Description:4. DESCRIPTION
Technical Field of the Invention

The present invention is directed to the field of synthetic biology. Particularly, the invention relates to construction of ß- carotene biosynthetic pathway and methods for the producing the same. More particularly, the invention is directed to biological synthesis of ß-carotene pigment for multiple applications and methods for obtaining improved ß - carotene yield in Saccharomyces cereviciae by strain engineering
.
Background of the Invention

Carotenoids are lipophilic isoprenoids found in plants, algae, microorganisms and have been extensively used in medicine, cosmetics, healthcare, and food industries due to their antioxidant properties. These are widely used as nutraceuticals. Carotenoids has two subcategories: Carotenes include lycopene, a-carotene, ß-carotene, and ?-carotene and xanthophylls include zeaxanthin, lutein, and astaxanthin. Because of their quenching activity towards singlet oxygen and capture free radicals, ß-carotene and lycopene are used for the treatment of cardiovascular diseases and prostate cancer. Currently, these compounds are produced through plant extraction and chemical synthesis.
Plant extraction is an expensive process and requires lot of space and water for farming. Chemical synthesis is cheap but not environmentally favorable. There is an increasing demand to replace chemically synthesized nutraceuticals with natural compounds. These issues can be resolved by microbial synthesis.
With the continuous development of synthetic biology and metabolic engineering, microbial synthesis of ß-carotene is an attractive strategy by heterologous expression of ß-carotene synthesis enzymes.
A few patent literature related to the production of BCarotene enzymes have been discussed below:
The patent US9909130B2 (Production of carotenoids in oleaginous yeast and fungi) relates to systems for producing engineered oleaginous yeast or fungi that express carotenoids. The recombinant fungus of claim 5, wherein the fungus comprises at least one modification selected from the group consisting of: expression of truncated HMG-CoA reductase; heterologous expression of carotene hydroxylase and carotene ketolase; complete or partial inactivation of a gene encoding squalene synthase; This method is different from our present invention, wherein our present invention utilises nucleic acids operably linked to strong constitutive promoter, the vectors are pESCHIS and the constitutive promoters are Pact1, Ppgk1, and Psptdh3 and the recombinant eukaryotic host cell, wherein the host cell is Saccharomyces cereviciae, W303-1A.
The patent US8734823B2 (Device including altered microorganisms, and methods and systems of use) relates to Devices, methods, and systems for administration to at least one biological tissue including at least one altered microorganism. In an embodiment, the altered microorganism includes at least one nucleic acid construct encoding at least one therapeutic agent.
Saccharomyces cerevisiae (baker's yeast) is generally regarded as safe (GRAS) microorganism can be engineered with heterologous biochemical pathways for production of molecules of interest.
As used herein, the term “gene” refers to a nucleic acid fragment corresponding to specific amino acid sequence that expresses a specific protein with regulatory sequences. “Native gene” or “wild type gene” refers to a gene as found in nature with its own regulatory sequences.
As used herein, the term “promoter” refers to a region of DNA that initiates transcription of a particular gene. Promoters are located near the transcription start sites of genes, on the same strand and upstream on the DNA capable of controlling the expression of a coding sequence or functional RNA which can be native, derived or synthetic. Some promoters are called constitutive as they are active in all circumstances in the cell, while others are called inducible as they are regulated and become active in response to specific stimuli.
As used herein, the term “gene expression”, refers to the process by which information from a gene is used in the synthesis of a functional gene product. These products are often proteins, but in non-protein coding genes such as transfer RNA (tRNA) or small nuclear RNA (snRNA) genes, the product is a functional RNA.
As used herein, the term “transformation” as used herein, refers to the transfer of a nucleic acid fragment into a host organism either in the form of plasmid or integrated stably to the chromosome of the host organisms resulting in genetically stable inheritance. A cloning vector is a small piece of DNA, mostly a plasmid, that can be stably maintained in an organism, and into which a foreign DNA fragment can be inserted for cloning or transformation purposes.
The term “host cell” includes an individual cell or cell culture which can be, or has been, a recipient for the subject of expression constructs. Host cells include progeny of a single host cell. Host cell can be any expression host including prokaryotic cell such as but not limited to Bacillus subtilis, Escherichia coli, Pseudomonas putida, Corynebacterium glutamicum or eukaryotic system, such as, but not limited to Saccharomyces cerevisiae, Pichia pastoris, Hansenula polymorpha.
The term “recombinant strain” refers to a host cell which has been transfected or transformed with the expression constructs or vectors of this invention.
The term “expression cassette” denotes a gene sequence used for cloning in expression vectors or in to integration vectors or integrated in to coding or noncoding regions of chromosome of the host cell in a single or multiple copy numbers, where the expression cassette directs the host cell's machinery to make RNA and protein encoded by the expression cassette.
The term “expression construct” is used here to refer to a functional unit that is built in a vector for the purpose of expressing recombinant proteins/peptides, when introduced into an appropriate host cell, can be transcribed and translated into a fusion protein which is displayed on the cell wall.
The term “nucleic acid” or “nucleotide sequence” is used to refer to an artificially synthesized nucleic acid in which the genes encoding ?- carotene enzymes has been operably fused with promoters and terminators of Saccharomyces cerevisiae.
S. cerevisiae is well established microbial host for ß-carotene synthesis as evidenced by publications as well as availability of genetic tools. The metabolic pathway for ß-carotene synthesis consists of three enzymes that convert naturally produced farnesyl phosphate via geranylgeranyl diphosphate to ß-carotene. These three enzymes are crtE, crtYB, and crtI, which are not naturally found in S. cerevisiae. To generate ß-carotene yeast, these enzymes should be expressed heterogeneously.
This present invention utilises S. cerevisiae as a chassis for the reconstruction of ß- carotene biosynthetic pathway for cost effective cum sustainable production of ß- carotene with high yield.

