METHOD OF INHIBITION OF LEUKEMIC STEM CELLS
FIELD OF THE INVENTION
This invention relates to a method for the inhibition of leukemic stem cells, and in particular
for the inhibition of leukemic stem cells associated with acute myelogenous leukemia (AML)
and other haematologic cancer conditions as an effective therapy against these hematologic
cancer conditions.
BACKGROUND OF THE INVENTION
Hematological cancer conditions are the types of cancer such as leukemia and malignant
lymphoproliferative conditions that affect blood, bone marrow and the lymphatic system.
Leukemia can be classified as acute leukemia and chronic leukemia. Acute leukemia can be
further classified as acute myelogenous leukemia (AML) and acute lymphoid leukemia
(ALL). Chronic leukemia includes chronic myelogenous leukemia (CML) and chronic
lymphoid leukemia (CLL). Other related conditions include myelodysplastic syndromes
(MDS, formerly known as "preleukemia") which are a diverse collection of hematological
conditions united by ineffective production (or dysplasia) of myeloid blood cells and risk of
transformation to AML.
Leukemic stem cells (LSCs) are cancer cells that possess characteristics associated with
normal stem cells, that is, the property of self renewal and the capability to develop multiple
lineages. Such cells are proposed to persist in hematological cancers such as AML as distinct
populations.1
Acute myelogenous leukemia (AML) is a clonal disorder clinically presenting as increased
proliferation of heterogeneous and undifferentiated myeloid blasts. The leukemic hierarchy is
maintained by a small population of LSCs, which have the distinct ability for self-renewal,
and are able to differentiate into leukemic progenitors'. These progenitors generate the large
numbers of leukemic blasts readily detectable in patients at diagnosis and relapse, leading
ultimately to mortality2"4. AML-LSC have been commonly reported as quiescent cells, in
contrast to rapidly dividing clonogenic progenitors3'5'6. This property of LSCs renders
conventional chemotherapeutics that target proliferating cells less effective, potentially
explaining the current experience in which a high proportion of AML patients enter complete
remission, but almost invariably relapse, with <30% of adults surviving for more than 4
years7. In addition, minimal residual disease occurrence and poor survival has been attributed
to high LSC frequency at diagnosis in AML patients . Consequently, it is imperative for the
long term management of AML (and similarly other above mentioned hematological cancer
conditions) that new treatments are developed to specifically eliminate LSCs9"14.
AML-LSCs and normal hematopoietic stem cells (HSCs) share the common properties of
slow division, self-renewal ability, and surface markers such as the CD34+CD38' phenotype.
Nevertheless, LSCs have been reported to possess enhanced self-renewal activity, in addition
to altered expression of other cell surface markers, both of which present targets for
therapeutic exploitation. Interleukin-3 (IL-3) mediates its action through interaction with cell
surface receptors that consist of 2 subunits, the a subunit.(CD123) and the ß common (ßc)
chain (CD 131). The interaction of an a chain with a ß chain forms a high affinity receptor for
IL-3, and the ßc chain mediates the subsequent signal transduction 15'16. Over-expression of
CD 123 on AML blasts, CD34+ leukemic progenitors and LSCs relative to normal
hematopoietic cells has been widely reported * , and has been proposed as a marker of LSCs
in some studies 24'25. CD131 was also reported to be expressed on AML cells 2I'25 but there are
conflicting reports on its expression on AML-LSCs 23'25.
Overexpression of CD123 on AML cells confers a range of growth advantages over normal
hematopoietic cells, with a large proportion of AML blasts reported to proliferate in culture in
response to IL-3 26"31. Moreover, high-level CD 123 expression on AML cells has been
correlated with: the level of IL-3-stimulated STAT-5 activation; the proportion of cycling
cells; more primitive cell surface phenotypes; and resistance to apoptosis. Clinically, high
CD 123 expression in AML is associated with lower survival duration, a lower complete
remission rate and higher blast counts at diagnosis l9'21-32.
The increased expression of CD 123 on LSCs compared with HSCs presents an opportunity for
therapeutic targeting of AML-LSCs. The monoclonal antibody (MAb) 7G3, raised against
CD123, has previously been shown to inhibit IL-3 mediated proliferation and activation of
both leukemic cell lines and primary cells 33 However, it has remained unclear whether
targeting CD 123 can functionally impair AML-LSCs, and whether it can inhibit the homing,
lodgment and proliferation of AML-LSCs in their bone marrow niche. Moreover, the relative
contributions of direct inhibition of IL-3 mediated signaling versus antibody-dependent cell-
mediated cytotoxicity (ADCC) in the ability of 7G3 to target AML-LSCs remain unresolved.
US Patent No. 6,177,078 (Lopez) discloses the anti-IL-3Receptor alpha chain (IL-3Ra)
monoclonal antibody 7G3, and the ability of 7G3 to bind to the N-terminal domain,
specifically amino acid residues 19-49, of IL-3Rct Accordingly, this patent discloses the use
of a monoclonal antibody such as 7G3 or antibody fragment thereof with binding specificity
for amino acid residues 19-49 of IL-:3Ra in the treatment of conditions resulting from an
overproduction of IL-3 in a patient (including myeloid leukemias, lymphomas and allergies)
by antagonizing the functions of the IL-3.
US Patent No. 6,733,743 (Jordan) discloses a method of impairing a hematologic cancer
progenitor cell that expresses CD 123 but does not significantly express CD131, by contacting
the cell with a composition of an antibody and a cytotoxic agent (selected from a
chemotherapeutic agent, a toxin or an alpha-emitting radioisotope) whereby the composition
binds selectively to CD 123 in an amount effective to cause cell death. The hematologic
cancer may be leukemia or a malignant lymphoproliferative disorder such as lymphoma.
In work leading to the present invention, the inventors have tested, the ability of MAb 7G3 to
exploit the overt differences in CD 123 expression and function between AML-LSCs and
HSCs. MAb 7G3 inhibited the IL-3 signaling pathway and proliferation of primary AML
cells. Moreover, the homing and engraftment of AML blasts in the nonobese diabetic/severe
combined immunodeficient (NOD/SCID) xenograft model were profoundly reduced by MAb
7G3, and LSC function was inhibited.
SUMMARY OF THE INVENTION
In one aspect, the present invention provides a method for inhibition of leukemic stem cells
expressing IL-3Ra (CD123), which comprises contacting said cells with an antigen binding
molecule comprising a Fc region or a modified Fc region having enhanced Fc effector
function, wherein said antigen binding molecule binds selectively to IL-3Ra(CD123).
The present invention also provides a method for the treatment of a hematologic cancer
condition in a patient, which comprises administration to the patient of an effective amount of
an antigen binding molecule comprising a Fc region or a modified Fc region having enhanced
Fc effector function, wherein said antigen binding molecule binds selectively to IL-3Ra
(CD 123).
In another aspect, the present invention also provides the use of an antigen binding molecule
comprising a Fc region or a modified Fc region having enhanced Fc effector function in, or in
the manufacture of a medicament for, the inhibition of leukemic stem cells expressing IL-3Ra
(CD 123), wherein said antigen binding molecule binds selectively to IL-3Ra(CD123).
In this aspect, the invention also provides the use of an antigen binding molecule comprising a
Fc region or a modified Fc region having enhanced Fc effector function in, or in the
manufacture of a medicament for, the treatment of a hematologic cancer condition in a patient,
wherein said antigen binding molecule binds selectively to IL-3Ra(CD123).
The present invention also provides an agent for inhibition of leukemic stem cells expressing
IL-3Ra(CD123), which comprises an antigen binding molecule comprising a Fc region or a
modified Fc region having enhanced Fc effector function, wherein said antigen binding
molecule binds selectively to the IL-3Ra(CD123).
In this aspect, the invention also provides an agent for the treatment of a hematologic cancer
condition in a patient, which comprises an antigen binding molecule comprising a Fc region or
a modified Fc region having enhanced Fc effector function, wherein said antigen binding
molecule binds selectively to IL-3Ra(CD123).
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 shows that MAb 7G3 inhibits IL-3-stimulated phosphorylation of CD131, and
proliferation, of primary AML cells, (a) Primary AML cells from two individual patients were
incubated with antibody at the concentrations shown in the figure for 30 min on ice. Without
washing, cells were stimulated with IL-3 (lnM for 10 min at 37°C). Immediately following
stimulation cells were lysed. Lysates were run on SDS-PAGE and immunoblotted with MAb
4GI0 and then the blots were stripped and re-probed with MAb 1C1 as a loading control, (b-e)
Proliferation of primary AML cells assessed by 3H-thymidine incorporation into TCA
insoluble material, (b-d) Freshly isolated mononuclear cells from 3 individual AML patients
were incubated with a titration of MAb 7G3 for 48 hours either in the absence (A, dashed line)
or presence of cytokine: IL-3 at 1 ng/mL (0, dotted line) or GM-CSF at 0.1 ng/mL (¦, solid
line). Data points show mean + s.e.m. of triplicate points, (e) Thawed cells from 35 patients
with AML were analyzed for inhibition of proliferation by MAb 7G3 (1 jug/mL) in the
absence or presence of IL-3 (1 ng/mL). Inhibition was shown in 32 of 35 patients tested. In 9
of those patients proliferation levels fell to below that in the absence of IL-3 (constitutive
proliferation). Proliferation was quantified using 3H-Thymidine incorporation and liquid
scintillation counting.
Figure 2 shows that CD 123 neutralization inhibits homing and engraftment of primary
AML cells in NOD/SCID mice. Engraftment of primary AML cells from 10 patients (a), or
normal bone marrow (NBM) or cord blood (CB) from 5 individuals (b), following ex vivo
exposure to 7G3 (grey bars) or IgG2a (black bars) (10 µg/mL, 2 h). Following antibody
treatment cells were transplanted into sublethally irradiated NOD/SCID mice, culled at 4-8 (a)
or 4-11 (b) weeks, and the proportion of human CD45+ cells in the femoral bone marrow
estimated by flow cytometry. For each sample, 3 to 10 mice were used per treatment group.
AML-8 and AML-8-rel correspond to leukemic cells harvested from the same patient at
diagnosis and relapse, respectively. NBM-4 and CB-1 originated from pooled samples, (c)
Kaplan-Meier event-free survival curve of mice transplanted with IgG2a (n = 10, solid line) or
7G3 (n = 10, dotted line) ex vivo treated AML-9 cells, (d) Homing efficiency of IgG2a (black
bars), 7G3 (grey bars) ex vivo treated AML-8-rel or AML-9 cells to the bone marrow and
spleen, assessed 24 h post-transplantation, (e) Engraftment levels of AML-8-rel cells in mice
transplanted with lgG2a (white bars) or 7G3 (black bars) ex vivo treated cells, following
intravenous infusion (IV) or intrafemoral injection (IF). For the IF transplanted mice,
engraftment levels in the right femur (RF) where AML cells were transplanted, and in non-
transplanted bones (WBM) are shown. For (d) and (e) 4-5 mice were used per treatment
group. Mice were sacrificed at 5 weeks post-transplantation. Values represent mean ± s.e.m.
Significant differences between control IgG2a and treated mice are indicated: *, P < 0.05; **,
P<0.01; ?**, P < 0.0001. (f) Absolute number of CD34+38" AML cells homed in the BM and
spleen of NOD/SCID mice injected with ex vivo 7G3-treated leukemic cells. N= 2-3 mice per
group for AML-8 and n = 5 mice per group for AML-9. Values represent mean ± SEM. (g)
Homing efficiency of sorted CD34+CD38' AML-9 cells after ex vivo treatment into both BM
and spleen of mice. N = 3 mice per treatment group.
Figure 3 shows that administration of 7G3 to NOD/SCID mice reduces AML
engraftment. (a) Engraftment levels of AML-1 cells in the femoral bone marrow of irradiated
NOD/SCID mice which had received a single dose of IgG2a control or 7G3 (300 µg) 6 h prior
to transplantation. Mice were culled at 5 weeks post transplantation, (b) Engraftment of AML-
1, 2, and 3 in NOD/SCID mice treated with IgG2a (black bars) or 7G3 (grey bars). Treatments
were initiated at 24 hours post-transplantation, 300 µg per dose, every other day for 4 doses.
Mice were culled at 5 weeks post-transplantation, (c) CD 123 expression on bone marrow-
derived cells, and (d) engraftment levels in the peripheral blood and spleen, of AML-1 cells
' inoculated into mice, then IgG2a or 7G3 treatments initiated 4 days post transplantation for a
total of 12 injections administered 3 times/week. Mice were culled at 5 weeks post-
transplantation, (e) Engraftment levels of AML-2 cells in the bone marrow when IgG2a
(dotted line) or 7G3 (solid line) treatments were initiated 28 days post transplantation and
continued 3 times/week until time of sacrifice. Between 3 and 10 mice were used per
treatment group. Values represent mean ± s.e.m. (f) Percentage of human AML-1 cells in the
BM of NOD/SCID mice after 4 doses of 7G3 or IgG2a control at 300 µg/ dose, administered 3
times a week starting on Day 28 post transplantation. Each individual symbol represents value
obtained from a single mouse. Significant differences between IgG2a control and 7G3 treated
mice are indicated: *, P < 0.05; **, P < 0.005.
Figure 4 Part I shows that administration of 7G3 and Ara-C to mice with established
AML disease blocks LSC repopulation of secondary recipient mice, (a) Engraftment levels of
AML-10 cells in the bone marrow and spleen of primary mice treated with Ara-C combined
with either IgG2a or 7G3 as shown in the schematic, (b) homing efficiency to bone marrow
and spleen, (c) engraftment levels, and (d) proportion of CD34+38" cells in the secondary graft,
of leukemic cells harvested from the bone marrows of mice treated in (a), and transplanted
into secondary recipient mice. Horizontal bars indicate the mean value. Significant differences
between IgG2a plus Ara-C control and 7G3 plus Ara-C treated group are indicated: *, P <
0.05 and **P<0.01.
Part II shows (A) engraftment levels of AML-10 cells in BM and spleen after 10
weeks of 7G3 or control IgG2a treatment. Antibody treatment was initiated at Day 28 post
transplantation, 300 ug per mouse thrice weekly, as shown in the schematic overview. (B-D)
Homing efficiency (B), levels of engraftment in the BM and spleen (C), and the percentage of
CD34+CD38' cells in the BM (D) of secondary recipient mice. Mice in C and D were analyzed
at 12 weeks post transplantation. Each symbol represents a single mouse, horizontal bars
indicate the mean value. *, P < 0.05; **, P < 0.01 between control IgG2a and 7G3 groups.
Part III shows (A) engraftment levels of AML-9 cells in BM and spleen after 10
weeks of 7G3 or control IgG2a treatment. Antibody treatment was initiated at Day 28 post
transplantation, 300 \i% per mouse thrice weekly, as shown in the schematic overview. (B)
Levels of engraftment in the BM of secondary recipient mice. Secondary mice were analyzed
at 8 weeks post transplantation. Each symbol represents a single mouse, horizontal bars
indicate the mean value. **, P < 0.01 between control IgG2a and 7G3 groups.
Figure 5 shows that natural killer (NK) lymphocytic cells contribute to the 7G3-
mediated inhibition of AML engraftment. (a) Level of engraftment, and (b) homing efficiency
of AML-8-rel cells treated ex vivo with IgG2a (white bars) or 7G3 (black bars) (10 µg/mL, 2
h) and transplanted into NOD/SCID mice without (-) or with (+) prior CD122+ NK cell
depletion. Four mice were used for each treatment group. Values represent mean ± s.e.m.
Significant differences are indicated: *, P < 0.05 and ** P< 0.01.
Figure 6 shows that MAb 7G3, but not 6H6 nor 9F5, inhibits IL-3-stimulated
phosphorylation of CD131 (ßc), STAT-5 and Akt in IL-3 dependent cell lines and AML cells,
(a) TF-1 cells were incubated with varying concentrations of 7G3, 9F5 or 6H6 for 30 min on
ice. Without washing, cells were stimulated with IL-3 (1 nM for 10 min at 37°C). Immediately
following stimulation cells were lysed and CD131 immunoprecipitated as described in the
methods. Immunoprecipitates were separated by SDS-PAGE and immunoblotted with
antibodies to phosphorylated tyrosine residues (4G10), phosphorylated STAT-5 or
phosphorylated Akt. Blots were stripped and re-probed with antibody to /3c (1C1) as a loading
control, (b) 7G3 inhibition of IL-3 induced activation of STAT-5 was also confirmed by
intracellular FACS staining of the TF-1 and M07e cell lines, and primary AML-9 cells. Mock
treatment (dotted line), IL-3 alone (10 ng/mL 2 h, solid line), IL-3 plus 7G3 (10 ng/mL,
dashed line).
