Abstract: Disclosed herein is Ricinus communis perennial plant designated as NANDAN-31 produced by crossing RCZ-P94 and RCZ-S128 and applying biparental crossing process adopting diallel mating design (half-diallel) at F2 generation following selection. The invention further discloses process for producing said plant of Ricinus communis for high seed yield and construction of molecular marker specific to NANDAN-31.
FIELD OF INVENTION
The present investigation relates to a new and distinctive high yielding perennial Ricinus communis plant designated as NANDAN-31, with continuous bearing and productive up to 2/3 years and construction of molecular marker specific to it. All publications cited in this application are herein incorporated by reference.
BACKGROUND AND PRIOR ART OF THE INVENTION:
Ricinus communis L. (castor) is an important crop of the family Euphorbiaceae. It is a monotypic species of the genus Ricinus and has considerable economic value for its oil with numerous industrial uses like bio-based lubricants, paints, coatings, plastics, anti-fungal compounds and cosmetics. The castor bean contains up to 60% oil of unique composition and up to 90% of the fatty acid content of the oil is ricinoleic acid.
In India, the plant species considered for lubricant and biodiesel production are those that are not used as edible oil, which do not compete with food crops for resources and not used in traditional medicine. Among the oil yielding species, Ricinus communis is considered to be the most prospective plant due to its hardness, rapid growth, easy propagation, high oil content, low gestation period and ability to grow on degraded soils and waste lands with low to high rainfall.
Although there is demand for a dependable supply of Castor in the United States, the Castor plant is not cultivated in the U.S. because the Castor bean from which the oil is obtained also contains the potent toxin ricin and highly allergenic proteins. While breeding of lower toxin strains has been reported, the toxin and allergenic content of Castor remain a problem, and workers who handle Castor or Castor meal can exhibit severe immune reactions, including debilitating hives and asthma. Modification of castor to lessen the hazardous components and make the castor plant suitable for handling by growers and processors is needed to facilitate re-introduction into the United States and acceptance of this important industrial crop which has both an appreciable domestic market and considerable export potential. Improvement of castor has been limited to traits available in germ plasm; however, castor germplasm is of limited use in reducing toxin and allergen content.
Castor plant can reach a height of 2-3 m in a year. The glossy leaves are 15-45 cm long, long-stalked, alternate and palmate with 5-12 deep lobes with coarsely toothed segments. Their Colour varies from dark green, sometimes with a reddish tinge, to dark reddish purple or bronze. The stems and the spherical, spiny seed pods also vary in pigmentation. Terminating stems are panicle-like inflorescences of green monoecious flowers; the stalked female flowers are at above and the male flowers are at below, both without petals. The fruit is a spiny, greenish capsule with large, oval, shiny, bean-like, highly poisonous seeds with variable brownish molting.
Breeding objectives depend on use of the specific crop; increasing yield is a primary objective in all programs. Seed yield of Castor is determined by number of spikes per plant, number of fertile pistillate flowers per spike, seeds per capsule and 100-seed weight. As the maximum number of seeds per capsule is limited and the agronomic factor of planting density does not offer much flexibility for increasing yields, selection should focus on the other yield components to obtain higher yield. Heritable variation exists for all of these components except number of seeds per capsule; and breeders may directly or indirectly select for increase in any of them.
Numerous steps are involved in the development of any novel, desirable cultivar. Plant breeding begins with the analysis and definition of problems and weakness of the current cultivars, followed by the fixation of program goals, and the definition of specific breeding objectives. The next step is selection of parental lines that possesses the traits, required to meet the program goals. The goal is to combine in a single cultivar an improved combination of desirable traits from the parental sources. These important traits may include higher yield, resistance to disease and insect pests, better canopy structure, tolerance to environmental stresses, better agronomic characteristics and higher oil content in oil bearing plants.
The goal of Castor breeding is to develop new, unique and superior Castor plants. The breeder initially selects and crosses two or more parental lines, followed by selection among the many new genetic combinations. The breeder can theoretically generate billions of new and different genetic combinations via crossing. The breeder has no direct control at the cellular level; therefore, two breeders will never develop the same line, or even very similar line, having the same traits of Castor.
Choice of breeding methods to select for the improved combination of traits depends on the mode of plant reproduction, the heritability of the traits being improved, and the type of cultivar used commercially. For highly heritable traits, a choice of superior individual plants evaluated at a single location will be effective, whereas for traits with low heritability, selection should be based on mean values obtained from replicated evaluations of families of related plants.
Castor is an important and valuable oil seed crop. Thus, a continuing goal of Castor breeders is to develop stable, high yielding plants that are agronomically sound. The reasons for this goal are to maximize the amount of seed oil produced on the land used and to supply biofuels. To accomplish this goal, the Castor breeder must select and develop Castor plants that have the traits to result in superior Yields.
Pollination occurs by insects. After pollination, a trilocular ellipsoidal capsule forms and the exocarp remains fleshy until the seeds mature. Seeds are black in color, 2cm long and 1cm thick. The caruncle is rather small. The Ricinus communis is a diploid species with 2n = 20 chromosomes.
As Castor is a cross-pollinated crop, any genetic improvement has to be based on populations. Mass selection would be the simplest breeding method, where superior selected plants are composited. Populations can be stepwise improved if they remain large, so that additive genetic variation can be used. The method of recurrent selection is widely used in tree breeding. This involves concurrent cycles of selection with or without progeny tests.
