Sign In to Follow Application
View All Documents & Correspondence

Methods For Detecting Single Nucleotide Polymorphism (Snp) As Marker For Genetic Male Sterility (Gms) In Capsicum Annuum

Abstract: “METHODS FOR DETECTING SINGLE NUCLEOTIDE POLYMORPHISM (SNP) AS MARKER FOR GENETIC MALE STERILITY (GMS) IN CAPSICUM ANNUUM” ABSTRACT The present disclosure provides methods for identifying presence or absence of a gene associated with genetic male sterility (GMS) in a Capsicum annuum plant. This is done by analyzing SNP based markers that are tightly linked to genetic male sterility (gms) trait in said Capsicum annuum. Through this identification, the present disclosure also provides a useful method that allows distinguishing of a genetically sterile Capsicum annuum plant from a fertile Capsicum annuum plant. The present disclosure also provides methods that allow production of offsprings having the said GMS trait, and the plants or parts thereof.

Get Free WhatsApp Updates!
Notices, Deadlines & Correspondence

Patent Information

Application #
Filing Date
11 August 2022
Publication Number
07/2024
Publication Type
INA
Invention Field
COMPUTER SCIENCE
Status
Email
Parent Application

Applicants

Rallis India Limited
23rd Floor, Lodha Excelus, New Cuffe parade, Off Eastern Freeway, Wadala, Mumbai-400037, Maharashtra, India.

Inventors

1. SATISH KANUGANTI
23rd Floor, Lodha Excelus, New Cuffe parade, Off Eastern Freeway, Wadala, Mumbai-400037, Maharashtra, India
2. RAMANATHAN VAIRAMANI
23rd Floor, Lodha Excelus, New Cuffe parade, Off Eastern Freeway, Wadala, Mumbai-400037, Maharashtra, India
3. MUKESH KUMAR VARSHNEY
23rd Floor, Lodha Excelus, New Cuffe parade, Off Eastern Freeway, Wadala, Mumbai-400037, Maharashtra, India

Claims

1. A method of identifying presence or absence of a gene associated with genetic male sterility (GMS) in a Capsicum annuum plant or part thereof, said method comprising detecting at least one single nucleotide polymorphism (SNP) in chromosome 1 of the Capsicum annuum, wherein said SNP is detected in sequence selected from a group comprising: SEQ ID No. 1, SEQ ID No. 3, SEQ ID No. 5 and SEQ ID No. 7, or any combination thereof.

2. The method as claimed in claim 1, wherein said SNP is selected from a group comprising: a. SNP at 24th position of SEQ ID No. 1, wherein the SNP is characterized by deletion of T at said 24th position of SEQ ID No. 1; b. SNP at 21st position of SEQ ID No. 3, wherein the SNP is characterized by replacement of G with A at said 21st position of SEQ ID No. 3; c. SNP at 21st position of SEQ ID No. 5, wherein the SNP is characterized by replacement of C with T at said 21st position of SEQ ID No. 5; and d. SNP at 21st position of SEQ ID No. 7, wherein the SNP is characterized by replacement of G with A at said 21st position of SEQ ID No. 7.

3. The method as claimed in claim 2, wherein the corresponding sequence comprising said SNP is selected from a group comprising: a. SEQ ID No. 2; b. SEQ ID No. 4; c. SEQ ID No. 6; and d. SEQ ID No. 8, respectively.

4. The method as claimed in claim 3, wherein presence of at least one of the sequences selected from SEQ ID No. 2; SEQ ID No. 4; SEQ ID No. 6; and SEQ ID No. 8 in a Capsicum annuum plant or part thereof confirms presence of a gene associated with genetic male sterility (GMS).

5. A method of distinguishing a genetically sterile Capsicum annuum plant or part thereof from a fertile Capsicum annuum plant or part thereof, said method comprising detecting presence of at least one single nucleotide polymorphism (SNP) in chromosome 1 of the Capsicum annuum, wherein said SNP is detected in sequence selected from a group comprising: SEQ ID No. 1, SEQ ID No. 3, SEQ ID No. 5 and SEQ ID No. 7, or any combination thereof.

6. The method as claimed in claim 5, wherein said SNP is selected from a group comprising: a. SNP at 24th position of SEQ ID No. 1, wherein the SNP is characterized by deletion of T at said 24th position of SEQ ID No. 1; b. SNP at 21st position of SEQ ID No. 3, wherein the SNP is characterized by replacement of G with A at said 21st position of SEQ ID No. 3; c. SNP at 21st position of SEQ ID No. 5, wherein the SNP is characterized by replacement of C with T at said 21st position of SEQ ID No. 5; and d. SNP at 21st position of SEQ ID No. 7, wherein the SNP is characterized by replacement of G with A at said 21st position of SEQ ID No. 7.

7. The method as claimed in claim 5, wherein the sequence comprising the SNP co-segregates with a gene associated with genetic male sterility (GMS) in Capsicum annuum, and presence of at least one SNP indicates a genetically sterile Capsicum annuum plant or part thereof.

8. The method as claimed in claim 5, wherein presence of at least one of the sequences selected from SEQ ID No. 2; SEQ ID No. 4; SEQ ID No. 6; and SEQ ID No. 8 in a Capsicum annuum plant or part thereof confirms genetic sterility of the said Capsicum annuum.

9. The method as claimed in claim 1 or claim 5, wherein the method comprises obtaining nucleic acid from the Capsicum annuum plant or part thereof, and subjecting it to amplification or hybridization for detecting at least one single nucleotide polymorphism (SNP) in chromosome 1 of the plant.

10. The method as claimed in claim 9, wherein the amplification or hybridization is carried out in presence of primers or probes designed for detecting at least one single nucleotide polymorphism (SNP) in chromosome 1 of the plant.