Figure 7 shows that the intensity of CD 123 expression on CD34+/CD38' cells inversely
correlates with the ability of 7G3 to inhibit engraftment in NOD/SCID mice. The Y-axis
represents the logarithmic of RFI of CD 123 expression on the CD34+/CD38' fraction for each
patient or donor specimen. The X-axis plots the logarithmic of the engraftment level of 7G3 ex
Wvo-treated group standardized to % of IgG2a control taken as 100% for each individual
patient or donor sample. Each point represents a separate experiment reflecting the average
value from 3-10 mice per treatment group and each experiment performed using different
AML patient (solid symbols) or normal BM samples (open symbols). All mice were analysed
after 4-6 weeks after engraftment. Each engraftment data point was based on measurements
from 3-10 mice shown in Figure 2a.
Figure 8 shows CD 107a expression in NK cells with AML cells as target cells.
Peripheral Blood Mononuclear cells (PBMCs) from a normal healthy donor were incubated
with primary human AML cells (RMH003) at a ratio of 1:1 (A & B), either with IgGl control
(10µg/mL) (A & C) or CSL360 (10µg/mL) (B & D) for three hours at 37°C. To assess non-
specific expression of CD107a, PBMC were incubated with antibody and no target cells (1:0)
(C & D).
Figure 9 shows a histogram plot of the data generated in the experiment depicted in
figure 8 and as indicated also includes samples in which no antibody was added.
Figure 10 shows homing efficiency of a AML-8-rel sample treated ex vivo with 10 µg/mL
IgG2a, intact 7G3, 6H6 or 9F5 antibodies and the F(ab')2 fragments of 7G3 (7G3 Fab) and
6H6 (6H6 Fab) prior to inoculation into NOD/SCID mice. Homing efficiency of human
mononuclear cells into the bone marrow was measured after 16 hrs. For each sample, 3 mice
were used per treatment group.
Figure 11 shows engraftment of primary AML cells from two patients (AML-9 and
AML 10) in sublethally irradiated NOD/SCID mice following ex vivo exposure to 10 µg/mL
IgG2a, intact 7G3 or 9F5 antibodies and the F(ab')2 fragments of 7G3 (7G3 Fab) and 9F5
(9F5 Fab). AML engraftment was assessed 4 weeks post inoculation as the proportion of
human CD45+ cells in the femoral bone marrow estimated by flow cytometry. For each
sample, 5 mice were used per treatment group.
Figure 12 shows comparison of ADCC activities of chimeric CSL360, human CSL360
and its Fc variants. Calcein AM labeled CTLEN cells were incubated with different antibodies
and freshly isolated PBMC from a normal human donor. Ratio of PBMC to CTLEN cells was
100:1. Cells were incubated for 4 hours at 37°C in an incubator with 5% CO2. After the
incubation period, cells were centrifuged and 100µL of supernatant transferred to a fresh plate.
Fluorescence in the supernatant was measured using a Wallac microplate reader (excitation
filter 485nm, emission filter 535nm). Antibodies used were either chimeric CSL360 (open
bars), humanized CSL360 (solid bars), humanized CSL360 with two amino acid changes
(diagonal lines) or humanized CSL360 with three amino acid changes (dotted). Human IgGl
(horizontal lines) and wells with no antibody (vertical lines) were included as controls.
Figure 13 shows (a) Biacore analysis of hCSL360, and three variants thereof, binding to
FcRs. huCSL 360 and three variants thereof were individually captured on a BIAcore CM5
chip coupled with CD 123. huFcyRI, huFcyRIIb/c and huFcyRIIIa, at concentrations ranging
from 0.4 nM to 800 nM, were flowed over the respective surfaces and the responses used to
determine KAs. Affinities are reported as fold increase over hCSL360 which is assigned a
relative value of 1. (b) KA values were expressed as the A/I ratio of huFcTRIIIa to
huFcyRIIb/c for each of the four antibodies
Figure 14 shows ADCC mediated lysis of Raji-CD123 positive cells examined in a
calcein release assay using normal PBMC as effector cells. Approximate numbers of CD123
molecules expressed on Raji-CD123 low and high expressors are 4,815 and 24,432
respectively, (a) ADCC-mediated lysis of Raji-CD123 low at E:T=25:1 (b) ADCC mediated
lysis of Raji-CD123 low at E:T=50:l (c) ADCC mediated lysis of Raji-CD123 high at
E:T=25:1. (d) ADCC mediated lysis of Raji-CD123 high at E:T=50:l. Filled triangles
represent hCSL360Fc3, circles hCSL360kif, filled circles CSL360, squares hCSL360, asterisk
represents no antibody.
Figure 15 shows enhanced ADCC activity of CSL360 and its variants with TF-1 cells as
target cells. ADCC activity of antibodies were examined using LDH assay, (a) Filled triangles
represent hCSL360Fc3, filled squares hCSL360Fc2, empty circles hCSL360kif, filled circles
CSL360 and asterisk represents no antibody, (b) Fitted triangles represent 168-26Fc3, filled
squares 168-26Fc2, filled circles represent 168-26 and asterisk represents no antibody
Figure 16 shows enhanced ADCC activity of CSL360 and its variants with primary
human leukaemic cells as target cells, (a) RMH003 AML, (b) RMH011 AML, (c) RMH010
AML, (d) RMH008 AML, (e) WMH007 AML, (f) RMH009 B-ALL, (g) RMH007 B-ALL.
ADCC activity was determined using LDH assay.
Figure 17 shows in vivo sensitivity of mice with pre-engrafted ALL to control MAb
(murine IgG2a), 7G3, 168-26 and 168-26Fc3 depicted as Kaplan-Meier curves for event-free
survival (EFS) from the day of leukemic transplantation. An event is defined as 25% hCD45+
burden in peripheral blood. The number of animals in each group were 7, 6, 6 and 7
respectively. Leukemic growth delay (LGD) is defined as the number of days a treated group
survived more than the control MAb group based on comparison of median EFS and were 2.9
(P=0.54), 6.4 (P=0.13) and 12.2 (P=0.044) days for 7G3, 168-26 and 168-26Fc3 respectively.
DETAILED DESCRIPTION OF THE INVENTION
In one aspect, the present invention provides a method for inhibition of leukemic stem cells
expressing IL-3Ra (CD 123), which comprises contacting said cells with an antigen binding
molecule comprising a Fc region or a modified Fc region having enhanced Fc effector
function, wherein said antigen binding molecule binds selectively to IL-3Ra(CD123).
In this aspect, the invention also provides a method for the treatment of a hematologic cancer
condition in a patient, which comprises administration to the patient of an effective amount of
an antigen binding molecule comprising a Fc region or a modified Fc region having enhanced
Fc effector function, wherein said antigen binding molecule binds selectively to IL-3Ra
(CD 123).
Preferably, the patient is a human.
The antigen binding molecule is preferably a monoclonal antibody or antibody fragment
comprising a Fc region or a modified Fc region having enhanced Fc effector function.
Antibodies provide a link between the humoral and the cellular immune system with IgG
being the most abundant serum immunoglobulin. While the Fab regions of the antibody
recognize antigens, the Fc portion binds to Fey receptors (Fey Rs) that are differentially
expressed by all immune accessory cells such as natural killer (NK) cells, neutrophils,
mononuclear phagocytes or dendritic cells. Such binding crosslinks FcR on these cells and
they become activated as a result. Activation of these cells has several consequences; for
example, NK cells kill cancer cells and also release cytokines and chemokines that can inhibit
cell proliferation and tumour-related angiogenesis, and increase tumour immunogenicity
through increased cell surface expression of major histocompatibility antigens (MHC)
antigens. Upon receptor crosslinking by a multivalent antigen/antibody complex, effector cell
degranulation and transcriptional-activation of cytokine-encoding genes are triggered and is
followed by cytolysis or phagocytosis of the target cell.
The effector functions mediated by the antibody Fc region can be divided into two categories:
(1) effector functions that operate after the binding of antibody to an antigen (these functions
involve, for example, the participation of the complement cascade or Fc receptor (FcR)-
bearing cells); and (2) effector functions that operate independently of antigen binding (these
functions confer, for example, persistence in the circulation and the ability to be transferred
across cellular barriers by transcytosis). For example, binding of the Cl component of
complement to antibodies activates the complement system. Activation of complement is
important in the opsonisation and lysis of cell pathogens. The activation of complement also
stimulates the inflammatory response and may also be involved in autoimmune
hypersensitivity. Further, antibodies bind to cells via the Fc region, with an Fc receptor
binding site on the antibody Fc region binding to a Fc receptor (FcR) on a cell. Binding of
antibody to Fc receptors on cell surfaces triggers a number of important and diverse biological
responses including engulfment and destruction of antibody-coated particles, clearance of
immune complexes, lysis of antibody-coated target cells by killer cells (known as antibody-
dependent cell-mediated cytotoxicity, or ADCC), release of inflammatory mediators, placental
transfer and control of immunoglobulin production.
The present inventors have shown that the presence in the antigen binding molecule of a Fc
region or a modified Fc region having enhanced Fc effector function is important for
inhibition of leukemic stem cells expressing CD123, and hence in treatment of hematologic
cancer conditions associated with leukemic stem cells.
The hematologic cancer conditions associated with leukemic stem cells (LSCs) which may be
treated in accordance with the present invention include leukemias (such as acute
myelogenous leukemia, chronic myelogenous leukemia, acute lymphoid leukemia, chronic
lymphoid leukemia and myelodysplastic syndrome) and malignant lymphoproliferative
conditions, including lymphomas (such as multiple myeloma, non-Hodgkin's lymphoma,
Burkitt's lymphoma, and small cell- and large cell-follicular lymphoma).
As used herein the term "antigen binding molecule" refers to an intact immunoglobulin,
including monoclonal antibodies, such as chimeric, humanized or human monoclonal
antibodies, or to an antigen-binding and/or variable-domain-comprising fragment of an
immunoglobulin that competes with the intact immunoglobulin for specific binding to the
binding partner of the immunoglobulin, e.g. a host cell protein. Regardless of structure, the
antigen-binding fragment binds with the same antigen that is recognized by the intact
immunoglobulin. Antigen-binding fragments may be produced synthetically or by enzymatic
or chemical cleavage of intact immunoglobulins or they may be genetically engineered by
recombinant DNA techniques. The methods of production of antigen binding molecules and
fragments thereof are well known in the art and are described, for example, in Antibodies: A
Laboratory Manual, Edited by E. Harlow and D, Lane (1988), Cold Spring Harbor
Laboratory, Cold Spring Harbor, New York, which is incorporated herein by reference.
The term "inhibition" as used herein, in reference to leukemic stem cells, includes any
decrease in the functionality or activity of the LSCs (including growth or proliferation and
survival activity), in particular any decrease or limitation in the ability of the LSCs to survive,
proliferate and/or differentiate into progenitors of leukemia or other malignant
hyperproliferative hematologic cancer cells.
The term "binds selectively", as used herein, in reference to the interaction of a binding
molecule, e.g. an antibody, and its binding partner, e.g. an antigen, means that the interaction
is dependent upon the presence of a particular structure, e.g. an antigenic determinant or
epitope, on the binding partner. In other words, the antibody preferentially binds or
recognizes the binding partner even when the binding partner is present in a mixture of other
molecules or organisms.
The term "effective amount" refers to an amount of the binding molecule as defined herein
that is effective for treatment of a hematologic cancer condition.
The term "treatment" refers to therapeutic treatment as well as prophylactic or preventative
measures to cure or halt or at least retard progress of the condition. Those in need of treatment
include those already afflicted with a hematologic cancer condition as well as those in which
such a condition is to be prevented. Subjects partially or totally recovered from the condition
might also be in need of treatment. Prevention encompasses inhibiting or reducing the onset,
development or progression of one or more of the symptoms associated with a hematologic
cancer condition.
In the method of the present invention, administration to the patient of a chemotherapeutic
agent may be combined with the administration of the antigen binding molecule, with the
chemotherapeutic agent being administered either prior to, simultaneously with, or subsequent
to, administration of the antigen binding molecule. •
Preferably, the chemotherapeutic agent is a cytotoxic agent, for example a cytotoxic agent
selected from the group consisting of:
(a) Mustard gas derivatives: Mechlorethamine, Cyclophosphamide, Chlorambucil,
Melphalan, and Ifosfamide
(b) Ethylenimines: Thiotepa and Hexamethylmelamine
(c) Alkylsulfonates: Busulfan
(d) Hydrazines and triazines: Althretamine, Procarbazine, Dacarbazine and
Temozolomide
(e) Nitrosureas: Carmustine, Lomustine and Streptozocin
(f) Metal salts: Carboplatin, Cisplatin, and Oxaliplatin
(g) Vinca alkaloids: Vincristine, Vinblastine and Vinorelbine
(h) Taxanes: Paclitaxel and Docetaxel
(i) Podophyllotoxins: Etoposide and Tenisopide.
(j) Camptothecan analogs: Irinotecan and Topotecan
(k) Anthracyclines: Doxorubicin, Daunorubicin, Epirubicin, Mitoxantrone and
Idarubicin
(1) Chromomycins: Dactinomycin and Plicamycin
(m) Miscellaneous antitumor antibiotics: Mitomycin and Bleomycin
(n) Folic acid antagonists: Methotrexate
(o) Pyrimidine antagonists: 5-Fluorouracil, Foxuridine, Cytarabine, Capecitabine,
and Gemcitabine
(p) Purine antagonists: 6-Mercaptopurine and 6-Thioguanine
(q) Adenosine deaminase inhibitors: Cladribine, Fludarabine, Nelarabine and
Pentostatin
(r) Topoisomerase I inhibitors: Ironotecan and Topotecan
(s) Topoisomerase II inhibitors: Amsacrine, Etoposide, Etoposide phosphate and
Teniposide
(t) Ribonucleotide reductase inhibitors: Hydroxyurea
(u) Adrenocortical steroid inhibitors: Mitotane
(v) Enzymes: Asparaginase and Pegaspargase
(w) Antimicrotubule agents: Estramustine
(x) Retinoids: Bexarotene, Isotretinoin and Tretinoin (ATRA).