There are possibilities for the breeder to modify the method. In addition, hybrid cultivars could be bred to use the heterosis effect. The existence of male sterile cultivars would facilitate crossings. Emasculation was not necessary for hybridization in the insect-free greenhouse due to absence of insect vectors and the time lag of anthesis of staminate flowers. The standard routine procedure of bagging should be sufficient in the field. However, to avoid self-pollination if staminate and pistillate flowers were to open simultaneously, emasculation in this unisexual species could be required as Castor is self-compatible and this can be achieved very easily as staminate and pistillate flowers look very distinct species.
The two important features of cross-pollinated species are inbreeding depression and heterosis. Population improvement schemes generally aim at keeping inbreeding at a low level to avoid its ill effects, but an effort to exploit heterosis is rarely made. Heterosis is the basis of hybrid varieties and hybrid varieties are the best means for exploiting heterosis.
There are highly significant correlations in different seed samples between the 100-seed weight and percent of crude fat content. This is interesting from the breeders' point of view, as simple selection for high 100-seed weight could imply increased crude fat contents. But the shrubs which produce seeds of a high 100-seed weight, and consequently a higher crude fat content, may not yield more oil per hectare. Hence, to solve this, the development of a high yielding Ricinus communis hybrid is very necessary.
Ricinus communis belonging to the family Euphorbiaceae, which natively occur in India, Africa, North America and the Caribbean. Ricinus communis is one of the important species and has gained attention in tropical and sub-tropical countries as it is a commercially viable and potential feedstock for biodiesel production from a non-edible tree borne oil seeds. With existing trend of converting the vegetative oils into biodiesel, the question of food security vs. fuel security arises. At this juncture it is important to promote biodiesel from non-edible tree borne oil seeds; hence, Castor can address food vs. fuel conflict.
The following are the patents either issued or in the process of issuing related to Castor, but none of them are citing about plant material improvement for higher seed yield.
W0/2003/096811 discloses increasing yield of an agronomic plant that indicating the need for the use of an insecticide for insect control purposes by treating a seed of the plant with a neonicotinoid compound. The method is useful for non-transgenic plants and for plants having a foreign gene that encodes for the production of a modified Bacillus thuringiensis delta-endotoxin protein. A method of improving the results of a plant breeding program, a method of marketing plant seed, and a seed that has been treated by the method is also described. Plants which are suitable for the practice of the said invention include any gymnosperm and angiosperm, including dicotyledons and monocotyledons. Preferred plants are those which are agronomically important, for example, plants that are edible in part or in whole by a human or an animal, wherein such plants include cereals, beet, pear-like fruits, stone fruits, and soft fruits, legumes, oil plants (rape, mustard, poppy, olive, sunflower, coconut, castor-oil plant, cocoa bean, peanut, etc).
US20060179498 discloses a method for efficiently producing homozygous organisms (wherein the organism is a plant) from a heterozygous non-human starting organism, comprising providing of a heterozygous starting organism; allowing the starting organism to produce haploid cells; creating homozygous organisms from the haploid cells thus obtained; and selecting the organisms having the desired set of chromosomes, wherein during production of the haploid cells no recombination occurs in order to obtain a limited number of genetically different haploid cells, wherein recombination at least partially prevented or suppressed.
US 6,974,893 relates to isoform of castor oleate hydroxylase genes, proteins, and methods of their use including in their expression in transgenic organisms and in the production of hydroxylated fatty acids.
US 6620986 disclose a method of Agrobacterium-mediated transformation of castor, wherein the method comprises: (a) stably introducing by Agrobacterium-mediated transformation a transgene into a female flower bud of an intact castor plant to produce a transformed flower bud, wherein said Agrobacterium-mediated transformation comprises wounding of the flower bud and infiltration of Agrobacterium comprising the transgene, (b) allowing said transformed flower bud to develop and set seed, (c) collecting seed that comprises the transgene, and (d) growing the seed into a plant, wherein the plant comprises the transgene.
No patent prior art or publication is available on Ricinus communis perennial plant development or molecular characterization. Hence, the invention has great significance for increased yields, consistent feed stock supply for biodiesel production. The NANDAN-31 has socio-economic and environmental benefits globally, for supporting developing economies by utilizing marginal lands for energy production and supply.
OBJECT OF THE INVENTION:
The object of the present invention is to develop a new, unique and superior Ricinus communis perennial plant for continuous bearing and yielding upto2/3 years for high yielding, NANDAN-31 and method of construction of a specific molecular marker responsible for high seed yield and its progeny.
SUMMARY OF THE INVENTION
The present invention discloses to a perennial Ricinus communis plant designated as NANDAN-31, responsible for higher seed yield and construction of specific molecular marker.
The following embodiments and aspects thereof are described in conjunction with systems, tools and methods which are meant to be exemplary and illustrative, not limiting in scope. In various embodiments, one or more of the above described problems have been reduced or eliminated, while other embodiments are directed to other improvements.
The present invention relates to a Perennial castor plant designated as NANDAN-31 and plants (clones) derived from NANDAN-31. The invention also relates to the selected plants and any further progeny or descendants of the hybrid derived by crossing NANDAN-31 as a pollen donor. The invention is also directed to methods for producing a Castor plant by crossing two inbred parental lines following diallel mating design. Thus, any methods using the selected Castor plant NANDAN-31 in backcross, hybrid production, crosses to population, clonal propagation, micro propagation and the like are part of this invention. All plants which are a progeny of or descend from NANDAN-31 are within the scope of this invention. It is an aspect of this invention for NANDAN-31 to be used in crosses with other, different, castor plants to produce first generation (Fi) Castor hybrid seeds and plants with superior characteristics.
