Field of the Invention
The present invention relates to method of detecting rhizome rot in turmeric crop and a rapid detection kit for early diagnosis of rhizome rot infection in turmeric plants. More particularly, the present invention relates to rapid immune chromatographic test of fungal antigenic proteins in turmeric plants indicative of rhizome rot caused by Pythium aphanidermatum fungal species, which can detect rhizome rot infection in turmeric crop at very early stages even when the symptoms are not so visible and reliability and application prospect is promising.
Background of the invention and the related Prior Art
India is the world's largest producer and exporter of turmeric (Rao and Rao 1994). Orissa is area wise the second largest state (25,800ha) in production of this crop next to Andhra Pradesh (44,100ha) (Rao and Rao 1994). India accounts for about 80 per cent of world turmeric production and 60 per cent of world exports. The processed forms of turmeric exported are dry turmeric, fresh turmeric, turmeric powder and oleoresin. United Arab Emirates is a major importer, accounting for 18.35 per cent of the total exports followed by the US with 11.44 per cent. The other leading importers are Japan, the UK and Sri Lanka. The quality specification is thus very important for export of turmeric. But this crop is threatened by a wide variety of plant diseases and pests due to improper supervision. Emerging, re-emerging of plant pathogens continue to challenge our ability to safeguard plant health worldwide. Further, globalization, climate change, increased human mobility, pathogen and vector evolution have combined to increase the spread of invasive plant pathogens. Early and accurate diagnosis and

pathogen surveillance on local, regional, and global scales are necessary to predict outbreaks and allow time for development and application of mitigation strategies. The rhizome rot is the most serious disease which affects the turmeric crop resulting in rotting of rhizomes with dark brown color and causes yield losses upto 60-80%. This crop loss can be minimized and specific treatments can be tailored to combat specific pathogen if plant disease are correctly diagnosed and identified early. The traditional method of identifying plant pathogen is through visual examination. This is often possible only after major damage has already been done to the crop, so treatments will be of limited or no use. To save plants from irreparable damage by pathogens/farmers have to be able to identify an infection even before it becomes visible. Efforts are already underway to produce better diagnostic kits to detect pathogens. However, for turmeric very less effort has been taken to control these diseases. So far, diagnostic kits have already been designed to detect diseases in crops such as rice, potatoes, papaya, tomatoes, and banana but not for turmeric diseases. India is the major exporter of turmeric, exporting to over 100 countries throughout the world. UAE is the major importer of turmeric from india, followed by the U.S., Japan, U.K., Iran, Singapore, Srilanka and South Africa. In Indian state, Orissa is 2nd largest producer of turmeric according to statistic of Spice Board. Indian turmeric is regarded as the best in the world market because of its high curcumin content. The rhizome of turmeric consists of curcumin, various curcuminoids, essential oil and oleoresin which exhibit a wide range of biological activities, e.g. food color in cheese, spices, cereal products, pickles potato flakes, soups, ice-creams, yogurt, as hypolipidemic, hepatoprotective, antibacterial, antifungal, anticancer, antioxidant, insect repellant and anti snake venom agent (Roses, 1999, Jain et al. 2000). Turmeric oil is used in aromatherapy, perfume industry and in the preparation of mosquito repellants. The oleoresin in turmeric is used

in flavouring industries as a replacement of powdered rhizome. In spite of immense use of turmeric no major breakthrough has been noticed in monitoring the quality of plant in terms of disease free rhizome production and thus increasing the export value. Though Orissa is area wise second largest state in production of turmeric, the average productivity and quality (disease free turmeric) are not satisfactory. The cultivation of turmeric crops needs many processing that is why this plant is more prone to attack by pathogens which results in rhizome rot of turmeric. Accurate disease diagnosis and precise identification of pathogen involved is an essential prerequisite for understanding the rhizome rot diseases of turmeric and controlling them effectively. Efforts are already underway to produce better diagnostic kits to detect pathogens in crops important to developing countries. For instance, the Department of Biotechnology of India's Ministry of Science and Technology is developing diagnostic kits to detect viruses in fruits, ornamentals, spices, and plantation crops. The Genetic Engineering Services Unit of Egypt's Agricultural Genetic Engineering Research Institute has developed diagnostic kits and testing services to detect viruses in crop plants. The use of these kits presents a tremendous opportunity to improve disease diagnosis and treatment. However, it also presents a major challenge, since in many states of India like Orissa have the most limited training institutes for diagnosis or no formal education and may even be non-literate. Further, developing this ELISA kit for detecting turmeric pathogens may work in settings that lack resources for training and supervision. The ELISA kit will help in the production of healthy and profitable crops because of its high level of sensitivity, specificity, quick and user friendly character. Even the farmers from remote areas with minimum literacy can also use this kit. The theory is that when a plant is attacked by any pathogen it will generates a complex immune response in a plant, resulting in the production of disease-specific proteins involved in plant defense and in

