Specification
FIELD OF INVENTION
The present invention describes an improved method of generation of Brassica transformants based on a method of selecting genetically transformed Brassica juneea explants based on their ability to utilize Xylose as a sole carbohydrate source.The said invention encompasses the process of Ayrobacterium Mediated I ransformation of the target host plant with the constructed vector for tlte expression of the enzvme Xylose Isomerase. Also disclosed is the method of selecting the putative transformants subsequent to transformation with the said vector to obtain a metabolic advantage of utilizing X\ lose as a carbon source. The subject invention alleviates the disadvantage of the negative selection methods. Reported is a stable transformation efficiency of 34-40% using Xylose Isomerase for selection.
BACKGROUND AND PRIOR ART OF THE INVENTION
I he production of transgenic plants often requires the use of a selection system thai allows the regeneration and the growth of the successfully transformed cells. When a nucleotide of interest (NOT) or Gene of Interest (OOl) has to be introduced ink* a population of cells by transformation only a certain number of cells arc successful!) transformed ie.. only few cells receive the NOl or GOl. Since the transformed cells constitute a minor fraction of the treated cells, compared to the majority of cells which remain tint ran stormed, the selection system has to enable efficient screening in selecting the successfully transformed cells such that the probability to recover transgenic plants in the presence of a selective agent is greater than in its absence, especially because the transformation rale is always low {lO'to If)'1).
The selection process is undertaken by the introduction of a selectable marker gene with the gene of interest. The use of this kind of a selectable marker gene in the transformation process aims to a give a selective advantage to the transformed cells, allowing them to grow faster, better and to kill the n on-transformed cells.
\n ideal selectable marker gene should he capable to express in an\ cell or tissue and in great number of plant species. This expression should be easily distinguished from ans endogenous activity in the plant tissue allowing to differentiate the phenotype of the transformed from the untransformed tissues. During the regeneration steps, the inlluence exerted bv the dying non-transformed cells on the transformed cells should
\ V) he minimal on the selective medium. In addition to tlie above an easy assay should he
able to confirm the presence the marker (ACM'P. 1994)
Selectable markers identified today can be differentiated into two types that eimhlc transgenic plants or cells to be identified after transformation. They are positive and negative markers conferring a selective advantage or disadvantage respectheK. Negative Selection kills the cells which do not contain the introduced DNA and includes antibiotic and herbicide based selection. I'hey allow the selection of transformed ceils, or tissue explants by their ability to grow in the presence of an antibiotic or a herbicide.
So far. the most widely used selectable gene is the neomycin phosphotransferase II (NPI'll) gene (1-alley el al.l986i which confers resistance to the aminoglycoside, antibiotics kanamycin. neomycin and G4I8 (Bcvan et al. 14831. A number of oilier selective systems has been developed based on resistance to bleomycin (llille ct al. 1986) bromoxynil (Stalker et al. 1988). chloramphenicol (Traley el al. 1983). 2. 4-diehlorophenoxyacetie acid (Sireher and Willmilzer 1989). glyphosaie (Shall c-t a!. I486), hygromycin (Waldron ct al. 1985) or phosphinothriein (De Block el at. 19X71.
Negative Selection methods, which rely on the use of antibiotics or herbicides, suffer from a number of disadvantages. Plant cells dying from antibiotic toxicity release growth inhibitors and toxins, which are thought to negatively, affect transformed cells and hinder their growth (Haldrup ct al.1988a). The non-transformed cells are killed in the presence of the phyto-toxie product and in eases where a coherent tissue is used there is a risk that the transformed cells also die. due to Ihe fact that the death of the non-transformed cells may cui off supply of the nutrients to the transformed cells or because o\' the damaged or dying non-transformed cells may excrete loxic compounds, thus limiting the transformation efficiency of the negative systems. In addition selection of cells or tissues using negative selection requires the precise timing of expression of ihe introduced genes in relation to the selection process. Ifthe transgenic cells are treated with a loxic compound before the detoxifying gene is expressed or before enough gene products are produced to ameliorate ihe action ofthe toxic compound, both the transgenic and the non-transgenie cells are killed. If selection is delayed, ihe selection ofthe transgenic cells or tissues may be hindered b\. for example, shoot or callus formation from non- transgenic cells or tissues, which
form a harrier to the penetration of the compound used to select the transformed cells They cause genome wide alterations in DMA methyiation (Sehmitt et al. 1997). This non-reversible phenomenon leads to gene silencing and is thought to hinder both the selection of transgenic cells and the plant regeneration process. Changes in methyiation can be dosage dependant and lead to sequence mutation (Bardini et a!.20()3.)