In another aspect, the present invention provides regenerable cells for use in tissue culture (micro propagation) of NANDAN-31. The tissue culture will preferably be capable of regenerating plants having the physiological and morphological characteristics of the foregoing Castor plant, and of regenerating plants having substantially the same genotype as the foregoing Castor plant. Preferably, the regeneration cells in such tissue cultures will be embryos, protoplasts, meristematic cells, callus, pollen, leaves, anthers, pistils, root tips, seeds or stems. Still further, the present invention provides selected Castor, NANDAN-31 plants regenerated from the tissue cultures of the invention.
In addition to the exemplary aspects and embodiments described above, further aspects and embodiments will become apparent by study of the following descriptions.
DEFINITIONS
In the description and tables which follow, a number of terms are used. In order to provide a clear and consistent understanding of the specification and claims, including the scope to be given to such terms, the following definitions are provided:
Essentially all the physiological and morphological characteristics: - A plant having essentially all the physiological and morphological characteristics mean a plant having the physiological and morphological characteristics of the cultivar, except for the characteristics derived from the hybridization and selection.
• 100-Seed weight: The weight of 100 Castor seeds as measured in grams.
• Regeneration: Regeneration refers to the development of a plant from tissue culture.
• Bloom. Bloom is the waxy coating found on the stem and certain other parts of the Castor plant that protects the plant naturally both from extremes of weather and from some insect pests.
• No bloom. No waxy material whatsoever on any part of the plant.
• Single bloom. With bloom only on stems, but not on leaves or fruits.
• Double bloom. With bloom on the stem, fruits, and on the lower (dorsal) side of leaf, but not on the upper surface (Ventral) of the leaf.
• Triple bloom. With bloom on every part such as the stem, petiole, upper and lower surfaces of leaves and on fruits.
• Mottling on Seed. The coloration on the seed coat different from the ground color.
DETAILED DESCRIPTION OF THE INVENTION
Castor hybrid NANDAN-31 is high yielding plants with more numbers of spikes per plant, more numbers of pistillate flowers per spike, bold capsules with three seeds per capsule and higher 100-seed weight.
Germplasm accessions of Castor have been collected from different agro-climatic regions covering the parts of South, North, West, East & Central India. The performances of these accessions in respect to yield and yield components and other morphological characters have been studied for two consecutive years. From these accessions two accessions were selected for the hybridization program. The female parent (RCZ-P94) was selected for having the character of producing raceme spikes with more number of pistillate flowers per spike with highly fertile ovule and bold capsules. The pollen parent (RCZ-S128) was selected due to its potentiality for producing more number of spikes per plant. Stability of the characters identified for selection of both the female and male parents has been established for two consecutive years. Inbred lines were then developed from the selected plants and crossed (RCZ-P94 x RCZ-S128) for the production of F1 hybrid and applying biparental crossing process adopting diallel mating design (half-diallel) at F2 generation following selection, the best out of them is NANDAN-31.
Castor plant NANDAN-31 has the following morphological and other characteristics as mentioned in Table 1, recorded at the age of second year.
This invention also is directed to methods for producing a castor hybrid by crossing a first parent with a second parent castor plant, wherein the first or second castor plant is a plant from the selected plant, NANDAN-31. Further, both first and second parent castor plants may be from the selected castor plant NANDAN-31. Therefore, any methods using the selected castor plant NANDAN-31 are part of this invention: selfing, backcross, hybrid breeding and crosses to populations. Any plants produced using castor selected plant NANDAN-31 as a parent are within the scope of this invention.
This invention also is directed to methods for producing castor selection NANDAN-31 with a second castor plant and growing the progeny seed, and repeating the crossing and growing steps with the castor selection NANDAN-31-derived plant from 0 to 7 times. Thus, any such methods using the castor selection NANDAN-31 are part of this invention: selfing, backcrosses, hybrid production, crosses to populations, and the like. All plants produced using castor selection NANDAN-31 as a parent are within the scope of this invention, including plants derived from Castor selection NANDAN-31.
It should be understood that the parents of selection NANDAN-31 can, through routine manipulation of cytoplasmic or other factors, be produced in a male-sterile form. Such embodiments are also contemplated within the scope of the present claims.
FURTHER EMBODIMENTS OF THE INVENTION METHODS FOR HYBRIDIZATION
The invention of Castor selection NANDAN-31 is produced through crossing RCZ-P94 with RCZ-S128 following Diallel mating design. Germplasm accessions have been collected from different agro-climatic regions covering the parts of South, North, West, East & Central India. The performances of these accessions in respect to yield and yield components and other morphological characters have been studied for two consecutive years. From these accessions, two accessions were selected for the hybridization program. The female parent (RCZ-P94) was selected for having the character of producing raceme spikes with more number of pistillate flowers per spike with highly fertile ovule and bold capsules. The pollen parent (RCZ-S128) was selected due to its potentiality for producing more number of spikes per plant. Stability of the characters identified for selection of both the female and male parents has been established for two consecutive years.