Other examples of chemotherapeutic agents include, but are not limited to: acivicin;
aclarubicin; acodazole hydrochloride; acronine; adozelesin; aldesleukin; altretamine;
ambomycin; ametantrone acetate; aminoglutethimide; anastrozole; anthracyclin; anthramycin;
asperlin; azacitidine (Vidaza); azetepa; azotomycin; batimastat; benzodepa; bicalutamide;
bisantrene hydrochloride; bisnafide dimesylate; bisphosphonates (e.g., pamidronate (Aredria),
sodium clondronate (Bonefos), zoledronic acid (Zometa), alendronate (Fosamax), etidronate,
ibandornate, cimadronate, risedromate, and tiludromate); bizelesin; brequinar sodium;
bropirimine; cactinomycin; calusterone; caracemide; carbetimer; carrnustine; carubicin
hydrochloride; carzelesin; cedefingol; cirolemycin; crisnatol mesylate; decitabine (Dacogen);
demethylation agents; dexormaplatin; dezaguanine; dezaguanine mesylate; diaziquone;
droloxifene; droloxifene citrate; dromostanolone propionate; duazomycin; edatrexate;
eflornithine hydrochloride; EphA2 inhibitors; elsamitrucin; enloplatin; enpromate;
epipropidine; erbulozole; esorubicin hydrochloride; etanidazole; etoprine; fadrozole
hydrochloride; fazarabine; fenretinide; floxuridine; flurocitabine; fosquidone; fostriecin
sodium; histone deacetylase inhibitors (HDAC-Is); ilmofosine; imatinib mesylate (Gleevec,
Glivec); iproplatin; lanreotide acetate; lenalidomide (Revlimid); letrozole; leuprolide acetate;
liarozole hydrochloride; lometrexol sodium; lomustine; losoxantrone hydrochloride;
masoprocol; maytansine; megestrol acetate; melengestrol acetate; menogaril; metoprine;
meturedepa; mitindomide; mitocarcin; mitocromin; mitogillin; mitomalcin; mitosper;
mycophenolic acid; nocodazole; nogalamycin; ormaplatin; oxisuran; peliomycin;
pentamustine; peplomycin sulfate; perfosfamide; pipobroman; piposulfan; piroxantrone
hydrochloride; plomestane; porfimer sodium; porfiromycin; prednimustine; puromycin;
puromycin hydrochloride; pyrazofurin; riboprine; rogletimide; safingol; saflngol
hydrochloride; semustine; simtrazene; sparfosate sodium; sparsomycin; spirogermanium
hydrochloride; spiromustine; spiroplatin; streptonigrin; streptozocin; sulofenur; talisomycin;
tecogalan sodium; tegafur; teloxantrone hydrochloride; temoporfin; teroxirone; testolactone;
thiamiprine; tiazofurin; tirapazamine; toremifene citrate; trestolone acetate; triciribine
phosphate; trimetrexate; trimetrexate glucuronate; triptorelin; tubulozole hydrochloride; uracil
mustard; uredepa; vapreotide; verteporfin; vindesine; vindesine sulfate; vinepidine sulfate;
vinglycinate sulfate; vinleurosine sulfate; vinrosidine sulfate; vinzolidine sulfate; vorozole;
zeniplatin; zinostatin; zorubicin hydrochloride; 20-epi-l,25 dihydroxyvitamin D3; 5-
ethynyluracil; abiraterone; aclarubicin; acylfulvene; adecypenol; adozelesin; aldesleukin;
ALL-TK antagonists; altretamine; ambamustine; amidox; amifostine; aminolevulinic acid;
amrubicin; anagrelide; anastrozole; andrographolide; angiogenesis inhibitors; antagonist D;
antagonist G; antarelix; antiandrogen, prostatic carcinoma; antiestrogen; antineoplaston;
antisense oligonucleotides; aphidicolin glycinate; apoptosis gene modulators; apoptosis
regulators; apurinic acid; ara-CDP-D L-PTBA; asulacrine; atamestane; atrimustine;
axinastatin 1; axinastatin 2; axinastatin 3; azasetron; azatoxin; azatyrosine; baccatin III
derivatives; balanol; batimastat; BCR/ ABL antagonists; benzochlorins; benzoylstaurosporine;
beta lactam derivatives; beta-alethine; betaclamycin B; betulinic acid; bFGF inhibitor;
bicalutamide; bisantrene; bisaziridinylspermine; bisnafide; bistratene A; bizelesin; breflate;
bropirimine; budotitane; buthionine sulfoximine; calcipotriol; calphostin C; camptothecin
derivatives; canarypox IL-2; carboxamide-amino-triazole; carboxyamidotriazole; CaRest M3;
CARN 700; cartilage derived inhibitor; carzelesin; casein kinase inhibitors (ICOS);
castanospermine; cecropin B; cetrorelix; chlorlns; chloroquinoxaline sulfonamide; cicaprost;
cis-porphyrin; clomifene analogues; clotrimazole; collismycin A; collismycin B;
combretastatin A4; combretastatin analogue; conagenin; crambescidin 816; crisnatol;
cryptophycin 8; cryptophycin A derivatives; curacin A; cyclopentanthraquinones;
cycloplatam; cypemycin; cytolytic factor; cytostatin; dacliximab; decitabine;
dehydrodidemnin B; deslorelin; dexamethasone; dexifosfamide; dexrazoxane; dexverapamil;
diaziquone; didemnin B; didox; diethylnorspermine; dihydro-5-azacytidine; dihydrotaxol,
dioxamycin; diphenyl spiromustine; docosanol; dolasetron; doxifluridine; droloxifene;
dronabinol; duocarrnycin SA; ebselen; ecomustine; edelfosine; edrecolomab; eflornithine;
elemene; emitefur; epristeride; estramustine analogue; estrogen agonists; estrogen antagonists;
etanidazole; exemestane; fadrozole; fazarabine; fenretinide; filgrastim; finasteride;
flavopiridol; flezelastine; fluasterone; fluorodaunorunicin hydrochloride; forfenimex;
formestane; fostriecin; fotemustine; gadolinium texaphyrin; gallium nitrate; galocitabine;
ganirelix; gelatinase inhibitors; glutathione inhibitors; HMG CoA reductase inhibitors (e.g.,
atorvastatin, cerivastatin, fluvastatin, lescol, lupitor, lovastatin, rosuvastatin, and simvastatin);
hepsulfam; heregulin; hexamethylene bisacetamide; hypericin; ibandronic acid; idoxifene;
idramantone; ilmofosine; ilomastat; imidazoacridones; imiquimod; insulin-like growth factor-
1 receptor inhibitor; interferon agonists; interferons; interleukins; iobenguane;
iododoxorubicin; ipomeanol, 4- iroplact; irsogladine; isobengazole; isohomohalicondrin B;
itasetron; jasplakinolide; kahalalide F; lamellarin-N triacetate; lanreotide; leinamycin;
lenograstim; lentinan sulfate; leptolstatin; letrozole; leuprolide and, estrogen, and
progesterone; leuprorelin; levamisole; LFA-3TIP (Biogen, Cambridge, MA; International
Publication No. WO 93/0686 and U.S. Patent No. 6,162,432); liarozole; linear polyamine
analogue; lipophilic disaccharide peptide; lipophilic platinum compounds; lissoclinamide 7;
lobaplatin; lombricine; lometrexol; lonidamine; losoxantrone; lovastatin; loxoribine;
lurtotecan; lutetium texaphyrin; lysofylline; lytic peptides; maitansine; mannostatin A;
marimastat; masoprocol; matrilysin inhibitors; matrix metal Ioproteinase inhibitors;
menogaril; merbarone; meterelin; metoclopramide; MIF inhibitor; mifepristone; miltefosine;
mirimostim; mismatched double stranded RNA; mitoguazone; mitolactol; mitonafide;
mitotoxin fibroblast growth factor-saporin; mofarotene; molgramostim; monophosphoryl lipid
A+myobacterium cell wall sk; mopidamol; multiple drug resistance gene inhibitor; multiple
tumor suppressor 1 -based therapy; mustard anticancer agent; mycaperoxide B; mycobacterial
cell wall extract; myriaporone; N-acetyldinaline; N-substituted benzamides; nafarelin;
nagrestip; naloxone+pentazocine; napavin; naphterpin; nartograstim; nedaplatin; nemorubicin;
neridronic acid; nilutamide; nisamycin; nitric oxide modulators; nitroxide antioxidant;
nitrullyn; O6-benzylguanine; octreotide; okicenone; oligonucleotides; onapristone; oracin; oral
cytokine inducer; ormaplatin; osaterone; oxaunomycin; paclitaxel; paclitaxel analogues;
paclitaxel derivatives; palauamine; palmitoylrhizoxin; pamidronic acid; panaxytriol;
panomifene; parabactin; pazelliptine; peldesine; pentosan polysulfate sodium; pentrozole;
perflubron; perfosfamide; perillyl alcohol; phenazinomycin; phenylacetate; phosphatase
inhibitors; picibanil; pilocaine hydrochloride; pirarubicin; piritrexim; placetin A; placetin B;
platinum complex; platinum compounds; platinum-triamine complex; porftmer sodium;
porfiromycin; prednisone; propyl bis-acridone; prostaglandin J2; proteasome inhibitors;
protein A-based immune modulator; protein kinase C inhibitors, microalgal; protein tyrosine
phosphatase inhibitors; purine nucleoside phosphorylase inhibitors; purpurins;
pyrazoloacridine; pyridoxylated hemoglobin polyoxyethylene conjugate; raf antagonists;
raltitrexed; ramosetron; ras farnesyl protein transferase inhibitors; ras inhibitors; ras-GAP
inhibitor; retelliptine demethylated; rhenium Re 186 etidronate; rhizoxin; RII retinamide;
rogletimide; rohitukine; romurtide; roquinimex; rubiginone Bl; ruboxyl; safingol; saintopin;
SarCNU; sarcophytol A; sargramostim; Sdi 1 mimetics; semustine; senescence derived
inhibitor 1; sense oligonucleotides; signal transduction inhibitors; signal transduction
modulators; gamma secretase inhibitors, sizofiran; sobuzoxane; sodium borocaptate; sodium
phenylacetate; solverol; sonermin; sparfosic acid; spicamycin D; spiromustine; splenopentin;
spongistatin 1; squalamine; stem cell inhibitor; stem-cell division inhibitors; stipiamide;
stromelysin inhibitors; sulfinosine; superactive vasoactive intestinal peptide antagonist;
suradista; suramin; swainsonine; synthetic glycosaminoglycans; tallimustine; leucovorin;
tamoxifen methiodide; tauromustine; tazarotene; tecogalan sodium; tegafur; tellurapyrylium;
telomerase inhibitors; temoporfin; tetrachlorodecaoxide; tetrazomine; thaliblastine;
thiocoraline; thrombopoietin; thrombopoietin mimetic; thymalfasin; thymopoietin receptor
agonist; thymotrinan; tin ethyl etiopurpurin; tirapazamine; titanocene bichloride; topsentin;
toremifene; totipotent stem cell factor; translation inhibitors; triacetyluridine; triciribine;
trimetrexate; triptorelin; tropisetron; turosteride; tyrosine kinase inhibitors; tyrphostins; UBC
inhibitors; ubenimex; urokinase receptor antagonists; vapreotide; variolin B; vector system,
erythrocyte gene therapy; thalidomide; velaresol; veramine; verdins; verteporfin; vinxaltine;
vorozole; zanoterone; zeniplatin; zilascorb; and zinostatin stimalamer.
In accordance with the present invention, the antigen binding molecule comprising a Fc region
or a modified Fc region having enhanced Fc effector function is preferably administered to a
patient by a parenteral route of administration. Parenteral administration includes any route of
administration that is not through the alimentary canal (that is, not enteral), including
administration by injection, infusion and the like. Administration by injection includes, by
way of example, into a vein (intravenous), an artery (intraarterial), a muscle (intramuscular)
and under the skin (subcutaneous). The antigen binding molecule may also be administered in
a depot or slow release formulation, for example, subcutaneously, intradermally or
intramuscularly, in a dosage which is sufficient to obtain the desired pharmacological effect.
In one embodiment of the invention, the antigen binding molecule comprises a modified Fc
region, more particularly a Fc region which has been modified to provide enhanced effector
functions, such as enhanced binding affinity to Fc receptors, antibody-dependent cellular
cytotoxicity (ADCC) and complement-dependent cytotoxicity (CDC). For the IgG class of
antibodies, these effector functions are governed by engagement of the Fc region with a family
of receptors referred to as the Fcy receptors (FcyRs) which are expressed on a variety of
immune cells. Formation of the Fc/FcyR complex recruits these cells to sites of bound
antigen, typically resulting in signaling and subsequent immune responses. Methods for
optimizing the binding affinity of the FcyRs to the antibody Fc region in order to enhance the
effector functions, in particular to alter the ADCC and/or CDC activity relative to the "parent"
Fc region, are well known to persons skilled in the art. By way of example only, procedures
for the optimization of the binding affinity of a Fc region are described by Niwa et o/.34,
Lazar et a/.35, Shields et a/.36 and Desjarlais et a/37. These methods can include modification
of the Fc region of the antibody to enhance its interaction with relevant Fc receptors and
increase its potential to facilitate antibody-dependent cell-mediated cytotoxicity (ADCC) and
antibody-dependent cell-mediated phagocytosis (ADCP)34. Enhancements in ADCC activity
have also been described following the modification of the oligosaccharide covalently
attached to IgGl antibodies at the conserved Asn297 in the Fc region35'36. Other methods
include the use of cell lines which inherently produce antibodies with enhanced Fc effector
function (e.g. Duck embryonic derived stem cells for the production of viral vaccines,
WO/2008/129058; Recombinant protein production in avian EBX® cells, WO/2008/142124).
Methods for enhancing CDC activity can include isotype chimerism, in which portions of
IgG3 subclass are introduced into corresponding regions of IgG 1 subclass (e.g. Recombinant
antibody composition, US2007148165).
In another aspect, the present invention provides the use of an antigen binding molecule
comprising a Fc region or a modified Fc region having enhanced Fc effector function in, or in
the manufacture of a medicament for, the inhibition of leukemic stem cells expressing IL-3Ra
(CD123), wherein said antigen binding molecule binds selectively to IL-3Ra(CD123).
In this aspect, the invention also provides the use of an antigen binding molecule comprising a
Fc region or a modified Fc region having enhanced Fc effector function in, or in the
manufacture of a medicament for, the treatment of a hematologic cancer condition in a patient,
wherein said antigen binding molecule binds selectively to IL-3Ra(CD123).
In yet another aspect, the invention provides an agent for inhibition of leukemic stem cells
expressing IL-3Ra (CD 123), which comprises an antigen binding molecule comprising a Fc
region or a modified Fc region having enhanced Fc effector function, wherein said antigen
binding molecule binds selectively to the IL-3Ra (CD 123).
In this aspect, the invention also provides an agent for the treatment of a hematologic cancer
condition in a patient, which comprises an antigen binding molecule comprising a Fc region or
a modified Fc region having enhanced Fc effector function, wherein said antigen binding
molecule binds selectively to IL-3Ra(CD123).
The agent of this aspect of the invention may be a pharmaceutical composition comprising the
antigen binding molecule together with one or more pharmaceutically acceptable excipients
and/or diluents.
Compositions suitable for parenteral administration conveniently comprise a sterile aqueous
preparation of the active component which is preferably isotonic with the blood of the
recipient. This aqueous preparation may be formulated according to known methods using
suitable dispersing or wetting agents and suspending agents. The sterile injectable preparation
may also be a sterile injectable solution or suspension in a non-toxic parenterally-acceptable
diluent or solvent, for example as a solution in polyethylene glycol and lactic acid. Among
the acceptable vehicles and solvents that may be employed are water, Ringer's solution,
suitable carbohydrates (e.g. sucrose, maltose, trehalose, glucose) and isotonic sodium chloride
solution. In addition, sterile, fixed oils are conveniently employed as a solvent or suspending
medium. For this purpose, any bland fixed oil may be employed including synthetic mono- or
di-glycerides. In addition, fatty acids such as oleic acid find use in the preparation of
injectables.
The formulation of such therapeutic compositions is well known to persons skilled in this
field. Suitable pharmaceutically acceptable carriers and/or diluents include any and all
conventional solvents, dispersion media, fillers, solid carriers, aqueous solutions, coatings,
antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like. The
use of such media and agents for pharmaceutically active substances is well known in the art,
and it is described, by way of example, in Remington's Pharmaceutical Sciences, 18th Edition,
Mack Publishing Company, Pennsylvania, USA. Except insofar as any conventional media or
agent is incompatible with the active ingredient, use thereof in the pharmaceutical
compositions of the present invention is contemplated. Supplementary active ingredients can
also be incorporated into the compositions.
Throughout this specification and the claims which follow, unless the context requires
otherwise, the word "comprise", and or variations such as "comprises" or "comprising", will
be understood to imply the inclusion of a stated integer or step or group of integers or steps
but not the exclusion of any other integer or step or group of integers or steps.
The reference in this specification to any prior publication (or information derived from it), or
to any matter which is known, is not, and should not be taken as an acknowledgment or
admission or any form of suggestion that that prior publication (or information derived from
it) or known matter forms part of the common general knowledge in the field of Endeavour to
which this specification relates.
The present invention is further illustrated by the following non-limiting Examples:
EXAMPLE 1
This Example demonstrates the ability of MAb 7G3 to exploit the overt differences in CD 123
expression and function between AML-LSCs and HSCs. MAb 7G3 inhibits the IL-3 signaling
pathway and proliferation of primary AML cells. In addition, the homing and engraftment of
AML blasts in the NOD/SCID xenograft model is profoundly reduced by MAb 7G3, and LSC
function is inhibited.
METHODS
AML patient samples, normal hematopoietic cells, and cell lines
Apheresis product, bone marrow or peripheral blood samples were obtained from newly
diagnosed and relapsed patients with AML. Patient samples were collected after informed
consent according to institutional guidelines and studies were approved by the Royal Adelaide
Hospital Human Ethics Committee, Melbourne Health Human Research Ethics Committee,
Research Ethics Board of the University Health Network, and the South Eastern Sydney &
Illawarra Area Health Service Human Research Ethics Committee. Diagnosis was made using
cytomorphology, cytogenetics, leukocyte antigen expression and evaluated according to the
French-American-British (FAB) classification. Mononuclear cells were enriched by
Lymphoprep or Ficoll density gradient separation and frozen in liquid nitrogen. Human cord
blood and BM cells were obtained from full-term deliveries or consenting patients receiving
hip replacement surgery or commercially from Cambrex (US), respectively, and processed as
previously described38.
Proliferation assays
AML cell growth responses to IL-3 or GM-CSF were measured by [3H]-thymidine assay as
previously described39. Briefly, 2 x 104 mononuclear cells per well .in 96 well plates were
stimulated with IL-3 (1 nM) or GM-CSF (O.lnM) in the presence of 0.001-10 nM 7G3 or
isotype-matched control BM4 (IgG2a) in 200 µl IMDM + 10% Heat Inactivated Fetal Calf
Serum (HI-FCS) (Hyclone, Utah) for 48 hours at 37°C, 5% CO2 with 0.5 µCi of 3H-thymidine
(MP Biomedicals, NSW, Australia) added for the last 6 hours of culture. Cells were deposited
onto glass fiber paper using a Packard Filtermate cell harvester (Perkin Elmer, Victoria,
Australia) and counted using a Top Count (Perkin Elmer). All cytokines and antibodies were
obtained commercially (R&D Systems, Minneapolis, MN) or supplied by CSL Limited
(Melbourne, Australia).
Cytokine signaling
Phosphorylation of signaling proteins was detected by immunoprecipitation and immunoblots.