The presence of an antibiotic resistance gene in ingested plants is a matter of environmental concern with the major concern being the potential transfer of the genes conferring antibiotic resistance into gut microorganisms. Homology between sequences in an antibiotic resistance marker gene that is prokaryotie in origin and the recipient's DNA is more likely to he found in gut microorganisms, which are prokaryotie in origin. The probability of integration and expression of a marker gene is therefore greater in gut microorganisms than in the gut epithelial ceils. Rare transfer events can be amplified very rapidly under selective pressure. The health impact would he significant if"a gene conferring resistance to a clinically important antibiotic was transferred and expressed in a pathogenic microorganism normally treated with that antibiotic. While such ecological concerns may lead to governmental restrictions on the use of antibiotic resistance genes in transgenic plants, and it is therefore desirable to develop new selection methods, which are independent of such genes. The European Union has enacted a ban on antibiotic resistance genes for the selection of transgenic plant cells effective at the end of 2004. and thus any future genetically enhanced plants and the food products sold in EU will have to contain alternative selectable markers. Even with respect to the usage of herbicide resistance genes as a selectable marker, there is a possibility that resistance might transfer to weedy relatives of crops via outcrossing (Ricgcr et a 1.1999).
fhc above-mentioned concerns are overcome to a substantial extent, by the method of positive selection whose operating principle is converse to negative selection, in contrast, to negative selection, positive selection gives the transformed cells the ability to grow using a specific carbon, nitrogen or growth regulator as the selection agent (Joersbo and Okkels 19%: Bojsen el al. 1998: Haldrup el al 1998a]. fhe transgenic cells acquire a gene which confer a metabolic advantage to those cells whilst non-transgenic cells are starved rather than killed.
4
The selection method employed in the in\union uses the selection agent, which is the carbohydrate x\ lose, which are not inetaboii/ed by a number of plant species (Bojscn el at. IW4), B\ substituting the normally employed carbohydrate with one of these compounds, cells transformed with the gene encoding an enzyme capable of converting it to metabolizable isomer are favored in growth while the non-transgenic cells are starved. Thereby giving the transformed cells a metabolic advantage. Xvlose can be converted to xylulose by xylose isomerase which functions as a selectable marker in this system (Haldrup 1996). These marker genes for positive selection make possible the identification and the selection of genetically modified cells without injuries or death of the non-transformed population of cells (negative selection). I he addition of a new compound in the culture medium as nutrient source during the regeneration process, allow the normal growth and the differentiation of transformed cells, while nan- transformed cells will not be capable of growth or generate dcnoui plants.
Disclosed in this invention is a method of generation of Brassica transgenics employing a selection method without usage of any of the commonly known antibiotic resistance genes or herbicide resistance genes. Described is the method of selecting and regenerating transformants of the species Brassica juncea. speeitiealh exemplifying a positive selection method that involves conferring to the transformed tissue explains an ability to utilize certain carbon sources preferably Xylose and transformed explants can be selected by simplv subjecting them to a medium containing the referred selection agent.
Prior art describes a positive selection method that has been developed using the \\ lose isomerase gene* (xvIA) isolated from Thermoaerobaeterium thermosLilfurogenes or from Strcptomvces rubiginosus. as a selective marker gene (Haldrup et aL 1998a;). Transgenic plants of potato, tobacco and tomato were successful!;* selected on xylose-containing media. The method of selection disclosed herein is lucid enough to distinguish from the prior art documents cited. Our invention specifically aims at the method of positive selection of the translormed plant explains that belong to the species Brassica juncea. The selectable marker gene has been isolated from the organism vhizochytrium and has been suitably modified for its expression in the host plant titter successful transformation.