The selected parental lines were self-pollinated for three generations for the development of inbred lines. The inbred parental lines were then crossed (RCZ-P94 x RCZ-S128) for the production of the Fi generation following Diallel fashion (half-diallel) for heterosis and combining ability. The performance of the Fi population was studied for two consecutive years in multilocation trials for testing the best combining ability and heterosis. From this population, the superior performer was selected as NANDAN-31. The hybrid showed its superior characters (heterosis) over both the parents, as described in the following description information.
Further to state that it is possible to get higher yields from NANDAN-31 by further hybridization, crop improvement by developing area specific package of practices and other agronomical measures
"Molecular markers" are a tool to study the diversity on the genetic level. For molecular cloning and PCR techniques, DNA markers are a popular means for identification and authentication of plant and animal species. DNA based markers are less affected by age, physiological conditions of samples and environmental factors.
They are not tissue specific and thus can be detected at any phase of organism development. Only a small amount of sample does not restrict detection. The power of discrimination of DNA-based markers is so high that very closely related varieties can be differentiated.
Significance of molecular markers
DNA-based molecular markers have acted as versatile tools and have found their own position in various fields like taxonomy, physiology, embryology, genetic engineering, etc. They are no longer looked upon as simple DNA fingerprinting markers in variability studies or as mere forensic tools. Ever since their development, they are constantly being modified to enhance their utility and to bring about automation in the process of genome analysis. The discovery of PCR (polymerase chain reaction) was a landmark in this effort and proved to be an unique process that brought about a new class of DNA profiling markers. This facilitated the development of marker-based gene tags, map-based cloning of agronomically important genes, variability studies, phylogenetic analysis, synteny mapping, marker-assisted selection of desirable genotypes, etc. Thus giving new dimensions to concerted efforts of breeding and marker-aided selection that can reduce the time span of developing new and better varieties and will make the dream of super varieties come true. These DNA markers offer several advantages over traditional phenotypic markers, as they provide data that can be analysed objectively. In this article, DNA markers developed during the last two decades of molecular biology research and utilized for various applications in the area of plant genome analysis are reviewed. DNA markers that can be routinely employed in various aspects of plant genome analysis such as taxonomy, phylogeny, ecology, genetics and plant breeding.
Genetic polymorphic markers employ DNA amplification using short primers of arbitrary sequence. These primers have been termed 'random amplified polymorphic DNA' or "RAPD" primers, "RAPD amplification" refers to a method of single primer directed amplification of nucleic acids using short primers of arbitrary sequence to amplify nontargetd, random segments of nucleic acid. Williams et al., Nucl. Acids. Res., 18, 6531(1990) and U.S Pat. No. 5,126,239; (also EP 0 543 484 A2, WO 92/03567). The RAPD method amplifies either double or single stranded nontargetd, arbitrary DNA sequences using standard amplification buffers, dATP, dCTP, dGTP and TTP and a thermostable DNA polymerase such as Taq. The nucleotide sequence of the primers is typically about 9 to 13 bases in length, between 50 and 80% G+C in composition and contains no palindromic sequences. RAPD detection of genetic polymorphisms represents an advance over RFLP in that it is less time consuming, more informative, and readily susceptible to automation. Because of its sensitivity for the detection of polymorphisms RAPD/PCR methods have become the methods of choice for analyzing genetic variation within species or closely related genera, both in the animal and plant kingdoms (U.S Pat. No. 5, 660, 981). "RAPD Primers" refers to primers of about 8 to 13 bp, of arbitrary sequence, useful in the RAPD amplification or RAPD analysis according to the instant method. The "RAPD marker profile" refers to the pattern, or fingerprint, of amplified DNA fragments which are amplified during the RAPD method and separated and visualized by gel electrophoresis.
Randomly-Amplified Polymorphic DNA Markers (RAPD). In 1991, Welsh and McClelland developed a new PCR-based genetic assay namely randomly amplified polymorphic DNA (RAPD). This procedure detects nucleotide sequence polymorphisms in DNA by using a single primer of arbitrary nucleotide sequence. In this reaction, a single species of primer anneals to the genomic DNA at two different sites on complementary strands of DNA template. If these priming sites are within an amplifiable range of each other, a discrete DNA product is formed through thermo cyclic amplification. On an average, each primer directs amplification of several discrete loci in the genome, making the assay useful for efficient screening of nucleotide sequence polymorphism between individuals. However, due to the stochastic nature of DNA amplification with random sequence primers, it is important to optimize and maintain consistent reaction conditions for reproducible DNA amplification. They are dominant markers and hence have limitations in their use as markers for mapping, which can be overcome to some extent by selecting those markers that are linked in coupling. RAPD assay has been used by several groups as efficient tools for identification of markers linked to agronomically important traits, which are introgressed during the development of near isogenic lines. The application of RAPDs and their related modified markers in variability analysis and individual-specific genotyping has largely been carried out, but is less popular due to problems such as poor reproducibility faint or fuzzy products, and difficulty in scoring bands, which lead to inappropriate inferences.