TF-l cells and AML MNC cells were washed and rendered quiescent in IMDM medium with
0.5% HI-FCS (Hyclone, Utah) or with 0.5% human albumin (CSL, Melbourne, Australia) in
the absence of growth factors for 18 hours. One hundred million cells were incubated with
IgG2a (100 nM), 9F5, 6H6 (non-blocking anti-CD123 antibodies), or 7G3 (0.0001 - 100 nM)
for 30 min on ice, and then stimulated with 50 ng/mL IL-3 for 15 min at 37°C. Cells were
lysed in NP-40 lysis buffer40 and human ß (CD131) was immunoprecipitated using 1C1 and
8E4 antibodies conjugated to Sepharose beads. Immunoprecipitates were subjected to SDS-
PAGE and immunoblotting as previously described41. Antibodies used to probe the
immunoblots were: 4G10, antiphosphotyrosine MAbs (Upstate Biotech, Lake Placid, NY);
anti-phospho-Akt Ser473 (Cell Signaling, Beverly, MA); and anti-phosphorylated signal
transducer and activator of transcription 5 (STAT-5) MAb (Zymed, San Francisco, CA). All
antibodies were used according to manufacturer's instructions. Signals were developed using
enhanced chemiluminescence (ECL;Amersham Pharmacia or West Dura from Pierce).
STAT-5 activation was also detected by intracellular FACS on leukemic cell lines M07e and
TF1, and primary AML cells. Cells were incubated in MEDM plus 10% FCS and 10 ng/mL of
huIL-3 (CSL, Melbourne, Australia) for 60 minutes, and fixed with BD Cytofix™ Buffer
(Becton-Dickinson) followed by methanol permeabilization. Cells were then stained with anti-
phosphoSTAT-5 (Becton-Dickinson) and analyzed using a FACSCalibur (Becton- Dickinson)
instrument.
Ex vivo antibody treatment
Thawed AML or normal hematopoietic cells were incubated with control IgG2a or 7G3 (10
µg/mL) for 2 hours in X-VIVO 10 (Cambrex BioScience) supplemented with 15-20% BIT
(StemCell Technologies, Vancouver, BC Canada)) at 37DC before intravenous transplantation
into sub-lethally irradiated NOD/SCID mice for repopulating assays (see below). Engraftment
was measured at 4-10 weeks at 2 different time points.
In vivo antibody treatment of AML
For in vivo testing, control IgG2a or 7G3 (300 - 500 ug per injection) were injected
intraperitoneally (i.p.) into mice 3 times a week with schedules described in the legends to
each figure. To investigate possible synergistic effects of 7G3 with cytarabine (Ara-C), 35
days post-transplantation, 500 µg of antibodies were injected once a day for 3 consecutive
days followed by i.p. injection of Ara-C at 40 mg/kg/d for 5 consecutive days. Antibody
treatments resumed at 500 µg per injection 3 times a week for another 4 weeks following
which engraftment was measured 3 days after the last injection of antibody.
Xenotranspiantion of human ceils into NOD/SCID mice
Animal studies were performed under the institutional guidelines approved by the University
Health Network/Princess Margaret Hospital Animal Care Committee or the Animal Care and
Ethics Committee of the University of New South Wales. Transplantation of human cells into
NOD/SCID mice was performed as previously described38. Briefly, all mice received sublethal
irradiation (250 - 350 cGy) 24 hours before intravenous (i.v.) or intrafemoral transplantation
with 5-10 million human cells per mouse. Anti-CD 122 antibody was purified from the
hybridoma cell line TM-/31 (generously provided by Prof. T. Tanaka, Hyogo University of
Health Sciences)42 and 200 µg was injected i.p. into mice immediately after irradiation for
natural killer cell depletion as previously described43. Similarly, 8 million normal bone
marrow cells, or 1 million sorted CD34+ normal bone marrow cells, or 3xlO5 lineage depleted
CD34+ normal cord blood cells were transplanted i.v. per mouse. Engraftment levels of human
AML and normal hematopoietic cells in the murine bone marrow, peripheral blood, liver and
spleen were evaluated based on the percentage of hCD45+ cells by flow cytometry. To
measure 7G3 effects on LSC activity, secondary transplantations were also performed by i.v.
transplantation of identical numbers of human cells (9 million cells/mouse) isolated from the
bone marrow of previously engrafted mice in the IgG2a or 7G3 treatment groups.
Homing assay
Identical numbers of human cells from primary patient samples or harvested from engrafted
mice were injected i.v. into sublethally irradiated NOD/SCID mice. Sixteen-twenty-four
hours after injection, mononucleated cells from bone marrow, spleen, and peripheral blood of
the recipient mice were analyzed by flow cytometry for human cells using 5x104 - lx00s
collected events. Homing efficiency of human cells into the mouse tissues was determined by
measuring the % of the injected cells found in specific organs, calculated by the formula: % of
huCD45+ cells assessed in the tissue x total number of cells in the specific tissue/total number
of injected human cells x 10044"46.
Cell staining and flow cytometry
Cells from the bone marrow, spleen, liver and peripheral blood of treated mice were stained
with fluorescein isothiocyanate (FITC)-conjugated antimurine and phycoerythrin-cyanin 5
(PC5, Beckman-Coulter) or allophycocyanin (APC, BioLegend and Becton-Dickinson)
conjugated anti-human antibodies, as previously described2. CD 123 expression was measured
with phycoerythrin (PE) conjugated anti-human CD 123 antibody (clone 9F5). 7G3 binding on
human cells recovered from 7G3 treated mice was measured by staining duplicate samples
with 9F5-PE or 7G3-PE, since the two clones bind to completely separate epitopes and
produce similar levels of fluorescence on untreated primary cells (data not shown). The level
of 7G3 binding was calculated by the formula: [(RFI of 9F5-PE detected CD 123) - (RFI of
7G3-PE detected CD 123)] + (RFI of 9F5-PE detected CD 123) x 100. Immunophenotype and
' stem cell population were identified using a range of anti-human antibodies: anti-CD 15-FITC,
anti-CD14 conjugated to PE, anti-CD19-PE, anti-CD33-PE, anti-CD34-FITC or anti-CD34-
PC5, and anti-CD38-PE or PE-Cyanine 7 (all antibodies from Becton-Dickinson unless
otherwise stated). Isotype control antibodies were used to exclude 99.9% of negative cells, and
cells were analyzed using FACScan or FACS Calibur flow cytometers (Becton-Dickinson).
Statistical analysis
Data are presented as the mean ± s.e.m. The significance of the differences between groups
was determined by using Student's t-test.
RESULTS
Monoclonal antibody 7G3 blocks IL-3-mediated signaling in IL-3-dependent cell lines
and primary AML cells.
The monoclonal antibody 7G3, raised against the IL-3Receptor asubunit (IL-3Ro; CD123),
has previously been shown to inhibit IL-3 binding to CD 123 as well as IL-3-mediated effects
in vitro, including proliferation of a leukemic cell line (TF-1), histamine release from human
basophils, and endothelial cell activation33. Consistent with these findings it has now been
found that MAb 7G3 inhibited intracellular signaling in TF-1 cells and primary human AML
cells. Stimulation of growth factor-deprived TF-1 cells with IL-3 (1 nM) resulted in tyrosine
phosphorylation of the receptor 0 subunit (CD 131), and activation of the STAT-5 and Akt
downstream signaling molecules that play a role in cell proliferation and survival (Fig. 6a).
CD131 tyrosine phosphorylation, and STAT-5 and Akt activation, were inhibited by
incubation of cells with 7G3 at 1 nM, further reduced at 10 nM, and completely blocked at
100 nM concentration consistent with a reported Kd of 900 pM for 7G333. Two poorly
neutralizing antibodies to CD 123 that do not block IL-3 binding, 9F5 and 6H6, were
ineffective at inhibiting IL-3-mediated signaling (Fig. 6a). The inhibition of IL-3-stimulated
phosphorylation of STAT-5 by 7G3 in IL-3-dependent leukemic cell lines TF-1 and M07e
was also demonstrated by a flow cytometric assay (Fig. 6b). Importantly, MAb 7G3
selectively inhibited the IL-3-dependent phosphorylation of tyrosine 577 of CD131, a signal
involved in promoting cell survival40, in primary AML cells in a concentration-dependent
manner (Fig. 6a). Similarly, 7G3 also reduced IL-3-stimulated STAT-5 phosphorylation in
primary AML cells, as measured by flow cytometry (Fig. 6b). This selective inhibition of IL-
3 signaling by MAb 7G3 is consistent with its ability to block IL-3 binding and raised the
important question of whether the leukemic stem cell, previously reported not to express
CD131 (/3 chain)25, could be signaling exclusively through CD 123 (a chain).
CD123 (IL-3Receptor a chain) is co-expressed with CD131 (receptor /3 chain) on AML
leukemic stem cells
Overexpression of CD 123 on CD34+/CD38" cells from AML patients has been widely
reported17'21 and has been proposed as a marker of leukemic CD34+/CD38' stem cells (LSCs)
in some studies24'25. In the current study, CD123 expression on multiple AML samples was
measured independently at 2 different laboratories. CD123 expression on AML CD34+/CD38'
cells (RFI 67.7 ± 24.2, n = 9) was significantly higher than that on normal hematopoietic
CD34+/CD38' cells (RFI 17.1 ± 8.6, n = 4, P = 0.21, (data summarized in Table 1 below),
consistent with other reports I7-2l'24,25. This overexpression appeared to be selective, in that the
GM-CSF receptor a chain (CD116) was not expressed in the equivalent population in AML
samples as measured by flow cytometry. Instead, the GM-CSF receptor a chain was
abundantly expressed on CD34* blast cells (data not shown). Furthermore, flow cytometry and
PCR analyses demonstrated that CD34+cells that express CD 123 also express CD131 (data not
shown) suggesting that signal transduction occurs through the classical heterdimeric IL-
3Receptor and not through CD 123 alone, which is also supported by the CD131
phosphorylation data (Fig. la). Moreover, the difference in CD 123 expression levels between
normal and malignant CD34+/CD38'progenitor cells provides the basis for 7G3 to selectively
target LSC but not normal hematopoietic stem cells.
7G3 inhibits spontaneous and IL-3-induced proliferation of primary AML samples in
vitro
The ability of 7G3 to inhibit IL-3-induced proliferation was investigated using 38 primary
AML patient samples. Representative plots for 3 primary samples are shown in Fig. lb-d.
7G3 inhibited IL-3-induced proliferation in 32/35samples (Fig. le), but not GM-CSF-
stimulated growth (Fig. lb-d). In the absence of exogenously added growth factors, 7G3 also
inhibited the growth of cells from some AML samples. In 9 of the primary samples tested, the
presence of 7G3 and IL-3 reduced the proliferation to -60% of endogenous levels with a range
of 50-75% (Fig. le), suggesting an autocrine pathway. The poorly blocking 6H6 antibody did
not inhibit IL-3-induced proliferation (data not shown). The Kd of the 7G3 antibody (approx
900pM)33 fitted well with the concentrations required to inhibit proliferation (Fig. 1 b-d).
Overall, 7G3 was effective in inhibiting IL-3-mediated growth in the majority of primary
AML samples, as well as spontaneous growth (no IL-3 added), suggesting that either some
AML cells constitutively produce IL-3 or that 7G3 triggers a negative signal in these cells.
Pretreatment with 7G3 inhibits AML but not normal hematopoietic cell engraftment in
NOD/SCID mice
To assess the effects of 7G3 on the ability of normal and malignant cells to repopulate in
immune-deficient mice, primary AML and normal bone marrow (NBM) or umbilical cord
blood (CB) cells were incubated ex vivo with 7G3 or irrelevant IgG2a (10 µg/mL, 2 h) and
transplanted into sub-lethally irradiated NOD/SCID mice. Ex vivo 7G3 incubation markedly
reduced the engraftment of 9/10 primary AML samples whose controls showed evidence of
bone marrow engraftment at 4-8 weeks post-inoculation (mean 89.7 ± 1.9% reduction relative
to controls, P = 0.013, Fig. 2a and Table 1). This reduction in engraftment was sustained in
6/7 of the samples when assessed between 8 and 12 weeks following inoculation. In contrast,
at 4-11 weeks post-inoculation, 7G3 had no significant inhibitory effects on the engraftment of
3/5 normal samples, and while small effects against two NBMs reached statistical
significance, the inhibition was much less marked compared to AML cells (Fig. 2b and Table
1). Ex vivo 7G3 treatment reduced normal hematopoietic cell engraftment by an average of
23.5 ± 8.9% (P - 0.078) relative to IgG2a controls. Multi-lineage engraftment for 3 of the
' NBMs was measured by monitoring CD33, CD 19, and CD3 expression, and no significant
differences were found between the IgG2a and 7G3 treatment groups (data not shown).
Ex vivo 7G3 treatment inhibited to a similar extent the engraftment of AML-8 harvested at
both diagnosis and relapse, indicating that both diagnosis and relapse samples may have
comparable sensitivity to 7G3 treatment. AML-5 was the only AML sample in which
engraftment was not reduced by ex vivo 7G3 treatment, which could be attributed to this
sample exhibiting a high proportion of LSC (CD34+/CD38") and the lowest CD 123 expression
of all the AML samples evaluated (Table 1). Overall, these results demonstrate the reduced
sensitivity of normal hematopoietic stem cells to 7G3 treatment in comparison with AML
LSC.
The reduction in AML engraftment caused by ex vivo 7G3 treatment was also associated with
improved survival. Mice transplanted with IgG2a or 7G3 treated AML-9 cells exhibited
median survival of 11.5 and 24 weeks, respectively (P = 0.0188, n = 10 for each group, Fig.
2c), with 40% of the 7G3 group surviving beyond the end of the experiment (25 weeks), in
contrast with the control group in which no mice survived beyond 20 weeks.
The inhibitory effect of ex vivo 7G3 treatment on engraftment of AML or normal
hematopoietic cells was inversely associated with the intensity of CD 123 expression on the
CD34+/CD38* population, with a significant relationship (Fig. 7; R = -0.68, P = 0.0051). A
binary pattern was apparent, demonstrating that for those AML samples where engraftment
was severely inhibited by 7G3 the CD 123 expression was generally high. Conversely, the
single AML sample (AML-5), along with the normal hematopoietic samples, for which
engraftment was not as markedly affected by 7G3, generally expressed lower levels of CD 123.
7G3 inhibits AML homing capacity in NOD/SCID mice
To determine the effects of 7G3 on the ability of intravenously-inoculated AML cells to home
to the bone marrow and spleen, ex v/vo-treated AML-8-rel and AML-9 cells were transplanted
and mice were euthanased and examined 24 h later. 7G3 significantly diminished homing to
the bone marrow to between 46-93% compared with isotype-treated controls (P < 0.05), while
homing to the spleen was reduced to 35 to 90% of control but the difference was not
statistically significant (P >0.05) (Fig. 2d). The leukemic cells that resided in the bone marrow
and spleen at 24 hours following inoculation were principally CD34+ primitive cells, and
while 7G3 reduced the number of cells in the bone marrow, it did not alter the cell surface
phenotype of the residing cells (data not shown).
To further characterize the effects of 7G3 on AML homing to the bone marrow, AML-8-rel
cells were exposed to 7G3 or isotype control antibodies, and subsequently transplanted via the
tail-vein (IV) or directly into the right femur (RF), and the animals euthanased 5 weeks
thereafter. Fig. 2e shows that intra-femoral inoculation attenuated the inhibitory effects of 7G3
on engraftment compared with IV inoculated, although 7G3 remained effective at significantly
reducing engraftment in both the injected femur and the non-injected femur. In order to more
directly demonstrate 7G3 inhibition of AML-LSCs, we investigated the impact of 7G3
treatment on CD34+CD38' cells since AML-LSCs (as defined by their ability to recapitulate
the human disease in NOD/SCID mice) are significantly enriched in this fraction2'3. The
number of CD34+CD38' cells from AML-8-rel and AML-9 homing to the BM was reduced by
ex vivo 7G3 treatment to 8.4 ± 0.018% and 12.0 ± 4.3% of control, respectively (P = 0.16 and
0.013, Fig. 20- Similarly, the number of AML-9 CD34+CD38" cells homing to the spleen was
reduced to 3.8 ± 1.5% of control (P = 0.019). To further confirm this finding, the homing
experiment was repeated with CD34+CD38' cells sorted from AML-9 and then treated ex vivo
with either IgG2a or 7G3 before injecting into NOD/SCID mice. The homing efficiency of
human cells in the 7G3 treated group was reduced to 7.8 ± 1.7% of IgG2a controls in the BM
(P = 0.0019) and 11.2 ± 0.84% in the spleen (P = 0.09) (Fig. 2g). Therefore, CD 123 appears
to play an important role in the homing of AML NOD/SCID leukemia-initiating cells (SL-ICs)
to their supportive microenvironment, as well as establishment and dissemination of the
disease in NOD/SCID mice.
Early administration of 7G3 reduces AML engraftment in NOD/SCID mice
To determine whether 7G3 treatment of NOD/SCID mice affected AML cell engraftment,
mice were administered a single intraperitoneal injection of 7G3 or isotype control antibodies
(300 ug) followed by IV transplantation of AML-1 cells 6 hours later. 7G3 treatment almost
completely ablated engraftment in the bone marrow, to 1.3 ± 0.9% of control at 5 weeks post-
transplantation (P = 0.0006, n=5, Fig. 3a).