Brief Summary of the Invention

The following presents a simplified summary of the disclosure in order to provide a basic understanding to the reader. This summary is not an extensive overview of the disclosure and it does not identify key/critical elements of the invention or delineate the scope of the invention. Its sole purpose is to present some concepts disclosed herein in a simplified form as a prelude to the more detailed description that is presented later.

The primary objective of this invention is to provide an improved high-yielding method for production of ß – carotene in a heterologous host by engineering the nucleotide sequence of the native genes encoding ß- carotene enzymes to match the preferred codon system of the host cell.
Another objective of our present invention is to provide a biological method for greater efficiency in protein expression for the production of ß – carotene.

The present invention relates to nucleic acids encoding ß- carotene producing enzymes operably fused to promoters and terminators and the process for obtaining a high yield of the ß- carotene.
In one aspect, the invention provides a recombinant vector containing nucleic acids encoding ß- carotene producing enzymes.
In another aspect, the invention provides a recombinant host cell which can optimally produce ß- carotene.
In a further aspect, the invention provides an improved process for production of ß - carotene

Brief Summary of the Drawings

The invention will be further understood from the following detailed description of a preferred embodiment taken in conjunction with an appended drawing, in which:

Fig 1: Diagram showing the recombinant vector carrying ß- carotene synthesis genes pESCHIS_CrtE-CrtI-CrtYB and their regulatory elements, in accordance with our present invention;

Detailed Description of the Invention

The present disclosure emphasises that its application is not restricted to specific details of construction and component arrangement, as illustrated in the drawings. It is adaptable to various embodiments and implementations. The phraseology and terminology used should be regarded for descriptive purposes, not as limitations.

The terms "including," "comprising," or "having" and variations thereof are meant to encompass listed items and their equivalents, as well as additional items. The terms "a" and "an" do not denote quantity limitations but signify the presence of at least one of the referenced items. Terms like "first," "second," and "third" are used to distinguish elements without implying order, quantity, or importance.