Our prior application field describes a method of transformation and selecting genetically transformed Sunflower explains based on their ability to utilize Xvlose as a sole carbon source.
IJS Patent Application 5.767.378 titled "Vlannose or Xylose positive selection" relates to the method of identifying or selecting from a population of eukaryotic cells cultivated on or in a medium containing ai least one compound, cells which ha\e a metabolic advantage as a result of being transformed. This invention pro\ ides a basis of specifically selecting transformed sugar beet or potato cells. The above referred prior art specifically claims the described protocol of positive selection in sugar beet and potato ceils as against our invention that refers to the positive selection of Brassica juncea per se. The protocols of transformation are unique with rcspeet to every plant species. Moreover, the methodology of transformation described in the subject invention is completely different in comparison to the prior art cited. furthermore, no cited literature describes the method of transformation based on positive selection in Brassica juncea.
! laldrup et aL 1948 have established that the xylose isomerase gene from the organism Thennonanaerobaeierium thermosulfurogenes allows the selection of transgenic plants using D-\ylose as the selection agent (Plant Molecular Biologv (1998). 37(2). 287-296. The Xylose isomerase gene was transferred to the targe! plant by Agrobaclerhim mediated transformation, linoptimized selection studies showed in that in potato and tomato, the xylose isomerase selection was more efficient than the kanamycin resistance selection, whereas in the tobacco plants the opposite effect wa' observed.
fhe method of selection disclosed herein is lucid enough to distinguish from the prior arl documents cited. Described is an improved method of generation ol Branca transgenics employing a selection method without usage of any of the commonly known antibiotic or herbicide resistance gene^. Also described is the method of selecting and regenerating transformanis of the species Brassica juncea. specifically exemplifying a positive selection method that involves conferring to the transformed tissue explants an ability to utilize alternate carbon source preferably Xylose. Transformed explants can be selected by simply subjecting them to a medium containing the referred selection agent, fhe selectable marker gene used in the
election utilizing Xylose. According to the first aspect of the invention, there i.-.
provided a method of isolation of the total RNA and the synthesis of cDNA from the mRNA. The LSI clones randomly picked from the primary cDNA library have been subjected to PCR amplification thereby leading to the identification of cDNA clone of I.5kh. which encodes a full length Xylose Isomerase (.xylA) cDNA possessing an OR|-of 1481 bp.
Iiirther still, an additional aspect of the subject invention pertains to the polynucleotide molecule that encodes the protein having the biological activity of Xvlose Isomerase. Specifically, the aspect pertains to a polynucleotide as represented in the S!:.Q ID 3. Also represented is the polypeptide encoded b\ the polvnucleotide molecule of the subject invention.
A specific aspect of the invention describes the homology of Xvlose Isomerase obtained Irom Schi/ochytrium to that of Arabidopsis thaliana and its cloning into a pGEiM-T F.asv.
According to a further aspect, the sequence of xylose isomerase is codon optimized b> subjecting the clone to multi-site directed mutagenesis for substituting 9 nucleotides and a successful expression of the gene in the host plant.
In one preferred aspect, the codon-optimi/ed gene is cloned into an expression veeioi. transformed into h.coli and experiments were conducted for proof of function to detect for the transcription and the translation of the xylose isomerase gene.
The xylose isomerase gene is then cloned into the pCAMBIA to be further transformed into the host plant Brassica juncea.
In accordance with the highly preferred aspect of the invention, describes ilie \»robacterium mediated gene transfer of the constructed vector comprising the selectable marker gene into the host plant explains under conditions suitable Un¬infect ion thereby inducing the transformed cells with a positive effect that gives the cells a metabolic advantage over the non-transformed cells when cultured together on a suitable medium containing the selective agent.
According to the most significant aspect o\~ the invention, described herein is a selection svstem tor selecting alleasl one genetically transformed cell Irom the
ipulation of cells from the medium, wherein at k-usl one genetically transformed cell f is transformed with the nucleotide; sequence which encodes an expression product capable of converting a component or precursor thereof that is present in the medium. More specifically the selective component referred in the invention is Xylose. The term "cells" is intended to refer to un\ type of cells from which individual genetically transformed cells may be identified and isolated using the method of the invention.