The efficacy of 7G3 in controlling the progression of AML in NOD/SCID mice was also
examined by initiating treatments either 24 h or 4 days post-transplantation, presumably
allowing the SL-IC to home to the bone marrow microenvironment before commencement of
treatments44"46. When treatment was initiated 24 hours post-transplantation, engraftment was
reduced in 2/3 AML samples. With this treatment regimen of 4 doses administered every other
day, engraftment of AML-2 and -3 was reduced to 41.1 ± 27.1% (P = 0.096) and 39.6 ± 10.0%
(P = 0.026) of controls, respectively, while engraftment of AML-1 was not affected (Fig. 3b).
Despite the relatively modest effects of 7G3 in both post-transplantation treatment regimens,
7G3 coating on AML cells harvested from the mouse bone marrow was clearly evident (data
not shown). Moreover, 7G3 treatment decreased CD 123 expression on AML-1 cells in any
treatment regimen tested. For illustration, 7G3 treatment commencing 4 days post-
transplantation decreased CD 123 expression of AML-1 harvested from the BM to 51.3 ± 4.0%
of control (Fig. 3c, P < 0.0001), as assessed using the 9F5 antibody. In the same experiment,
7G3 also reduced the dissemination of AML-1 to mouse peripheral blood and spleen to 27.8 ±
7.5% (P = 0.0029) and 23.5 ± 5.3% (P = 0.0009) of control, respectively (Fig. 3d).
7G3 can reduce the burden of established AML disease in NOD/SCID mice
While the primary aim of this study was to test the effect of targeting CD 123 on AML stem
cells, the ability of 7G3 to exhibit any single agent therapeutic activity on established
leukemic disease, above and beyond its effects on leukemic stem cell engraftment was
evaluated by initiating continuous 7G3 or control IgG2a treatments 28 days post-
transplantation in an established disease model, and continuing treatment until the time of
sacrifice. There was variation in response to 7G3 treatment in this model between patient
samples likely reflective of the heterogeneity of AML seen clinically. A significant reduction
in the BM burden of AML was seen in 2 of 5 samples (shown in Figs. 3e and f). AML-2
responded to 7G3 with a significant reduction in BM engraftment at 9 and 14 weeks post-
transplantation (Fig. 3e), while treatment of mice with only 4 doses of 7G3 over 8 days
significantly reduced the engraftment of AML-1 to 18.9 ± 4.1% (P = 0.001, Fig. 3f) of IgG2a
control. Moreover, while a number of AML samples did not have a significant reduction in
leukemic burden in the BM with initiation of 7G3 treatment at either 4 or 28 days post
transplantation, it was generally observed that the leukemic burden in the peripheral
hematopoietic organs (spleen, peripheral blood, and liver) was lower in the 7G3 treated group
(Fig. 3d and data not shown). Together, these data suggest that 7G3 is biologically active in
vivo and can repress the growth of AML in the NOD/SCID model when used as a single
agent.
7G3 targets SL-IC self renewal capability
The serial transplantation experiments address an important question for all cancer stem cell
(CSC)-directed therapies and provide evidence that the CSC is actually being targeted in vivo.
In the case of AML, it is known that when AML-LSCs repopulate primary NOD/SCID mice
they must self-renew3; self-renewal is a key property of all stem cells and is best assessed by
secondary transplantation.
To examine whether 7G3 can also be used to target the LSC with self-renewal ability as an
adjuvant to conventional therapy, which targets the more rapidly proliferating AML blasts,
7G3 or IgG2a were combined with cytarabine (Ara-C) and their effect on SL-IC and leukemic
burden determined. At 35 days post transplantation with AML-10 cells, mice were treated
with 7G3 or IgG2a control (500 µg/d) each day for 3 days followed by Ara-C (40 mg/kg/d) for
5 consecutive days. Following the Ara-C treatments, 7G3 was administered for another 4
weeks. Leukemic engraftment in the bone marrow and spleen of the mice treated with 7G3
and Ara-C was not decreased compared to mice treated with IgG2a and Ara-C (Fig. 4 Part
la). However, when cells were harvested from the bone marrows of treated mice and equal
numbers of human cells transplanted into secondary recipient mice, the homing of cells
harvested from 7G3/Ara-C-treated donor mice to the bone marrow and spleen was inhibited to
33.6 ± 5.0% (P = 0.014) and 10.9 ± 4.6% (P = 0.15) of IgG2A/Ara-C-treated controls,
respectively (Fig. 4 Part Ib). Moreover, repopulation of the bone marrow and spleen of
secondary recipient mice was also reduced by 7G3/Ara-C to 21.0 ± 15.2% (P = 0.024) and
35.8 ± 31.8% (P = 0.31) of IgG2a/Ara-C-treated controls, respectively (Fig. 4 Part Ic). While
the proportion of CD34+/CD38' LSCs appearing in the bone marrow of donor mice was not
decreased by 7G3/Ara-C relative to IgG2a/Ara-C treatment (data not shown), Fig. 4 Part Id
shows a significant decrease in this cell population in the bone marrow and spleen of
secondary recipient mice from 7G3/Ara-C donors compared with donors treated with
IgG2a/Ara-C. These data demonstrate that in vivo 7G3 administration specifically targets
AML-LSC in NOD/SCID mice, resulting in decreased homing and engraftment in secondary
recipient mice.
To establish whether 7G3 can act as a single agent, serial transplantation was performed
following in vivo 7G3 treatment in the absence of Ara-C. As shown in Fig. 4 Part II A, while
10 weeks of 7G3 treatment did not overtly decrease the engraftment of AML-10 in the BM or
spleen of primary engrafted mice, the AML cells harvested from 7G3-treated mice had
significantly impaired homing ability to the BM (28.2 ± 2.9%, P = 0.0083) and spleen (18.3 ±
4.8%, P = 0.0021) of secondary recipient mice compared with IgG2a-treated controls (Fig. 4
Part II B). The repopulation ability was also significantly impaired: while 8 of 9 secondary
recipient mice transplanted with untreated control cells were engrafted, only 3 of 8 mice
inoculated with cells from 7G3-treated mice showed evidence of engraftment (Fig. 4 Part II
C). The mean engraftment level in the 7G3 treated mice was significantly reduced compared
with IgG2a treated controls (BM, 34.6 ± 18.6%, P = 0.039; spleen, 33.7 ± 20.4%, P = 0.19)
(Fig. 4 Part II C). This patient sample had a high level of CD34+CD38" primitive cells that
' was not decreased in the 7G3-treated primary mice. However, there was a significant decrease
of this primitive cell population in the BM of secondary recipient mice transplanted from 7G3-
treated donors compared with donors treated with IgG2a (56.6 ± 15.0% of control, P = 0.031)
(Fig. 4 Part II D). Similar results were obtained in an independent experiment with AML-9
cells, showing that 7G3 caused a reduction in the mean level of engraftment to 19.3% ± 9.8%
of control (Fig. 4 Part III).
Collectively, combining data from all 3 independent experiments depicted in Figure 4, only 1
of 27 (3.7%) secondary mice was not engrafted by the cells harvested from IgG2a or IgG2a
plus Ara-C treated control mice. By contrast, 11 of 23 (48%) secondary mice could not be
' engrafted by the cells harvested from 7G3 or 7G3 plus Ara-C treated mice. These results
demonstrate that in vivo 7G3 administration specifically targets AML-LSCs in NOD/SCID
mice, resulting in decreased homing and engraftment in secondary recipients.
CD122* NK cells contribute to 7G3-mediated inhibition of AML repopulation in
NOD/SCID mice
NK cells, macrophages, neutrophils and dendritic cells are among the effector cells in the
immune system that facilitate Fc-dependent, antibody-dependent cellular cytotoxicity
(ADCC). Their contribution to the ability of 7G3 to inhibit engraftment of AML was assessed
by injecting a monoclonal antibody against murine 1L-2R /3-chain (IL-2R/3) also known as
CD 122 to irradiated NOD/SCID mice before leukemic cell transplantation of ex vivo 7G3-
treated AML cells. IL-2R/ß is widely expressed on NK cells, T cells, and macrophages and
blocking IL-2R/ß by mAb can improve the engraftment of human hematopoietic cells in the
NOD/SCID xenotransplant system.
At 4 weeks post-transplantation, leukemic engraftment in the NK cell depleted mice
transplanted with AML-8-rel cells treated ex vivo with IgG2a control was increased to 113.3 ±
2.8% (P = 0.023) of non-depleted mice (Fig. 5a), suggesting that CD122+ NK cells
moderately decrease AML engraftment in NOD/SCID mice. Depletion of CD122+ cells also
partially, but significantly, attenuated the ability of 7G3 to reduce engraftment of AML cells,
suggesting that CD 122 positive cells mediate, in part, the 7G3 inhibitory effect (Fig. 5a). In
contrast to the effects.on NOD/SCID repopulation, 7G3 still strongly inhibited the homing of
leukemic cells by more than 85% of IgG control in the anti-CD 122 treated mice (Fig. 5b).
These results indicate that the ability of 7G3 to inhibit engraftment and homing of AML cells
in NOD/SCID mice is mediated by at least 2 cooperative pathways: ADCC caused by NK
and/or other CD122-dependent cells; and, specific inhibitory effects of 7G3 blocking IL-
3/CD123 signaling pathways.
DISCUSSION
The consistent overexpression of CD 123 on AML blasts and LSCs provides a promising
therapeutic target for the treatment of AML either alone or in combination with established
therapies, especially for relapse or minimal residual disease. Several therapeutics based on
CD 123 have been devised and have demonstrated anti-AML effects in various assays 23-47'49.
In the current study, 7G3 has been demonstrated to specifically and consistently inhibit IL-3
mediated signaling pathways and subsequent induced proliferation of different AML samples
in vitro. Moreover, 7G3 treatment profoundly reduced AML-LSC engraftment and improved
mouse survival. Mice with pre-established disease showed reduced AML burden in the BM
and periphery and impaired secondary transplantation upon treatment establishing that AML-
LSCs in treated mice were directly targeted. These results provide clear validation for
therapeutic anti-CD 123 monoclonal antibody targeting of AML-LSCs, and for translation of
in vivo preclinical research findings towards a potential clinical application.
EXAMPLE 2
CSL360 is a chimeric antibody obtained by grafting the light variable and heavy variable
regions of the mouse monoclonal antibody 7G3 onto a human IgGl constant region. Like
7G3, CSL360 binds to CD123 (human IL-3Ra) with high affinity, competes with IL-3 for
binding to the receptor and blocks its biological activities.33 The mostly human chimeric
antibody CSL360, can thus potentially also be used to target and eliminate AML LSC cells.
CSL360 also has the advantage of potential utility as a human therapeutic agent by virtue of
its human IgGl Fc region which would be able to initiate effector activity in a human setting
Moreover, it is likely that in humans it would show reduced clearance relative to the mouse
7G3 equivalent and be less likely to be immunogenic. The mechanisms of action of CSL360
in treatment of CD123 expressing leukemias may involve 1) inhibition of IL-3 signalling by
blocking IL-3 from binding to its receptor, 2) recruitment of complement after the antibody
has bound to a target cell and cause complement-dependent cytotoxicity (CDC), or 3)
recruitment of effector cells after the antibody has bound to a target cell and cause antibody
dependent cell cytotoxicity (ADCC).
Methods developed to study antibody dependent cell cytotoxicity (ADCC) are described
below, and can be categorised into methods which analyse (1) target cell population or (2)
effector cell population in the assay. Methods involved with analysis of target cells measure
target cell lysis or early apoptosis of target cells brought about by ADCC. Methods that
examine the effector population measure induction of membrane granules on effector cells
such as NK cells as a marker for NK cell-induced cell lysis.
Methods
Measuring ADCC using a 51Chromium release assay
The murine lymphoid cell line CTL-EN engineered to express CD 123 as described by Jenkins
et a/50 or freshly thawed leukemic cells (5x106) were incubated with 250^Ci of slCr-sodium
chromate for one hour at 37°C. Cells were washed three times with RPMI-10% FCS medium
to remove any free slCr-sodium chromate. Chromium labelled target cells were dispensed at
10,000 cells/well in round bottom 96-well plates. CSL360 or an isotype control antibody,
(MonoRho, recombinant anti-Rhesus D human immunoglobulin Gl), was added at 10/ig/mL.
Freshly isolated PBMC were added as effector cells at different ratios in triplicates and
incubated for four hours at 37°C in a 5% CO2 incubator. Total sample volume was 200/tL/
well. After the incubation period, plates were centrifuged for 5 minutes at 600xg, 100/iL of
supernatant removed and 51Cr released measured in a Wallace 7-counter.
Specific lysis was determined by using the formula, % lysis= 100x [(mean cpm with antibody-
mean spontaneous cpm)/(mean maximum cpm- mean spontaneous cpm)]. Spontaneous release
was obtained from samples that had target cells with no antibody and no effector cells.
Maximum release was determined from target cells treated with 1% (v/v) Triton X-100.
Measuring ADCC using a Calcein AM-labelled target cell assay
ADCC induced by CSL360 was measured by the method described by Neri et al 52. This
method involved labelling of target cells with Calcein AM instead of 51Chromium. Target
cells were incubated with 10µM Calcein AM (Invitrogen, cat.no.C3099) for 30 minutes at
37°C in a 5 % CO2 incubator. Labelled cells were washed to remove any free Calcein AM and
then dispensed in round bottom plates at 5000 cells per well. Effector cells were added at
different ratios. Relevant antibodies were added to a final concentration of 10 /ig/mL, cells
with no antibody serving as negative controls. Plates were incubated for 4 hours at 37°C in a 5
. % CO2 incubator. After the incubation period, plates were centrifuged at 600xg for 5 minutes.
100µL of supernatant was removed and fluorescence measured in an Envision microplate
reader (excitation filter 485nm, emission filter 535nm). Specific lysis was calculated by using
the formula, % lysis= lOOx [(mean fluorescence with antibody-mean spontaneous
fluorescence)/(mean maximum fluorescence- mean spontaneous fluorescence)]. Maximum
fluorescence was determined by the lysis of cells with 3% Extran and spontaneous lysis was
the fluorescence obtained with target cells without any antibody or effector cells.
Measuring ADCC as effector cell expression of membrane granule protein CD 107a as a
surrogate marker of cytolysis
Fischer et al51 demonstrated that expression levels of CD 107a, a membrane-associated lytic
granule protein, by NK cells correlates with target cell cytotoxicity. This method was used to
assess ADCC activity of CSL360. The method involved incubation of freshly isolated human
PBMC from a buffy coat with target cells. Target cells used were either CD 123-expressing
cell lines or primary human AML cells. Target cells were added to human PBMC at 1:1 ratio
in presence or absence of antibody. Nonspecific or spontaneous expression of CD 107a was
assessed with human PBMC without any antibody or target cells added. PE-Cy5 conjugated
CD107a monoclonal antibody (BD Pharmingen, cat. no. 555802) was added to all samples
and cells were incubated for three hours at 37°C in a 5% CO2 incubator. After the first hour of
incubation, Brefeldin A (BFA) was added. At the end of incubation, cells were washed and
stained with anti-CD56-PE (BD Pharmingen, cat. no. 347747) and anti-CD 16-FITC (BD
Pharmingen, cat.no. 555406) monoclonal antibodies. Cells were then analysed by flow
cytometry using a FACS Calibur and analysed (Flow Jo Software Tree Star, Inc.) for
CD56dimCD16+CD107a cells that represent NK cells expressing FcRyHIA receptor that have
expressed the membrane associated lytic granule protein.
Results
CSL360 induces ADCC in an AML sample and a CD123-expressing cell line as assessed
by a 51Chromium-reIease assay
Total uptake of 51Chromium by CTLEN cells were between 2000-1500cpm as compared to
only about 400-200cpm by AML cells as determined by maximum chromium release with
detergent lysis. 15% lysis of AML (SL) cells was observed with CSL360 at 100:1 ratio of
effector to target cells compared to 1.9% lysis with negative control antibody, MonoRho. 51%
lysis of CTLEN cells was observed with CSL360 at 100:1 ratio of effector to target cells
compared to 5% lysis with negative control antibody MonoRho (Table 2). These results
suggested that CTLEN cells were more susceptible to CSL360-mediated ADCC lysis than the
AML cells even though AML cells had higher levels of surface expression of CD 123.
CSL360 induces ADCC in AML samples and CD123-expressing cell lines as assessed by
CD 107a expression on effector NK cells
Figure 8 shows flow cytometer analyses demonstrating the induction of membrane lytic
granule, CD 107a on NK cells derived from mixing PBMC from a normal donor incubated
with an AML patient sample, RMH003 in the presence of CSL360 or isotype control
antibody. NK cells within this mixed population were gated from lymphocyte populations that
expressed CD56 (NK marker) and CD 16 (FcR-ylllA ). The data show that NK exposed to
AML cells coated with CSL360 demonstrated significantly elevated CD 107a (-39% CD 107a
positive cells in Fig. 8B) compared to NK from the same donor and patient samples incubated
with isotype control antibody (~3% CD107a positive cells in Fig. 8A). Induction of CD107a
on the donor NK cells is target cell-dependent since CD 107a was not detected if CSL360 was
added to effector cells in the absence of the target AML patient cells (Fig. 8D). Figure 9
shows data from the same experiment plotted as a histogram.