The term "Primer" refers to a nucleic acid fragment or sequence that is complementary to at least one section along a strand of the sample nucleic acid, wherein the purpose of the primer is to sponsor and direct nucleic acid along that string. Primers can be designed to be complementary to specific segments of a targeted sequence. In PCR, for example, each primer is used in combination with another primer forming a "Primer Set" or "Primer Pair", this pair flanks the targeted sequence to be amplified. In RAPD amplification, single arbitrary primers are used to amplify non targeted segments of nucleic acid which are located between the primer sequence sites in opposing DNA strands. The term "primer" as such, is used generally herein by Applicants to encompass any sequence-binding oligonucleotide which functions to initiate the nucleic acid replication process. "Diagnostic primers" will refer to primers designed with sequences complementary to primer binding sites on diagnostic marker. Diagnostic primers are useful in the convenient detection and identification of individuals of a genetically related population.
PCR-based markers
PCR Enzymatically multiplies a defined region of the template DNA (Fig. 1). The specific multiplication is attributed to the presence of primers, which are single-stranded polynucleotide that recognize and bind to the complementary DNA sequence on template DNA. The amplification process starts with denaturation of the double-stranded template DNA to single stranded DNA under a high temperature, usually between 90-95°C, followed by the specific annealing of the primer(s) to the single-stranded template DNA at a lower temperature. The annealing primers are then extended by a thermo stable DNA polymerase. Repeating the denaturation-annealing extension cycle leads to an exponential accumulation of the DNA fragment of the defined sequence. The amplified products are then fractionated on agarose, polyacrylamide or other gel matrix and detected by Ethidium bromide (EtBr) or silver staining, autoradiography (using an isotope-labeled primer), or fluorescence (using a fluorescence-labeled primer). The distance between the priming sites is usually from 100 bp to a few kilo bases (kb) (and hence the size of the amplified fragments), although the recently developed 'long distance PCR' allows amplification of up to 40 kb or beyond. PCR amplification of any region of a DNA sample is possible, providing their flanking sequences are known, as these are needed for designing primers. Owing to PCR's sensitivity and ability to amplify DNA from a small amount of materials in vitro, a variety of PCR-derived methods have been established.
Hybridization-based marker technologies use cDNA, cloned DNA elements, or synthetic oligonucleotides as probes, which are labelled with radioisotopes or with conjugated enzymes that catalyze a coloured reaction, to hybridize DNA. The DNA is cleaved with restriction enzymes or amplified by PCR, separated by gel electrophoresis, and transferred to a solid support matrix.
Identification of the Marker
Molecular Characterization of NANDAN-31
Plant Material
Attempts were made to develop diagnostic molecular markers for the high yielding selected plant NANDAN-31. For this purpose, molecular analysis of the plant NANDAN-31 was carried out with 10 more diverse Ricinus communis lines that exhibited variability in seed characters (large versus small), maturity pattern (extended flowering versus synchronous maturity), leaf size (small versus medium) and yield (high vs low).
DNA Extraction
Total genomic DNA was extracted from younger leaves of the selected plant (NANDAN-31) following the standard CTAB method with minor modifications (Doyle and Doyle 1987). Five grams of leaves were ground in liquid nitrogen, then homogenized in 20 ml of extraction buffer (2% CTAB, 20 mM EDTA, 2% PVP, 1.4 M NaC1, 100 mM Tris-HCl pH 8.0 and 1% P-mercaptoethanol) and incubated at 65 °C for 1h. The supernatant was treated with RNase A (100 μg/ml), incubated at 37 °C for 30 min and twice extracted with chloroform: isoamylalcohol (24:1 v/v). The DNA was precipitated with isopropanol and washed twice with 70% ethanol. The pelleted DNA was air dried and resuspended in 500 μ of sterile Millipore water and stored overnight at -20 °C.
RAPD and PCR Analysis
A total of 200 decamer primers from Operon kits - OPB to OPK (Operon technologies, Alameda, USA) were used for DNA amplification according to the method of Williams et al. (1990). The PCR amplification reaction (10 μ 1) consisted of 2.5 ng of DNA, lx PCR buffer (10 mM Tris pH 9.0, 50 mM KC1, 1.5 mM MgCl2), 100 μ M of each of the four dNTPs, 0.4 μ M of RAPD primer and 0.3 U of Taq DNA polymerase (Bangalore Genei, India). PCR amplifications were performed in an Gene Amp 9700 Thermal Cycler (Eppendorf) with an initial denaturation at 94 °C for 3 min followed by 45 cycles at 94 °C for 45 s, 36 °C for 30 s and 72 °C for 2 min with a final extension at 72 °C for 7 min. The PCR products were separated on 1.5% agarose gel in lx TAE buffer by electrophoresis at 100 V for 3 h and visualized with ethidium bromide staining under gel documentation system. In general, RAPD markers suffer from a lack of reproducibility, but to check the consistency of the electrophoretic patterns and the polymorphism detected, every PCR reaction was repeated twice. All the PCR amplifications included a negative control (no DNA) to avoid erroneous interpretations.
The 200 tested primers gave robust amplification profiles. The polymorphism detected and Polymorphic bands were checked for accession specific bands. Only one marker was found specific to NANDAN-31.
Further, the distinction of NANDAN-31 has been accomplished through development of a molecular marker specific to the hybrid. The molecular marker gives a specific band of 797 bp (OPH-O5797) in NANDAN-31. The inheritance of the marker was validated by checking it on progeny (20) resulting from this promising plant. Results indicated the association of the marker with the plant of interest.
GEL PICTURE
Fig. PCR amplification of castor NANDAN-31 (1-10) and control samples (11-20) using RAPD primers specific to the castor NANDAN-31 genotype. M represents A DNA double digest with Eco RI and Hind III restriction enzymes, Nc-negative (no DNA) control.