Unless otherwise defined herein, scientific and technical terms used in connection with the present disclosure shall have the meanings that are commonly understood by those of ordinary skill in the art. Further, unless otherwise required by context, singular terms shall include the plural and plural terms shall include the singular as is considered appropriate to the context and/or application. The various singular/plural permutations may be expressly set forth herein for the sake of clarity. Generally, nomenclatures used in connection with, and techniques of biotechnology, fermentation technology, genetic engineering and recombinant DNA technology described herein are those well-known and commonly used in the art. Certain references and other documents cited are expressly incorporated herein by reference. In case of conflict, the present specification, including definitions, will control. The materials, methods, figures and examples are illustrative only and not intended to be limiting.
Furthermore, the methods, preparation and use of the nucleic acids encoding ß- carotene enzymes employ, unless otherwise indicated, conventional techniques in recombinant DNA technology, fermentation technology and related fields. These techniques, their principles, and requirements are explained in the literature and known to a person skilled in the art.
Before the method of generating the nucleic acids encoding the ß- carotene enzymes, vectors, recombinant hosts, methods of downstream processing and other embodiments of the present disclosure are disclosed and described, it is to be understood that the terminologies used herein are for the purpose of describing particular embodiments only and are not intended to be limiting.
The present invention provides a multidimensional approach for achieving a high rate of ß- carotene synthesis in a heterologous host. This approach coupled with engineering the nucleotide sequence of the native genes encoding ß- carotene enzymes to match the preferred codon system of the host cell gives a greater efficiency in protein expression.
The present invention discloses a method involving nucleic acids encoding ß- carotene enzymes in which the genes encoding ß- carotene enzymes has been operably fused to promoters and terminators of Saccharomyces cerevisiae and having optimal expression levels in heterologous hosts. In a preferred embodiment, the nucleic acids are represented by SEQ ID Numbers: 1, 3, 5.
The present disclosure of our present invention also relates to polypeptides encoded by the nucleic acid sequences as in SEQ ID Numbers: 2, 4, 6 or any variant thereof.
In another embodiment of our present invention, suitable vectors comprising the nucleic acid for optimal expression of ß- carotene enzymes in a heterologous host are utilised. In yet another embodiment of our present invention, the vector of the disclosure is an expression vector which can be conveniently subjected to recombinant DNA procedures. The choice of vector will often depend on the host cell into which it is to be introduced. Thus, the vector could be an autonomously replicating vector, i.e. a vector which exists as an extra-chromosomal entity, the replication of which is independent of chromosomal replication, e.g. a plasmid. Alternatively, the vector could be one which, when introduced into a host cell, is integrated into the host cell genome, in part or in its entirety, and replicated together with the chromosomes into which it has been integrated.
In another embodiment of our present invention, the vector is preferably an expression vector in which the DNA sequences encoding the ß- carotene enzymes are operably linked to additional segments required for transcription of the DNA. The term, "operably linked" indicates that the segments are arranged so that they function in concert for their intended purposes, e.g. transcription initiates in some promoter and proceeds through the DNA sequence coding for the enzyme.
Preferably, the gene can be cloned into any Saccharomyces cerevisiae expression vectors known in the art. In a preferred embodiment, the vector is a pESCHIS.
Any suitable promoter can be used. In a preferred embodiment of our present invention, the strong constitutive promoters Pact1, Ppgk1, and Psptdh3 are used.
In another embodiment, the host cell into which the DNA construct or the recombinant vector of the disclosure is introduced may be any cell which can produce the ß- carotene enzymes and includes bacteria, yeast, any other microorganism, a mammalian cell, plant cell or any cell culture of said category.
In a preferred embodiment, the host cell is a eukaryotic cell selected from a group comprising Saccharomyces cerevisiae, Pichia pastoris and Hansenula polymorpha or any host known in the art for expression of heterologous pathway enzymes using yeast promoter-based vectors for expression.
In a preferred embodiment, the host cell is Saccharomyces cereviciae, W303-1A. Commercially available Saccharomyces cereviciae, W303-1A, was used in the preferred embodiment of the invention.
In another embodiment, the process for production of ß- carotene is provided. In a preferred embodiment, the process of production includes the steps of culturing host cells transformed with a vector comprising nucleic acids of SEQ ID Numbers: 1, 3, 5 in a suitable culture medium.
In another embodiment, the process of culturing host cells transformed with a vectors comprising the nucleic acids in selection media without histidine and comprises glucose, yeast nitrogen base without amino acids.
A few examples depicting the different embodiments of our present invention have been discussed below:
EXAMPLES
The following examples particularly describe the manner in which the invention is to be performed. But the embodiments disclosed herein do not limit the scope of the invention in any manner.
