereof refers to the
quantity of taxane, a platinum-based chemotherapeutic agent,
custirsen, paclitaxel, docetaxel, or carboplatin, or any combination
thereof that is sufficient to yield a desired therapeutic response
without undue adverse side effects (such as toxicity, irritation, or
allergic response) commensurate with a reasonable benefit/risk ratio
when used in the manner of this invention.
As used herein, "treating" encompasses, e.g., inhibition, regression,
or stasis of the progression of NSCLC. Treating also encompasses the
prevention or amelioration of any symptom or symptoms of NSCLC.
As used herein, "inhibition" of disease progression or disease
complication in a subject means preventing or reducing the disease
progression and/or disease complication or symptom in the subject.
As used herein, a "symptom" associated with NSCLC includes any
clinical or laboratory manifestation associated with NSCLC and is
not limited to what the subject can feel or observe. Symptoms of
NSCLC include but are not limited to chest pain, pleural effusions,
pulmonary edema, dyspnea, hemoptysis, wheezing, cachexia, shortness
of breath, and dysphagia.
As used herein, an "adverse event" or "AE" means any untoward
medical occurrence in a clinical trial subject administered a
medicinal product and which does not have a causal relationship with
the treatment. An adverse event can therefore be any unfavorable and
unintended sign including an abnormal laboratory finding, symptom,
or diseases temporally associated with the use of an investigational
medicinal product, whether or not considered related to the
investigational medicinal product. A new condition or the worsening
of a pre-existing condition may be considered an AE. Stable chronic
conditions such as arthritis that is present prior to study entry
and do not worsen during treatment are not considered AEs. Worsening
of the disease may be measured by clinical and radiological
parameters, and is only an AE if the outcome is more serious than
would normally be expected from the normal course of the disease in
a particular subject.
As used herein, "pharmaceutically acceptable carrier" refers to a
carrier or excipient that is suitable for use with humans and/or
animals without undue adverse side effects (such as toxicity,
irritation, and allergic response) commensurate with a reasonable
benefit/risk ratio. t can be a pharmaceutically acceptable solvent,
suspending agent or vehicle, for delivering the instant compounds to
the subject. An example of a pharmaceutically acceptable carrier is
a nanoparticle. The nanoparticle may be a protein, such as albumin.
A taxane, .such as Docetaxel or Paclitaxel, and/ or a platinum-based
chemotherapeutic agent, such as carboplatin, may be conjugated to a
nanoparticle. An ' example of a taxane bound to a nanoparticle
includes, but is not limited to nanoparticle paclitaxel (nabpaclitaxel)
, which is sold under the brand name Abraxane .
The following abbreviations are used herein:
AE Adverse Event
ALT Alanine Transaminase (SGPT)
ANC Absolute Neutrophil Count
ASCO American Society of Clinical Oncology
ASO Antisense Oligonucleotide
AST Aspartate Transaminase (SGOT)
AUG Area Under the Curve
AV Atrioventricular
AWP Alive Without Progression
b hCG Beta Human chorionic gonadotropin
BSA Body Surface Area
CA Competent Authority
CD S Clinical Data Management System
CRA Clinical Research Associate
CRF Case Report Form
CRO Clinical Research Organization
CRPC Castrate Resistant Prostate Cancer
CSU Clinical Supplies Unit
CT Computed Tomography
CTCAE Common Terminology Criteria for Adverse Events
Cerebrovascular Accident
Deciliter
Deoxyribonucleic Acid
Data Monitoring Committee
Ethics Committee
Electrocardiogram
Eastern Cooperative Oncology Group
Electronic Data Capture
Epidermal Growth Factor Receptor
European Medicines Agency
End of Infusion
Excision Repair Cross Complementation Group 1
European Union
Food and Drug Administration
Good Clinical Practice
Granulocyte Colony Stimulating Factor
Glomerular Filtration Rate
Gamma Glutamyltransferase
Heart Rate/ Hazard Ratio
International Association for the Study of Lung
Cancer
Investigator 's Brochure
Informed Consent Form
International Conference on Harmonization
Investigational New Drug
Investigational Medicinal Product
Institutional Review Board
Innovative Research and Development
Intent to Treat
Intravenous
Interactive Voice Response System
Interactive Web Response System
Potassium
Kilogram
Local Clinical Management
Longest Diameter
Lactate Dehydrogenase
Liver Function Tests
Meter Squared
Medical Dictionary for Regulatory Activities
Milligram
Minute
Milliliter
Methoxyethyl
Magnetic Resonance Imaging
Sodium
National Cancer Institute
Nonsteroidal Anti- inflammatory Drugs
Non-small Cell Lung Cancer
Overall Survival
Phyical Examination
Positron Emission Tomography
Per Os
Progression Free Survival
Quality Assurance
Red Blood Cell (Count)
RECIST Response Evaluation Criteria n Solid Tumors
R A Ribonucleic Acid
SAE Serious Adverse Event
SAP Statistical Analysis Plan
SD Standard Deviation
SGOT Serum Glutamate Oxaloacetate Transaminase
SGPT Serum Glutamate Pyruvate Transaminase
SOI Start of Infusion
SOP Standard Operating Procedure
SUSAR Suspected Unexpected Serious Adverse Reaction
T M TNM Classification of Malignant Tumors (Tumor,
Nodes, Metastases)
ULN Upper Limit of Normal
WBC White Blood Cell (Count)
WHO World Health Organization
In some embodiments of the invention, the anti-tumor activity of the
taxane regimen is enhanced when combined with custirsen-induced
clusterin suppression. In some embodiments of the invention, the
anti-tumor activity of the taxane /platinum-based chemotherapeutic
agent regimen is enhanced when combined with custirsen-induced
clusterin suppression. In some embodiments of the invention, the
anti-tumor activity of the paclitaxel/carboplatin regimen is
enhanced when combined with custirsen-induced clusterin suppression.
In some embodiments of the invention, the anti-tumor activity of a
docetaxel regimen is enhanced when combined with custirsen-induced
clusterin suppression, since suppressing clusterin expression may in
turn lead to increased apoptosis, custirsen has effect on disease
progression and survival in advanced NSCLC as described herein.
Threshold Levels of Baseline Serum Clusterin
The methods of the present invention include performing at least one
test to determine a level of serum clusterin. This test may be done
to determine a "baseline level of serum clusterin" which is the
level of clusterin present in the human patient prior to the
initiation of treatment intended to reduce clusterin expression.
As used herein, an "upper threshold level" refers to a baseline
level of serum clusterin present in a human patient below which the
human patient is likely to substantially benefit from anti-clusterin
therapy. In the present invention, there is a statistically
significant difference in the efficacy of treatment of lung cancer
(for example, NSCLC) between populations below and above the upper
threshold level. o "substantially benefit from anti-clusterin
therapy" means to exhibit treatment of a symptom of lung cancer, the
degree of amelioration or prevention of which is improved when
compared to a representative patient whose baseline clusterin levels
are above the upper threshold level. For example, to substantially
benefit from anti-clusterin therapy may mean having prolonged
survival as compared to a representative patient whose baseline
clusterin levels are above the upper threshold level.
In some embodiments of the invention, a decision on whether to treat
the human patient with custirsen is made based on the whether the
measured baseline value is above or below a predetermined threshold
level of serum clusterin. In some embodiments, this threshold is
between 30 and 75 g/mL, although a person skilled in the art will
recognize that the selection of specific threshold values may be
dependent on the type of lung cancer, and also on the level of
predictability of therapeutic efficacy that is desired.
In various embodiments of the present invention, a determination of
baseline clusterin level is made and compared to a predetermined
threshold. The threshold value is determined by a statistical
analysis of data for a population of patients for whom both baseline
clusterin levels, and periods of survival are known. It will be
appreciated that the specific numerical value may be refined as more
data becomes available. Furthermore, the specific numerical value
employed will depend on the level of predictability of extended
survival that is desired. Thus, if one wishes to be very sure that
the use of custirsen will provide for longer survival, then a lower
threshold value would be selected than if only a reasonable
expectation of longer survival is required.
In some embodiments of the invention, the threshold value is
selected as the median baseline clusterin value for a population of
patients without selection for eventual survival time.
In some embodiments of the invention, the threshold value is
determined by fitting baseline values and survival data a
statistical model such as the Cox proportional hazards (PH) model
with baseline clusterin as sole predictor.
In some embodiments of the invention, the threshold level of
baseline serum clusterin is between 30 and 75ug/m . The threshold
level of baseline serum clusterin may be 30, 35, 40, 45, 50, 55, 60,
65, 70, or 75 g/m , or any level between any of these possible
levels.
n some embodiments of the invention, the threshold level of
baseline serum clusterin is 3 g/m .
In some embodiments of the invention, the threshold level of
baseline serum clusterin is g/mL .
In some embodiments of the invention, the threshold level of
baseline serum clusterin is 55 g/m .
In some embodiments of the invention, the threshold level of
baseline clusterin is 75 g/m .
In some aspects of the invention, the level of serum clusterin may
be determined at a time after initiation of treatment with an anticlusterin
oligonucleotide such as custirsen. Testing the level of
serum clusterin may be performed once or multiple times for a human
patient. Suitably, this test is performed, one day, one week, two
weeks, three weeks or one month after the initiation of treatment
with custirsen, or multiple tests may be performed at weekly,
biweekly, tri-weekly or monthly intervals. In some embodiments,
tests are performed before the administration of chemotherapy, such
as a taxane or a taxane and a platinum-based chemotherapeutic agent.
In some embodiments, tests are performed after the administration of
chemotherapy. In some embodiments, tests are performed at the
beginning or end of one or more chemotherapy cycles comprising, e.g.
taxane/platinum-based chemotherapeutic agent, or
paclitaxel/carboplatin, or docetaxel during which the human patient
also receives custirsen.
Based on the results of the serum clusterin determination, an
effective dosage amount and schedule for custirsen is selected. When
a post- treatment level of serum clusterin is determined and used,
the effective dosage amount and schedule is referred to herein as an
"adjusted dosage and treatment protocol." The "adjusted dosage and
treatment protocol" provides custirsen to the human patient at
levels that are predicted to have optimized therapeutic efficacy in
view of the serum clusterin levels .
Once a determination of serum clusterin is made after the initiation
of treatment with custirsen, an effective dosage and schedule are
determined that takes the serum clusterin value into account in
order to maximize survival duration for the human patient . In
general, higher levels of serum clusterin indicate a higher dosage
and/or more frequent custirsen administration, provided the dosage
of custirsen does not exceed 640 g . The specific dosage and
schedule that is selected will depend on a number of factors,
including the human patient being treated. In some cases, a "post
anti-clusterin oligonucleotide initiation threshold" value may be
set which is indicative of a good prognosis for effective therapy.
The post anti-clusterin oligonucleotide initiation threshold may
also be referred to as a "post custirsen initiation threshold". In
this case, human patients below this threshold may be treated with a
base custirsen dose/protocol. In some embodiments, a suitable base
custirsen dose/protocol is 640 mg of custirsen per dose, independent
of the weight of the human patient, with an administration schedule
of once a week, optionally preceded by an initial loading of three
doses in the first week. Human patients with post custirsen
initiation serum clusterin levels higher than the post custirsen
initiation threshold are suitably treated with more frequent dosages,
for example twice or three times a week even after the loading week.
In some embodiments of the invention, a dosage of custirsen lower
than 640 mg custirsen is delivered more frequently than once per
week following the loading week. This same post custirsen initiation
threshold, or a different threshold value, may be used if the
initiation of chemotherapy (e.g. with paclitaxel/carboplatin or
docetaxel) is to be delayed during an initial period of clusterin
reduction. Such a period may be one, two or three weeks, or until
the baseline serum clusterin measurement drops below a determined
threshold.
The post custirsen initiation threshold level of serum clusterin may
be between 20pg/mL and 75pg/mL. The post custirsen initiation
threshold level may be 20, 25, 30, 35, 40, 45, 50, 55 60, 65, 70,
or 75pg/mL, or any level between any of these possible levels.
Determining Serum Clusterin Levels
In the methods of the present invention, the manner in which the
determination of serum clusterin is done is not critical.