Data generated in a similar way as above from a number of cell lines engineered to express
human CD 123 (CTLEN, EL4) or human leukemic cell line expressing endogenous CD 123
(TF-1) and primary samples from leukemic patients as target cells incubated with effector
cells derived from up to 3 different donors are included in Table 3. The data are expressed as
percentages of NK cells that expressed CD 107a incubated with different samples in presence
of CSL360 or without added antibody. Two mouse cell lines expressing human CD123
induced CD 107a expression in NK cells in presence of CSL360. 4/8 primary leukemic
samples demonstrated CSL360-mediated expression of CD 107a on NK cells. RMH007
induced expression of CD 107a in NK cells even in absence of CSL360. RBH013 gave similar
results with PBMC from one donor, however, with a different donor CD 107a expression was
specific to CSL360 indicating donor-specific susceptibility to NK-mediated ADCC induced
by CSL360 in this case.
Six of the eight primary leukemic samples were examined for ADCC effects with different
donors as a source for effector cells. An important observation was that samples that were
susceptible to ADCC usually induced CD 107a in effector cells irrespective of the donor.
Similarly, samples that were resistant to ADCC also generally remained negative irrespective
of donor cells.
CSL360 induces ADCC in AML samples as assessed by a Calcein-AM release assay
Calcein released in the medium by lysed cells is an indicator of ADCC-mediated cell lysis.
Patients RMH003 and RMH008 showed susceptibility to ADCC in this assay whereas
RMH009, RMH010 and RBH013 appeared resistant to lysis (Table 4). All of these five
patients were tested for their susceptibility to CSL360-mediated ADCC in a NK cell CD 107a
expression assay with same effector cells as used for this assay and comparative results are
shown in Table 5. Status of ADCC in three out of six patients samples were in agreement with
Table 3. Surface expression of CD107a as a measure of ADCC activity.

a'b'c indicate that samples were tested for ADCC with different donors as a source for effector cells.
Table 4. Assessment of ADCC in Calcein release assay.

Table 5. Comparison of Flow cytometry based assays to lysis assays.

a These samples were tested for ADCC using CD 107a and Calcein release assays with same
effector cells for both assays.
* not done
Discussion
Through the use of several assays all acknowledged to measure ADCC activity, albeit with
varying sensitivity, it has been shown that CSL360 can induce ADCC responses in mouse cell
lines maintained in culture that express ectopic human CD 123. Importantly, CSL360 also was
able to induce an ADCC response against primary human AML patient samples in the
presence of functional effector cells from normal donors. This data suggests that in some
leukemic patients whose leukemic cells including LSC, express sufficient levels of CD 123
that CSL360 administered therapeutically may be able to induce ADCC-directed elimination
of the leukemic cells particularly if the patients retained some functional effector cells in their
circulation, for example such as those in remission or with minimal residual disease.
EXAMPLE 3
The ubiquitous expression of CD 123 on AML cells including LSC and the evidence
implicating IL-3 having an important role in the etiology of AML suggested that the ability to
block IL-3Ra function would be critical for any therapeutic activity of an antibody targeting
IL-3Ra such as 7G3. In this example, it is demonstrated somewhat surprisingly, that the
ability of 7G3 to inhibit the engraftment or repopulation of NOD/SCID mice by AML patient
samples is at least partially dependent upon the effector function responses elicited by the Fc
domain of 7G3. Also, other IL-3Ra antibodies that do not significantly inhibit IL-3Ra
function also block engraftment and hence demonstrate therapeutic activity in the NOD/SCID
mouse model of AML.
Methods
F(ab)'2 fragment preparation
F(ab)'2 fragments for 6H6, 9F5 and 7G3 were derived by pepsin cleavage using immobilised
pepsin-agarose (22.5U pepsin agarose/mg antibody) incubated with antibody at 37°C for 2 hr.
Digestion was quenched by pH adjustment using 3M Tris to 6.5. Immobilised beads were
separated from resultant F(ab)'2 by centrifugation.
F(ab)'2 of 7G3 was purified from residual immuunoglobulin and other contaminants using
tandem chromatographic procedures: thiophilic adsorption chromatography (20-0%
ammonium sulphate gradient in 40mM HEPES over IS column volumes) and anion exchange
chromatography. 9F5 F(ab)'2 and 6H6 F(ab)'2 were purified by ion exchange chromatography
" followed by affinity chromatography. Endotoxin levels were quantitated by LAL chromogenic
assay. Where endotoxin levels were >10EU/mL, Detoxigel was used to reduce endotoxin
levels. 7G3 F(ab)'2 as expected, retained CD123-neutralising activity as assessed by the IL-3-
dependent TF-1 proliferation assay (data not shown).
* AML patient samples
Peripheral blood cells were collected from 3 newly diagnosed patients after informed consent
was obtained. AML patients were diagnosed and classified according to the French-American-
British (FAB) criteria. AML-8-rel was originally classified as M4 at first diagnosis, AML-9
was classified as M5a, and AML-10 was unclassified. AML blasts were isolated by Ficoll
' density gradient centrifugation and frozen in aliquots in liquid nitrogen.
In vitro antibody treatment
Monoclonal antibodies against IL-3 receptor a chain (CD 123), 7G3, 9F5, 6H6 and their
F(ab)'2 fragments, were used to treat the cells harvested from AML patients. IgG2a was used
• in parallel as a control. Thawed AML cells were seeded in XVIVO10 plus 15%BIT and
independently incubated with antibodies at the concentration of 10µg/mL. After 2 hours of
incubation at 37°C, harvested leukemic cells were intravenously injected into sub-lethally
irradiated NOD/SCID mice for repopulating assays.
Xenotransplantion of human cells into NOD/SCID mice
Xenotransplantion was performed essentially performed as outlined in Example 1. NOD/SCID
mice were bred and housed at the Animal facility of the University Health Network/Princess
Margaret Hospital. Animal studies were performed under the institutional guidelines approved
by the University Health Network/Princess Margaret Hospital Animal Care Committee.
Transplantation of leukemic cells into NOD/SCID mice was performed as previously
described3. Briefly, all mice in the same experiment were irradiated at the same time with the
dose of 300cGy before being injected with an equal number of human cells. For intravenous
transplantation, 5 mice were used for each group with injection of 5-10 million leukemic cells
per mouse. Engraftment levels of human AML were evaluated based on the percentage of
CD45+ cells by flow cytometry of the murine bone marrow.
Cell staining and flow cytometry
Cells from the bone marrow of treated mice were stained with mouse antibody specific to
human CD45 (anti-CD45) conjugated to APC (Beckman-Coulter), anti-CD34 conjugated to
fluorescein isothiocyanate (FITC), and anti-CD38-PC5 (Becton-Dickinson). Isotypic controls
were used to avoid false positive cells. Anti-CD123-PE (clone 9F5 and 7G3, Becton-
Dickinson) was used to test the expression of IL-3 receptor a chain on the AML cells. Stained
cells were analyzed using Caliber (Becton-Dickinson).
Statistical analysis
Data are presented as the mean ± s.e.m. The significance of the differences between treated
groups was determined by p value using Student's t-test. Results were considered statistically
significant at P < 0.05.
Results
Anti-IL-3Ra antibody Fc domain contributes significantly to inhibit AML homing
capacity
The data in Example 1, Figure 5a and b indicate that ADCC caused by NK. and/or other
CD122-dependent cells contributes to the ability of 7G3 to inhibit homing and repopulation of
AML cells into the bone marrow of NOD/SCID mice and is in addition to effects of 7G3
blocking IL-3/CD123 signaling pathways. To examine this directly, the effect of other poorly-
neutralising anti-IL-3Ra antibodies 6H6 and 9F5 on the homing of an AML sample treated ex
vivo was examined. Both 6H6 and 9F5 specifically bind CD 123 however, unlike 7G3 they do
not block IL-3Ra function33. This is also evident in Figure 6a which shows that unlike 7G3,
both 9F5 and 6H6 failed to inhibit IL-3-induced signaling including CD 131 (/3c) tyrosine
' phosphorylation, STAT-5 phosphorylation and Akt phosphorylation even at the highest doses
tested. Figure 10 shows that 6H6 and 9F5 nevertheless, potently inhibited homing of AML
cells to the BM at least as well as 7G3 in this experiment.
The contribution of the Fc domain for the effects of 7G3 for inhibition of homing was
' assessed by testing F(ab)'2 fragments of both 7G3 and 6H6. Antibody F(ab)'2 fragments lack
the Fc effector immunoglobulin domain and are not able to elicit ADCC or CDC responses.
Figure 10 also shows that the F(ab)'2 fragments of both 7G3 and 6H6 did not inhibit AML
cell homing in this experiment and indicate that the Fc domain of both antibodies is important
for the inhibition of homing of AML cells to the bone marrow.
Anti-IL-3Ra antibody Fc domain contributes significantly to inhibit bone marrow
engraftment and repopulation capacity of AML cells
The experiment was then extended to evaluate the contribution of IL-3Ra neutralisation and
effector activity for the inhibition of engraftment of AML cells into the bone marrow of
recipient mice. Two AML patient samples were treated ex vivo with the various intact
antibodies and antibody fragments at a concentration of 10µg/mL at 37°C for 2 hours.
Following incubation, cells were centrifuged to remove unbound antibodies and transplanted
to sub-lethally irradiated NOD/SCID mice. The engraftment levels of human AML were
analyzed by assessing the percentage of huCD45 positive cells in the bone marrow of the mice
4 weeks post-transplantation. As shown in Figure 11a and b, 7G3 as expected, significantly
inhibited the engraftment into NOD/SCID mice of both AML patient samples. Consistent with
the effect on homing, 9F5 also potently inhibited AML cell engraftment of both patient
samples. Interestingly, Figure lla shows that for patient sample AML-9 the F(ab)'2
fragments of both 7G3 and 9F5 demonstrated significantly reduced inhibitory capacity, but did
not completely allow engraftment to return to the levels seen with control antibody. In
contrast, for sample AML-10 there was no inhibitory effects of both F(ab)'2 fragments.
Discussion
Taken together, these results indicate that in addition to the ability of 7G3 to neutralise IL-3Ra
function, that the Fc domain of 7G3 is also important for inhibition of the homing and
engraftment capacities of AML cells. Without the Fc domain, antibodies against CD123
significantly lose their capacity to inhibit homing, lodgement, and repopulation of AML-LSCs
in NOD/SCID mice.
EXAMPLE 4
A number of methods have been described for increasing the effector function activity of
antibodies. These methods can include amino acid modification of the Fc region of the
antibody to enhance its interaction with relevant Fc receptors and increase its potential to
facilitate antibody-dependent cell-mediated cytotoxicity (ADCC) and antibody-dependent
cell-mediated phagocytosis (ADCP)34'35. Enhancements in ADCC activity have also been
described following the modification of the oligosaccharide covalently attached to IgGl
antibodies at the conserved Asn297 in the Fc region34. In a further study36 the expression of
human IgGl antibodies in Lee 13 cells, a variant Chinese hamster ovary cell line which is
deficient in its ability to add fucose to an otherwise normal oligosaccharide, resulted in a
fucose-deficient antibody with up to 50-fold improved binding to human FcyRIIIA and
improved ADCC activity.
Alternative approaches to producing defucosylated antibodies have also been described
through culturing antibody-expressing cells in the presence of certain glycosidase inhibitors53.
In this study, CHO cells expressing antibodies of interest were cultured in the presence of
kifunensine, a potent a-mannosidase I inhibitor, which resulted in secretion of IgGs with
oligomannose-type glycans that do not contain fucose. These antibodies exhibited increased
affinity for FcR and enhanced ADCC activity.
In this example, generation and testing of CSL360 variants with enhanced ADCC activity
through Fc-engineering or defucosylation is described.
METHODS
Mammalian expression vector construction for transient expression of CSL360 and Fc
optimized CSL360
The genes for both the light and heavy chain variable region of the murine anti^CD123
antibody 7G3 were cloned from total 7G3.1B8 hybridoma RNA isolated using the NucleoSpin
RNA II kit (BD Bioscience) according to the manufacturer's instructions. First-strand cDNA
was synthesized using the SMART RACE Amplification kit (Clontech) and the variable
regions amplified by RACE-PCR using proof-reading DNA polymerase, Plantinum® Pfx
DNA polymerase (Invitrogen). The primers used for the variable heavy region were UPM
(Universal Primer A mix, DB Bioscience) and MH2a
(S'AATAACCCTTGACCAGGCATCCTA31). Similarly, the variable light region was
amplified using UPM and MK (5'CTGAGGCACCTCCAGATGTTAACT3'). Using standard
molecular biology techniques, the heavy chain variable region was cloned into either; a) the
mammalian expression vector pcDNA3.1(+)-hIgGl, which is based on the pcDNA3.1(+)
expression vector (Invitrogen) modified to include the human IgGl constant region or , b)
pcDNA3.1(+)-hIgGls239D/A330L'/332E. or c) pcDNA3.1(+)-hIgGls239D/1332E. The vectors used in
b) and c) encode for protein that incorporate amino acid mutations which are reported to result
in an antibody with significantly improved ADCC activity35. These mutations were
introduced using QuikChange mutagenesis techniques (Stratagene). The light chain variable
region was cloned into the expression vector pcDNA3.1(+)-hk, which is based on the
pcDNA3.1(+) expression vector modified to include the human kappa constant region.
Cell Culture
FreeStyle™ 293-F cells were obtained from Invitrogen. Cells were cultured in FreeStyle™
Expression Medium (Invitrogen) supplemented with penicillin/streptomycin/fungizone
reagent (Invitrogen). Prior to transfection the cells were maintained at 37°C with an
atmosphere of 8% CO2.
Transient Transfection
Transient transfections of the expression plasmids using FreeStyle™ 293-F cells were
performed using 293fectin transfection reagent (Invitrogen) according to the manufacturer's
instructions. The light and heavy chain expression vectors were combined and co-transfected
into the FreeStyle™ 293-F cells. Cells (1000 ml) were transfected at a final concentration of 1
x 106 viable cells/mL and incubated in a Cellbag 2L (Wave Biotech/GE Healthcare) for 5 days
at 37°C with an atmosphere of 8% CO2 on a 2/10 Wave Bioreactor system 2/10 or 20/50
(Wave Biotech/GE Healthcare). Pluronic® F-68 (Invitrogen), to a final concentration of 0.1%
v/v, was added 4 hours post-transfection. 24 hours post-transfection the cell cultures were
supplemented with Tryptone Nl (Organotechnie, France) to a final concentration of 0.5 % v/v.
The cell culture supernatants were then harvested by filtration through a Millistak+ POD filter
(Millipore) prior to purification.
Kifunensine treatment
For production of defucosylated antibodies where indicated kifunensine (Toronto Research
Chemicals) was added to the culture medium of transiently transfected FreeStyle™ 293-F
cells (24 hours post transfection) to a final concentration of 0.5 /ig/mL as described53.
Analysis of Protein Expression
After 5 days 20ul of culture supernatant was electrophoresed on a 4-20% TrisTGlycine SDS
polyacrylamide gel and the antibody was visualised by staining with Coomassie Blue reagent.
Antibody Purification
In addition to the chimeric CSL360 described in Example 2, in this example the use of a
humanised variant of CSL360 (hCSL360) is also described. This was produced by standard
CDR grafting techniques where the murine CDR regions from 7G3 were grafted on suitable
human variable framework regions54. The resulting humanised antibody contains entirely
human framework sequence. As a result of the humanisation process, the MAb affinity for
CD123 was moderately decreased (indicative KD's of 1.06 nM vs 12.8 nM for CSL360 and
hCSL360 respectively) however, the binding specificity remained unchanged and the
hCSL360 retained potent CD123-neutralisation activity as measured by IL-3-dependent TF-1
cell proliferation (indicative IC50s of 5nM vs 19nM for CSL360 and hCSL360 respectively).
Affinity optimisation was employed using standard ribosome display-based mutagenesis55 to
restore the binding affinity of hCSL360 to levels at least equivalent to the parent mouse MAb
7G3 and the chimeric CSL360. An affinity optimised MAb clone was produced (168-26) that
exhibited comparable CD 123 binding affinity and neutralisation of CD 123 activity to the
parent MAb (indicative KD of 0.6 nM for binding to CD 123 and IL-3 neutralisation IC50 of
6nM). Fc engineered derivatives of this clone containing the IgGl Fc domains with the three
amino acid substitutions S239D/A330L/I332E (168-26Fc3) or with the two amino acid
substitutions S239D/I332E (168-26Fc2) were also produced as described above for hCSL360.