Example 1: Recombinant plasmid construction for expression of ß- carotene genes in Saccharomyces cereviciae
Genes encoding for ß- carotene enzymes CrtE, CrtI and CrtYB are cloned in pESCHIS. The resulting plasmid is pESCHIS_CrtE – CrtI – CrtYB. The preferred codons for expression in Saccharomyces cereviciae has been used in place of rare codons.
The sequences of the open reading frame encoding for ß- carotene enzymes are represented by SEQ ID Numbers: 1, 3, 5.
These open reading frames are codon optimized for Saccharomyces cereviciae and are artificially synthesized and cloned in pESCHIS by Genscript.
The recombinant plasmids contain promoters, open reading frames and terminators. The recombinant vector is represented in Figure 2.
Example 2: Polynucleotide sequences for expression of ß- carotene enzymes and corresponding polypeptide sequence
The polynucleotide sequences and corresponding translated proteins sequences represented by SEQ ID Numbers: 1, 2, 3, 4, 5, 6.
Example 3: Development of recombinant host cell by transformation with recombinant plasmid
Recombinant plasmid pESCHIS_CrtE – CrtI – CrtYB as described in foregoing example carrying the genes for ß- carotene enzymes SEQ ID Numbers: 1, 3, 5 were used.
Host cells were electroporated with the plasmid as described in foregoing example and recovered in YPD media at 30°C with shaking for 3 hours before plating on selection plate. These plates are incubated for 5 days to get transformants. These colonies are inoculated in selection media and observed for media color change indicating ß- carotene synthesis.
The nucleotide sequence utilized in the method of our present invention are given by:
CrtE (Geranylgeranyl pyrophosphate synthase, Xanthophyllomyces dendrorhous, Accession No: MT321297.1)
DNA (Seq ID No: 1)
ATGGATTACGCTAACATCTTGACTGCAATCCCATTGGAATTCACTCCACAAGATGATATCGTTTTGTTGGAACCA TACCATTACTTGGGTAAAAATCCTGGTAAAGAAATCAGATCTCAATTGATCGAAGCTTTTAATTACTGGTTGGAT GTTAAGAAAGAAGATTTGGAAGTTATTCAAAACGTTGTTGGCATGTTGCATACTGCTTCATTGTTAATGGATGAT GTTGAAGATTCTTCAGTTTTGAGAAGAGGTTCTCCAGTTGCACATTTGATCTATGGTATCCCACAAACTATTAAT ACAGCTAACTACGTTTACTTTTTGGCATACCAAGAAATTTTTAAGTTAAGACCAACACCAATTCCAATGCCAGTT ATTCCACCATCTTCAGCTTCTTTACAATCTTCAGTTTCTTCAGCTTCTTCATCTTCATCTGCATCATCTGAAAAT GGTGGTACTTCAACACCAAACTCTCAAATCCCATTTTCAAAGGATACTTATTTGGATAAAGTTATTACAGATGAA ATGTTGTCTTTACATAGAGGTCAAGGTTTGGAATTATTTTGGAGAGATTCATTGACTTGTCCATCTGAAGAAGAA TACGTTAAGATGGTTTTGGGTAAAACTGGTGGTTTGTTTAGAATCGCTGTTAGATTGATGATGGCAAAGTCAGAA TGTGATATCGATTTCGTTCAATTGGTTAATTTGATCTCTATCTATTTCCAAATCAGAGATGATTACATGAATTTG CAATCATCTGAATACGCTCATAATAAGAACTTCGCAGAAGATTTGACTGAGGGTAAATTTTCATTCCCAACAATC CATTCTATCCATGCTAACCCATCATCTAGATTGGTTATTAATACTTTGCAAAAGAAATCTACATCTCCAGAAATC TTGCATCATTGTGTTAACTACATGAGAACTGAAACACATTCATTCGAATACACTCAAGAAGTTTTGAACACATTG TCTGGTGCATTGGAAAGAGAATTGGGTAGATTACAAGGCGAATTTGCTGAAGCAAATTCAAGAATGGATTTGGGT GACGTTGATTCTGAAGGTAGAACTGGTAAAAATGTTAAGTTGGAAGCTATCTTGAAGAAATTGGCAGATATCCCA TTATAA
Protein (Seq ID No: 2)
MDYANILTAIPLEFTPQDDIVLLEPYHYLGKNPGKEIRSQLIEAFNYWLDVKKEDLEVIQNVVGMLHTASLLMDDVEDSSVLRRGSPVAHLIYGIPQTINTANYVYFLAYQEIFKLRPTPIPMPVIPPSSASLQSSVSSASSSSSASSENGGTSTPNSQIPFSKDTYLDKVITDEMLSLHRGQGLELFWRDSLTCPSEEEYVKMVLGKTGGLFRIAVRLMMAKSECDIDFVQLVNLISIYFQIRDDYMNLQSSEYAHNKNFAEDLTEGKFSFPTIHSIHANPSSRLVINTLQKKSTSPEILHHCVNYMRTETHSFEYTQEVLNTLSGALERELGRLQGEFAEANSRMDLGDVDSEGRTGKNVKLEAILKKLADIPL
CrtI (Phytoene desaturase, Xanthophyllomyces dendrorhous, Accession No: MT321297.1)
DNA (Seq ID No: 3)
ATGGGTAAAGAACAAGATCAAGATAAACCAACTGCTATTATTGTTGGTTGTGGTATTGGTGGTATTGCTACTGCT GCAAGATTGGCAAAGGAAGGTTTCCAAGTTACAGTTTTTGAAAAGAATGATTACTCTGGTGGTAGATGTTCATTG ATCGAAAGAGATGGTTACAGATTCGATCAAGGTCCATCTTTGTTATTGTTACCAGATTTGTTTAAACAAACTTTC GAAGATTTGGGTGAAAAGATGGAAGATTGGGTTGATTTGATTAAATGTGAACCAAACTACGTTTGTCATTTCCAT GATGAAGAAACTTTTACATTTTCTACAGATATGGCTTTGTTGAAGAGAGAAGTTGAAAGATTCGAGGGTAAAGAT GGTTTCGATAGATTTTTATCTTTTATTCAAGAAGCTCATAGACATTACGAATTGGCAGTTGTTCATGTTTTGCAA AAGAATTTTCCAGGTTTTGCTGCATTTTTGAGATTGCAATTCATTGGTCAAATCTTGGCATTGCATCCATTCGAA TCTATCTGGACTAGAGTTTGTAGATACTTCAAGACAGATAGATTGAGAAGAGTTTTCTCTTTCGCTGTTATGTAC ATGGGTCAATCTCCATACTCAGCACCAGGTACTTACTCATTGTTACAATACACTGAATTGACAGAAGGTATCTGG TACCCAAGAGGTGGTTTTTGGCAAGTTCCAAACACATTGTTACAAATCGTTAAGAGAAATAATCCATCTGCTAAG TTTAATTTCAACGCACCAGTTTCTCAAGTTTTGTTATCACCAGCTAAAGATAGAGCAACAGGTGTTAGATTGGAA TCTGGTGAAGAACATCATGCTGATGTTGTTATTGTTAACGCTGATTTGGTTTACGCATCAGAACATTTGATTCCA GATGATGCTAGAAATAAGATTGGTCAATTGGGTGAAGTTAAAAGATCTTGGTGGGCAGATTTGGTTGGTGGTAAA AAGTTGAAGGGTTCATGTTCTTCATTATCTTTCTACTGGTCAATGGATAGAATTGTTGATGGTTTGGGTGGTCAT AACATTTTCTTGGCTGAAGATTTCAAGGGTTCTTTCGATACTATCTTTGAAGAATTGGGTTTACCAGCAGATCCA TCATTCTACGTTAACGTTCCATCTAGAATTGATCCATCAGCTGCACCAGAGGGTAAAGATGCTATCGTTATCTTG GTTCCATGTGGTCATATTGATGCATCTAATCCACAAGATTACAATAAGTTGGTTGCTAGAGCAAGAAAGTTCGTT ATCCAAACATTGTCTGCTAAGTTGGGTTTACCAGATTTCGAAAAGATGATCGTTGCTGAAAAAGTTCATGATGCA CCATCTTGGGAAAAGGAATTCAATTTGAAGGATGGTTCAATCTTGGGTTTAGCTCATAACTTCATGCAAGTTTTG GGTTTTAGACCATCTACTAGACATCCAAAGTACGATAAGTTGTTTTTCGTTGGTGCATCAACTCATCCAGGTACA GGTGTTCCAATTGTTTTGGCTGGTGCAAAGTTGACAGCTAACCAAGTTTTGGAATCTTTTGATAGATCACCAGCA CCAGATCCAAATATGTCTTTGTCAGTTCCATACGGTAAACCATTGAAGTCTAACGGTACTGGTATCGATTCACAA GTTCAATTGAAGTTTATGGATTTGGAAAGATGGGTTTACTTGTTGGTTTTGTTGATCGGTGCTGTTATTGCAAGA TCTGTTGGTGTTTTGGCTTTTTAA
Protein (Seq ID No: 4)
MGKEQDQDKPTAIIVGCGIGGIATAARLAKEGFQVTVFEKNDYSGGRCSLIERDGYRFDQGPSLLLLPDLFKQTFEDLGEKMEDWVDLIKCEPNYVCHFHDEETFTFSTDMALLKREVERFEGKDGFDRFLSFIQEAHRHYELAVVHVLQKNFPGFAAFLRLQFIGQILALHPFESIWTRVCRYFKTDRLRRVFSFAVMYMGQSPYSAPGTYSLLQYTELTEGIWYPRGGFWQVPNTLLQIVKRNNPSAKFNFNAPVSQVLLSPAKDRATGVRLESGEEHHADVVIVNADLVYASEHLIPDDARNKIGQLGEVKRSWWADLVGGKKLKGSCSSLSFYWSMDRIVDGLGGHNIFLAEDFKGSFDTIFEELGLPADPSFYVNVPSRIDPSAAPEGKDAIVILVPCGHIDASNPQDYNKLVARARKFVIQTLSAKLGLPDFEKMIVAEKVHDAPSWEKEFNLKDGSILGLAHNFMQVLGFRPSTRHPKYDKLFFVGASTHPGTGVPIVLAGAKLTANQVLESFDRSPAPDPNMSLSVPYGKPLKSNGTGIDSQVQLKFMDLERWVYLLVLLIGAVIARSVGVLAF