The transformation efficient:} reported from the disclosed method of transformation is 34-40% and the regeneration efficiency has been 3-4 fold greater than the known hvgromycin based methods.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1. Complete Xylose isomerase domain in the 1.5kb sequence of'SC-l desaUirase
FIG. 2. Homolog\ of the motif from SO-1 to the Xylose isomerase domain
FIG. 3. Map of pGHX-XI. The Xylose Isomerase gene was cloned at Bam] II and Xhol of pGEX.
FIG. 4. Induction of Xylose isomerase in K.coli. Amplification of transformed SI.A explains with XI primers. Lanes: I: Induced: (J: Uiinduced: 1.2.3: Different clones earning the xylose isomerase gene: M: M\V marker.
FIG. 5. A. Amplification of the ORF from the xylose Isomerase clone.
B: Restriction of the pCAMBlA-Xl with Xhol. Note the release of the hpt gene from the Xhol site.
FIG. 6. Replacement of hpt with XI in pCAMBlA-CO-XI.
FIG. 7. Brassica juneea cotyledonary petiole cxplants A) cultured on sucrose (35 gzm/l) B) cultured on D-X}lose (30 gm/1) (.') cultured on medium without and carbon source.
FIG. 8. Budding comparison of cotvlcdonar} petiole explains transformed with p(.'AMBIA-CO-XI and pCAMBIA 1380 and cultured on Xvlose (25gdi l Sucrose
comprising:
(a) construction of a recombinant \eetor incorporating I he nucleic acid sequence separably linked to a regulator sequence encoding the enzyme \_\lose Isomerase required Tor the metabolism ofthe selection agent wlosu.
(b) Agrobacterium mediated method of transformation ofthe said \eetor ink) the plant cells or plant tissues under conditions optimal lor infection.
(c) a step of selection of putative trynsformants from a population of genetically non-transformed plant cells or plant tissue on MS medium containing the selection agent of step (a), and
td) a step of regeneration ot'the selected plant cells or tissues.
In another embodiment ofthe present invention, the plant used belongs to the specie-. Brassica juneca.
In another embodiment ofthe present invention, the nucleic acid sequence encoding the enzvme xylose isomerase is isolated from the organism Schi/oehytrium and is represented in the ShQ ID I.
In yet another embodiment ofthe present invention, at least one of the nucleotide sequence is modified in that the expression of thus modified DMA occurs in the ho-l plant explain.
In still another embodiment of the present invention, the modified sequence is represented in SEQ ID.V
In still another embodiment ofthe present invention, the corresponding ammo acid sequence ofthe expressed protein is represented in SEQ ID 2.
In still another embodiment of the present invention, the plant cells or tissues subjected to transformation is obtained from the eotvledonar\ petiole post termination of seeds ofthe host plant in MS medium.
In still another embodiment ofthe present invention, plant cells IISM.ICS prini \, transformation with the vector construct aie unable to utilize \\lose as a sole source of carbon.
The present invention relates to a method of transformation, wherein the plant of the genus Brassica. transformed with the recombinant vector comprising the nucleic acid sequence encoding the enzyme xylose isomerase required for the metabolism a\~ \\lose. characterized in that, in the step of transformation a stagewise co- cultivation of explants is used which comprises:
(a) a step of preparing an explant b; excision of cot;ledonar; petiole avoidins: the inclusion of an; primordial tissue.
(b) a step of infection of the said explant with the Agrohacterium earning the said vector construct for 10 seconds and the subsequent transfer to the co-cultivation medium.
(c) a step of co-cultivation of the said explants for 3 da;s at 28"C. in durk conditions.
(d) a step of transferring the explants with the selection medium containing the selection agent.
(e) a step of subsequent transfer of the selected explants into the selection and elongation medium, and
(0 a step further comprising the regeneration of the selected transtormants.
In another embodiment of the present invention, the method is characterized in that the confirmation of transformation of the said selectable marker gene in the regenerated plantlets is done using the known molecular techniques of screening.