limiting the spread of infection. Pathogens also produce proteins and toxins to facilitate their infection, before disease symptoms appear. This protein plays a vital role in the development of plant diagnostic kits. The enzyme-linked immunosorbent assay (ELISA) method makes use of this detection system very easy using protein-based diagnosis. ELISA kits are very easy to use because test takes only a few minutes to perform, and does not require sophisticated laboratory equipment or training. This ELISA kit will detect plant diseases early, by identifying the presence of the pathogen in the plant by testing the proteins produced by either the pathogen or the plant during infection with the help of specific antibody. These techniques require minimal processing time and are more accurate in identifying pathogens. So far, many diagnostic kits have already been designed to detect diseases in crops such as rice, potatoes, papaya, tomatoes, and banana by different companies like ADGEN photodiagnostics, Biosense laboratories, Prime diagnostics etc.
In the prior art a patent document WO 2014066481 Al discloses diagnostic approach utilizing quantitative polymerase chain reaction (PCR) in rapid detection of the pathogen Leifsonia that causes ratoon stunting disease (RSD) in sugarcane. This is a rapid, cost-effective and/or high sensitivity methodology for detecting this pathogen. The present invention relates to methods and kits for detecting a pathogen in a plant, plant part or plant cell from the Gramineae/Poaceae family, such as plants of the Saccharum spp, including sugarcane.

Another prior art patent document WO 2004065627 Al discloses method and kit for early diagnosis of fungal infection (Pyricularia oryzae) in rice using molecular techniques. The method utilizes oligonucleotide primers fo early diagnosis of fungal infection in rice.
Another prior art patent document US 20070026390 Al, discloses PCR primers and/or cloned nucleotide sequences and/or nucleic probes has been successfully utilized for the diagnosis and identification of harmful viruses affecting the quality of nursery vegetable, flower and fruit productions.
Yet another prior art document US20070026390 describes a set of
primers of sequence ID 1: upstream primer
AACTGCAGATGGTTTGCCGAATTTGCAA and sequence ID 2: downstream primer GCTCTAGACTAGATCTCAAGCAGGTC useful for detection of Prunus necrotic ringspot virus in plants. It also relates to a method for detection of Prunus necrotic ringspot virus in plants by using said primers. Further the invention also relates to a diagnostic kit useful for detection-of-coatprotein of Prunus necrotic ringspot in plants.

Another prior art document WO 2016112179 Al discloses methods and kits for detecting fungus and bacteria in cannabis. Here a method of detecting the presence of at least one of a fungus and a bacteria in a Cannabis plant includes amplifying one or more nucleotide sequences from DNA separated from the Cannabis plant in the presence of Cannabis-specific primers as set forth in SEQ ID NOs: 1 and 2 and in the presence of at least one of a fungus-specific primer and a baeteria specific primer, to thereby form amplicons. The amplicons are compared with known nucleotide sequences of the Cannabis plant and at least one known nucleotide sequence of at least one of the fungus and the bacteria, whereby matching of the amplicons to the known nucleotide sequences of the Cannabis plant and, separately, of the known nucleotide of at least one of the fungus and the bacteria indicates contamination of the Cannabis plant with at least one of the fungus and bacteria.
Object of Invention
The principal object of the invention is to provide a immune-
chromatography based detection method for early and rapid rhizome
rot infection in turmeric crop.
Another object of the invention is to provide a ICT detection kit for rapid
and early diagnosis of rhizome rot of turmeric in which the specific
antibodies against Pythium aphanidermatum is used.
Another object of the invention is to provide a method of detecting the
rhizome rot infection at very early stage in which ICT kit is detecting
antigens in leaves and rhizome samples of turmeric indicative of
rhizome rot caused by Pythium aphanidermatum species.