One method for determining serum clusterin levels is an enzymelinked
immunoassay (ELISA) . One such test is available commercially
in microplate format with the BioVendor (2006) test kit. This ELISA
uses two antihuman clusterin mouse monoclonal antibodies and a human
serum-based calibrator. Calibrators, quality controls, and diluted
samples are incubated in microtitration wells coated with the first
antihuman clusterin monoclonal antibody. After a thorough wash, a
biotin-labeled second antihuman clusterin monoclonal antibody is
added to the wells and incubated with the immobilized antibodyclusterin
complex. After a 1-h incubation and the subsequent washing
step, streptavidin-horseradish peroxidase conjugate is added and
incubated for 30 in . After the last washing step, the conjugate
bound is allowed to react with the substrate (H 0 -
tetramethylbenzidine) . The reaction was then stopped by addition of
an acid, and the absorbance of the resulting yellow product is
measured spectrophotometrically at 450nm. The absorbance is
proportional to the concentration of clusterin.
Dosage Units
Administration of custirsen can be carried out using the various
mechanisms known in the art, including naked administration and
administration in pharmaceutically acceptable lipid carriers. For
example, lipid carriers for antisense delivery are disclosed in U.S.
Patent Nos. 5,855,911 and 5,417,978, which are incorporated herein by
reference. In general, custirsen is administered by intravenous
(i.v.), intraperitoneal (i.p.), subcutaneous (s.c), or oral routes,
or direct local tumor injection. In some embodiments, custirsen is
administered by i.v. injection.
The amount of custirsen administered may be from 40 to 640 mg, or
from 300 to 640 mg. Administration of custirsen may be once in a
seven day period, 3 times a week, or more specifically on days 1 , 3
and 5 , or 3 , 5 and 7 of a seven day period. In some embodiments,
administration of the antisense oligonucleotide is less frequent than
once in a seven day period. In some embodiments, administration of
the antisense oligonucleotide is more frequent than once in a seven
day period. Dosages may be calculated by patient weight, and
therefore in some embodiments a dose range of about 1-20 mg/kg, or
about 2-10 mg/kg, or about 3-7 mg/kg, or about 3-4 mg/kg could be
used. This dosage is repeated at intervals as needed. One clinical
concept is dosing once per week with 3 loading doses during week one
of treatment. The amount of antisense oligonucleotide administered is
one that has been demonstrated to be effective in human patients to
inhibit the expression of clusterin in cancer cells .
A dosage unit may comprise a single compound or mixtures of compounds
thereof. A dosage unit can be prepared for oral, injection, or
inhalation dosage forms.
In some embodiments, custirsen may be formulated at a concentration
of 20 mg/mL as an isotonic, phosphate-buffered saline solution for IV
administration. In some embodiments custirsen may be supplied as a 32
mL solution containing 640 mg custirsen sodium in a single vial, or
may besupplied as an 8 mL solution containing 160 mg custirsen sodium
in a single vial. The drug product and active ingredient of custirsen
sodium is a second-generation, 4-13-4 MOE-gapmer antisense
oligonucleotide (ASO) .
In some embodiments, custirsen may be added to 250 mL 0.9% sodium
chloride (normal saline) . In some embodiments, the dose may be
administered using either a peripheral or central indwelling catheter
intravenously as an infusion over 2 hours . Additionally, in some
embodiments an infusion pump may be used.
In some embodiments, subjects may receive paclitaxel 200 mg/m 2 as a
constant rate infusion on Day 1 of each of one or more 21-day
treatment cycles. The amount of paclitaxel administered may be from
100-250mg/m . The amount of paclitaxel administered may be 100mg/m2,
105mg/m2, 110mg/m2, 115mg/m2, 120mg/m2, 125mg/m2, 130mg/m , 140mg/m2,
145mg/m2, 150mg/m2, 155mg/m2, 160mg/m2, 165mg/m 2, 170mg/m2, 175 mg/m2,
180mg/m2, 185mg/m2, 190mg/m2, 195mg/m2, 200mg/m 2, 205mg/m 2, 210mg/m2,
220mg/m2, 225mg/m2, 230mg/m2, 235mg/m2, 240mg/m2, 245mg/m2, or 250mg/m2.
The duration of paclitaxel constant rate infusion may be from 1 to 3
hours, or from 3 to 6 hours. The duration of paclitaxel constant
rate infusion may be 1 , 1.5, 2 , 2.5, 3 , 3.5, 4 , 4.5, 5 , 5.5, or 6
hours, in some embodiments, subjects may receive IV carboplatin at a
dose calculated for a target AUG of 6mg/mL per min as a 30 minute
constant rate infusion. The amount of carboplatin may be a dose
calculated for a target AUC from 2-8mg/mL per min. The amount of
carboplatin may be a dose calculated for a target AUC of 2mg/mL per
min, 3mg/mL per min, 4mg/mL per min, 6mg/mL per min, 7mg/mL per min,
or 8mg/mL per min. In some embodiments paclitaxel and/or carboplatin
may be administered less frequently than once every 21-days. In some
embodiments paclitaxel and/or carboplatin may be administered more
frequently than once every 21-days. In some embodiments the
carboplatin is administered immediately following paclitaxel. In some
embodiments the paclitaxel is administered immediately following the
carboplatin.
In some embodiments of the invention, the amount of paclitaxel,
carboplatin, or paclitaxel/carboplatin required for treatment of
NSCLC is less in combination with custirsen, than would be required
with a therapy comprising paclitaxel, carboplatin, or
paclitaxel/carboplatin without custirsen.
some embodiments, the amount of paclitaxel when taken together
with custirsen is more effective to treat the human patient than
when paclitaxel is administered alone.
In some embodiments, the amount of paclitaxel/carboplatin when taken
together with custirsen is more effective to treat the human patient
than when paclitaxel/carboplatin is administered alone.
In some embodiments, the amount of paclitaxel in combination with
custirsen is less than is clinically effective when administered
alone or without custirsen.
In some embodiments, the amount of paclitaxel/carboplatin in
combination with custirsen is less than is clinically effective when
administered without custirsen.
In some embodiments, the amount of paclitaxel when administered with
custirsen is effective to reduce a clinical symptom of NSCLC of nonsquamous
histology in the human patient .
In some embodiments, a chemotherapeutic agent may be administered via
an infusion control device (pump) using non-PVC tubing and connectors
The pharmacokinetic (area under the time concentration curve [AUC] )
and the pharmacodynamic effects (hematologic toxicity) of
carboplatin are better predicted by glomerular filtration rate (GFR)
based dosing as compared with the more traditional body surface area
(BXA ) dosing method. The Calvert formula provides a consistent
method for determining carboplatin dosage in adults that should
produce the desired degree of toxicity (Calvert et al., 1989) .
The Calvert formula may be used to calculate the carboplatin dose:
Carboplatin dose (mg) = target AUC x (GFR + 25)
The Cockcrof t-Gault formula may be used to calculate the creatinine
clearance (CrCl) (Cockcroft and Gault, 1976) , which can be
substituted for glomerular filtration rate (GFR) in the Calvert
formula. Calculations may be based upon the serum creatinine value
obtained within 72 hours prior to treatment for each cycle.
(140 - subject's age) x subject's actual body weight in kg*
72 x subject's serum creatinine (in mg/dL)
*For females, multiply the result by 0.85
n some embodiments doses of both chemotherapeutic agents may be
based on the subject's actual body weight within 3 days prior to
treatment. The same weight measurement may be used to calculate the
dosage of both drugs.
In some embodiments, subjects may receive docetaxel 75 mg/m 2 as an
infusion on Day 1 of each of one or more 21-day treatment cycles. The
amount of docetaxel administered may be from 25 mg/m 2 to 100 mg/m 2 .
The amount of docetaxel administered may be about 25mg/m 2 , 30mg/m 2,
35mg/m 2, 40mg/m 2, 5mg/m2 , 50mg/m 2, 55mg/m 2, 60mg/m 2, 65mg/m 2 , 70mg/m 2,
75mg/m 2 , 80mg/m 2, 85mg/m 2, 90mg/m 2 , 95mg/m 2 or 100mg/m 2 . The duration
of docetaxel infusion may be from 1 to 3 hours, or from 3 to 6 hours.
The duration o f docetaxel constant rate infusion may be 1 , 1.5, 2 ,
2.5, 3 , 3.5, 4 , 4.5, 5 , 5.5, or 6 hours. In some embodiments,
docetaxel infusion is constant rate infusion.
In some embodiments, subjects may receive a taxane 75 mg/m 2 as an
infusion on Day 1 of each of one or more 21-day treatment cycles. In
some embodiments, subjects may receive a taxane 200 mg/m 2 as an
infusion on Day 1 of each of one or more 21-day treatment cycles. The
amount of taxane administered may be from 25 mg/m 2 to 250 mg/m 2 . The
amount of taxane administered may be about 25mg/m 2, 30mg/m 2 , 35mg/m 2 ,
40mg/m 2 , 45mg/m 2, 50mg/m 2, 55mg/m 2, 60mg/m 2 , 65mg/m 2 , 70mg/m 2, 75mg/m 2 ,
80mg/m 2 , 85mg/m , 90mg/m 2, 95mg/m 2 100mg/m 2 , 105mg/m 2 , 110mg/m 2,
115mg/m 2 , 120mg/m 2 , 125mg/m 2 , 130mg/m 2 , 140mg/m 2 , 145mg/m 2, 150mg/m 2 ,
155mg/m 2, 160mg/m 2, 165mg/m 2, 170mg/m 2, 175 mg/m 2 , 180mg/m 2 , 185mg/m 2 ,
190mg/m 2, 195mg/m 2 , 200mg/m 2 , 205mg/m 2 , 210mg/m 2, 220mg/m 2, 225mg/m 2 ,
230mg/m 2, 2 3 5 g /m 2 , 240mg/m 2, 245mg/m 2, or 250mg/m 2 . The duration of
taxane infusion may be from 1 to 3 hours, or from 3 to 6 hours. The
duration of taxane constant rate infusion may be 1 , 1.5, 2 , 2.5, 3 ,
3.5, 4 , 4.5, 5 , 5.5, or 6 hours. In some embodiments, taxane infusion
is constant rate infusion.
In some embodiments of the invention, the amount of a taxane, a
platinum-based chemotherapeutic, or a combination of both required
for treatment of NSCLC is less in combination with custirsen, than
would be required with a therapy comprising a taxane, a platinumbased
chemotherapeutic, or a combination of both without custirsen.
In some embodiments of the invention, the amount of docetaxel,
platinum-based chemotherapy or docetaxel/platinum-based chemotherapy
required for treatment o f NSCLC is less in combination with custirsen,
than would be required with a therapy comprising docetaxel, platinumbased
chemotherapy or docetaxel/platinum-based chemotherapy without
custirsen.
In some embodiments of the invention, the amount o f a taxane required
for treatment of NSCLC is less in combination with custirsen, than
would be required with a therapy comprising a taxane without
custirsen.
In some embodiments of the invention, the amount of docetaxel
required for treatment o f NSCLC is less in combination with custirsen,
than would be required with a therapy comprising a taxane, a
platinum-based chemotherapeutic, or a combination of both without
custirsen.
In some embodiments, the amount of taxane when taken together with
custirsen is more effective to treat the human patient than when a
taxane is administered alone.
In some embodiments, the amount of docetaxel when taken together
with custirsen is more effective to treat the human patient than
when docetaxel is administered alone.
In some embodiments, the amount of a taxane/platinum-based
chemotherapy when taken together with custirsen is more effective to
treat the human patient than when a taxane/platinum-based
chemotherapy is administered alone.
In some embodiments, the amount of docetaxel /platinum-based
chemotherapy when taken together with custirsen is more effective to
treat the human patient than when docetaxel /platinum-based
chemotherapy is administered alone.
In some embodiments, the amount of a taxane in combination with
custirsen is less than is clinically effective when administered
alone or without custirsen.
In some embodiments, the amount of docetaxel in combination with
custirsen is less than is clinically effective when administered
alone or without custirsen.
some embodiments , the amount of a taxane/platinum-based
chemotherapy in combination with custirsen is less than is
clinically effective when administered without custirsen.
In some embodiments, the amount of docetaxel/platinum-based
chemotherapy in combination with custirsen is less than is
clinically effective when administered without custirsen.
In some embodiments, the amount of a taxane when administered with
custirsen is effective to reduce a clinical symptom of NSCLC of nonsquamous
histology in the human patient.