CrtYB (Bifunctional lycopene cyclase/phytoene synthase, Xanthophyllomyces dendrorhous, Accession No: MT321297.1)
DNA (Seq ID No: 5)
ATGACTGCTTTGGCATACTACCAAATCCATTTGATCTATACATTGCCAATCTTGGGTTTGTTAGGTTTGTTAACT TCACCAATCTTGACAAAGTTCGATATCTATAAGATTTCTATTTTGGTTTTTATTGCTTTTTCAGCAACTACACCA TGGGATTCTTGGATTATTAGAAATGGTGCTTGGACTTATCCATCTGCTGAATCAGGTCAAGGTGTTTTTGGTACA TTTTTAGATGTTCCATACGAAGAATACGCTTTCTTTGTTATCCAAACTGTTATTACAGGTTTAGTTTACGTTTTG GCTACTAGACATTTGTTACCATCATTGGCATTACCAAAAACAAGATCTTCAGCTTTGTCTTTAGCTTTGAAAGCA TTGATCCCATTGCCAATCATATATTTGTTTACTGCACATCCATCTCCATCACCAGATCCATTGGTTACAGATCAT TACTTCTACATGAGAGCTTTGTCATTGTTAATTACTCCACCAACAATGTTGTTAGCTGCATTATCTGGTGAATAT GCATTTGATTGGAAATCAGGTAGAGCTAAATCTACTATTGCTGCAATCATGATCCCAACAGTTTATTTGATCTGG GTTGATTACGTTGCAGTTGGTCAAGATTCTTGGTCAATTAATGATGAAAAGATTGTTGGTTGGAGATTAGGTGGT GTTTTGCCAATTGAAGAAGCTATGTTTTTCTTGTTGACAAATTTGATGATTGTTTTAGGTTTGTCTGCTTGTGAT CATACTCAAGCATTGTATTTGTTGCATGGTAGAACAATCTATGGTAATAAGAAAATGCCATCTTCATTCCCATTG ATCACTCCACCAGTTTTGTCTTTGTTTTTCTCTTCTAGACCATACTCTTCACAACCAAAGAGAGATTTGGAATTG GCTGTTAAGTTGTTGGAAAAGAAATCTAGATCTTTCTTTGTTGCTTCAGCAGGTTTTCCATCTGAAGTTAGAGAA AGATTAGTTGGTTTGTACGCATTTTGTAGAGTTACTGATGATTTGATCGATTCTCCAGAAGTTTCTTCAAATCCA CATGCTACTATCGATATGGTTTCAGATTTCTTGACATTGTTGTTTGGTCCACCATTGCATCCATCTCAACCAGAT AAGATCTTATCTTCTCCATTGTTACCACCATCTCATCCATCAAGACCAACAGGCATGTATCCATTGCCACCACCA CCATCTTTGTCACCAGCTGAATTGGTTCAATTCTTGACTGAAAGAGTTCCAGTTCAATACCATTTCGCTTTTAGA TTGTTAGCAAAGTTACAAGGTTTGATTCCAAGATATCCATTGGATGAATTGTTAAGAGGTTACACTACAGATTTG ATCTTCCCATTGTCAACTGAAGCTGTTCAAGCAAGAAAAACACCAATCGAAACTACAGCTGATTTGTTGGATTAT GGTTTATGTGTTGCTGGTTCTGTTGCAGAATTATTAGTTTACGTTTCTTGGGCTTCAGCACCATCTCAAGTTCCA GCTACTATTGAAGAAAGAGAAGCTGTTTTGGTTGCATCTAGAGAAATGGGTACAGCTTTACAATTGGTTAACATC GCAAGAGATATTAAAGGTGACGCTACTGAAGGTAGATTCTATTTGCCATTGTCTTTCTTTGGTTTAAGAGATGAA TCTAAGTTGGCTATTCCAACTGATTGGACAGAACCAAGACCACAAGATTTCGATAAGTTGTTGTCTTTGTCACCA TCTTCAACATTGCCATCTTCAAACGCATCTGAATCTTTTAGATTCGAATGGAAAACTTACTCATTACCATTGGTT GCTTACGCAGAAGATTTGGCTAAGCATTCTTACAAGGGTATCGATAGATTGCCAACAGAAGTTCAAGCTGGTATG AGAGCTGCATGTGCTTCTTACTTGTTGATCGGTAGAGAAATTAAAGTTGTTTGGAAAGGTGACGTTGGTGAAAGA AGAACTGTTGCTGGTTGGAGAAGAGTTAGAAAGGTTTTGTCAGTTGTTATGTCTGGTTGGGAAGGTCAATAA
Protein (Seq ID No: 6)
MTALAYYQIHLIYTLPILGLLGLLTSPILTKFDIYKISILVFIAFSATTPWDSWIIRNGAWTYPSAESGQGVFGTFLDVPYEEYAFFVIQTVITGLVYVLATRHLLPSLALPKTRSSALSLALKALIPLPIIYLFTAHPSPSPDPLVTDHYFYMRALSLLITPPTMLLAALSGEYAFDWKSGRAKSTIAAIMIPTVYLIWVDYVAVGQDSWSINDEKIVGWRLGGVLPIEEAMFFLLTNLMIVLGLSACDHTQALYLLHGRTIYGNKKMPSSFPLITPPVLSLFFSSRPYSSQPKRDLELAVKLLEKKSRSFFVASAGFPSEVRERLVGLYAFCRVTDDLIDSPEVSSNPHATIDMVSDFLTLLFGPPLHPSQPDKILSSPLLPPSHPSRPTGMYPLPPPPSLSPAELVQFLTERVPVQYHFAFRLLAKLQGLIPRYPLDELLRGYTTDLIFPLSTEAVQARKTPIETTADLLDYGLCVAGSVAELLVYVSWASAPSQVPATIEEREAVLVASREMGTALQLVNIARDIKGDATEGRFYLPLSFFGLRDESKLAIPTDWTEPRPQDFDKLLSLSPSSTLPSSNASESFRFEWKTYSLPLVAYAEDLAKHSYKGIDRLPTEVQAGMRAACASYLLIGREIKVVWKGDVGERRTVAGWRRVRKVLSVVMSGWEGQ