In yet another embodiment of the present invention, the geneiicall; transformed plant explants harboring the vector comprising the nucleotide sequence, the expression ol which confers a metabolic advantage to the transformed explants over the non-transformed cells.
In still another embodiment of the present invention, the transformed cells are selected based on the said competitive metabolic advantage of utilizing the selection
agent xylose as a carbohydrate source attributed to the expression of the en/\me h\ the nucleic acid of claim 3.
In still another embodiment of the present invention, the transformation efficient obtained is greater than 35%
In still another embodiment of the present invention, the transformation efficient obtained is greater than 30%
In still another embodiment of the present invention, the transformation efficiency obtained is greater than 25%
['he term "Selectable marker gene" refers to any nucleotide sequence that is preferably co-introduced with the gene of interest, uherein a selective advantage is conferred to a cell transformed u ith the said selectable marker gene.
The term "marker compound" or "selective agent" is the compound or nutrient which only the successfully transformed cells are able to metabolize thereby allowing the selection of the transformed cells over the non-transformed cells by virtue ol transformation and expression of the selectable marker gene
The term "selective advantage" as used herein includes the terms selecti\e. metabolic and the physiological advantage and means the transformed cells arc able to grow more quickly than the disadvantaged (non-transformed) cells, or are advantageously able to utilize substrates (such as nutrient precursors, etc.) which disadvantaged cells are not able to utilize.
['he term "selecting" refers to the process of identifying and/or isolating the genetically transformed cells from the non-genetieally transformed cells using the method of the present invention.
The term "genetically transformed" includes transformation using recombinant DV\ techniques.
1'he term "vector" includes expression vectors and transformation vectors.
EXAMPLE 1
Cloning of Xylose Isomerase from a Thraustochytrid strain SC-I.
lotal RNA was isolated from three-day-old cultures of the Schizochyirium SC-I. a Thraustochytrid isolated from the backwaters of Goa. eDNA was synthesized from the mRNA using superscript Rnase (GibcoBRU, The cDNA was cloned into the Xot /-Sail site of pSPORTI vector and transformed into hcoli DH10B.
The primary cDNA library consists of 2 \ 106 clones, while the amplified library has a titer of 2 x 1010 clones/ml. EST clones were randomly picked and inserts amplified with SP6 and T7 primers. The 5' ends of the 2000 eDNA clones were randomi\ selected and sequenced with T7 primers. 5' end sequencing of clones from the eDNA library of SC-I led to the identification of cDNA clone of 1.5kb which encodes a full-length Xylose Isomerase (xy!A) cDNA of 1511 bp with a 5' U'l R of 158bp and a 3' UTR oi30bp. It has an ORF of 1481 bp.
The sequence of the CDS is given in the SEQ !D 1. It is the sequence of the full length Xylose Isomerase transcript of SC-I. The sequence translates into a protein of 440 amino acids. "I he amino acid sequence of the translated protein is represented in SEQ. ID 2. The sequence shows 74% homology to the Xylose isomerase of Arabidopsis lhaliana. It contains the complete X\ lose isomerase domain and has been designated as the xylose isomerase of SC-I. Presence of the complete Xylose isomerase domain in the 1.5kb sequence of SC-I desaturase has been represented in the IIG.NO I.
FIG. NO.2 represents the homology of the motif from SC-I to Xylose Isomerase domain.
EXAMPLE: 2
Cixlon optimization of the Xylose isomerase
The xvlose isomerase (xvlA) sequence of SC-I uses codons that are comparatively rarely used in plants; SC-I predominantly utilizes CGC to code for Argiiiine where onlv 9% of the plant codons for Arg are CGC. Hence, the CGC codons were replaced with more frequently used codons for arginine. fhe clone was subjected to two round*
of mulli-site directed mutagenesis tor substituting nucleotides prior to introduction into plants. The optimized sequence is represented in SEQ ID 3.