In some embodiments, the amount of docetaxel when administered with
custirsen is effective to reduce a clinical symptom of NSCLC of nonsquamous
histology in the human patient.
n some embodiments, the amount of a platinum-based chemotherapeutic
agent when taken together with custirsen is more effective to treat
the human patient than when the platinum-based chemotherapeutic
agent is administered alone.
n some embodiments, the amount of a platinum-based chemotherapeutic
agent in combination with custirsen is less than is clinically
effective when administered alone or without custirsen.
In some embodiments, the amount of a platinum- based chemotherapeutic
agent when administered with custirsen is effective to reduce a
clinical symptom of NSCLC of non-squamous histology in the human
patient .
According to an aspect of the invention, there is provided a
custirsen-containing pharmaceutical composition packaged in dosage
unit form, wherein the amount of custirsen in each dosage unit is
640mg. Said pharmaceutical composition may include a taxane and/or
platinum- based chemotherapeutic agent, and may be in an injectable
solution or suspension, which may further contain sodium ions.
According to an aspect of the invention, there is provided a
custirsen-containing pharmaceutical composition packaged in dosage
unit form, wherein the amount of custirsen in each dosage unit is
64Qmg. Said pharmaceutical composition may include paclitaxel and/or
carboplatin, and may be in an injectable solution or suspension,
which may further contain sodium ions .
According to an aspect of the invention, there is provided a
custirsen-containing pharmaceutical composition packaged in dosage
unit form, wherein the amount of custirsen in each dosage unit is
640mg. Said pharmaceutical composition may include docetaxel, and
may be in an injectable solution or suspension, which may further
contain sodium ions.
According to another aspect of the invention, there is provided the
use of custirsen and a taxane and/ r a platinum- based
chemotherapeutic agent in the manufacture of a medicament for the
treatment of cancer, where the medicament is formulated to deliver a
dosage of 640mg custirsen to a patient. The medicament may contain
sodium ions, and/or be in the form of an injectable solution.
According to another aspect of the invention, there is provided the
use of custirsen and paclitaxel and/or carboplatin in the manufacture
of a medicament for the treatment of cancer, where the medicament is
formulated to deliver a dosage of 640mg custirsen to a patient. The
medicament may contain sodium ions, and/or be in the form of an
injectable solution.
According to another aspect of the invention, there is provided the
use of custirsen and docetaxel in the manufacture of a medicament for
the treatment of cancer, where the medicament is formulated to
deliver a dosage of 640mg custirsen to a patient. The medicament may
contain sodium ions, and/or be in the form of an injectable solution.
General techniques and compositions for making dosage forms useful in
the present invention are described in the following references: 7
Modern Pharmaceutics, Chapters 9 and 10 (Banker & Rhodes, Editors,
1979); Pharmaceutical Dosage Forms: Tablets (Lieberman et a ., 1981);
Ansel, Introduction to Pharmaceutical Dosage Forms 2nd Edition
(1976); Remington's Pharmaceutical Sciences, 17th ed. (Mack
Publishing Company, Easton, Pa., 1985); Advances in Pharmaceutical
Sciences David Ganderton, Trevor Jones, Eds., 1992); Advances in
Pharmaceutical Sciences Vol 7 . (David Ganderton, Trevor Jones, James
McGinity, Eds., 1995); Aqueous Polymeric Coatings for Pharmaceutical
Dosage Forms (Drugs and the Pharmaceutical Sciences, Series 36 (James
McGinity, Ed., 1989); Pharmaceutical Particulate Carriers:
Therapeutic Applications: Drugs and the Pharmaceutical Sciences, Vol
61 (Alain Rolland, Ed., 1993); Drug Delivery to the Gastrointestinal
Tract (Ellis Horwood Books in the Biological Sciences. Series in
Pharmaceutical Technology; J . G . Hardy, S . S . Davis, Clive G . Wilson,
Eds.); Modern Pharmaceutics Drugs and the Pharmaceutical Sciences,
Vol. 40 (Gilbert S . Banker, Christopher T . Rhodes, Eds.). These
references in their entireties are hereby incorporated by reference
into this application.
This invention will be better understood by reference to the
Experimental Details which follow, but those skilled in the art will
readily appreciate that the specific experiments detailed are only
illustrative of the invention as described more fully in the claims
which follow thereafter.
Experimental Details
EXAMPLE Clinical Trial (Phase III) - Assessment of
Paclitaxel/carboplatin in Combination with Custirsen in Preventing
Progression of Hon- Squamous SC C
A multinational, randomized, open-label phase III study comparing a
standard first-line paclitaxel/carboplatin chemotherapy regimen to
paclitaxel/carboplatin in combination with custirsen ( V - 0 ) is
conducted to evaluate the safety, tolerability and efficacy in
subjects with Stage IV non-squamous NSC IX" .
Study Title
A Multinational, Randomized, Open-Label Phase III Study Comparing a
Standard First-Line Paclitaxel/carboplatin Chemotherapy Regimen to
Paclitaxel/carboplatin in Combination with Custirsen (TV-1011) in
Subjects with Stage IV Non- Squamous Non-Small Cell Lung Cancer.
Treatment Duration
Subjects randomized to the custirsen arm first receive three doses of
custirsen in a 5 to day loading dose period prior to Day 1 of Cycle
1 . Subjects randomized to both study arms have 21-day chemotherapy
cycles until disease progression, unacceptable toxicity, or
completion of 6 cycles; however, subjects randomized to the custirsen
arm also receive weekly doses of custirsen starting at Day 1 of each
of the 21-day chemotherapy cycles until disease progression,
unacceptable toxicity, or completion of all 6 cycles .
Study Population
Stage IV NSCLC of non-squamous histology.
Study Objectives
• The primary objective is to evaluate the overall survival
benefit of adding custirsen to standard paclitaxel/carboplatin
chemotherapy .
· The secondary objective is to evaluate the effect of adding
custirsen to standard paclitaxel/carboplatin chemotherapy on
the rate of progression free survival (PFS) at 14 weeks.
• Additional objectives are:
o To evaluate the safety and tolerability of adding
custirsen to standard paclitaxel/carboplatin
chemotherapy .
o To assess the effect of adding custirsen to standard
paclitaxel/carboplatin chemotherapy on quality of life
parameters .
o To assess the effect of adding custirsen to standard
paclitaxel/carboplatin chemotherapy on serum clusterin
pharmacodynamics.
o To explore the relationship between serum clusterin as a
biomarker and for evaluating efficacy measures, including
overall survival,
o To evaluate the effect of adding clustirsen to standard
paclitaxel/carboplatin chemotherapy on other disease
parameters such as progression free survival and time to
progression.
o To assess the exposure of the study population to
custirsen.
o To establish if custirsen alters the pharmacokinetics of
pacli taxel /carboplatin .
Study Design Overview
This is a randomized, open-label, sponsor-blinded multinational trial.
Treatment consists of paclitaxel/carboplatin/custirsen vs.
paclitaxel/carboplatin, which compose the two arms of the study.
After a screening period of up to 28 days, subjects are randomly
assigned with equal probability to the two arms. Stratified
randomization is used in order to minimize between-arm imbalance over
four stratification factors: Gender, Eastern Cooperative Oncology
Group (ECOG) performance status (0 vs. 1), Smoking status
(former/current smoker vs. never-smoker ) and Geographical Region
(North America, Europe and Southeast Asia) .
Subjects randomized to the custirsen arm have a 5 to 9 day loading
dose period prior to Day 1 of Cycle 1 . Subjects receive
paclitaxel/carboplatin on a 3-week cycle either alone or with weekly
custirsen infusions, until disease progression, unacceptable toxicity
or completion of 6 cycles. Subjects who are removed from study
treatment for any reason other than disease progression or death are
followed for documented disease progression. Once disease progression
is documented, subjects enter a survival follow-up phase during which
data is collected regarding further cancer treatment and their
survival status .
Tumor response to study treatment and disease progression is based on
the criteria proposed by the Response Evaluation Criteria in Solid
Tumors (RECIST) 1.1 guidelines. All subjects undergo CT or MRI scans
of the chest and upper abdomen, as well as any other areas clinically
indicated, at screening, then every 6 weeks, starting at week 8 for
the first 26 weeks (week 8 , 14, 20 and 26) and then every 12 weeks
after the week 26 scan until disease progression. These time points
are kept within a window of + one week, regardless of the treatment
schedule. The week 26 scan is performed as scheduled, regardless of
whether the patient is still in the treatment period (i.e. due to
treatment delays) or has already completed the end of treatment visit.
Once a patient is discontinued from study treatment for documented
disease progression, scanning is no longer required. Assessment of
these scans is carried out in a blinded fashion, by a Central Imaging
Lab.
Note: CT scans are preferred; however, RIs can be used for disease
assessment as long as they are consistently performed for an
individual subject's assessments.
Note: CT scans are performed with cuts of 5 mm or less in contiguous
slice thickness.
Adverse events are recorded at each visit during the study and 28
days after the last dose of study treatment. Medical history is
assessed at screening and an electrocardiogram is performed. Physical
examination, assessment of the ECOG performance status, vital signs
and laboratory evaluations are conducted at screening and throughout
the study. Adverse events are recorded from when a subject is signed
the Informed Consent Form and throughout the study, until the end of
the treatment visit (28 days following last dose) . They are reviewed
and updated at each subsequent visit and during any phone contact
with the subject.
The general health status, as reported by the subjects is assessed by
the EuroQoL (EQ-5D) and FACT-L questionnaires. Medical resource
utilization is also compared between the treatment arms. The EQ-5D is
a standardized instrument for use as a measure of health outcome.
Applicable to a wide range of health conditions and treatments, it
provides a simple descriptive profile and a single index value for
health status that can be used in the clinical and economic
evaluation of health care as well as population health surveys. EQ-5D
is designed for self-completion by subjects. In this study the
instrument is self-administrated.
Pharmacodynamic blood samples for serum clusterin are drawn, in order
to evaluate the arm-specific levels of serum clusterin and explore
whether there is an association with efficacy measures. All serum
clusterin testing is done at a central laboratory.
Pharmacokinetic testing for blood levels of custirsen, paclitaxel and
carboplatin (Arm A ), or paclitaxel and carboplatin (Arm B ) , are
performed. These samples allow further exploration of the
pharmacokinetic profile of custirsen, to investigate the interaction
between custirsen and the paclitaxel/carboplatin combination, and to
model the relationship within the paclitaxel/carboplatin/ custirsen
treatment arm, between exposure to custirsen (i.e., serum custirsen
levels at the end of custirsen infusion) and outcome measures (e.g.,
clinical efficacy and toxicity parameters) .
Number of Subjects
Approximately 950 subjects with Stage IV non small cell lung cancer
of non-squamous histology (NSCLC) .
Incluaioa /Excl i Criteria.
Inclusion Criteria
1 . Subjects must have a histologically or cytologically confirmed
diagnosis of NSCLC of non-squamous (adenocarcinoma, large cell
or other) histology.
2 . Males or females ³ 18 years of age at screening.
3 . Stage IV disease (according to the IASLC 7th edition T M
staging, thus including patients with pleural effusion who
were previously classified as Stage B ) that is not amenable
to either surgery or radiation therapy of curative intent.
4 . Life expectancy of >12 weeks .
5 . Subjects must have at least one lesion meeting RECIST 1.1
criteria for measurable disease.
6 . All of the following if patient has had prior radiation
therapy:
• Lesion (s) used for determination of response was not
previously irradiated or has increased in size (by at
least 30% in the longest diameter) since the completion
of radiotherapy.
· Radiotherapy to lesion (s) used for determination of
response was completed at least 6 weeks prior to
randomization,- radiotherapy to other sites was completed
at least 4 weeks prior to randomization.
7 . ECOG performance status of 0 or 1 .
8 . Have adequate bone marrow reserve as defined by:
• Absolute neutrophil count (ANC) ³ 1.5 x 10 /L
• Platelets ³ 100 x lO'/L
• Hemoglobin ³ 9 g/dL
9 . Have adequate liver function as defined by:
· Bilirubin < 1.5 x ULN (unless elevated secondary to
conditions such as Gilbert's disease)
• AST and ALT < 3 x ULN (£ 5 x ULN in subjects with liver
metastases at screening)
10 . Have adequate renal function as defined by creatinine
clearance ³ 50 mL/min per the Cockcroft and Gault formula.