NANDAN-31 (797 bp)
AGTCGTCCCCATTCAAGCATTTCTAATTCCTCTCTAGCGAGATCCACTGTCTAGAACATAGAAAGATGAGGAGGCAAAGGAATTCAACGTTTGCTGGGACTATGCTCCCAATTATAAATCCTCTCGCTGAGGTACCAAGCCCGATAGACAGCCCTACCAGCAGCACTTTCCTCTGGCTCGAGGTTGGCTGCAAATAACATAAAAGGCTCCCACTGGTCGCGTTCCCCTAGCTAATCACTCAGAATTTTGTAAACCAGAAAAGATAAGTGACAATATAAATAAAACCACCGAATATAACCTAACGAATTATGTTTACTATGTCTCAGGTCAAGTCGTTGCTCTTAATAGAATTTCAATCTTCTAAAGACAATAAAGTAAAAGATACCTATACAAACGAGCTTTTAGTATAGTGGATTGCTAAANCTTATACTAAATATCATTGAATTGCCATACGCGGGATTAAATTTGCATGCATATATGTACAATGATCCTGTTCATAAGAGATTAATGGTGTCAGTAGTGTTATTAATTATTAAGCTCTCCTTCAATGAAAAAAATAAAAAAAAATGTATTATAGGAAAGTAATAAAGATCACAACGAACGTGTGGGCATATGAAAGGAATGTGCCTAGAGAAGGTCATAATGGCAGCAGAAGGTCAATCCAACAAAGACGTAAAGGGGGTTAGGGATGAGACCATTAAGGAAAATCTTGGTGACGCTAATTTTAGGACCTAGATGATGGTGACAAGAAAAGGAAGGCCATGGATCAAGGAAATGAGTTGATCAAGGGGACGACT
TISSUE CULTURE
As used herein, the term 'tissue culture' indicates a composition comprising isolated cells of the same or a different type or a collection of such cells organized into parts of a plant. Exemplary types of tissue cultures are protoplasts, calli, plant meristems, and plant cells that can generate tissue culture that are intact in plants or parts of plants, such as embryos, pollen flowers seeds, spikes, leaves, stems, roots, root tips, anthers, and the like. Means for preparing and maintaining plant tissue culture are well known in the art. By way of example, a tissue culture comprising organs has been used to produce regenerated plants.
As used herein, the term 'plant' includes plant cells, plant protoplasts, plant cells of tissue culture from which Castor plants can be regenerated, plant calli, plant meristems, and plant cells that are intact in plants or parts of plants, such as pollen, flowers, embryos, ovules, seeds, spike, leaves, stems, pistils, anthers and the like. Thus another aspect of this invention is to provide for cells which upon growth and differentiation produce a cultivar having essentially all of the physiological and morphological characteristics of NANDAN-31.
The present invention contemplates a Castor plant regenerated from tissue culture of the selected Castor plant NANDAN-31 of the present invention. As is well known in the art, tissue culture of Castor can be used for the in vitro regeneration of a Castor plant. Tissue culture of various tissues of Castor and regeneration of plants there from is well known and widely published. For example, reference may be had to Sujatha and Reddy, Plant Cell Reports 17: 561 (1998); Athma and Reddy, Curr. Sci. 52: 256 (1983); Genyu, Crops. IRRI. Cassell, Tycooly, pp.393 (1988); Sarvesh et. al, Adv Plant Sci 5: 124 (1992) Molina and Schobert, J Plant Physiol 147: 270 (1995); Reddy and Bahadur, Curr. Sci. 58: 152 (1989); and Sujatha, Dissertation, Osmania University, Hyderabad (1996). Thus, another aspect of this invention is to provide cells which upon growth and differentiation produce castor plants having the physiological and morphological characteristics of NANDAN-31.
Additional Breeding Methods
The utility of Castor plant NANDAN-31 also extends to crosses with other species. Commonly, suitable species will be of the family Euphorbiaceae, and especially of the genera Ricinus.
This invention also directed to methods for producing a Castor plant by crossing a first parent Castor plant with a second parent Castor plant, and vice versa to produce a Castor plant or a Castor selected plant NANDAN-31. Further, both first and second parent Castor plants can come from the Castor selected plant NANDAN-31 Thus, any such methods using the selected plant NANDAN-31 are part of this invention: selfing, backcross, hybrid production, crosses to populations and the like. All plants produced using Castor selection NANDAN-31 as a parent are within the scope of this invention, including those developed from varieties derived from Castor selected plant NANDAN-31. Advantageously, the Castor selection of the present invention could be used in crosses with other, different, Castor plants to produce the first generation (Fi) castor hybrid seeds and plants with superior characteristics. One or both the parents of the selection of the invention can also be used for genetic transformation where exogenous genes are introduced and expressed by one or both of the parents of the invention. Genetic variants created either through traditional breeding methods using one or both the parents of NANDAN-31 through genetic transformation of one or both the parents of NANDAN-31 by any of a number protocol known to these of skill in the art are intended to be within the scope of this invention.