The unmodified chimeric CSL360, humanised variant (hCSL360) and the ADCC-optimised
and humanised CSL360S239d/i332e (hCSL360Fc2) and CSL36OS239D/a330l/i332e (hCSL360Fc3)
and material derived from kifunensine-treated cells were purified using protein A affinity
chromatography at 4°C, with MabSelect resin (5 ml, GE Healthcare, UK) packed into a 30 mL
Poly-Prep empty column (Bio-Rad, CA). The resin was first washed with 10 column volumes
of pyrogen free GIBCO Distilled Water (Invitrogen, CA) to remove storage ethanol and then
equilibrated with 5 column volumes of pyrogen free phosphate buffered saline (PBS)
(GIBCO PBS, Invitrogen, CA). The filtered conditioned cell culture media (1L) was then
loaded onto the resin by gravity feed. The resin was then washed with 5 column volumes of
pyrogen free PBS to remove non-specific proteins. The bound antibody was eluted with 2
column volumes of 0.1M glycine pH 2.8 (Sigma, MO) into a fraction containing 0.2 column
volumes of 2M Tris-HCl pH 8.0 (Sigma, MO) to neutralise the low pH. The eluted antibody
was dialysed for 18 hrs at 4°C in a 12ml Slide-A-Lyzer cassette MW cutoff 3.5kD (Pierce, IL)
against 5L PBS. The antibody concentration was determined by measuring the absorbance at
280 nm using an Ultraspec 3000 (GE Healthcare, UK) spectrophotometer. The purity of the
antibody was analysed by SDS-PAGE, where 2 fig protein in reducing Sample Buffer
(Invitrogen, CA) was loaded onto a Novex 10-20% Tris Glycine Gel (Invitrogen, CA) and a
constant voltage of 150V applied for 90 minutes in an XCell SureLock Mini-Cell (Invitrogen,
CA) with Tris Glycine SDS running buffer before visualised using Coomassie Stain, as per the
manufacturer's instructions.
RESULTS
ADCC testing of wildtype CSL360 and the Fc-engineered CSL360 variants
To test the effector activity of the various variant antibodies the CD123-expressing CTLEN
cell line was used as a target cell line and ADCC activity assessed using the calcein AM
release assay as outlined in Example 2 in the presence of normal PBMC as a source of effecter
cells. Figure 12 shows the comparison of chimeric CSL360 and a humanised variant
(hCSL360) antibody as well as the Fc-modified variants hCSL360Fc2 and hCSL360Fc3 for
their abilities to induce ADCC-directed lysis of the CTLEN target cell line. The data show that
both the chimeric CSL360 as well as the humanised variant without modification of the Fc
domain had a detectable but modest ability to induce ADCC against the CTLEN cell line (5-
10% target cell lysis) and is consistent with the findings outlined in example 2. Both variants
with modified Fc domains, hCSL360Fc2 and hCSL360Fc3, demonstrated significantly
enhanced capacity to elicit ADCC-directed lysis of the CTLEN target cells with 50-60% target
cell lysis being observed when tested at the same concentration as the Fc unmodified
antibodies.
Testing of CSL360, Fc-engineered CSL360 variants and defucosylated CSL360 for
binding to Fc receptors
As already mentioned, antibody Fc effector function is mediated through binding to Fc gamma
receptors (FcyR) expressed on the various effector cells of the innate immune system37.
Optimisation of antibodies for enhanced binding to FcyR's results in greater effector cell
activation and greater killing of antibody-coated tumor cells.
The relative affinities of the various human FcyR's for hCSL360, the Fc engineered variants
hCSL360Fc2 and hCSL360Fc3 and defucosylated hCSL360 produced by kifunensine
treatment (hCSL360kif) were measured with a BIAcore A100 biosensor. The various
antibodies were individually captured on a CM5 BIAcore chip coupled with CD123. Soluble
FcyR's (huFcyRI, huFc-yRIIb/c and huFcyRIIIa (obtained from R & D Systems) at
concentrations ranging from 0.3 nM to 800 nM were flowed over the respective surfaces and
affinity measurements determined by fitting the data to kinetic and/or steady state models.
Figure 13A compares the affinities (KA) of hCSL360Fc2, hCSL360Fc3 and hCSL360kif
relative to hCSL360 for binding to huFcyRI, huFcyRIIb/c and huFcyRIIIa. The results are
broadly similar for hCSL360Fc2 and hCSL360Fc3 with an approximate 15-35-fold increase in
KA relative to hCSL360 for binding to huFcyRI and huFcyRIIb/c. The most pronounced
increase in binding was seen for huFcyRIIIa where affinities were increased -100-fold.
Although the absolute increase in fold affinity of hCSL360kif was lower than the Fc-
engineered variants, a similar pattern was observed with huFcyRIIIa once again exhibiting the
greatest fold improvement (~5-fold) compared to huFcyRI (0.75-fold) and huFc7RIIb/c (2.6-
fold).
Recent studies have shown that rather than absolute affinities, a high activating/inhibitory
(A/I) (Fc7RIII:huFcyRIIb) ratio in IgG affinity is important for maximal antibody-mediated
effector activity56. Figure 13B shows the data expressed as a ratio of hCSL360 variant
affinities for FcyRIII:huFcyRII. All the variants demonstrated increased A/I ratio relative to
hCSL360 with ~2-fold, ~4-fold and ~3-fpld increase in A/I for hCSL360kif, hCSL360Fc2 and
hCSL360Fc3 respectively.
These data confirm that, as expected, the various hCSL360 Fc enhanced variants exhibit
increased affinities for FcyR's with greater effects for the activating versus inhibitory FcyR's.
Discussion
It is shown here that Fc-engineered and defucosylated CSL360 variants demonstrate
significantly increased affinities and A/I binding ratio's for FcRyas well as improved ADCC
effector activity in vitro. This result, taken together with the data provided in Examples 1 and
3 demonstrating an important role for effector function activity for therapeutic efficacy of anti-
CD 123 antibodies in mouse models of AML, strongly suggest that effector function enhanced
variant anti-CD 123 antibody therapeutics would likely demonstrate improved therapeutic
activity for the treatment of AML and other CD 123-positive leukemias in human patients.
EXAMPLE 5
In this example, the various Fc-enhanced antibodies were tested for enhanced ADCC activity
against cell lines engineered to express CD 123 as well as human leukemic cell lines that
express native CD123. The Fc-enhanced MAb's were also tested using ex vivo ADCC assays
against a panel of primary leukemia samples from AML and ALL patients.
METHODS
Measuring ADCC using a Lactate Dehydrogenase release assay
ADCC was measured using a lactate dehydrogenase (LDH) release assay as described35. LDH
is a stable cytosolic enzyme that is released upon cell lysis. LDH released in to the culture
medium is measured using a colorimetric assay where LDH converts a specific substrate into a
red coloured product. Lysis is measured as LDH released and is directly proportional to the
colour formed. Target cells that express CD 123 were incubated with varying amounts of anti-
CD 123 antibodies in the presence of NK cells used as effector cells for ADCC. NK cells were
purified from a normal buffy pack using Miltenyi Biotec's NK Isolation Kit (Cat#l30-092-
657). Cells were incubated for a period of four hours at 37°C in presence of 5% CO2. Target
cells with no antibody or NK cells were used as spontaneous LDH release (background)
controls and target cells lysed with lysis buffer were used as maximal lysis controls. LDH
released into the culture media was measured using Promega's CytoTox 96® Non-
Radioactive Cytotoxicity Assay Kit according to manufacturers instructions (Cat# G1780).
All other methods are as described in the previous Examples.
RESULTS
Figure 14 examines the effects of the various CSL360 derivative antibodies on ADCC activity
against human lymphoblastoid Raji cells engineered to express CD 123. A stable clone
expressing low levels of CD 123 (-4,800 receptors/cell) (Raji-CD123 low) (Figures 14a and
b) or an independent clone expressing high levels of CD 123 (~24,400 receptors/cell) (Raji-
CD123 high) (Figures 14c and d) were used for these experiments. Effector to target cell
ratios of 25:1 and 50:1 were used. Consistently, hCSL360Fc3 and CSL360kif demonstrated
significantly improved ADCC activity against both the Raji-CD123 low and Raji-CD123 high
compared to the parent hCSL360 antibody. At the E:T ratio of 50:1 both hCSL360Fc3 and
hCSL360kif achieved almost complete lysis of the Raji-CD123 high target cells at low
concentrations (~1 ng/mL) of antibody. Approximately one order of magnitude more antibody
was required for equivalent effects in the Raji-CD123 low cells. Interestingly, chimeric
CSL360-induced ADCC was marginally more pronounced (albeit at a lower level than the Fc
enhanced variants) compared to hCSL360. This may be due to the ~10-fold decreased affinity
for the humanized variant for CD123 binding compared to the chimeric MAb which resulted
from the humanization process as discussed earlier.
Figure 15a shows a repeat of the above experiment this time using TF-1 human Ieukemic
cells which naturally express CD 123 as target cells. Once again the hCSL360Fc3 variant
showed significantly improved ADCC with hCSL360Fc2 and hCSL360kif, although less
potent, also demonstrating increased activity compared to Fc unoptimised hCSL360.
Figure 15b compares in TF-1 cells the activity of the humanised and affinity optimised anti-
CD 123 antibody variant 168-26 and its Fc-enhanced derivatives 168-26Fc3 and 168-26Fc2.
The data in this Figure demonstrate that Fc engineering improved ADCC activity of the
humanised and affinity optimised 168-26 variant similarly to that seen with the humanised
only variant (hCSL360).
Next, the activity for the various Fc-enhanced hCSL360 variants was compared against a
panel of primary Ieukemic cell samples from 5 AML patients (Figures 16 a-e) and 2 ALL
patients (Figures 16 f-g). The results in these primary patient samples were similar to those
obtained using the cell lines with rank order of potency for ADCC activity being
hCSL360Fc3>168-26Fc3> hCSL360Fc2 > hCSL360kif»CSL360 >I68-26 >hCSL360.
Importantly, the Fc-optimised variants consistently induced ADCC in all the primary patient
samples tested. All 5 AML and both ALL samples demonstrated significantly higher levels of
ADCC by the Fc optimised variants whereas for the variants without Fc optimisation only 3 of
the AML samples demonstrated a weak response. Neither ALL sample demonstrated any
significant ADCC response to the non Fc optimised variant MAbs.
These data are consistent with the results depicted in Example 2 where CSL360 treatment
induced modest ADCC activity in 4/6 AML samples and 0/2 ALL samples assessed by
various ADCC methodologies.
DISCUSSION
The data in Example 5 demonstrate that Fc optimisation of the CD 123 MAbs resulted in
significant effector function responses against all primary leukemia samples tested in ex vivo
assays and represents a significant improvement compared to Fc unoptimised anti-CD 123
MAbs.
These findings with ALL tumors that express CD 123 are consistent with the notion that other
malignancies that express CD 123 in addition to AML are also likely to be sensitive to anti-
CD 123 MAb therapeutics with enhanced Fc effector functions57"61.
EXAMPLE 6
The results described in Examples 4 and 5 indicate that CSL360 variants with enhanced Fc
effector function exhibit increased ADCC activity in vitro against a panel of cell lines
engineered to express CD 123, human leukemic cell lines which naturally express CD 123 and
importantly also in ex vivo assays using primary leukemic samples taken from patients with
AML or ALL. The ex vivo ADCC data against both AML and ALL patient primary samples is
particularly important as testing in this ex vivo setting allows for some estimation of the
potential for efficacy in a human disease setting.
In this example, the experiments are extended to test an Fc-engineered variant of CSL360
(168-26Fc3) for therapeutic efficacy in a NOD/SCID mouse xenograft model of human ALL.
This is a preclinical model which has been demonstrated to accurately reflect ALL clinical
disease and significantly correlates with patient outcome62. The clinical relevance of this
model is well recognized and is currently an integral part of the National Cancer Institute
initiative: the Pediatric Preclinical Testing Program63.
METHODS
Human ALL leukemia cells (ALL-2) derived from a pediatric ALL patient were propagated
by intravenous inoculation in female non-obese diabetic (NOD)/scid-/- mice as described
' previously62. This xenograft was derived from the third relapse of a 65 month old female
diagnosed with common CD10+ B-cell precursor ALL. The patient has since died of her
disease and this xenograft is resistant to conventional chemotherapy62. Mice were randomized
into treatment and control groups of 6-7 mice each to give an approximately equal median
leukemic burden in all groups at commencement of treatment. All mice were maintained
under barrier conditions and experiments were conducted using protocols and conditions
approved by the Committee and the Animal Care and Ethics Committee of the University of
New South Wales. Percentages of human CD45-positive (hCD45+) cells were determined as
previously described62.
The exact log-rank test, as implemented using GraphPad Prism 4.0a, was used to compare
event-free survival distributions between treatment and control groups. P values were two-
sided and were not adjusted for multiple comparisons given the exploratory nature of the
studies.
Treatment commenced on day 34 post transplantation and mice received treatments of 300 fig
per 100 /tL of antibody dissolved in phosphate-buffered saline. Antibodies were administered
by intraperitoneal injection given three times per week (every 2-3 days). Leukemic burden
was monitored by weekly tail vein bleed of the mice. Treatment continued until event was
reached and was defined as 25% hCD45+ burden in peripheral blood.
RESULTS
Figure 17 examines the effect on ALL-engrafted mice for the various antibodies including an
irrelevant MAb control (murine IgG2a), murine MAb 7G3, the humanised and affinity
optimised variant 168-26 and the latter's Fc-engineered variant 168-26Fc3. The figure depicts
Kaplan-Meier curves for event-free survival (EFS) for each of the treatment groups with each
vertical line representing an event. Mice treated with control MAb exhibited a median EFS of
53.5 days compared to 56.3, 59.9 and 65.7 days for 7G3, 168-26 and 168-26Fc3 respectively.
The results show that 7G3 and 168-26 although delaying the growth of the leukemia by 2.9
and 6.4 days respectively, that the effects were not statistically significant compared to control
MAb (P>0.05). 168-26Fc3 exhibited the most profound effect on growth of the ALL with a
statistically significant delay in leukemia growth of 12.2 days compared to control treated
animals (P=0.044). Importantly, the increased EFS effect of the Fc-engineered variant 168-
26Fc3 vs 168-26 (the same MAb without Fc modifications) was statistically significant
(P=0.037) with a leukemic growth delay of 5.9 days. This demonstrates that anti-CD 123
antibodies with enhanced Fc effector function exhibit improved therapeutic efficacy in vivo.
CONCLUSION
These data significantly extend those presented in the previous examples in that they
demonstrate that anti-CD 123 MAbs with enhanced Fc effector function have improved
therapeutic efficacy in mice with pre-established leukemia compared to Fc-unmodified MAbs.
Importantly, the use of a preclinically validated model of ALL that has been demonstrated to
predict the course of human disease62 strongly supports that such Fc optimised anti CD 123
MAbs may also exhibit improved clinical efficacy in leukemic patients.
REFERENCES
1. Wang, J.C. & Dick, J.E. Cancer stem cells: lessons from leukemia. Trends Cell Biol
(2005).
2. Bonnet, D. & Dick, J.E. Human acute myeloid leukemia is organized as a hierarchy
that originates from a primitive hematopoietic cell. Nat Med, 3, 730-737 (1997).
3. Hope, K.J., Jin, L. & Dick, J.E. Acute myeloid leukemia originates from a hierarchy of
leukemic stem cell classes that differ in self-renewal capacity. Nat Immunol. 5, 738-
743 (2004).
4. Lapidot, T., et al. A cell initiating human acute myeloid leukaemia after
transplantation into SCID mice. Nature 367, 645-648 (1994).
5. Guan, Y. & Hogge, D.E. Proliferative status of primitive hematopoietic progenitors
from patients with acute myelogenous leukemia (AML). Leukemia 14, 2135-2141
(2000).
6. Guzman, M.L., et al. Nuclear factor-kappaB is constitutively activated in primitive
human acute myelogenous leukemia cells. Blood 98, 2301-2307 (2001).
7. Lowenberg, B., Griffin, J.D. & Tallman, M.S. Acute myeloid leukemia and acute
promyelocytic leukemia. Hematology Am Soc Hematol Educ Program, 82-101 (2003).
8. van Rhenen, A., et al. High stem cell frequency in acute myeloid leukemia at diagnosis
predicts high minimal residual disease and poor survival. Clin Cancer Res 11, 6520-
6527 (2005).
9. Morgan, M.A. & Reuter, C.W. Molecularly targeted therapies in myelodysplasfic
syndromes and acute myeloid leukemias. Ann Hematol 85, 139-163 (2006).
10. Tallman, M.S. New agents for the treatment of acute myeloid leukemia. Best Pract Res
Clin Haematol 19, 311-320 (2006).
11. Aribi, A., Ravandi, F. & Giles, F. Novel agents in acute myeloid leukemia. Cancer J.
12, 77-91 (2006).
12. Abutalib, S.A. & Tallman, M.S. Monoclonal antibodies for the treatment of acute
myeloid leukemia. Curr Pharm Biotechnol. 7, 343-369 (2006).
13. Stone, R.M. Novel therapeutic agents in acute myeloid leukemia. Exp Hematol. 35,
163-166(2007).
14. Krug, U., et al. New molecular therapy targets in acute myeloid leukemia. Recent
Results Cancer Res. 176, 243-262 (2007).
15. Miyajima, A., Mui, A.L., Ogorochi, T. & Sakamaki, K. Receptors for granulocyte-
macrophage colony-stimulating factor, interleukin-3, and interleukin-5. Blood 82,
1960-1974(1993).