, Claims:5. CLAIMS
I/We Claim:
1. A method for preparing a recombinant host cell capable of expressing beta - carotene enzymes comprising the steps of:
a. synthesizing nucleic acids comprising the nucleotide sequence of SEQ ID Numbers: 1, 3, 5;
b. constructing a recombinant pESCHIS vector harboring the nucleic acids of SEQ ID NO: 1, 3, 5 wherein the nucleic acids are operably linked to constitutive promoters; and
c. transforming a Saccharomyces cereviciae, W303-1A, host cell with the recombinant pESCHIS_CrtE – CrtI – CrtYB vector to obtain a recombinant host cell.
wherein the nucleic acids are operably linked to strong constitutive promoter, the vectors are pESCHIS and the constitutive promoters are Pact1, Ppgk1, and Psptdh3 and the recombinant eukaryotic host cell, wherein the host cell is Saccharomyces cereviciae, W303-1A.
2. The method for producing a recombinant host cell capable of expressing ß- carotene enzymes, wherein the nucleic acids comprising the nucleotide sequences of SEQ ID Numbers: 1, 3, 5 and encodes ß- carotene enzymes in a host cell, wherein, the nucleotide sequence are given by:
CrtE (Geranylgeranyl pyrophosphate synthase, Xanthophyllomyces dendrorhous, Accession No: MT321297.1)
DNA (Seq ID No: 1)
ATGGATTACGCTAACATCTTGACTGCAATCCCATTGGAATTCACTCCACAAGATGATATCGTTTTGTTGGAACCA TACCATTACTTGGGTAAAAATCCTGGTAAAGAAATCAGATCTCAATTGATCGAAGCTTTTAATTACTGGTTGGAT GTTAAGAAAGAAGATTTGGAAGTTATTCAAAACGTTGTTGGCATGTTGCATACTGCTTCATTGTTAATGGATGAT GTTGAAGATTCTTCAGTTTTGAGAAGAGGTTCTCCAGTTGCACATTTGATCTATGGTATCCCACAAACTATTAAT ACAGCTAACTACGTTTACTTTTTGGCATACCAAGAAATTTTTAAGTTAAGACCAACACCAATTCCAATGCCAGTT ATTCCACCATCTTCAGCTTCTTTACAATCTTCAGTTTCTTCAGCTTCTTCATCTTCATCTGCATCATCTGAAAAT GGTGGTACTTCAACACCAAACTCTCAAATCCCATTTTCAAAGGATACTTATTTGGATAAAGTTATTACAGATGAA ATGTTGTCTTTACATAGAGGTCAAGGTTTGGAATTATTTTGGAGAGATTCATTGACTTGTCCATCTGAAGAAGAA TACGTTAAGATGGTTTTGGGTAAAACTGGTGGTTTGTTTAGAATCGCTGTTAGATTGATGATGGCAAAGTCAGAA TGTGATATCGATTTCGTTCAATTGGTTAATTTGATCTCTATCTATTTCCAAATCAGAGATGATTACATGAATTTG CAATCATCTGAATACGCTCATAATAAGAACTTCGCAGAAGATTTGACTGAGGGTAAATTTTCATTCCCAACAATC CATTCTATCCATGCTAACCCATCATCTAGATTGGTTATTAATACTTTGCAAAAGAAATCTACATCTCCAGAAATC TTGCATCATTGTGTTAACTACATGAGAACTGAAACACATTCATTCGAATACACTCAAGAAGTTTTGAACACATTG TCTGGTGCATTGGAAAGAGAATTGGGTAGATTACAAGGCGAATTTGCTGAAGCAAATTCAAGAATGGATTTGGGT GACGTTGATTCTGAAGGTAGAACTGGTAAAAATGTTAAGTTGGAAGCTATCTTGAAGAAATTGGCAGATATCCCA TTATAA
Protein (Seq ID No: 2)