The following describes breeding methods that may be used with selected plant NANDAN- 31 with one or both of the parents of selected plant NANDAN-31 in the development of further castor plants. One such embodiments is a method for developing an NANDAN-31- derived progeny castor plant in a breeding program comprising: obtaining the Castor plant, or a part thereof, of castor plant NANDAN-31, utilizing said plant or plant part as a source of breeding material and selecting an NANDAN-31 progeny plant with molecular markers in common with NANDAN-31 and/or with morphological and/or physiological characteristics selected from the characteristics listed in Table 1. The same method may be used with one or both the parents of NANDAN-31. Breeding steps that may be used in the Castor breeding program include pedigree breeding, mutation breeding, and recurrent selection. In conjugation with these steps, techniques such as RFLP enhanced selection, genetic marker enhanced selection like SSR markers and the making of double haploids may be utilized.
Another method involves producing a population of NANDAN-31 progeny Castor plants, comprises crossing NANDAN-31 with another Castor plant, thereby producing a population of Castor, which on average, derive 50% of their alleles from NANDAN-31. A plant of this population may be selected and repeatedly selfed or sibbled with a Castor plant resulting from these successive filial generations. One embodiments of this invention is the castor cultivar produced by this method and that has obtained at least 50% of its alleles from selected plant NANDAN-31. The same method may be used with one or all four of the parents of NANDAN-31.
One of ordinary skill in the art of plant breeding would know how to evaluate the traits of two plant types to determine if there is no significant difference between the two traits expressed by those plant types. Thus the invention includes castor selected plant NANDAN- 31 progeny plants comprising a combination of at least two NANDAN-31 traits selected from the group consisting of those listed in Table-2 the combination of traits listed in the 'Summary of the Invention', so that said progeny castor plant is not significantly different for said traits than NANDAN-31. Using techniques described herein, molecular markers may be used to identify said progeny plant as an NANDAN-31 progeny plant. Mean trait values may be used to determine whether trait difference are significant, and preferably the traits are measured on plants grown under the same environmental conditions. Once such a variety is developed its value is substantial since it is important to advance the germplasm base as a whole in order to maintain or improve traits such as yield, disease resistance, insect pest resistance, and plant performance in extreme environmental conditions.
Progeny of Castor selected plant NANDAN-31 may also be characterized through their filial relationship with NANDAN-31, as for example, being within a certain number of breeding crosses of NANDAN-31. A breeding cross is a cross made to introduce new genetics into the progeny, and is distinguished from a cross, such as a self or a sib cross, made to select among existing genetic alleles. The lower the number of breeding crosses in the pedigree, the closer the relationship between NANDAN-31 and its progeny. For example, progeny produced by the methods describes herein may be within 1, 2, 3, 4, or 5 breeding crosses of NANDAN- 31.
TABLES:
The following tables present data on the traits and characteristics of Ricinus communis plant NANDAN-31 (Table-1) and comparison to its parental lines RCZ-P94 and RCZ-S128 (Table-2).
The results in Table-2 compare the yield, number of spikes per plant, number of pistillate flowers per plant, seeds per capsule, 100-seed weight of NANDAN-31, the selected plant of the recent invention produced by crossing RCZ-P94 and RCZ-S128. As shown in Table-2, selected NANDAN-31 has significant higher yield, more number of spikes per plant, more number of pistillate flowers per plant, more seeds per capsule, and higher 100-seed weight than both of the parental lines of NANDAN-31.
In Table-2 below, column 2 shows the yield, column 3 shows number of spikes per plant, column 4 shows number of pistillate flowers per plant, column 5 shows seeds per capsule, and column 6 shows 100-seed weight.
TABLE 1
TABLE 2
WE CLAIM
1. An intra-specific F2-selection of Ricinus communis plant designated as NANDAN-31 produced by crossing RCZ-P94 and RCZ-S128 and applying biparental crossing process adopting diallel mating design (half-diallel) at F2 generation following selection.
2. A Ricinus communis selected plant (NANDAN-31) or a part thereof, produced by asexual propagation or tissue culture method or growing the seed of the claim 1.
3. Pollen of the selected plant (NANDAN-31) of claim 2.
4. An ovule of the selected plant (NANDAN-31) of claim 2.
5. A Ricinus communis selected plant (NANDAN-31) or a part thereof, is having all of the physiological and morphological characteristics of the Ricinus communis selected plant (NANDAN-31) of claim 2.
6. A tissue culture cells produced from the Ricinus communis selected plant (NANDAN-31) of claim 2, wherein said cells of the tissue culture are produced from a plant part selected from the group consisting of leaves, pollen, embryos, cotyledons, hypocotyls, meristematic cells, roots, root tips, pistils, anthers, flowers, spike, and stems.
7. A protoplast produced from Ricinus communis selected plant (NANDAN-31) of claim 2.
8. A Ricinus communis plant regenerated from the tissue culture of claim 6, wherein the plant has all the morphological and physiological characteristics of selected NANDAN- 31.
9. A process of producing the Ricinus communis intra-specific F2-selected plant NANDAN- 31 by crossing RCZ-P94 and RCZ-S128 and then applying biparental crossing process adopting diallel mating design (half-diallel) at F2 generation following selection.
10. An intra-specific selected plant NANDAN-31 or part thereof prepared by the process of claim 9.
11. A method of producing an intra specific F2 selected plant NANDAN-31 with Ricinus communis the morphological and physiological characteristics of selected NANDAN- 31 according to claim 9 or claim 10, comprising regeneration of a tissue culture.