11. At randomization, at least 4 weeks have passed since
prior major surgery.
12. At randomization, at least 4 weeks (or 5 elimination
half -lives of study agent, whichever is longer) have passed
since receiving any investigational agent.
13. Women of child-bearing potential practice a highly
effective method of birth control during and for 3 months
after the treatment period.
1 . Male partners of women of child-bearing potential can be
either surgically sterile, or ensure that their female partner
utilizes a highly effective contraceptive method during and
for 3 months after the treatment period.
15. Subjects give written informed consent prior to any
protocol-specific procedures being performed and comply with
the protocol requirements for the duration of the study.
Exclusion Criteria
1 . Subjects with NSCLC that is predominantly !>50%) of squamous
histology.
2 . Subjects that received any prior systemic anti-cancer therapy
(approved or experimental) for advanced NSCLC. Subjects who
have received adjuvant chemotherapy are eligible if the last
administration of the prior adjuvant regimen occurred at least
1 year prior to randomization.
3 . Subjects with brain metastases that are symptomatic or require
ongoing treatment with steroids or anticonvulsants. Brain
imaging is required for symptomatic patients to rule out brain
metastases, but is not required in asymptomatic patients.
4 . Subjects with an active second malignancy (except in situ
carcinoma of the cervix, adequately treated non-melanomatous
skin cancers, clinically localized prostate cancer,
superficial bladder cancer or other malignancy treated at
least 2 years previously with no evidence of recurrence) .
5 . Subjects with persistent grade 2 or greater toxicity related
to prior therapy (except alopecia or anemia) .
6 . Subjects with grade 2 or greater peripheral neuropathy.
7 . Medical conditions such as heart failure. myocardial
infarction, uncontrolled hypertension, uncontrolled diabetes
mellitus, cerebrovascular accident or acute hepatitis within 3
months of randomization or treatment of a major active
infection within 1 month of randomization, an ongoing serious
cardiac arrhythmia requiring medication as well as any other
significant concurrent medical illness that in the opinion of
the Investigator would preclude protocol therapy.
8 . Planned concomitant participation in another clinical trial of
an experimental agent, vaccine, or device. Concomitant
participation in observational studies is acceptable.
9 . Female subjects who are pregnant or breastfeeding.
10. Subjects with a known sensitivity to any component of
paclitaxel or carboplatin.
Dosage and Route of Administration
Study Agent : Custirsen sodium
640 g in 250 m normal saline IV over 2 hours.
Chemotherapy: Paclitaxel and Carboplatin
Paclitaxel 200 mg/m 2 IV over 3 hours.
Carboplatin AUG 6.0 mg/ml/min IV over 30 minutes.
Custirsen Loading Dose Period
If randomized onto the investigational arm (Arm A ), subjects receive
custirsen. The schedule of administration of custirsen starts with a
Loading Dose Period. The first dose of custirsen for the Loading Dose
Period is administered within 4 days following randomization.
Three doses of 640 mg custirsen are administered IV during the
Loading Dose Period (Days -9 to -1) . There is at least one "noninfusion"
day between each administration of custirsen (i.e. every
other day) during the Loading Dose Period and between the third
loading dose of custirsen and Day 1 of Cycle . The day prior to Day
1 of Cycle 1 (Day 0 ) is a "no treatment" day. There are no more than
4 days between the last loading dose and Day 1 of Cycle . A common
schedule is to give the three loading doses of custirsen on Monday,
Wednesday and Friday with Day 1 , Cycle 1 starting on the following
Monday. Up to nine days are allowed for completing the three loading
doses prior to Day 0 to account for clinic visits, weekends, and
holidays. Subjects receive each dose of custirsen as a 2 hour
infusion. Because grade 1 - 2 constitutional symptoms (e.g., fever
and chills) are seen in 50-60% of subjects during the first two to
three custirsen infusions, all subjects are be premedicated with
ibuprofen (400 mg) or acetaminophen (500-1000 mg) 30-60 minutes prior
to and every 4-6 hours for 24 hours following each of the three
loading doses of custirsen during the Loading Dose Period only.
21 Day (three-week) Treatment Cycles
Arm A Subjects Only:
Following completion of the loading dose period, and within a maximum
of 4 days, 640 mg custirsen is given IV weekly on Days 1 , 8 , and 15
of each 21 day cycle. Custirsen is administered prior to paclitaxel
and carboplatin on Day 1 of each cycle.
Arm B Subjects Only:
The first doses of paclitaxel and carboplatin are administered within
4 days following randomization.
Both Arm A and Arm B Subjects:
Paclitaxel (200 mg/m 2) and Carboplatin AUC 6.0 mg/ml/min IV is
administered IV on Day 1 of each 21 day cycle.
Treatment cycles continue until disease progression, unacceptable
toxicity, or completion of 6 cycles .
Dose Modifications for Toxicity
Toxicities are graded using the NCI CTCAE, Version 4.0.
In general, the need for dose modifications is assessed based on
laboratory values or physical signs obtained within 72 hours prior
to treatment on Day 1 of each cycle. While dose reductions are
employed for paclitaxel and carboplatin, custirsen is always given
at the 640 mg dose, but the dose may be withheld if necessary. f
Day 1 chemotherapy is delayed for hematological toxicity due to
paclitaxel or carboplatin, weekly custirsen administration continues,
unless the criteria for holding custirsen are met (herein below) .
Treatment may be delayed no more than three weeks to allow recovery
from toxicity. If a subject has greater than a 3-week lapse in study
treatment for any reason, the subject has an "End of Treatment"
assessment and enters the "Off-Treatment Follow-up Period" until
disease progression.
The dose of paclitaxel or carboplatin is not re-escalated once the
dose is reduced. If more than two dose reductions of paclitaxel or
carboplatin are required, the subject is removed from study
treatment. If custirsen, paclitaxel or carboplatin is discontinued,
the subject is removed from study treatment. These subjects have an
"End of Treatment" assessment and enter the "Off-Treatment Follow-up
Period" until disease progression.
The reason for modifying the dose of any study treatment (custirsen,
paclitaxel and/or carboplatin) is recorded.
Specific Dose Levels for Paclitaxel and Carboplatin Modification
The table below defines the specific dose level modifications for
paclitaxel and carboplatin.
Table 1 : Dose Modification Levels for Paclitaxel and Carboplatin
* If more than two dose reductions of paclitaxel or carboplatin are
required, the subject is removed from study treatment.
Hematologic Toxicity
G-CSF and other growth factors are allowed to assist in subject
management. The following section delineates how to modify or hold
the dose of paclitaxel and carboplatin based on the hematology
results and clinical findings on Day 1 of each cycle.
If Day 1 chemotherapy is delayed for hematological toxicity, weekly
custirsen administration continues, unless the criteria for holding
custirsen have been met.
No dose reductions are required for anemia. Subjects may be
supported with transfusions or erythropoietin to maintain their
hematocrit at acceptable levels .
Prior to receiving each cycle of therapy, subjects must have an
absolute neutrophil count (A C ) ³ 1.5 x 109 cells/L and PLT ³ 100 x
109 cells/L. Treatment may be delayed no more than three weeks to
allow for hematologic recovery. If ANC < 1.5 x 109 cells/L and/or PLT
< 100 x 109 cells/L after 3 weeks, chemotherapy is discontinued.
If on Day 1 of a cycle, the ANC is <1.5 x 109 cells/L and/or the
platelet count is <100 x 109 cells/L, both paclitaxel and carboplatin
are withheld. Blood counts are repeated weekly. Once the ANC recovers
to ³ 1.5 x 109 cells/L and the platelet count is ³ 100 x 109 cells/L,
treatment with paclitaxel and carboplatin is resumed. If this lasts
for more than one week, chemotherapy doses are reduced by 1 dose
level .
Chemotherapy doses are also reduced by 1 dose level if at any time
during the previous cycle for one of the following has occurred:
Grade 3 febrile neutropenia (defined as an ANC <1.0 x 109
cells/L and a temperature >38.5°C)
Documented infection with grade 3 neutropenia (defined as an ANC
<1.0 x 109 cells/L)
Grade 4 neutropenia (defined as an ANC <0.5 x 109 cells/L)
lasting 7 days or more
□ Grade 4 thrombocytopenia (platelet count <25 x 109/L) lasting 7
days or more
In any of the above four cases, weekly custirsen infusions are also
held, and are resumed at the full 640mg dose, once the toxicity
recovers to grade 2 or less.
When a chemotherapy dose reduction is required at the beginning of a
21 -day cycle, paclitaxel and carboplatin are reduced together and no
dose re-escalation is permitted in future cycles.
If any of the following occur, the subject is removed from study
treatment :
□ Grade 4 febrile neutropenia or grade 4 infection with
neutropenia
□ Thrombocytopenic hemorrhage (gross not occult bleeding)
associated with a platelet count <50 x 109/L
Hepatic Toxicity
The FT values (AST, ALT and bilirubin) on Day 1 of each cycle are
used in determining if a dose reduction is necessary. Chemotherapy
(paclitaxel and carboplatin) and custirsen are held in any case of
LFT elevation (AST, ALT and/or bilirubin) to grade 3 or greater and
resumed once the toxicity recovers to grade 2 or less . Subsequently,
the dose of paclitaxel is reduced by 1 dose level in the next cycle.
Treatment with carboplatin and custirsen is resumed at the full dose.
If treatment is withheld, LFT values must recover within 3 weeks or
the subject's protocol treatment is discontinued.
Renal Toxicity
To enter the trial, subjects are required to have adequate renal
function as defined by creatinine clearance ³ 50 /min per the
Cockcroft and Gault formula.
For on study decrease in the creatinine clearance of up to 30 ml/min
(Grade 2), the carboplatin dose is adjusted according to the Calvert
formula. Paclitaxel and custirsen are continued at the full dose.
For grade 3 decrease in creatinine clearance (to below 30 ml/min) or
grade 3 increase in creatinine (>3 x baseline value or >4.0 mg/dl) ,
all protocol treatment is withheld until toxicity resolves to £ grade
2 . Upon resolution to £ grade 2 , paclitaxel and carboplatin are
resumed at a dose reduction of one level, and custirsen at the full
dose.
If the toxicity is not resolved within 3 weeks, the subject is
discontinued from study treatment. If the toxicity recurs in a
subsequent cycle at a grade 3 or higher, the subject is removed from
study treatment and followed for disease progression.
For any grade 4 renal toxicity (defined as creatinine clearance <15
ml/min or dialysis or renal transplant indicated) the subject is
removed from protocol treatment.
Paclitaxel and Carboplatin - Dose Modifications for Neurotoxicity
For grade 4 neurotoxicity, the subject should be removed from
protocol treatment .
For grade 3 neurotoxicity, paclitaxel and carboplatin are withheld
until toxicity resolves to £ grade 2 . Both are then resumed at a dose
reduction of one level.
Paclitaxel and Carboplatin - Dose Modifications for Diarrhea and/or
Vomiting
In the case of grade 4 (life threatening) diarrhea and/or vomiting,
the subject is removed from protocol treatment.
In the case of grade 3 diarrhea (³ 7 stools per day over baseline;
incontinence; need for IV fluids > 24 hours limiting self care AD
or hospitalization) , paclitaxel and carboplatin are held until
resolution to £ grade 2 and the subject receives prophylactic anti
diarrhea therapy in subsequent cycles .
f grade 3 diarrhea recurs despite maximal prophylactic treatment
(e.g., loperamide, diphenoxylate hydrochloride with atropine,
octreotide), the subject is removed from protocol treatment.
In the case of grade 3 vomiting [>=6 episodes (separated by 5 minutes)
in 24 hrs; tube feeding, TPN or hospitalization indicated],
paclitaxel and carboplatin are held until resolution to £ grade 2 and
the subject receives prophylactic anti emetic therapy in subsequent
cycles .
If grade 3 vomiting recurs despite maximal prophylactic treatment
(e.g. ondansteron, metoclopramide, dexamathasone) the subject is
removed from protocol treatment .