MDYANILTAIPLEFTPQDDIVLLEPYHYLGKNPGKEIRSQLIEAFNYWLDVKKEDLEVIQNVVGMLHTASLLMDDVEDSSVLRRGSPVAHLIYGIPQTINTANYVYFLAYQEIFKLRPTPIPMPVIPPSSASLQSSVSSASSSSSASSENGGTSTPNSQIPFSKDTYLDKVITDEMLSLHRGQGLELFWRDSLTCPSEEEYVKMVLGKTGGLFRIAVRLMMAKSECDIDFVQLVNLISIYFQIRDDYMNLQSSEYAHNKNFAEDLTEGKFSFPTIHSIHANPSSRLVINTLQKKSTSPEILHHCVNYMRTETHSFEYTQEVLNTLSGALERELGRLQGEFAEANSRMDLGDVDSEGRTGKNVKLEAILKKLADIPL
CrtI (Phytoene desaturase, Xanthophyllomyces dendrorhous, Accession No: MT321297.1)
DNA (Seq ID No: 3)
ATGGGTAAAGAACAAGATCAAGATAAACCAACTGCTATTATTGTTGGTTGTGGTATTGGTGGTATTGCTACTGCT GCAAGATTGGCAAAGGAAGGTTTCCAAGTTACAGTTTTTGAAAAGAATGATTACTCTGGTGGTAGATGTTCATTG ATCGAAAGAGATGGTTACAGATTCGATCAAGGTCCATCTTTGTTATTGTTACCAGATTTGTTTAAACAAACTTTC GAAGATTTGGGTGAAAAGATGGAAGATTGGGTTGATTTGATTAAATGTGAACCAAACTACGTTTGTCATTTCCAT GATGAAGAAACTTTTACATTTTCTACAGATATGGCTTTGTTGAAGAGAGAAGTTGAAAGATTCGAGGGTAAAGAT GGTTTCGATAGATTTTTATCTTTTATTCAAGAAGCTCATAGACATTACGAATTGGCAGTTGTTCATGTTTTGCAA AAGAATTTTCCAGGTTTTGCTGCATTTTTGAGATTGCAATTCATTGGTCAAATCTTGGCATTGCATCCATTCGAA TCTATCTGGACTAGAGTTTGTAGATACTTCAAGACAGATAGATTGAGAAGAGTTTTCTCTTTCGCTGTTATGTAC ATGGGTCAATCTCCATACTCAGCACCAGGTACTTACTCATTGTTACAATACACTGAATTGACAGAAGGTATCTGG TACCCAAGAGGTGGTTTTTGGCAAGTTCCAAACACATTGTTACAAATCGTTAAGAGAAATAATCCATCTGCTAAG TTTAATTTCAACGCACCAGTTTCTCAAGTTTTGTTATCACCAGCTAAAGATAGAGCAACAGGTGTTAGATTGGAA TCTGGTGAAGAACATCATGCTGATGTTGTTATTGTTAACGCTGATTTGGTTTACGCATCAGAACATTTGATTCCA GATGATGCTAGAAATAAGATTGGTCAATTGGGTGAAGTTAAAAGATCTTGGTGGGCAGATTTGGTTGGTGGTAAA AAGTTGAAGGGTTCATGTTCTTCATTATCTTTCTACTGGTCAATGGATAGAATTGTTGATGGTTTGGGTGGTCAT AACATTTTCTTGGCTGAAGATTTCAAGGGTTCTTTCGATACTATCTTTGAAGAATTGGGTTTACCAGCAGATCCA TCATTCTACGTTAACGTTCCATCTAGAATTGATCCATCAGCTGCACCAGAGGGTAAAGATGCTATCGTTATCTTG GTTCCATGTGGTCATATTGATGCATCTAATCCACAAGATTACAATAAGTTGGTTGCTAGAGCAAGAAAGTTCGTT ATCCAAACATTGTCTGCTAAGTTGGGTTTACCAGATTTCGAAAAGATGATCGTTGCTGAAAAAGTTCATGATGCA CCATCTTGGGAAAAGGAATTCAATTTGAAGGATGGTTCAATCTTGGGTTTAGCTCATAACTTCATGCAAGTTTTG GGTTTTAGACCATCTACTAGACATCCAAAGTACGATAAGTTGTTTTTCGTTGGTGCATCAACTCATCCAGGTACA GGTGTTCCAATTGTTTTGGCTGGTGCAAAGTTGACAGCTAACCAAGTTTTGGAATCTTTTGATAGATCACCAGCA CCAGATCCAAATATGTCTTTGTCAGTTCCATACGGTAAACCATTGAAGTCTAACGGTACTGGTATCGATTCACAA GTTCAATTGAAGTTTATGGATTTGGAAAGATGGGTTTACTTGTTGGTTTTGTTGATCGGTGCTGTTATTGCAAGA TCTGTTGGTGTTTTGGCTTTTTAA
Protein (Seq ID No: 4)
MGKEQDQDKPTAIIVGCGIGGIATAARLAKEGFQVTVFEKNDYSGGRCSLIERDGYRFDQGPSLLLLPDLFKQTFEDLGEKMEDWVDLIKCEPNYVCHFHDEETFTFSTDMALLKREVERFEGKDGFDRFLSFIQEAHRHYELAVVHVLQKNFPGFAAFLRLQFIGQILALHPFESIWTRVCRYFKTDRLRRVFSFAVMYMGQSPYSAPGTYSLLQYTELTEGIWYPRGGFWQVPNTLLQIVKRNNPSAKFNFNAPVSQVLLSPAKDRATGVRLESGEEHHADVVIVNADLVYASEHLIPDDARNKIGQLGEVKRSWWADLVGGKKLKGSCSSLSFYWSMDRIVDGLGGHNIFLAEDFKGSFDTIFEELGLPADPSFYVNVPSRIDPSAAPEGKDAIVILVPCGHIDASNPQDYNKLVARARKFVIQTLSAKLGLPDFEKMIVAEKVHDAPSWEKEFNLKDGSILGLAHNFMQVLGFRPSTRHPKYDKLFFVGASTHPGTGVPIVLAGAKLTANQVLESFDRSPAPDPNMSLSVPYGKPLKSNGTGIDSQVQLKFMDLERWVYLLVLLIGAVIARSVGVLAF