Another object of the invention is to provide the ICT based detection kit which is convenient for farmers and fast for operation, is suitable for on-site detection, and is high in specificity, detection sensitivity, accuracy, and reliability and application prospect is promising.
Another embodiment of the invention is to provide ICT based detection kit for rapid and early rhizome rot-infection diagnosis which consists of conjugate releasing pad and absorbent pad.
Another object of the invention is to provide the detection kit which will provide a cost-effective approach for the screening of rhizomes in large scale, in epidemiological surveys while being affordable, rapid, and easy to use for farmers.
Summary of the invention
The present invention relates to method of detecting rhizome rot in turmeric crop and a rapid detection kit for early diagnosis of rhizome rot infection in turmeric plants. More particularly, the present invention relates to rapid immune chromatographic test of fungal antigenic proteins in turmeric plants indicative of rhizome rot caused by Pythium aphanidermatum fungal species, which can detect rhizome rot infection in turmeric crop at very early stages even when the symptoms are not so visible and reliability and application prospect is promising.
Brief description of the accompanying drawings
Figure 1 illustrates detection of P. aphanidermatum using ICT strips at various dilutions (A) Results of ICTs showing positive reaction with P. aphanidermatum-infected leaves; (B) reaction with control healthy sap

and buffer (PBS) and (C) reaction with infected rhizomes C control line and T: test line in accordance with the present invention.
Detailed Description
In this study, polyclonal antibodies were developed against antigenic peptide of P. aphanidermatum. For this, the 65 kDa band was subjected to MS analysis followed by blastp. The results lead to the identification of several peptide fragments with 100% identity to homologous proteins of P. aphanidermatum. Specific immunoreactive linear epitope was identified based on the parameters of hydophilicity, hydrophobicity and antigenicity. Two 17-mer long peptides (RAAVALKMRRYRDALKL) were synthesized and used as immunogens for polyclonal antibodies production against P. aphanidermatum. The peptide, PI was conjugated with KLH and was used as immunogens for raising polyclonal antibodies. The IgG fractions after purification were screened using ELISA and western blot. The results of ELISA confirmed good titers of anti-Pi antibodies. The high titer anti-sera reacted positively with the corresponding synthetic peptide as well as with the crude proteins in ELISA and western blot. High absorbance readings were observed up to 1:10000 dilution. Anti-Pi antisera at a dilution of 1:2000 were successfully used in ELISA (> 3 fold increase in absorbance values in infected samples compared to healthy) for specific detection of P. aphanidermatum in infected turmeric. The western blot analysis further confirmed the high level of specificity of anti-Pi antibodies and revealed the presence of immune reactive bands in crude antigens. The anti-Pi pAb recognized the antigens of Pythium aphanidermatum-infected samples at 45 and 65 kDa. Based on the combined results of ELISA and western blot, the antibody was further utilized for the development of immunochromatographic test assay for rapid detection of rhizome rot antigens. Immunochromatographic test strips were developed using

antibody labeled with gold nanoparticles. Procedure for conjugation of antibodies with nanoparticles was optimized. Antibody was successfully conjugated with gold nanoparticles of size 40 nm (synthesized using citrate method). These labelled antibody was immobilized on the ICT strips which formed a red color line upon binding to the target antigen. The sensitivity of the ICT works out to till a dilution of 1:500 in the crude antigen.The test strips Were able to detect Pythium aphanidermatum antigens in the infected rhizomes (1:500 dilution) and leaves (1:200 dilution). The optimal detection time for reading the test line was 2-5 min in our present study. The sensitivity, specificity and accuracy of the ICT strips were calculated using 70 samples, consisting of 38 infected and 32 non-infected healthy controls, in each case. The overall sensitivity, specificity and accuracy of ICT for P. aphanidermatum diagnosis was found to be 96.43 %, 85.71 % and 94.29 %, respectively. Hence, the test strips were found to be a rapid, sensitive and reliable procedure for the routine diagnosis of rhizome rot infection in turmeric at different stages of disease development. This is the first report on identification of antigenic peptides of P. aphanidermatum, production of polyclonal antibodies against them and their successful use in immune-detection.
The invention relates to early diagnosis of rhizome rot disease of turmeric and its essential appropriate treatment. Our primary objective was to devise simple kit containing immunochromatographic test strips to detect P. aphanidermatum in rhizome rot infected turmeric. Therefore, the ICT strips were designed in a sandwich format such that the two intensely red color lines appear when the test sample contains the target antigen. The conjugate pads contained gold-conjugated antibodies raised against the peptides. When any test sample without the specific antigen runs on the strip, the gold-conjugated pAb gets dissolved in the buffer and moves up in the membrane and binds to the