Paclitaxel - Cardiovascular Toxicity
Cardiac rhythm disturbances have occurred infrequently in subjects
receiving paclitaxel. Most subjects were asymptomatic and cardiac
monitoring is not required. Transient asymptomatic bradycardia has
been noted in as many as one third of subjects. More significant
atrioventricular (AV) block has rarely been noted. Cardiac events
should be managed as follows:
Asymptomatic bradycardia - no treatment required
□ Asymptomatic AV block or any symptomatic arrhythmia during
infusion -paclitaxel infusion is stopped, arrhythmia is managed
according to standard practice. All protocol treatment is
discontinued.
□ Chest pain and/or symptomatic hypotension (below 90/60 mmHg or
requiring fluid replacement) - paclitaxel infusion is stopped. An ECG
is performed. The pation is given intravenous diphenhydramine and
dexamethasone as above if hypersensitivity is considered. Also,
epinephrine or bronchodilators are considered if chest pain is not
thought to be cardiac. All protocol treatment is discontinued.
W
-83-
Paclitaxel - Allergic React io /Hypersens i ty
Subjects who had a mild to moderate hypersensitivity reaction have
been successfully rechallenged with paclitaxel, but careful attention
to prophylaxis and bedside monitoring of vital signs is recommended.
5
Mild symptoms: Complete paclitaxel infusion. Supervise at bedside. No
treatment required.
Moderate to severe symptoms (grade 2 or 3 ) : Paclitaxel infusion is
stopped. Diphenhydramine 25-50 mg and intravenous dexamethasone 10 g
10 is given. Paclitaxel infusion is resumed after recovery of symptoms
at a low rate, 20 mL/hour for 15 minutes, then 40 mL/hour for 15
minutes, then, if no further symptoms, at full dose rate until
infusion is complete. If symptoms recur, paclitaxel infusion is
stopped and protocol treatment is discontinued. Subjects who
15 experience grade 3 hypersensitivity to paclitaxel receive twice the
dose of steroid premedication for subsequent cycles. Paclitaxel
administration is slower (half the usual rate) for the first hour of
the infusion. The infusion rate is increased during the later 2 hours
The total duration of paclitaxel infusion remains unchanged, i.e. 3
20 hours.
Severe life- threatening symptoms (grade 4 , anaphylaxis): Paclitaxel
infusion is stopped and subject is given IV diphenhydramine and
dexamethasone as herein above. Epinephrine or bronchodilators are
25 added if indicated protocol treatment is discontinued.
Dose Modifications for Non-Hematological Grade 3 or 4 Toxicities
For any grade 4 NCI CTCAE denoted as "life threatening" toxicity, the
subject is discontinued from study treatment and followed for disease
30 progression.
For any grade 3 or 4 event defined below (Note: this does not include
alopecia, nausea, cough, headache, insomnia, nail changes, changes in
taste and nonsymptomatic laboratory values [e.g., sodium, potassium,
35 magnesium]), paclitaxel, carboplatin and custirsen, are held until
resolution to £ grade :
□ Grade 4 NCI CTCAE denoted as "disabling" (tinnitus, fatigue,
asthenia, lethargy, malaise, arthralgia, myalgia, dizziness, tremor)
or;
Grade 3 NCI CTCAE not mentioned in the sections above and viewed
by the Investigator as clinically significant
Upon resolution to £ grade 2 , both paclitaxel and carboplatin are
resumed with a reduction of one dose level. If the toxicity does not
resolved within 3 weeks, the subject is discontinued from study
treatment. If the toxicity recurs in a subsequent cycle at a grade 3
or higher, the subject is removed from study treatment and followed
for disease progression.
Statistical Analysis
Primary Outcome
The primary outcome measure is overall survival (OS) . Time to death
from any cause is the primary efficacy endpoint. The primary analysis
is a stratified log-rank test (stratified by the above-identified
stratification factors) .
Secondary Outcome
Progression Free Survival (PFS) at 14 weeks from randomization. For
each subject, a Week 14 Progression Free Survival (PFS) status
variable "Alive Without Progression (AWP)" is defined as one (1) if
the subject is alive and found to be free of evidence of progression
as defined herein above, and zero (0) if otherwise. The proportions
of subjects in each arm for which AWP = 1 are compared as a secondary
analysis of efficacy. The Cochran-Mantel-Haenszel test with the
above-defined stratification factors is used for testing.
Results
The combination treatment of custirsen and paclitaxel /carboplatin
administered to arm A subjects is safe and well tolerated, with an
acceptable adverse events profile. Arm A subjects (custirsen +
paclitaxel/carboplatin) have prolonged survival compared to Arm B
subjects (paclitaxel/carboplatin) . Additionally, progression free
survival is increased in Arm A subjects and a statistically
significant higher proportion of Ar A subjects survive free of
progression for at least 14 weeks compared to Arm B subjects.
Overall progression free survival is improved in arm A subjects. One
or more symptoms of NSCLC, such as chest pain, pleural effusions,
pulmonary edema, dyspnea, or hemoptysis occasionally improve in Arm
A subjects compared to Arm B subjects. Furthermore, quality of life
improves in Arm A subjects compared to Arm B subjects.
Example 2 . Correlation of Serum Clusterin Levels to the Duration of
Individual Survival in NSCLC
In this Example, the baseline clusterin levels in patients receiving
treatment within Arm A of Example 1 are analyzed and compared to
clinical outcome. A subpopulation of these patients having a baseline
clusterin level below 71ug /mL are more likely to substantially
benefit from anti-clusterin therapy compared to patients with
baseline levels above 71 g /mL. Specifically, patients with baseline
clusterin levels below 71 g/m tend to survive longer than patients
with baseline clusterin levels above 71 g/m . These data fit with a
previous study (described herein below) that indicated a predictive
threshold level of baseline clusterin in patient serum. Patients with
baseline clusterin levels below this threshold were likely to benefit
more from anti-clusterin therapy than patients with levels above the
threshold.
The relationship between serum clusterin levels and the duration of
individual survival was evaluated during a phase 1-2 study of weekly
custirsen plus a gemcitabine/platinum-based regimen in patients with
stage IB or IV NSCLC. Not all of the patients in this study had
baseline levels of clusterin measured. However, starting with N=69
subjects with measured baseline clusterin levels, fitting the Cox
proportional hazards PH ) model with baseline clusterin as sole
predictor gives p =0.10; the coefficient is positive, so that higher
clusterin is associated with increased survival risk. Among the N=55
subjects who also had post-baseline data collected, fitting the same
PH model gives p = 0.05, again with positive coefficient.
Splitting baseline clusterin levels into Low and High strata yielded
a dichotomous predictor more effective than the measured clusterin
levels. A careful search for possible cutpoints, using all N=69
subjects with baseline clusterin levels, produced 71 pg/mL as a
strong candidate.
Among all N-69 subjects with a baseline clusterin level, there were
N-45 with clusterin £ 71 pg/mL (median survival time was 18.8
months) , and N-26 subjects with baseline clusterin > 71 mL
(median survival time was 10.2 months); the log-rank p-value =0.004.
Removing the N-14 early discontinuers leaves N=35 subjects with
baseline clusterin £ 71 pg/mL (median survival time was 28.7 months),
and N=20 subjects with baseline clusterin > 71 pg/mL (median
survival time was 12.2 months); the log-rank p-value =0.0002. Figure
4 shows the Kaplan-Meier curves corresponding to the 71 pg/mL
outpoint .
To further assess the relevance of baseline clusterin as a predictor
of survival, data from the study were further segregated based on
average and minimum clusterin levels achieved during treatment. Fig.
5 shows the Kaplan-Meier curves corresponding to the 71 pg/mL
cutpoint for baseline clusterin and a 33 pg/mL cutpoint for average
clusterin. Fig. 6 shows the Kaplan-Meier curves corresponding to the
71 pg/mL cutpoint for baseline clusterin and a 30 pg/mL cutpoint for
minimum clusterin. In both cases, the combination of low baseline
clusterin and low levels during therapy provided the greatest
probability of extended survival .
It is surprising that similar results are observed upon treatment of
a different patient population with different therapy as described in
Examples 1 and . Additionally, one would expect that patients with
more clusterin would have a greater need for, and thus benefit more
from anti-clusterin therapy than patients with lower levels. Thus,
the observation of a baseline threshold level below which patients
receiving custirsen plus a taxane/platinum bases chemotherapy
combination such as paclitaxel/carboplatin, or a taxane based
chemotherapy such as docetaxel are likely to substantially benefit is
an important and novel discovery.
EXAMPLE 3 Clinical Trial (Phase III) - Assessment of Cuatirsan In
Combination With Docetaxel Versus Docetaxel For Treatment of Lung
Cancer
Study Title
A Multinational, Randomized, Open-Label Phase III Study of Custirsen
(TV-lOll/OGX-011) In Combination With Docetaxel Versus Docetaxel As A
Second-Line Treatment In Patients with Advanced or Metastatic (Stage
IV) Non Small Cell Lung Cancer.
Treatment Duration
Patients randomized to the custirsen arm (Arm A ) have 3 doses of
custirsen administered in a 5 to 9 day Loading Dose Period prior to
Day 1 of Cycle 1 . Patients in Arm A receive custirsen on Days 1 , 8
and 15, and docetaxel on Day 1 of the 21-day cycles. Patients in Arm
B receive only docetaxel on Day 1 of the 21-day cycles. Patients
randomized to both arms have 21-day chemotherapy cycles until disease
progression, unacceptable toxicity, withdrawal of consent or protocol
specified parameters to stop treatment.
t d Population
Patients with advanced or metastatic (Stage IV) non small cell lung
cancer (NSCLC) who have received one prior line of platinum-based
systemic anticancer therapy.
Study Objectives
Primary objective:
· To evaluate the benefit of the combination regimen of custirsen
and docetaxel in the improving the Overall Survival (OS) of
patients with advanced or metastatic (Stage IV) NSCLC who have
received one prior line of platinum-based systemic anticancer
therapy.
Secondary objectives:
Efficacy:
• To compare Progression Free Survival (PFS) , Objective Response
Rate (ORR) , and duration of response (CR or PR) , between
patients receiving docetaxel with or without custirsen.
• To compare the arms with respect to Quality of Life (QoL)
parameters .
Safety:
• To assess the safety profile of custirsen in combination with
docetaxel .
Exploratory Objectives:
• To explore clinical efficacy of custirsen (PFS, OS) in subsets
of patients, according to disease parameters and genetic
markers .
• To model the relationship within Arm A , between exposure to
custirsen (i.e., plasma custirsen levels) and outcome measures
(e.g., clinical efficacy and toxicity parameters).
• To explore the pharmacokinetics of custirsen.
• To explore the effect of custirsen on pharmacodynamic biomarkers
in the plasma samples.
· To compare the arm specific levels of serum clusterin and
explore whether there is an association with efficacy measures.
Study Design Overview
This is a multinational, randomized, open-label, Phase ill study in
advanced or metastatic (Stage IV) NSCLC patients previously treated
with first-line platinum-based therapy.
After a screening period of up to 28 days, patients are randomized
1:1 to receive either docetaxel and custirsen (Arm A ) or docetaxel
(Arm B ) . Randomization is stratified .by gender (male vs. female),
NSCLC histology (squamous vs. non-sguamous) , best overall response to
the first-line platinum-based therapy (SD/ CR/ PR vs. PD) and ECOG PS
(0 vs. 1 ) to minimize imbalance at randomization. Patients randomized
to Arm A receive 3 doses of custirsen administered in a 5 to 9 day
Loading Dose Period prior to Day 1 of Cycle 1 . Following the Loading
Dose period, patients in Arm A receive custirsen on Days 1 , 8 and 15,
and docetaxel on Day 1 of the 21-day cycle. Patients in Arm B receive
only docetaxel on Day 1 of the 21-day cycle. Patients randomized to
both study arms have 21-day chemotherapy cycles until disease
progression, unacceptable toxicity, withdrawal from study treatment,
or protocol specified parameters to stop treatment. Patients who are
removed from study treatment for any reason other than disease
progression or death are followed for documented radiological disease
progression. All patients who discontinued study treatment are
followed to collect further anticancer treatment and survival
information until death, loss to follow-up, withdrawal of consent, or
up to 12 months after the end of treatment visit for the last patient
on the study, whichever comes first.