CrtYB (Bifunctional lycopene cyclase/phytoene synthase, Xanthophyllomyces dendrorhous, Accession No: MT321297.1)
DNA (Seq ID No: 5)
ATGACTGCTTTGGCATACTACCAAATCCATTTGATCTATACATTGCCAATCTTGGGTTTGTTAGGTTTGTTAACT TCACCAATCTTGACAAAGTTCGATATCTATAAGATTTCTATTTTGGTTTTTATTGCTTTTTCAGCAACTACACCA TGGGATTCTTGGATTATTAGAAATGGTGCTTGGACTTATCCATCTGCTGAATCAGGTCAAGGTGTTTTTGGTACA TTTTTAGATGTTCCATACGAAGAATACGCTTTCTTTGTTATCCAAACTGTTATTACAGGTTTAGTTTACGTTTTG GCTACTAGACATTTGTTACCATCATTGGCATTACCAAAAACAAGATCTTCAGCTTTGTCTTTAGCTTTGAAAGCA TTGATCCCATTGCCAATCATATATTTGTTTACTGCACATCCATCTCCATCACCAGATCCATTGGTTACAGATCAT TACTTCTACATGAGAGCTTTGTCATTGTTAATTACTCCACCAACAATGTTGTTAGCTGCATTATCTGGTGAATAT GCATTTGATTGGAAATCAGGTAGAGCTAAATCTACTATTGCTGCAATCATGATCCCAACAGTTTATTTGATCTGG GTTGATTACGTTGCAGTTGGTCAAGATTCTTGGTCAATTAATGATGAAAAGATTGTTGGTTGGAGATTAGGTGGT GTTTTGCCAATTGAAGAAGCTATGTTTTTCTTGTTGACAAATTTGATGATTGTTTTAGGTTTGTCTGCTTGTGAT CATACTCAAGCATTGTATTTGTTGCATGGTAGAACAATCTATGGTAATAAGAAAATGCCATCTTCATTCCCATTG ATCACTCCACCAGTTTTGTCTTTGTTTTTCTCTTCTAGACCATACTCTTCACAACCAAAGAGAGATTTGGAATTG GCTGTTAAGTTGTTGGAAAAGAAATCTAGATCTTTCTTTGTTGCTTCAGCAGGTTTTCCATCTGAAGTTAGAGAA AGATTAGTTGGTTTGTACGCATTTTGTAGAGTTACTGATGATTTGATCGATTCTCCAGAAGTTTCTTCAAATCCA CATGCTACTATCGATATGGTTTCAGATTTCTTGACATTGTTGTTTGGTCCACCATTGCATCCATCTCAACCAGAT AAGATCTTATCTTCTCCATTGTTACCACCATCTCATCCATCAAGACCAACAGGCATGTATCCATTGCCACCACCA CCATCTTTGTCACCAGCTGAATTGGTTCAATTCTTGACTGAAAGAGTTCCAGTTCAATACCATTTCGCTTTTAGA TTGTTAGCAAAGTTACAAGGTTTGATTCCAAGATATCCATTGGATGAATTGTTAAGAGGTTACACTACAGATTTG ATCTTCCCATTGTCAACTGAAGCTGTTCAAGCAAGAAAAACACCAATCGAAACTACAGCTGATTTGTTGGATTAT GGTTTATGTGTTGCTGGTTCTGTTGCAGAATTATTAGTTTACGTTTCTTGGGCTTCAGCACCATCTCAAGTTCCA GCTACTATTGAAGAAAGAGAAGCTGTTTTGGTTGCATCTAGAGAAATGGGTACAGCTTTACAATTGGTTAACATC GCAAGAGATATTAAAGGTGACGCTACTGAAGGTAGATTCTATTTGCCATTGTCTTTCTTTGGTTTAAGAGATGAA TCTAAGTTGGCTATTCCAACTGATTGGACAGAACCAAGACCACAAGATTTCGATAAGTTGTTGTCTTTGTCACCA TCTTCAACATTGCCATCTTCAAACGCATCTGAATCTTTTAGATTCGAATGGAAAACTTACTCATTACCATTGGTT GCTTACGCAGAAGATTTGGCTAAGCATTCTTACAAGGGTATCGATAGATTGCCAACAGAAGTTCAAGCTGGTATG AGAGCTGCATGTGCTTCTTACTTGTTGATCGGTAGAGAAATTAAAGTTGTTTGGAAAGGTGACGTTGGTGAAAGA AGAACTGTTGCTGGTTGGAGAAGAGTTAGAAAGGTTTTGTCAGTTGTTATGTCTGGTTGGGAAGGTCAATAA
Protein (Seq ID No: 6)
MTALAYYQIHLIYTLPILGLLGLLTSPILTKFDIYKISILVFIAFSATTPWDSWIIRNGAWTYPSAESGQGVFGTFLDVPYEEYAFFVIQTVITGLVYVLATRHLLPSLALPKTRSSALSLALKALIPLPIIYLFTAHPSPSPDPLVTDHYFYMRALSLLITPPTMLLAALSGEYAFDWKSGRAKSTIAAIMIPTVYLIWVDYVAVGQDSWSINDEKIVGWRLGGVLPIEEAMFFLLTNLMIVLGLSACDHTQALYLLHGRTIYGNKKMPSSFPLITPPVLSLFFSSRPYSSQPKRDLELAVKLLEKKSRSFFVASAGFPSEVRERLVGLYAFCRVTDDLIDSPEVSSNPHATIDMVSDFLTLLFGPPLHPSQPDKILSSPLLPPSHPSRPTGMYPLPPPPSLSPAELVQFLTERVPVQYHFAFRLLAKLQGLIPRYPLDELLRGYTTDLIFPLSTEAVQARKTPIETTADLLDYGLCVAGSVAELLVYVSWASAPSQVPATIEEREAVLVASREMGTALQLVNIARDIKGDATEGRFYLPLSFFGLRDESKLAIPTDWTEPRPQDFDKLLSLSPSSTLPSSNASESFRFEWKTYSLPLVAYAEDLAKHSYKGIDRLPTEVQAGMRAACASYLLIGREIKVVWKGDVGERRTVAGWRRVRKVLSVVMSGWEGQ