12. A method of producing an intra specific hybrid F2 and selection of Ricinus communis plant designated as NANDAN-31 according to any one of claims 9 to 11 wherein the NANDAN-31 exhibits a high yield, resistance to disease and insect pests, improved canopy structure, tolerance to environmental stresses, improved agronomic characteristics and/or higher seed yield.
13. A method of producing an intra specific hybrid F2 and selection of Ricinus communis plant designated as NANDAN-31 according to any one of claims 9 to 12, wherein the female parent used in the method comprises the characteristics of producing cyathium inflorescence, a highly fertile ovule and a small number of abortive flowers.
14. A method of producing an intra specific hybrid F2 and selection of Ricinus communis plant designated as NANDAN-31 according to any one of claims 9 to 13, wherein the male parent used in the method comprises the characteristics of producing a greater number of inflorescences per plant.
15. A method of producing an intra specific hybrid F2 and selection NANDAN-31of Ricinus communis plant according to any one of claims 9 to 14, wherein the intra specific hybrid F2 and selection NANDAN-31 of Ricinus communis plant is then crossed with a Ricinus communis or part thereof, to produce a population of NANDAN-31 progeny comprising 20 to 70% of alleles from the NANDAN-31 parent.
16. A method of producing an intra specific hybrid F2 and selection of Ricinus communis plant designated NANDAN-31 according to any one of claims 9 to 15, wherein the NANDAN-31 product comprises the sequence SEQ .ID.l (OPH - 05 at 797 bp)
17. A method of producing an intra specific hybrid F2 and selection of Ricinus communis plant designated NANDAN-31 according to any one of claims 9 to 16, wherein part of the NANDAN-31 is a product comprising the sequence SEQ .ID. 1 (OPH - 05 at 797 bp)
18. A method of producing an intra specific hybrid F2 and selection NANDAN-31 of Ricinus communis plant according to any one of claims 9 to 17 wherein the NANDAN-31 product comprises a sterile male form.
19. An intra specific hybrid F2 and selection NANDAN-31 plant or part thereof prepared by the method of any one of claims 9 to 18.
20. A method of producing pollen from an intra specific hybrid of Ricinus communis plant designated as NANDAN-31, comprising forming the plant by the method of any one of claims 9 to 18 and extracting pollen there from.
21. A method of producing an ovule from an intra specific hybrid of Ricinus communis plant designated as NANDAN-31, comprising forming the plant by the method of any one of claims 9 to 18 and extracting an ovule there from.
22. A method of producing a protoplast from an intra specific hybrid F2 and selection of Ricinus communis plant designated as NANDAN-31, comprises forming the plant by the method of any one of claims 9 to 18 and extracting a protoplast there from.
23. A method of producing a microbiological product from an intra specific hybrid F2 and selection of Ricinus communis plant designated as NANDAN-31 comprises forming the plant by the method of any one of claims 9 to 18 and extracting a microbiological product.
24. A method of producing a microbiological product from an intra specific hybrid F2 and selection of Ricinus communis plant designated as NANDAN-31 comprises forming the plant by the method of any one of claims 9 to 18 and extracting a microbiological product selected from either a pollen cell or an ovule cell.
25. A method of producing a microbiological product from an intra specific hybrid F2 and selection of Ricinus communis plant designated as NANDAN-31 comprises forming the plant by the method of any one of claims 9 to 18 and extracting a microbiological product comprising one or more of embryos, protoplasts, meristematic cells, callus, leaves, anthers, pistils, root tips, seeds or stems.
26. A method of culturing tissue cells from an intra specific hybrid F2 and selection of Ricinus communis plant according to any one of claims 9 to 18, comprising culturing tissue cells produced from the Ricinus communis plant, where cells are selected from the group consisting of leaves, pollen, embryos, cotyledons, hypocotyls, meristematic cells, roots, root tips, pistils, anthers, flowers, inflorescence, callus, seeds and stems.
27. Use of the intra specific hybrid F2 and selection NANDAN-31 plant or part thereof, according to claim 19 in a process for the production of a biofuel.
28. Use according to claim 27 wherein the biofuel is biodiesel.
29. A biofuel generated by the use according to claim 27 or claim 28.
| # | Name | Date |
|---|---|---|
| 1 | 1508-CHE-2011 POWER OF ATTORNEY 02-05-2011.pdf | 2011-05-02 |
| 2 | 1508-CHE-2011 FORM-5 02-05-2011.pdf | 2011-05-02 |
| 3 | 1508-CHE-2011 FORM-3 02-05-2011.pdf | 2011-05-02 |
| 4 | 1508-CHE-2011 FORM-2 02-05-2011.pdf | 2011-05-02 |
| 5 | 1508-CHE-2011 FORM-1 02-05-2011.pdf | 2011-05-02 |
| 6 | 1508-CHE-2011 DESCRIPTION (COMPLETE) 02-05-2011.pdf | 2011-05-02 |
| 7 | 1508-CHE-2011 CORRESPONDENCE OTHERS 02-05-2011.pdf | 2011-05-02 |
| 8 | 1508-CHE-2011 CLAIMS 02-05-2011.pdf | 2011-05-02 |
| 9 | 1508-CHE-2011 ABSTRACT 02-05-2011.pdf | 2011-05-02 |
| 10 | 1508-CHE-2011 FORM-1 03-06-2011.pdf | 2011-06-03 |
| 11 | 1508-CHE-2011 CORRESPONDENCE OTHERS 03-06-2011.pdf | 2011-06-03 |