Tumor response to study treatment and disease progression are based
on the criteria proposed by the Response Evaluation Criteria in Solid
Tumors (RECIST) guideline (version 1.1). All patients undergo CT or
R scans of the chest and upper abdomen, as well as any other areas
clinically indicated, at screening, then every 6 weeks, starting at
week 8 after randomization until disease progression. Tumor
measurement is also performed during the end of treatment visit if it
is not done within the previous 6 weeks. Patients who discontinue
study treatment for reasons other than disease progression continue
to have tumor measurements per RECIST vl.l until disease progression,
start of new anticancer therapy, withdrawal of consent, lost to
follow-up, or death, whichever occurs first. Assessment of these
scans is carried out in a blinded fashion, by a Central imaging Lab
designated by the Sponsor.
Adverse events and concomitant medications are collected throughout
the study up to 28 days after the last dose of study treatment.
Medical history is assessed, documented results of EGFR and KRAS
mutation status are collected, if available, and an electrocardiogram
is performed at screening. Physical examination, assessment of the
ECOG Performance Status, vital signs, and laboratory evaluations are
conducted at screening and throughout the study.
The general health status, as reported by the patients, are assessed
by the Functional Assessment of Cancer Therapy - Lung (FACT-L)
questionnaire .
Pharmacodynamic blood samples for serum clusterin are drawn in order
to compare the arm-specific levels of serum clusterin and explore
whether there is an association with efficacy measures. All serum
clusterin testing is done at a central laboratory.
Pharmacokinetic evaluation : A subset of patients in Arm A undergo PK
sampling for custirsen level determination.
Study stopping criteria :
Two formal interim analyses may stop the trial early based on
inadequate evidence of clinical benefit or futility:
.The first assessment for stopping early occurs in two steps. In
the first step, PFS rate (proportion of patients alive without
disease progression) at 14 weeks is analyzed after the first
170 randomized patients have the chance to complete week 14
scheduled tumor assessment and assessments are reviewed by the
independent radiologist. If this first criterion shows an
improvement in the PFS rate at 14 weeks based on predefined
criteria (i.e. one-sided p-value £ 0.1 in the Chi-square test
comparing PFS rates) , the trial is not stopped. However, if the
required improvement in PFS rate at 14 weeks criterion is not
observed, then an early survival futility analysis on the first
100 death events is performed as a second step to either stop
the trial early or continue. NOTE: Study enrollment continues
while the pre-defined criteria are being assessed. The second
step of survival futility analysis is not performed if the
first criterion assuring required improvement in PFS rate is
met .
2 .The second interim analysis is for futility and is performed
when 50% of the death events (425 deaths) have occurred.
Blinding is maintained for all interim analyses and to the criteria
leading to study continuation in the first interim analysis with the
DSMC. If the study is not stopped early in the first interim analysis,
up to 200 sites are activated to accelerate enrollment of 1100
patients for completion of the study.
The trial is not stopped early in order to claim efficacy.
Inclusion/Exclusion Criteria
Inclusion Criteria
1 . Patients must have a histologically or cytologically confirmed,
unresectable, advanced or metastatic (Stage IV per AJCC 7th
edition TNM staging) NSCLC
2 . Males or females ³ 18 years of age at screening.
3 . Life expectancy of > 12 weeks from screening, according to the
investigator's assessment.
4 . Patients must have received one prior line of platinum-based
systemic anticancer therapy for advanced or metastatic NSCLC.
Prior maintenance therapy is allowed and will be considered as
the same line of therapy when continued without discontinuation
after initiation of a treatment regimen.
5 . Patients must have documented radiological disease progression
either during or after the first-line therapy.
6 . Patients must have at least one measurable lesion per RECIST 1.1
criteria.
7 . ECOG performance status of 0 or 1 at screening.
8 . Have adequate electrolyte values, bone marrow, renal and liver
functions at screening as defined below:
• Absolute neutrophil count (ANC) ³ 1.5 x 109/L
• Platelets ³ 100 x 109/L
• Hemoglobin ³ 9 g/dL
• Serum creatinine £ 1.5 x upper limit of normal (ULN)
• Total Bilirubin £ 1.0 x ULN (unless elevated secondary to
benign conditions such as Gilbert's disease)
• AST and ALT £ 1.5 X ULN
• Alkaline phosphatase £ . ULN
• Electrolyte values (sodium, potassium and magnesium) ³ 1 x
L and < 1 x ULN. Patients with corrected electrolyte
values are eligible
. Resolution of any toxic effects of prior therapy to Grade £1
according to NCI CTCAE, v .0 (exception of alopecia and £
Grade 2 peripheral neuropathy) .
10. Females of child-bearing potential must have negative serum
pregnancy test within 72 hours before randomization.
11. Women of child-bearing potential practice a highly effective
method of birth control during and for 3 months after the
chemotherapy/ custirsen last dose. Male partners of women of
child-bearing potential can be either surgically sterile, or
ensure that their female partner utilizes a highly effective
contraceptive method during and for 3 months after
chemotherapy/custirsen last dose.
1 . Patients must be willing and able to give written informed
consent prior to any protocol-specific procedures being
performed and comply with the protocol requirements for the
duration of the study.
Exclusion Criteria
1 . Patients treated with any systemic anti-cancer therapy for NSCLC
within 21 days prior to randomization.
2 . Radiotherapy £ 2 weeks prior to randomization. Patients must
have recovered from all radiotherapy-related toxicities.
3 . Major surgical procedure within 4 weeks prior to randomization.
Patient must have recovered from all surgery-related
complications .
4 . Patients with known CNS metastases (Patients with any clinical
signs of CNS metastases must have a CT or MR of the brain to
rule out CNS metastases in order to be eligible for
participation in the study. Patients who have had brain
metastases treated with radiotherapy or surgically removed
should be clinically stable off corticosteroid treatment at
least 3 weeks prior to randomization.
5 . Patients with history of another active primary malignancy
(except in situ carcinoma of the cervix, adequately treated nonmelanomatous
skin cancers, clinically localized prostate cancer,
superficial bladder cancer or other malignancy treated at least
5 years previously with no evidence of recurrence) .
6 . Medical conditions such as heart failure, myocardial infarction,
uncontrolled hypertension, uncontrolled diabetes mellitus,
cerebrovascular accident or acute hepatitis within 3 months of
randomization or treatment of a major active infection within
one month of randomization, as well as an ongoing cardiac
arrhythmia requiring medication (³ Grade 2 , according to NCI
CTCAE v4.0) or any other significant concurrent medical illness
that in the opinion of the Investigator would preclude protocol
therapy .
7 . Planned concomitant participation in another clinical trial of
an experimental agent, vaccine, or device. Concomitant
participation in observational studies is acceptable.
8 . Female patients who are breastfeeding.
. Patients previously treated with docetaxel for SCLC or with a
known sensitivity to taxane therapies.
Dosage and Routa of A is r i n
Study Agent : Three loading doses of custirsen 640 g IV over 2
hours administered in 5 to 9 days prior to Day 1 of Cycle 1 , then
custirsen 640 mg IV over 2 hours on Days 1 , 8 and 15 of a 21-day
cycle.
Chemotherapy: Docetaxel 75 mg/m 2 IV over 1 hour on Day 1 of a 21-day
cycle.
In Arm A , docetaxel is administered immediately after custirsen
infusion.
Premedications for Custirsen During the Loading Dose Period Only (Arm
A ) :
Ibuprofen (400 mg) is administered 30-60 minutes prior to and every
4-6 hours for 24 hours following each infusion of custirsen during
the Loading Dose Period. If a patient cannot tolerate ibuprofen,
acetaminophen (650 mg) is substituted for ibuprofen. Further
administration of premedications following the Loading Dose Period is
at the discretion of the Investigator.
Premedication for Docetaxel Treatment:
All patients are premedicated with oral corticosteroid as described
below or per local Institutional standards:
Dexamethasone 8 mg twice daily for 3 days starting 1 day prior to
docetaxel administration to reduce the incidence and severity of
fluid retention as well as the severity of hypersensitivity reactions.
Concomitant Medications
Following concomitant medications considered as supportive care are
acceptable while participating in this study:
• Prophylactic or therapeutic use of antiemetics at investigator's
discretion.
• Hematopoietic growth factors should be used in accordance with
the guidelines established by the American Society of Clinical
Oncology (ASCO) , unless otherwise specified by Institutional
standards .
• Palliative radiation therapy for symptomatic non- target bone
lesions .
• Anticoagulation therapy is allowed and is at the discretion of
the Investigator.
• Standard nonsurgical therapies for concurrent medical conditions .
• Short-term treatment with high doses of corticosteroids is
permitted for the treatment of COPD or other inflammation
exacerbation .
Following concomitant therapies are not permitted while participating
in this trial:
• Other investigational agents .
• Any concurrent anticancer therapy including chemotherapy,
radiotherapy for target lesions, surgery, hormonal therapy, or
immunotherapy .
Docetaxel is a CYP3A4 substrate. Concomitant use of docetaxel
and drugs that inhibit CYP3A4 may increase exposure to docetaxel and
should be avoided.
Outcome Measures:
Primary Efficacy Variable and Endpoint :
The primary endpoint and variable for the study is overall survival
(OS) , defined as the time from date of randomization to the date of
death from any cause.
Secondary Efficacy Variables and Endpoints:
Progression Free Survival (PFS) , defined as the time from the date of
randomization to the first objective documented progression per
RECIST vl.l or death due to any cause, whichever occurs first.
The Objective Response (OR) is defined as achieving a best overall
response of complete response (CR) or partial response (PR) , as
defined using RECIST vl.l.
The duration of overall response (CR or PR) is defined as the time
from the first occurrence of CR or PR until the date of the first
documented disease progression (taking as reference for progressive
disease the smallest measurements recorded on study) or death.
Quality of life parameters: Functional Assessment of Cancer Therapy -
Lung (FACT-L)
Safety variables:
Occurrence of Adverse events throughout the study
Clinical laboratory test results
Vital signs and body weight measurements
Pharmacokinetic Variables :
Custirsen levels for population PK analysis
Statistical Considerations:
Sample Size
The maximal sample size for this study was calculated based on OS for
final analysis. This size depends on the number of death events
required. To detect a hazard ratio (HR) of 0.8 at one-sided
significance level (alpha) of 0.025 and power of 90%, a total of 850
death events are required. Based on assumption of exponential
survival time distribution with median survival time of 9 months in
the control arm, recruitment period of 48 months (assumed recruitment
rate of 0.18 patients per site per month, starting with about 70
sites and increasing to about 200 sites), with additional 8 months of
follow-up, the required sample size is 1100 patients (550 per arm) .
The calculation of target events was performed using EAST software,
taking into account the futility analysis at 50% of events.
Sample Size and Timing for 1st Interim Assessment
Sample size for the alive without progression (AWP) at week 14
analysis was determined at 170 evaluable patients (85 patients per
arm) . Sample size for the early OS futility analysis was determined
at 100 death events, corresponding to randomization of approximately
235 patients. Specification of the rules for stopping the study early
and associated false-positive (go decision despite no difference) and
false-negative (stopping the trial despite true benefit)
probabilities are provided in the Statistical Analysis Plan and are
detailed in the operation characteristics section below. Based on
recruitment rates and exponential survival time distribution for the
control arm with median of 9 months (as specified above) , realization
of 100 death events occurs at about 19-20 months from beginning of
randomization. Completion of week 14 progression assessment for the
first 170 enrolled patients occurs at approximately 18.5 months after
beginning of randomization. Both analyses may be done together since
the PFS assessment (alive without event) is centrally reviewed before
the futility assessment and death events can be assessed without
delay.
Multiple Comparisons and Multiplicity
n this Phase III study, there may be only one analysis for
demonstrating efficacy. The efficacy analysis is performed once the
pre-defined target of 850 death events is realized, using type 1
error probability of one-sided 0.025.
Two formal interim analyses for stopping the trial early are based on
pre-defined assessments for inadequate evidence of clinical benefit
or futility. As these analyses indicate action regarding the trial
only if results are found that indicate the investigational treatment
is inadequate or futile, no adjustment to type 1 error for the final
analysis is made. The trial is not stopped early in order to claim
efficacy.
The secondary efficacy objectives are relevant to regulatory goals
only if there is success with respect to the primary objective. The
secondary efficacy analysis is tested using one-sided 0.025,
according to their hierarchy, provided that the primary efficacy
analysis is significant. There are no further considerations of
multiplicity and additional test results are considered exploratory.