EXAMPLE: 3
Cloning of Xylose Isomerase into pGEX Expression vector
lo confirm that the codon optimized gene does transcribe and translate, the codon optimized SC-I XylA gene from pSPORTL was amplified with the forward primer (5'GCGCGGATCCATGGGTGAATTCTTTC3') containing an Bamlll site and the Reverse primer (S'GAAACTCGAGCTTGTCGATTAAGAAA'f GTATTGG I l'3') containing an Xhol site. The amplified PCR product (1323) was digested with Bamili and Xhol. pGEX--lT-3 is an expression vector used to express the proteins as fusion proteins with the 26-kDa glutathione S-transferase (GST under control of the tac promoter. pGEX-4T-3 was digested with Bam HI and Xhol and the PCR product (restricted with Bam HI and Xhol) cloned directional!;' between the two sites - the resultant clone was called pGEX-XI. Map of pGEX-XI has been represented in the MG.NO, 3.
Expression of the Xylose isomerase fusion protein in F.eoli
I'he pGEX-XI carrying the Xylose Isomerase gene was transformed into 1. coli 131.21. The transformed cells were selected on LB media containing lOOng/ml of Ampicillin. Colonies were picked up at random and were grown overnight in LB containing lOOug-ml of ampicillin. I % of these overnight cultures were used as starter cultures tor inoculating 5ml of LB broth containing lOOug/m! of ampicillin. Cultures were incubated till O.D. 600 reached approximate!; 0.6-0.7. 2 ml each of these cultures was induced with ImM ll'TG for 3 hrs. Simultaneously. 2ml of the culture was pelleted down as control without induction. The cell pellets were resuspended in lOOul sample buffer and 50i.il loaded onto a 10% SDS-PAGE gel. The induction is shown in the h'IG. NO 4.
A protein of 76KDa. the expected size of the GST-X; lose isomerase fusion protein, was observed in the induced cells of clones I and 2 while being absent from the uninduced cells. I bus the codon optimized xvlose isomerase is in the right reading frame and is capable of being transcribed and translated.
ORF from the Xylose isomerase clone and the restriction of the pCAMBIA-Xl with Xhol is represented in the FIG.NO.5
The ligation mix was transformed into DHB0B Vans formed colonies were picked up and the plasmid isolated from these colonies amplified with XI primers and sequenced with the same. Thus constructs carrying the XI gene in the right orientation and right frame were identified. The sequence of the gene, cloned in the right frame, is given in theSEIQID.4
I he FIG NO.d represents the sequence of full-length eodon optimized Xylose Isomerase transcript of SC-I in frame in pCAMBIA vector and the replacement of hpt with XI in pCAMBIA-CO-XI. The hpt gene coding for hygromycin phospho transferase cloned between Xho-I sites of vector pCAMBlAHOI has been replaced b\ eodon optimized Xylose isomerase in place of hygromycin and the resulting construct has been named pCAMBIA-Xl.
EXAMPLE5
Transformation oI'Brassica using xylose isomerase as positive selection marker
h is known that when genetic material is to be introduced into a population ol'cells b\ transformation, only a certain number of the cells arc successful!} transformed. Identification and selection of the transformed cells has traditional!} been accomplished using negative selection, whereby transformed cells are capable of survival on media containing an agent, which the} are able to degrade, while non-transformed cells are killed on the media, Hygromycin is the most common!} used antibiotic while the hygromycin phospho transference gene (hpt) in the construct used lor transformation provides resistance to the transformed cells grown in media containing the antibiotic. Kanamycin and herbicide (Phosphinolhricin) resistance are the other markers used for selection of brassica iransformanls.
I'hcse negative selection methods have certain disadvantages. While the non-transformed cells nta\ die because of the presence of antibiotics in the growth medium. the\ release toxins into the medium, which are inhibitor} and toxic to the transformed cells as well. Moreover, the presence of an antibiotic resistance gene in ingested plants and microorganisms is a matter of concern for environmental groups
and governmental authorities. In addition, selection of cells or tissues usim: negative selection requires precise timing of expression of the introduced genes in relation to the selection process. If the transgenic cells are treated with a toxic compound before the detoxifying gene is expressed or before enough gene products arc produced 10 ameliorate the action of the toxic compound, both the transgenic and the non-transgenic cells arc killed. If selection is delayed, the selection of transgenic cells or tissues may be hindered by. for example, shoot or callus formation from non-transgenic cells or tissues, which forms a barrier to the penetration of the compound used to select the transformed cells.