16. Bagley, C.J., Woodcock, J.M., Stomski, F.C. & Lopez, A.F. The structural and
functional basis of cytokine receptor activation: lessons from the common beta subunit
of the granulocyte-macrophage colony-stimulating factor, interleukin-3 (IL-3), and IL-
5 receptors. Blood 89, 1471 -1482 (1997).
17. Munoz, L., et al. Interleukin-3 receptor alpha chain (CD 123) is widely expressed in
hematologic malignancies. Haematologica 86, 1261-1269 (2001).
18. Sperr, W.R., et al. Human leukaemic stem cells: a novel target of therapy. Eur J Clin
Invest. 34 Suppl 2, 31-40 (2004).
19. Graf, M., et al. Expression and prognostic value of hemopoietic cytokine receptors in
acute myeloid leukemia (AML): implications for future therapeutical strategies. Eur J
Haematol. 72, 89-106 (2004).
20. Florian, S., et al. Detection of molecular targets on the surface of CD34+/CD38-- stem
cells in various myeloid malignancies. Leuk Lymphoma 47, 207-222 (2006).
21. Testa, U., et al. Elevated expression of IL-3Ralpha in acute myelogenous leukemia is
associated with enhanced blast proliferation, increased cellularity, and poor prognosis.
Blood 100, 2980-2988 (2002).
22. Riccioni, R., et al. Immunophenotypic features of acute myeloid Ieukemias
overexpressing the interleukin 3 receptor alpha chain. Leuk Lymphoma 45, 1511-1517
(2004).
23. Yalcintepe, L., Frankel, A.E. & Hogge, D.E. Expression of interleukin-3 receptor
subunits on defined subpopulations of acute myeloid leukemia blasts predicts the
cytotoxicity of diphtheria toxin interleukin-3 fusion protein against malignant
progenitors that engraft in immunodeficient mice. Blood 108, 3530-3537 (2006).
24. Hauswirth, A.W., et al. Expression of the target receptor CD33 in CD34+/CD38-
/CD123+ AML stem cells. Eur J Clin Invest. 37, 73-82 (2007).
25. Jordan, C.T., et al. The interleukin-3 receptor alpha chain is a unique marker for
human acute myelogenous leukemia stem cells. Leukemia 14, 1777-1784 (2000).
26. Budel, L.M., Touw, I.P., Delwel, R., Clark, S.C. & Lowenberg, B. Interleukin-3 and
granulocyte-monocyte colony-stimulating factor receptors on human acute myelocytic
leukemia cells and relationship to the proliferative response. Blood 74, 565-571
(1989).
27. Salem, M., et al. Maturation of human acute myeloid leukaemia in vitro: the response
to five recombinant haematopoietic factors in a serum-free system. Br J Haematol. 71,
363-370(1989).
28. Delwel, R., et al. Growth regulation of human acute myeloid leukemia: effects of five
recombinant hematopoietic factors in a serum-free culture system. Blood 72, 1944-
1949(1988).
29. Miyauchi, J., et al. The effects of three recombinant growth factors, IL-3, GM-CSF,
and G-CSF, on the blast cells of acute myeloblastic leukemia maintained in short-term
suspension culture. Blood 70, 657-663 (1987).
30. Pebusque, M.J., et al. Recombinant human IL-3 and G-CSF act synergistically in
stimulating the growth of acute myeloid leukemia cells. Leukemia 3,200-205 (1989).
31. Vellenga, E., Ostapovicz, D., O'Rourke, B. & Griffin, J.D. Effects of recombinant IL-
3, GM-CSF, and G-CSF on proliferation of leukemic clonogenic cells in short-term
and long-term cultures. Leukemia 1, 584-589 (1987).
32. Testa, U., et al. Interleukin-3 receptor in acute leukemia. Leukemia 18, 219-226
(2004).
33. Sun, Q., et al. Monoclonal antibody 7G3 recognizes the N-terminal domain of the
human interleukin-3 (IL-3) receptor alpha-chain and functions as a specific IL-3
receptor antagonist. Blood 91, 83-92 (1996).
34. Niwa, R., et al . IgG subclass-independent improvement of antibody-dependent
cellular cytotoxicity by fucose removal from Asn297-linked oligo saccharides, J.
Immunol. Methods, 306, 151 -160 (2005).
35. Lazar, G.A., et al. Engineered antibody Fc variants with enhanced effector function.
Proc. Natl. AcadSci. USA, 103, 4005-4010 (2006).
36. Shields, R.L., et al.. Lack of fucose on human IgGl N-linked oligosaccharide
improves binding to human Fc gamma RIII and antibody dependent cellular toxicity.
J. Biol. Chem., 277:26733-26740 (2002).
37. Desjarlais et al Optimizing engagement of the immune system by anti-tumor
antibodies: an engineer's perspective. Drug Discov Today. 2007 Nov; 12(21-22):898-
910).
38. Mazurier, F., Doedens, M., Gan, O.I. & Dick, J.E. Rapid myeloerythroid repopulation
after intrafemoral transplantation of NOD-SCID mice reveals a new class of human
stem cells. Nat Med. 9, 959-963 (2003).
39. Lopez, A.F., et al. Recombinant human interleukin-3 stimulation of hematopoiesis in
humans: loss of responsiveness with differentiation in the neutrophilic myeloid series.
Bloodll, 1797-1804(1988).
40. Guthridge, M.A., et al. The phosphoserine-585-dependent pathway of the GM-
CSF/IL-3/IL-5 receptors mediates hematopoietic cell survival through activation of
NF-kappaB and induction of bcl-2. Blood 103, 820-827 (2004).
41. Guthridge, M.A., et al. Site-specific serine phosphorylation of the IL-3 receptor is
required for hemopoietic cell survival. Mol Cell 6, 99-108 (2000).
42. Tanaka, T., et al. Selective long-term elimination of natural killer cells in vivo by an
anti-interleukin 2 receptor beta chain monoclonal antibody in mice. J Exp Med. 178,
1103-1107(1993).
43. McKenzie, J.L., Gan, O.I., Doedens, M. & Dick, J.E. Human short-term repopulating
stem cells are efficiently detected following intrafemoral transplantation into
NOD/SCID recipients depleted of CD122+ cells. Blood 106, 1259-1261 (2005).
44. Dick, J.E. & Lapidot, T. Biology of normal and acute myeloid leukemia stem cells. Int
JHematol. 82, 389-396 (2005).
45. Kollet, O., et al. Rapid and efficient homing of human CD34(+)CD38(-
/low)CXCR4(+) stem and progenitor cells to the bone marrow and spleen of
NOD/SCID andNOD/SCID/B2m(null) mice. Blood 97, 3283-3291 (2001).
46. Lapidot, T., Dar, A. & Kollet, O. How do stem cells find their way home? Blood 106,
1901-1910(2005).
47. Hogge, D.E., Feuring-Buske, M., Gerhard, B. & Frankel, A.E. The efficacy of
diphtheria-growth factor fusion proteins is enhanced by co-administration of cytosine
arabinoside in an immunodeficient mouse model of human acute myeloid leukemia.
LeukRes. 28, 1221-1226 (2004).
48. Feuring-Buske, M., Frankel, A.E., Alexander, R.L., Gerhard, B. & Hogge, D.E. A
diphtheria toxin-interleukin 3 fusion protein is cytotoxic to primitive acute myeloid
leukemia progenitors but spares normal progenitors. Cancer Res. 62, 1730-1736
(2002).
49. Du, X.,^Ho, M. & Pastan, I. New immunotoxins targeting CD 123, a stem cell antigen
on acute myeloid leukemia cells. JImmunother (1997) 30, 607-613 (2007).
50. Jenkins et al., A Cell Type-specific Constitutive Point Mutant of the Common -
Subunit of the Human Granulocyte-Macrophage Colony-stimulating Factor (GM-
CSF), Interleukin (IL)-3, and IL-5 Receptors Requires the GM-CSF Receptor -Subunit
for Activation. JBiol Chem, 1999 274:13, 8669-8677)
51. Fischer, Lars, Olaf Penack, Chiara Gentilini, Axel Nogai, Arne Muessig, Eckhard
Thiel and Lutz Uharek. The anti-lymphoma effect of antibody-mediated
immunotherapy is based on an increased degranulation of peripheral blood natural
killer (NK) cells. Exp Hematol. 34: 753-759 (2006)
52. Neri S, Mariani E, Meneghetti A, Cattini L and Facchini A. Calcein-Acetoxymethyl
cytotoxicity assay: standardisation of a method allowing additional analyses on
recovered effector cells and supernatants. Clinical and Diagnostic Lab Immunol.
8:1131-1135 (2001)
53. Zhou et al, Development of a simple and rapid method for producing non-fucosylated
oligomannose containing antibodies with increased effector function. Biotechnol
Bioeng. 2008 99(3):652-65)
54. Tan, P., et al, "Superhumanized" Antibodies: reduction of immunogenic potential by
complementarity-determining region grafting with human germline sequences:
application to an anti-CD28. 2002 JImmunol. 169, 1119-1125)
55. Kopsidas, G., et al, RNA mutagenesis yields highly diverse mRNA libraries for in
vitro protein evolution. 2007 BMC Biotechnol. 7, 18)
56. Nimmerjahn and& Ravetch, Divergent immunoglobulin g subclass activity through
selective Fc receptor binding. Science 2005 310(5753): 1510-2).
57. Feuillard et al, Clinical and biologic features of CD4(+)CD56(+) malignancies Blood
2002 99(5): 1556-63
58. Munoz et al, Interleukin-3 receptor alpha chain (CD123) is widely expressed in
hematologic malignancies Haematologica 2001 86( 12): 1261 -9
59. Lhermitte et al, Most immature T-ALLs express Ra-IL3 (CD 123): possible target for
DT-IL3 therapy. Leukemia 2006 20(10): 1908-10
60. Aldinucci et al, The role of interleukin-3 in classical Hodgkin's disease. Leuk
Lymphoma 2005 46(3):303-l 1
61. Jiang et al, Autocrine production and action of IL-3 and granulocyte colony-
stimulating factor in chronic myeloid leukemia. Proc Natl Acad Sci USA. 1999
26;96(22): 12804-9)
62. Liem et al, Characterization of childhood acute lymphoblastic leukemia xenograft
models for the preclinical evaluation of new therapies Blood 2004;103(10):3905-14)
63. Houghton et al, Testing of New Agents in Childhood Cancer Preclinical Models.
Clinical Cancer Research. 2002; 8:3646-3657)
CLAIMS:
1. A method for inhibition of leukemic stem cells expressing IL-3Ra (CD 123), which
comprises contacting said cells with an antigen binding molecule comprising a Fc region or a
modified Fc region having enhanced Fc effector function, wherein said antigen binding
molecule binds selectively to IL-3Ra(CD123).
2. A method for the treatment of a hematologic cancer condition in a patient, which
comprises administration to the patient of an effective amount of an antigen binding molecule
comprising a Fc region or a modified Fc region having enhanced Fc effector function, wherein
said antigen binding molecule binds selectively to IL-3Ra(CD123).
3. The method of claim 2 wherein the patient is a human.
4. The method of claim 1 or claim 2 wherein the antigen binding molecule is a
monoclonal antibody or antibody fragment comprising a Fc region.
5. The method of claim 1 or claim 2 wherein the antigen binding molecule is a
monoclonal antibody or antibody fragment comprising a modified Fc region having enhanced
Fc effector function.
6. The method of claim 5 wherein the modification in the Fc region of the antibody or
antibody fragment comprises substitution of at least one amino acid, preferably two or three
amino acids, in the Fc region to enhance the interaction of the Fc region with relevant Fc
receptors and complement.
7. The method of claim 5 wherein the antibody or antibody fragment comprising a
modified Fc region is a defucosylated antibody or antibody fragment.
8. The method of claim 5 wherein the modification in the Fc region of the antibody or
antibody fragment comprises modification of an oligosaccharide attached at the conserved
Asn297 in the Fc region.
9. The method of claim 4 or claim 5 wherein the antigen binding molecule is a chimeric,
humanized or human monoclonal antibody or antibody fragment.
10. The method of claim 9 wherein the antigen binding molecule is a chimeric antibody or
antibody fragment comprising light variable and heavy variable regions of a mouse anti-
CD 123 monoclonal antibody grafted onto a human constant region.
11. The method of claim 9 wherein the antigen binding molecule is a humanized antibody
or antibody fragment comprising complementarity-determining regions (CDRs) of a mouse
anti-CD 123 monoclonal antibody grafted on a human framework region.
12. The method of claim 2, wherein said hematologic cancer condition is leukemia or a
malignant lymphoproliferative disorder.
13. The method of claim 12, wherein said leukemia is selected from the group consisting
of acute myelogenous leukemia, chronic myelogenous leukemia, acute lymphoid leukemia,
chronic lymphoid leukemia, and myelodysplastic syndrome.
14. The method of claim 12, wherein said malignant lymphoproliferative disorder is
lymphoma.
15. The method of claim 14, wherein said lymphoma is selected from the group consisting
of multiple myeloma, non-Hodgkin's lymphoma, Burkitt's lymphoma, and small cell- and
large cell-follicular lymphoma.
16. The method of claim 2, further comprising administration to said patient of a
chemotherapeutic agent.
1 17. The method of claim 16, wherein administration of the chemotherapeutic agent is prior
to, simultaneous with, or subsequent to, administration of the antigen binding molecule.
18. The method of claim 16, wherein said chemotherapeutic agent is a cytotoxic agent
selected from the group consisting of:
(a) Mustard gas derivatives: Mechlorethamine, Cyclophosphamide, Chlorambucil,
Melphalan, and Ifosfamide
(b) Ethylenimines: Thiotepa and Hexamethylmelamine
(c) Alkylsulfonates: Busulfan
(d) Hydrazines and triazines: Althretamine, Procarbazine, Dacarbazine and
Temozolomide
(e) Nitrosureas: Carmustine, Lomustine and Streptozocin
(f) Metal salts: Carboplatin, Cisplatin, and Oxaliplatin
(g) Vinca alkaloids: Vincristine, Vinblastine and Vinorelbine
(h) Taxanes: Paclitaxel and Docetaxel
(i) Podophyllotoxins: Etoposide and Tenisopide.
(j) Camptothecan analogs: Irinotecan and Topotecan
(k) Anthracyclines: Doxorubicin, Daunorubicin, Epirubicin, Mitoxantrone and
Idarubicin
(1) Chromomycins: Dactinomycin and Plicamycin
(m) Miscellaneous antitumor antibiotics: Mitomycin and Bleomycin
(n) Folic acid antagonists: Methotrexate
(o) Pyrimidine antagonists: 5-Fluorouracil, Foxuridine, Cytarabine, Capecitabine,
and Gemcitabine
(p) Purine antagonists: 6-Mercaptopurine and 6-Thioguanine
(q) Adenosine deaminase inhibitors: Cladribine, Fludarabine, Nelarabine and
Pentostatin
(r) Topoisomerase I inhibitors: Ironotecan and Topotecan
(s) Topoisomerase II inhibitors: Amsacrine, Etoposide, Etoposide phosphate and
Teniposide
(t) Ribonucleotide reductase inhibitors: Hydroxyurea
(u) Adrenocortical steroid inhibitors: Mitotane
(v) Enzymes: Asparaginase and Pegaspargase
(w) Antimicrotubule agents: Estramustine
(x) Retinoids: Bexarotene, Isotretinoin and Tretinoin (ATRA).
19. The method of claim 18, wherein said cytotoxic agent is Cytarabine.
20. Use of an antigen binding molecule comprising a Fc region or a modified Fc region
having enhanced Fc effector function in, or in the manufacture of a medicament for, the
inhibition of leukemic stem cells expressing IL-3Ra (CD 123), wherein said antigen binding
molecule binds selectively to IL-3Ra(CD123).
21. Use of an antigen binding molecule comprising a Fc region or a modified Fc region
having enhanced Fc effector function in, or in the manufacture of a medicament for, the
treatment of a hematologic cancer condition in a patient, wherein said antigen binding
molecule binds selectively to IL-3Ra(CD123).
22. An agent for inhibition of leukemic stem cells expressing IL-3Ra (CD 123), which
comprises an antigen binding molecule comprising a Fc region or a modified Fc region having
enhanced Fc effector function, wherein said antigen binding molecule binds selectively to the
IL-3Ra(CD123).
23. An agent for the treatment of a hematologic cancer condition in a patient, which
comprises an.antigen binding molecule comprising a Fc region or a modified Fc region having
enhanced Fc effector function, wherein said antigen binding molecule binds selectively to IL-
3Ra(CD123).

A method for inhibition of leukemic stem cells expressing IL-3R; (CD
123), comprises contacting the cells with an antigen binding molecule
comprising a Fc region or a modified Fc region having enhanced Fc
effector function, wherein the antigen binding molecule binds selectively
to IL-3R (CD123). The invention includes the treatment of a hematologic
cancer condition in a patient by administration to the patient of an
effective amount of the antigen binding molecule.