Primary Efficacy Variable Analysis
All patients randomized into this trial are included in the primary
analysis, according to the randomized arm ("intent-to-treat"
analysis! . A patient that is not reported as dead before data cut-off
or has dropped out from survival follow-up is censored at his last
known alive date. The primary analysis is a stratified log-rank test
(stratified by the previously identified stratification factors) .
Hazard ratio and its 95% confidence interval (CI) are estimated using
a stratified Cox propotional hazards model (stratified by the
previously identified stratification factors) . Kaplan-Meier plot are
used to display estimated survival probabilities.
Randomization
Patients are stratified before randomization as described above.
Centralized Randomization are performed using blocks with a 1:1 ratio
into the 2 treatment arms. Randomization is stratified by gender
(male vs. female), NSCLC histology (squamous vs. non- squamous ), best
overall response to the first-line platinum-based therapy (SD/ CR/ PR
vs. PD) and ECOG PS 0 vs. 1 ) to minimize imbalance at randomization.
1 . Operating Characteristics of 1st Interim Assessment for
Inadequate Evidence of Clinical Benefit or Futility
Step 1 : binary progression assessment at 14 weeks.
The statistical rule was chosen to provide 10% false-positive
probability, if in fact there is no difference in progression rates
at Week 14 between the two arms, using 170 evaluable patients.
Thus, a one-sided p value £ .1 in the Chi -square test comparing PPS
rates allows the trial to proceed without going to Step 2 , the early
survival futility assessment .
Assuming the PFS rate at 14 weeks is 50% in the control arm (as
expected from reports on median PFS of about 3 months in patients
treated with docetaxel in the 2nd line setting) , the 10% significance
level criterion translates into a critical absolute difference of 10%.
The power of the proposed rule to correctly detect a true benefit and
enable study continuation is 87%, 80% and 76% for absolute true
difference between arms of 18%, 16% and 15%, respectively, assuming
control arm rate is 50%.
NOTE: The binary (PFS! assessment at the 14 week time point was
chosen as opposed to time-to-event PFS analysis because in-clinic
treatment visits schedule is more frequent for the experimental arm
(every week) in comparison to the docetaxel control arm (every 3
weeks) , whereas the scheduled assessment for progression (up to week
14) is only at two time points (8 weeks and 14 weeks) such that there
is the possibility for unscheduled weekly progression assessment for
the treatment arm and not for the control arm (leading to bias in
time to event) .
Step 2 : Overall survival at 100 events (time-to-event analysis) (only
analyzed if Step 1 show one-sided p-value>0.1 for difference in rate)
The statistical rule was chosen to provide 28% false-positive
probability, if in fact there is no difference in OS between the two
arms, using 100 death events, thus leading to 72% probability to
correctly stop the trial if indeed futile. The corresponding critical
HR for declaring futility is HR=0.890.
Thus, a futility criteria with failure defined as having an observed
HR of ³0.890 in the OS analysis, or equivalently, trial is allowed to
continue if observed HR<0.890.
The table below presents the estimated probability to continue the
trial using the proposed futility rule, for various specifications of
the true hazard ratio. As can be seen, if the true HR=0 . , then the
probability of showing futility incorrectly would be 20%, and it
would be as high as 30% if true HR=0.8.
2 . Operating Characteristics of 2nd Interim Assessment for Futility
The second futility analysis may occur when 50% of the death events
have occur (425 events) when approximately 800 patients are enrolled
into the trial, at about 39-40 months after beginning of
randomization. The stopping boundary was calculated to have 1% chance
of falsely stopping the trial for futility if true HR=0.8, and
provides 49% chance to correctly stop the trial if true HR=1. The
corresponding critical HR is 1.0025.
3 . Analysis Methods in the 1st Interim Assessment
Binary PFS variable analysis
Analysis are based on 170 evaluable patients, defined as having a
measurable disease at baseline (eligibility criteria into the study)
and received at least one dose of study treatment. For each patient,
a Week 14 "Alive Without Disease Progression" (AWP) status variable
is defined as one il) if the patient is alive and free of evidence of
radiological disease progression at Week 14 assessment and zero (0)
if otherwise. The proportions of patients in each arm for which AWP =
1 are compared using Chi square test. Supportive analysis adjusting
for imbalance of prognostic variables are performed using logistic
regression. The assessment of progression for this endpoint are based
on the results of the blinded independent central review of the
Central Imaging Lab. If this criterion is not met and required
improvement in PFS rate is not observed, then the early OS futility
analysis is warranted to determine if the trial should be stopped.
Early OS futility analysis at 100 death events:
All patients randomized up to realization of 100 death events are
included in the analysis . A patient that is not reported as dead
before data cut-off or has dropped out from survival follow-up are
censored at his last known alive date. The differences in OS
distribution between the two arms is summarized using the HR, as
estimated from a Cox proportional hazards model (un-stratif ied) .
Supportive analysis adjusting for imbalance in important prognostic
variables is performed by including such covariates into the model.
Table 2 : Study Task Flow Chart
Arm A patients only: During the Loading Dose Period, 3 custirsen
infusions must be given between Days -9 and -1. The first dose must
be given within 4 days after randomization. Each administration of
custirsen between Day -9 and Day -1 must be a minimum of one day
apart. There must be at least 1 non-infusion day (Day 0 ) and no more
than 4 days between the last loading dose and Day 1 of Cycle .
For Arm B patients, Day 1 of Cycle 1 must be given within 4 days
after randomization. For all patients, treatment should continue
until disease progression, unacceptable toxicity, withdrawal of
consent or investigator decision to stop treatment.
Collect EGFR and KRAS mutation status results, if available.
Height is measured only at screening visit. Subsequent physical
examinations are abbreviated (i.e., limited to weight and assessing
signs and symptoms of disease or toxicity)
Vital signs include blood pressure, heart rate and temperature. Axm
A patients only: ital signs are performed before and after
completion of custirsen infusions during the custirsen Loading Dose
Period and on Day 1 of each cycle. ital signs should also be taken
with any signs or symptoms (e.g., flushing, chills) during or
immediately after an infusion. For all patients: Vital signs are
performed at Screening, Day 1 of each cycle prior to study
treatment, at the End of Treatment visit.
To be completed by the patient upon arrival at the clinic and before
any study procedures or testing are performed.
All patients undergo CT or M scans of the chest and upper abdomen,
as well as any other areas clinically indicated, at screening, then
every 6 weeks (± one week) , starting at week 8 after randomization
(regardless of the treatment schedule) until disease progression.
Note: CT scans are preferred; however, R s can be used for disease
assessment as long as they are consistently performed for an
individual patient's assessments. A chest and upper abdomen CT scan
(MRI, if appropriate) that is performed as standard of care prior to
consent for this study may be used as the screening test if obtained
within 28 days prior to randomization and if accessible to the same
facility where subsequent scans are performed and if it is of
adequate quality for subsequent evaluations, according to the
requirements of the central imaging center.
ECG is performed for all patients at Screening and End of Treatment
Visit. ECG can be repeated at any visit if there is a clinical
indication for an ECG.
Hematology [White Blood Cell (WBC) count, hemoglobin, platelet
count, absolute neutrophil and lymphocyte counts] and Chemistry
[albumin, serum creatinine, sodium, potassium, calcium, phosphorus,
alkaline phosphatase, D , bilirubin (total and direct), SCOT (AST),
and SGP (ALT) ) is drawn at screening, prior to the first loading
dose custirsen infusion (unless screening blood draw was collected
within 14 days of randomization) , prior to infusion on Day 1 of each
cycle and at the End-o -Treatment isit . The hematology and serum
chemistry laboratory tests can be performed up to 72 hours prior to
the infusion on Day 1 of each cycle and is available before the
start of treatment on those days.
Does not have to be repeated if screening sample was collected
within 14 days prior to randomization.
For women of childbearing potential. Test is completed within 72
hours prior to randomization.
PK sampling (custirsen) is performed in a subset of patients in Arm
A at the following 6 timepoints; before the first loading dose, on
day Day 1 of Cycle 1 (end of custirsen infusion) , and on Day 1 of
Cycle 3 (predose, end of custirsen infusion and end of docetaxel
infusion) and on Day 8 of Cycle 8 (predose) .
For Arm A patients only, Ibuprofen (400 mg) or acetaminophen
(paracetamol) (500-1000 mg) is given 30-60 minutes prior to and
every 4-6 hours for 24 hours following each infusion of custirsen
during the Loading Dose Period. Further administration of
premedication following the Loading Dose Period is at the
discretion of the Investigator.
Adverse events to be graded using NCI CTCAE version 4.0 and
reported for each loading dose and at every cycle on Day 1 prior to
treatment. The adverse event reporting period begins from the
signing of informed consent and ends 28 days following the last
dose of study treatment. Serious adverse events and grade 3 or
higher adverse events that are ongoing at the End of Treatment
visit is followed until each event resolves or is assessed as
chronic .
After discontinuation of study treatment, all patients must be
contacted every 12 weeks to collect further anticancer treatment
and survival information.
Results
The combination treatment of custirsen and docetaxel administered to
arm A subjects is safe and well tolerated, with an acceptable
adverse events profile. Arm A subjects (custirsen + docetaxel) have
prolonged survival compared to Arm subjects (docetaxel) .
Additionally, progression free survival is increased in Arm A
subjects and a statistically significant higher proportion of Arm A
subjects survive free of progression for at least 14 weeks compared
to Arm B subjects. Overall progression free survival is improved in
arm A subjects. One or more symptoms of NSCLC, such as chest pain,
pleural effusions, pulmonary edema, dyspnea, or hemoptysis
occasionally improve in Arm A subjects compared to Arm B subjects.
Furthermore, quality of life improves in Arm A subjects compared to
Arm B subjects .
Discussion
The experimental examples provided herein show that, when combined
with custirsen, taxanes are particularly effective for the treatment
of lung cancer, whether administered in the absence of additional
chemotherapeutic agents or in combination with a platinum-based
chemotherapeutic agent. Example 1 shows that the combination of
custirsen with paclitaxel (a taxane) and carboplatin (a platinumbased
chemotherapy agent) is effective at treating NSCLC of nonsquamous
histology, and Example 2 shows that the combination of
custirsen with docetaxel is effective at treating NSCLC, even without
an additional platinum-based chemotherapeutic agent. Therefore, it
will be understood that the taxanes, and the combinations of taxanes
and platinum-based chemotherapeutic agents disclosed herein will be
particularly effective for treating lung cancer when combined with
custirsen.
References
1 . Calvert et al., Carboplatin dosage: prospective evaluation of a
simple formula based on renal function. J Clin Oncol.
1989;7:1748-1756.
2 . Carboplatin Package Insert, Bedford Laboratories, 2010; Accessed
from www.bedfordlabs.com/products/inserts/carboplatin_pi.pdf on
May 4 , 2011.
3 . Cockcroft and Gault, Prediction of creatinine clearance from
serum creatinine. Nephron 16 1976, (1): 31-41.
4 . D'Addario et al., Metastatic non-small-cell lung cancer: EXM0
Clinical Practice Guidelines for diagnosis, treatment and
follow-up. Annals of Oncology.
5 . Fidias and Novel lo. Strategies for Prolonged Therapy in Patients
with Advanced Non-Small-Cell Lung Cancer. Journal of Clinical
Oncology, 2010, 28(34): 5116-5123.
6 . Je al et al.. Global Cancer statistics, 2011. CA Cancer J Clin;
2011, 61:69-90.
7 . Knox et al.. Mechanism of cytotoxicity of anticancer platinum
drugs: evidence that cis-diamminedichloroplatinum( ) and cisdiammine-
(1 ,l-cyclobutanedicarboxylato)platinum(II) differ only
in the kinetics of their interaction with DNA. Cancer Research,
1986, 4 (4 Pt 2 ) :1972-9.
8 . Kuriyama, Effect of taxol on first and second meiotic spindle
formation in oocytes of the surf clam, Spisula solidissima. J
Cell Sci. 1986 84: 153-64.
9 . Langer et al., The Evolving Role of Histology in the Management
of Advanced Non-Small-Cell Lung Cancer. Journal of Clinical
Oncology, 2010, 28 (36) :5311-5320 .
10. National Comprehensive Cancer Network Clinical Practice
Guidelines in Oncology, Non-Small Cell Lung Cancer, V .2 .2010.
National Comprehensive Cancer Network, Inc., March 5 , 2010.