I he above disadvantages are overcome, to a substantial extent b> the method of positive selection which makes it possible to selectively grow transformed cells without damaging or killing the non-transformed cells in the population and without introduction of antibiotic or herbicide resistance genes.
Many plant species do not have the innate ability to metabolise xylose and hence fail to thrive on media where xylose is the sole carbon source. Transformation of such species with constructs carrying xylose isomerasc. as selection marker, would impart the transformed cells the ability to utilize xylose as the carbon source.
Transformation and selection in Brassica juncea. Plant Material:
for our study, we have used Brassica juncca. 'varuna ' \ selection from
Varanasi local, having plant height of 145-155 cm. erect and stout with moderak branching. Its leaves are medium in size, dark green, sparsely hairy on lower surface with purplish pigment at the base of leaves. Varuna is moderately resistant to Alternaria blight and Aphids. It is a medium duration variety (135-140 days) with oil content of 43% (21% linoleic acid) and yield of 20 -22 ntls'ha.
Seeds of Brassica juncea 'varuna ' were sterilised in 70% alcohol for 2 minutes and with 0.1% Mercuric Chloride for 5 minutes. The sterilized seeds were \ igoruusly washed 4-5 times with sterile water, followed by drying by blotting. These seeds were then germinated on half strength hormone free Murasbige and Skoog Medium MS media) solidified with 0.8% agar in tissue culture bottles (30-40 seeds'bottlei. The
seedlings were grown i'or 2 days in dark and 3 days in light (I6h light: 8h uarki photoperiod at 25" C in BOD. unit the cotyledons were fully expanded and hypoeotyls were 4 to 5 em long. Different explains were tested for their regeneration efficiency. Among these, the eoiyledonary petiole explains was found to have maximum potential for regeneration and were used for transformation.
Isolation of Cotyledonary petiole explant
Five days old healthy seedlings were collected and the bottom portion of the seedlings were cut and removed. The eoiyledonary petiole was isolated by giving a cut at the point of attachment of hypoeotyl and the petiole stem just ahove the men stem avoiding the inclusion of leaf primordial tissue. It is important that the scalpel blade is sharp, as petioles isolated with a good 'clean' cut surface (i.e. when the tissue is not lorn) respond best. Two explains per seedling were obtained each having a petiole length of 3-5 mm. Explants were collected and stored in eo cultivation media with petiole dipped in the media until further use.
EXAMPLE 6
Screening for capability to utilize xylose as carbon source
In order to determine if Brassica juncea is capable of using xylose as the carbon source, explants were cultured on media containing sucrose and Xylose respectively. !00 cotyledonar\ petiole explants were isolated and cultured in medium containing MS salts, ().2mg/l NAA. 2 mg/l BAP and X g'l Agar where the carbon source was a] 3.5% sucrose: b) 3% Xylose: c) no carbon source for 3 weeks. The effect of the carbon source on the explant war. observed at the end of 3 weeks. Represented in FIG. 7
Fxplants cultured in media containing xylose as the carbon source bleach or brown and die within 2-3 weeks. The explants grown in the absence of carbon source in the medium looked pale and unhealthy and did not callus, while explants grown in media containing sucrose were healthy and well developed. I lius. the Brassica juncea couledonarv petiole explants do not appear to be able to use xylose as a carbon source.
medium containing MS salts. 0.2mg/l NAA. 2mg/l BAP. 25g.'l D-Xylose. 5g. 1 Sucrose. 250mg/l Cefotaxime. 8g/l Agar. pH 5.6 and kepi under photoperiod of 16r light and 8hr dark condition for 4 weeks. These were then subcultured to Mnd selection medium containing MS salts. (>.lmg/l NAA. 3mg/| BAP. 2()n D-\}li>sc, Ig 1 Vic rose. 250mg'l sucrose. I50mg/1 Cefotaxime and 8g/l Agar with pi f 5.6 in light room
conditions of I6h light: 8h dark, at 25;,C temperature and 60% humidin.