secondary antibody that was immobilized on the control line of the membrane. The test was confirmed by the appearance of an intense red color at the control line. In presence of target antigen in the sample the gold conjugated antibody binds to the target antigen and this complex gets captured by the antibody immobilized at the test line on the membrane, leading to the development of a red color test line. The intensity of the tes line on the membrane correlates with the amount of target antigen in the test sample. All the parameters of the strips such as sensitivity, specificity and accuracy were evaluated. In the present test, the strips were able to detect P. aphanidermatum antigens in infected rhizomes even at a serial dilution of 1:500. The test strips were able to detect P.aphanidermatum antigens in infected leaves even at a serial dilution of 1:200. As the antigen dilution increases, a decrease in signal intensity was observed with the failure of the test strips to detect antigens at dilutions of 1:1000 and 1:500 in infected rhizome and leaf samples, respectively.
The impugned invention lies in the raoid ICTs for P. aDhanidermatum diagnosis, which is rapid, simple to perform and doesn't require expensive laboratory instrumentation.
Although the foregoing description of the present invention has been shown and described with reference to particular embodiments and applications thereof, it has been presented for purposes of illustration by way of examples and description and is not intended to be exhaustive or to limit the invention to the particular embodiments and applications disclosed. It will be apparent to those having ordinary skill in the art that a number of changes, modifications, variations, or alterations to the invention as described herein may be made, none of which depart from the spirit or scope of the present invention. The particular embodiments and applications were chosen and described to

provide the best illustration of the principles of the invention and its practical application to thereby enable one of ordinary skill in the art to utilize the invention in various embodiments and with various modifications as are suited to the particular use contemplated. All such changes, modifications, variations, and alterations should therefore be seen as being within the scope of the present invention as determined by the appended claims when interpreted in accordance with the breadth to which they are fairly, legally, and equitably entitled.

We claim:
1) A method of detecting the rhizome rot infection of turmeric comprising the. steps of :-isolating the Antigens proteins of P. aphanidermatum from the sample leaves and rhizome of infected turmeric sample of the infected plant; using said Antigens proteins,
polyclonal antibodies are raised; preparing Antigenic peptides and
coupIing it to a carrier protein, KLH to generate antibodies against the peptides; and performing an immune-chromatographic rapid test using the said antibody for rapid detection of rhizome rot antigens.
2. The method of detecting the rhizome rot infection of turmeric as claimed in claim 1, wherein specific immune reactive linear epitope is identified based on the parameters of hydophilicity, hydrophobicity and antigenicity.
3. The method of detecting the rhizome rot infection of turmeric as claimed in claim 1, wherein two 17-mer long peptides were synthesized and used as immunogens for polycional antibodies production against P. aphanidermatum.
4. The method of detecting the rhizome rot infection of turmeric as claimed in claim 1, wherein the peptide {PI} is conjugated with KLH and used as immunogens for raising polyclonal antibodies.
5. The method of detecting the rhizome rot infection of turmeric as
claimed in claim 1, wherein the immune-chromatographic test strips
were developed using antibody labeled with gold nanoparticles; and ,
wherein
antibody is conjugated with gold nanoparticles of size 40 nm.

6. An ICT based rapid rhizome rot detection kit in turmeric which
utilizes anti- Pythium aphanidermatum specific polyclonal antibody
against samples of rhizome rot specific 17 mer epitope
(RAAVALKMRRYRDALKL) gene of P. aphanidermatum species.
7. The ICT based rapid rhizome rot detection kit as claimed in claim
1, wherein the sample utilizes leaves and rhizime of infected turmeric
sample for the detection of specific antigens from Pythium aphanidermatum causing rhizome rot.
8. The ICT based rapid rhizome rot detection kit as claimed in claim
1, wherein the specificity of the developed antibodies are assessed by
indirect ELISA and western blot.
9. The ICT based rapid rhizome rot detection kit as claimed in claim
1, wherein the immune reactive protein band is identified by western
blotting.
10. The ICT based rapid rhizome rot detection kit as claimed in claim 1, wherein 65 kDa antigen is selected as a diagnostic marker for P. aphanidermatum and is subjected to MALDI-TOF analysis.