11. National Cancer institute. General Information about Non-Small
Cell Lung Cancer,
htt ://www .cancer .gov/ CANCERTOPICS /PDQ / REATMEN / ON-SMALL- CELLLUNG/
PATIEN , accessed February 24, 2011.
12. OncoGenex Technologies, A Study of OGX-011/Gemcitabine/Platinum-
Based Regimen in Stage B/ V Non-Small Cell Lung Cancer
(NSCLC) . 2005, accessed from www. clinical
trials.gov/ct2/showNCT00138658, accessed February 24, 2011.
13 . Pirker et al ., Cetuximab plus chemotherapy in patients with
advanced non-small-cell lung cancer (FLEX) : An open-label
randomized phase III trial. Lancet, 2009, 373:1525-1531.
14. Rowinsky et al., Taxol: A Novel Investigational Antimicrotubule
Agent. J . Natl Cancer Inst, 1990, 82 (15) :1247-59 .
15. Sandler et al., Paclitaxel-carboplatin alone or with bevacizumab
for non-small-cell lung cancer. N Eng J Med, 2006, 355:2542-
2550.
16. Soon et al., Duration of chemotherapy for advanced non-smallcell-
lung cancer: A systematic review and meta-analysis of
randomized clinical trials.
17. Taxol Package insert, Bristol-Myers Squibb Company, 2010;
Accessed from http://packageinserts.bms.com/pi/pi_taxol.pdf on
May 5 , 2011.
18. Teicher et al.. Influence of Schedule on Alkylating Agent
Cytotoxicity in Vitro and in Vivo. Cancer Research, 1989,
49:5994-5998.

We Claims:-
1 . A method of treating a human patient afflicted with
unresectable, advanced or metastatic non-small cell lung
cancer comprising periodically administering to the human
patient chemotherapy comprising an amount of docetaxel;
and 640mg of an anti-clusterin oligonucleotide having the
sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No. : 1 , wherein
the anti-clusterin oligonucleotide has a phosphorothioate
backbone throughout, has sugar moieties of nucleotides 1-
4 and 18-21 bearing 2 '-O-methoxyethyl modifications, has
nucleotides 5-17 which are 'deoxynucleotides , and has 5-
methylcytosines at nucleotides 1 , 4 , and 19, thereby
treating the human patient afflicted with unresectable,
advanced or metastatic non-small cell lung cancer.
2 . The method of claim 1 , wherein the treating includes
prolonging survival of the human patient.
3 . The method of claim 1 or 2 , wherein the treating includes
prolonging survival of the human patient which prolonged
survival is free of progression of the non-small cell
lung cancer .
. The method of claim 3 , wherein the human patient survives
free of progression of the non-small cell lung cancer for
at least 14 weeks .
5 . The method of any one of claims 1 to 4 , wherein the human
patient suffers from chest pain, pleural effusions,
pulmonary edema, dyspnea, or hemoptysis.
6 . The method of any one of claims 1 to 5 , wherein the nonsmall
cell lung cancer is lung adenocarcinoma or lung
large cell carcinoma.
7 . The method of any one of claims 1 to 6 , wherein during
the chemotherapy the amount of docetaxel administered is
75mg/m' intravenously to the human patient over a period
of 1 hour.
8 . The method of any one of claims 1 to 6 , wherein during
the chemotherapy the amount of docetaxel administered is
less than 75mg/m 2 intravenously to the human patient.
9 . The method of any one of claims 1 to 8 , wherein during
the chemotherapy the docetaxel is administered to the
human patient on the first day of each of at least one
three-week chemotherapy cycle.
10. The method of any one of claims 1 to 9 , wherein the anticlusterin
oligonucleotide is administered to the human
patient intravenously in an aqueous solution comprising
sodium ions .
11. The method of claim 10, wherein the anti-clusterin
oligonucleotide is administered to the human patient 3
times within a 5 to 9 day period before the first day of
chemotherapy and then once weekly beginning on the first
day of chemotherapy.
12. The method of any one of claims 1 to 11, wherein the lung
cancer is nonresectable, advanced or metastatic non-small
cell lung cancer.
13. The method of any one of claims 1 to 12, wherein the
human patient has not received treatment for non-small
cell lung cancer for at least 1 year.
14. The method of any one of claims 1 to 13, wherein the
human patient has not received a chemotherapeutic agent
for the treatment of non-small cell lung cancer for at
least 1 year.
15. The method of any one of claims 1 to 14, wherein the
human patient has before initiation of the periodic
administration received a chemotherapeutic agent for the
treatment of lung cancer.
16. The method of claim 15, wherein the che herapeuti
agent was a platinum-based chemotherapeutic agent.
17. The method of any one of claims 1 to 16, wherein the
human patient is afflicted with Stage IV non-small cell
lung cancer.
18. The method of any one of claims 1 to 17, wherein the
human patient is afflicted with non-small cell lung
cancer of non-squamous histology.
19. The method of any one of claims 1 to 18, further
comprising the steps of:
i ) measuring the level of serum clusterin present in
the blood of the human patient prior to the
administration of the anti-clusterin oligonucleotide;
ii) determining whether the level of serum clusterin
present in the human patient is lower than a
predetermined upper threshold level of baseline
serum clusterin below which a human patient is
likely to substantially benefit from anti-clusterin
therapy; and
iii) administering the anti-clusterin oligonucleotide
only if the level of serum clusterin present in the
blood of the human patient is lower than the
predetermined upper threshold level of baseline
serum clusterin.
20. The method of claim 19, wherein in step i ) the measuring
is performed after initiation of the chemotherapy.
21. The method of claim 19, wherein the predetermined upper
threshold level of baseline serum clusterin is 75pg/mL.
22. The method of any one of claims 1 to 21, further
comprising the steps o :
i ) administering to the human patient the ant iclusterin
oligonucleotide in an initial dosage and
treatment protocol;
ii) thereafter testing the human patient to determine a
level of serum clusterin after a period of treatment
with the anti-clusterin oligonucleotide intended to
reduce clusterin expression;
iii) determining an adjusted dosage and treatment
protocol based on the determined level of serum
clusterin; and
iv) administering to the human patient the anticlusterin
oligonucleotide in accordance with the
adjusted dosage and treatment protocol.
The method of claim 22 , wherein the determined level of
serum clusterin after a period of treatment with the
anti-clusterin oligonucleotide intended to reduce
clusterin expression is above a predetermined post anticlusterin
oligonucleotide initiation threshold level .
The method of claim 22 or 23, wherein the predetermined
post anti-clusterin oligonucleotide initiation threshold
level is 30 g/m .
The method of any one of claims 22 to 24, wherein the
adjusted dosage and treatment protocol comprises
administration of the anti-clusterin oligonucleotide to
the human patient two or three times per week.
A combination for treating a human patient afflicted with
unresectable, advanced or metastatic non-small cell lung
cancer, comprising chemotherapy comprising docetaxel; and
an anti-clusterin oligonucleotide having the sequence
CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1), wherein the anticlusterin
oligonucleotide has a phosphorothioate backbone
throughout, has sugar moieties of nucleotides 1-4 and 18-
21 bearing 2 '-O-methoxyethyl modifications, has
nucleotides 5-17 which are 2 'deoxynucleotides , and has 5-
methylcytosines at nucleotides 1 , 4 , and 19.
27 . A composition for treating a human patient afflicted with
unresectable, advanced or metastatic non-small cell lung
cancer, comprising chemotherapy comprising docetaxel; and
an anti-clusterin oligonucleotide having the sequence
CAGCAGCAGAGTCTTCATCAT (Seq. ID No. : 1), wherein the anticlusterin
oligonucleotide has a phosphorothioate backbone
throughout, has sugar moieties of nucleotides 1-4 and 18-
21 bearing 2 '-O-methoxyethyl modifications, has
nucleotides 5-17 which are 2 'deoxynucleotides, and has 5-
methylcytosines at nucleotides 1 , 4 , and 19.
28. A pharmaceutical composition for treating a human patient
afflicted with unresectable, advanced or metastatic nonsmall
cell lung cancer, the composition comprising
chemotherapy comprising docetaxel; and an anti-clusterin
oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT
(Seq. ID No. : 1 ) , wherein the anti-clusterin
oligonucleotide has a phosphorothioate backbone
throughout, has sugar moieties of nucleotides 1-4 and 18-
21 bearing 2 '-O-methoxyethyl modifications, has
nucleotides 5-17 which are 'deoxynucleotides, and has 5-
methylcytosines at nucleotides 1 , 4 , and 19.
29. Use of a composition comprising chemotherapy comprising
docetaxel; and an anti-clusterin oligonucleotide having
the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1),
wherein the anti-clusterin oligonucleotide has a
phosphorothioate backbone throughout, has sugar moieties
of nucleotides 1-4 and 18-21 bearing 2 '-O-methoxyethyl
modifications, has nucleotides 5-17 which are
2'deoxynucleotides , and has 5-methylcytosines at
nucleotides 1 , 4 , and 19, for treatment of a human
patient afflicted with unresectable, advanced or
metastatic non-small cell lung cancer.
30. Use of a composition comprising chemotherapy comprising
docetaxel; and an anti-clusterin oligonucleotide having
the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1),
wherein the anti-clusterin oligonucleotide has a
phosphorothioate backbone throughout, has sugar moieties
of nucleotides 1-4 and 18-21 bearing 2 '-O-methoxyethyl
modifications, has nucleotides 5-17 which are
2 'deoxynucleotides, and has 5-methylcytosines at
nucleotides 1 , 4 , and 19, for preparation of a medicament
for treatment of a human patient afflicted with
unresectable, advanced or metastatic non-small cell lung
cancer .
31. A package for use in the treatment of a human patient
afflicted with unresectable, advanced or metastatic nonsmall
cell lung cancer, comprising chemotherapy
comprising docetaxel; and an anti-clusterin
oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT
(Seq. ID No.: 1), wherein the anti-clusterin
oligonucleotide has a phosphorothioate backbone
throughout, has sugar moieties of nucleotides 1-4 and 18-
21 bearing 2'-O-methoxyethyl modifications, has
nucleotides 5-17 which are 'deoxynucleotides , and has 5-
methylcytosines at nucleotides 1 , 4 , and 19, and
instructions for the use of the chemotherapy in
combination with the anti-clusterin oligonucleotide for
the treatment of unresectable, advanced or metastatic
non-small cell lung cancer.
32. A chemotherapy comprising docetaxel for use in
combination with an anti-clusterin oligonucleotide having
the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1),
wherein the anti-clusterin oligonucleotide has a
phosphorothioate backbone throughout, has sugar moieties
of nucleotides 1-4 and 18-21 bearing 2 '-O-methoxyethyl
modifications, has nucleotides 5-17 which are
2 'deoxynucleotides , and has 5-methylcytosines at
nucleotides 1 , 4 , and 19, for treating of a human patient
afflicted with unresectable, advanced or metastatic nonsmall
cell lung cancer; or an anti-clusterin
oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT
!Seq. ID No.: 1), wherein the anti-clusterin
oligonucleotide has a phosphorothioate backbone
throughout, has sugar moieties of nucleotides 1-4 and 18-
21 bearing 2 '-O-methoxyethyl modifications, has
nucleotides 5-17 which are 2 'deoxynucleotides , and has 5-
methylcytosines at nucleotides 1 , 4 , and 19, for use in
combination with a chemotherapy comprising docetaxel, for
treating of a human patient afflicted with unresectable,
advanced or metastatic non-small cell lung cancer.

Documents

Application Documents

# Name Date
1 10390-DELNP-2014.pdf 2014-12-14
2 Spec.pdf 2014-12-16
3 Form 5.pdf 2014-12-16
4 Form 3.pdf 2014-12-16
5 Drawings.pdf 2014-12-16
6 10390-DELNP-2014-OTHERS-121214.pdf 2014-12-29
7 10390-DELNP-2014-Correspondence-121214.pdf 2014-12-29
8 10390-delnp-2014-GPA-(22-01-2015).pdf 2015-01-22
9 10390-delnp-2014-Form-3-(22-01-2015).pdf 2015-01-22
10 10390-delnp-2014-Correspondence Others-(22-01-2015).pdf 2015-01-22
11 10390-delnp-2014-Assignment-(22-01-2015).pdf 2015-01-22