■ Finalh ihe rooted plants arc removed from the bottles and Ihe roots are washed \\ ill] water. these plants are hardened by placing in bottles with tap water lor 2 da\s followed by transferring into plastic cups containing Red soil (20%) and vermieulite i80%) mixture for 4 days in light room conditions. These arc transferred lo sreen liott.se and maintained as such till it is complete!) acclimatized belbre transferrins: TO pots containing red soil and manure.
Selection and regeneration of transgenic shoots using positive selection in explains transformed with pCAVIBIA+XI construct has been represented in FIG. *■)
Stalling with 100 e\plants. 2-3 transgenic plants earning the hpt gene are obtained on transformation with pCAMBIA-1301. However, starting with the same number of explants. 80-85 explants show budding: 40 of the explants develop into shoollets in elongation media and ca. 35 plants survive to grow into plants, which show normal (lowering and seed set. The fully-grown '],, transgenic plants are health} and phenotypieally similar lo control plants. The\ produce the same amount of seeds (I 11 that are healths and weigh as much as untransfbrmed seeds.
EXAMPLE 11
Molecular Analysis of plants
Leases from T,i Plants obtained after transformation were screened for the selectable marker gene by amplification with XI primers respectively. Represented in M(i. ! 1. Ihe different stages of the X>lose Isomerase positive Brassiea juncea plants Lire shown in FIG. 10.
X\lose Isomerase^ I 5'CTC ICTCGAGCAACCATGGGTGAA I I C f I"ICC'3'
Forward Primer _______________„„
Xylose Isomerase- 5' GAAACTCGAGC ITG ICGATTAAC.AAA I G I A I'l GG IT-3*
Reverse Primer
Table 14. Primers used for amplification of xylose isomerase genes.
All the transgenic plants show integration of the XI gene into their genome as seen h\ amplification of the XI gene in the seed samples of the L, transgenic plants. Represented in FIG 12.
I hus. we report successful transformation of Brassica using X_\ lose Isomerase as the selection marker. An efficient;} of ea. 35 % is observed using the selection system using Xylose Isomerase (positive selection) compared to the transformation efficient o\' 15-23 % reported using herbicides and antibiotics resistance genes (negative selection) around the world so far.
Thus. Brassica has been successfully transformed using positive selection. The use of xylose isomerase of SCI for positive selection is an efficient method tor transformation of Brassica explains. This selection system is more efficient and results in larger number of transgenic plants than traditional antibiotic kanamyein. Hgromycin) and herbicide (phosphinothrieln) based systems. I inally. it also fulfills the demand of alternative selective markers and avoids the risk and en\ ironnicntal concern involved with the use of antibiotic resistance genes in the development of genetically modified plants.
MEDIA COMPOSITION
Murashige and Skoog (MS) salts:
l.9g;l KNO3 l.65g,lNH4\03 370mg/l MgS04 170mg'l KH;P04 440mg'l CaCk2H.O 15mgl MnS04.7ll:0 K.f.mg.l ZnS04.7H:(.) 6,2mg I hhBO.1 0.u25mg/ICuSO4.5H:O l).025mg/l C'oCI: 0.83mg
Documents
Application Documents
| # |
Name |
Date |
| 1 |
4274-chenp-2008 pct.pdf |
2011-09-04 |
| 2 |
4274-chenp-2008 others.pdf |
2011-09-04 |
| 3 |
4274-chenp-2008 form-5.pdf |
2011-09-04 |
| 4 |
4274-chenp-2008 form-3.pdf |
2011-09-04 |
| 5 |
4274-chenp-2008 form-13.pdf |
2011-09-04 |
| 6 |
4274-chenp-2008 form-1.pdf |
2011-09-04 |
| 7 |
4274-chenp-2008 drawings.pdf |
2011-09-04 |
| 8 |
4274-chenp-2008 description(complete).pdf |
2011-09-04 |
| 9 |
4274-chenp-2008 correspondence-others.pdf |
2011-09-04 |
| 10 |
4274-chenp-2008 claims.pdf |
2011-09-04 |
| 11 |
4274-chenp-2008 abstract.pdf |
2011-09-04 |