11. The method as claimed in claim 1 or claim 5, wherein one or more of the SEQ ID No. 1, SEQ ID No. 3, SEQ ID No. 5 and SEQ ID No. 7 are present as part of genome of a fertile Capsicum annuum plant or part thereof.

12. The method as claimed in claim 1 or claim 5, wherein one or more of the SEQ ID No. 2, SEQ ID No. 4, SEQ ID No. 6 and SEQ ID No. 8 are present as part of genome of a sterile Capsicum annuum plant or part thereof.

13. The method as claimed in claim 1 or claim 5, wherein the sterility is genetic male sterility characterized by non-functional or non-viable pollen grains.

14. A method of producing a Capsicum annuum offspring having a genetic male sterility (GMS) trait, said method comprising: (a) crossing a first Capsicum annuum plant having at least one SNP detected in sequence selected from a group comprising: SEQ ID No. 1, SEQ ID No. 3, SEQ ID No. 5 and SEQ ID No. 7, or any combination thereof, with a second Capsicum annuum plant; and (b) selecting a progeny comprising at least one of the said SNPs to obtain a Capsicum annuum offspring characterized by the GMS trait.

15. The method as claimed in claim 14, wherein the first Capsicum annuum plant and the progeny comprises at least one of SEQ ID No. 2, SEQ ID No. 4, SEQ ID No. 6 and SEQ ID No. 8 as part of genome of a sterile Capsicum annuum.

16. The method as claimed in claim 14, wherein the selection of the progeny comprising the SNP is carried out by amplification or hybridization techniques.

17. The method as claimed in claim 14, wherein the progeny is selfed or crossed with a third or further Capsicum annuum plant to produce subsequent offspring generations having the genetic male sterility (GMS) trait, characterized by presence of at least one SNP in sequence selected from a group comprising: SEQ ID No. 1, SEQ ID No. 3, SEQ ID No. 5 and SEQ ID No. 7, or any combination thereof; or characterized by presence of at least one of SEQ ID No. 2, SEQ ID No. 4, SEQ ID No. 6 and SEQ ID No. 8.

18. A kit comprising at least one primer or probe for detecting at least one SNP selected from a group comprising: a. SNP at 24th position of SEQ ID No. 1, wherein the SNP is characterized by deletion of T at said 24th position of SEQ ID No. 1; b. SNP at 21st position of SEQ ID No. 3, wherein the SNP is characterized by replacement of G with A at said 21st position of SEQ ID No. 3; c. SNP at 21st position of SEQ ID No. 5, wherein the SNP is characterized by replacement of C with T at said 21st position of SEQ ID No. 5; and d. SNP at 21st position of SEQ ID No. 7, wherein the SNP is characterized by replacement of G with A at said 21st position of SEQ ID No. 7; along with amplification or hybridization reagents and an instruction manual.

19. A Capsicum annuum plant or part thereof having genetic male sterility (GMS) trait, characterized by presence of at least one SNP in sequence selected from a group comprising: SEQ ID No. 1, SEQ ID No. 3, SEQ ID No. 5 and SEQ ID No. 7, or any combination thereof; or characterized by presence of at least one of SEQ ID No. 2, SEQ ID No. 4, SEQ ID No. 6 and SEQ ID No. 8.

Specification

Description:TECHNICAL FIELD
The present disclosure generally relates to the field of plant breeding, and provides methods for identifying presence or absence of specific traits in a plant. More particularly, the present disclosure relates to identifying presence or absence of a gene associated with genetic male sterility (GMS) in a Capsicum annuum plant. This is done by analyzing SNP as markers that are tightly linked to genetic male sterility (GMS) trait in said Capsicum annuum. Through this identification, the present disclosure also provides a useful method that allows distinguishing of a genetically sterile Capsicum annuum plant from a fertile Capsicum annuum plant. The present disclosure also provides methods that allow production of offsprings having the said GMS trait, and the plants or parts thereof.
BACKGROUND OF THE DISCLOSURE
Male sterility refers to a condition which is characterized by the impairment of the male reproductive development as a result of underlying genetic causes and leads to the malformation of male gametes and/or pollen. Male sterility therefore leads to non-functional pollen grains being produced in flowering plants. Male sterility that is caused by nuclear genes is termed as genic or genetic male sterility (GMS).
Male sterility is often used for development of hybrids and helps in reducing the cost of hybrid seed production by eliminating the process of hand emasculation. Male sterile plants have non-functional or non-viable pollen grains, which are formed through a chain of vital processes during microsporogenesis. These processes are under the genetic control of many loci that mutation of any locus may result in formation of non-functional pollen grains or microspores and hence male sterility.
Both manual and open pollination procedures are used for large scale hybridization. The increasing importance of male-sterility stems from the growing involvement of seed companies in producing elite F1 hybrids.
Capsicum annuum is a species of the plant genus Capsicum native to southern North America, the Caribbean, and northern South America. This species is the most common and extensively cultivated of the five domesticated capsicums. The species encompasses a wide variety of shapes and sizes of peppers, both mild and hot, such as bell peppers, jalapeños, New Mexico chili, and cayenne peppers. The species is a source of popular sweet peppers and hot chiles with numerous varieties cultivated all around the world, along with its use in traditional medicine in some parts of the world.
Male sterility is of high importance in hybrid seed production of hot and sweet peppers. GMS is a simply inherited (usually monogenic recessive) and highly stable trait.
For hybrid seed production in chilli, hand emasculation is manually practiced in one of the inbred parental lines so that two inbreds can be crossed and F1 hybrid is produced. This hand emasculation is a tedious and labour intensive process and add extremely high seed production cost. However, if one of the inbred is converted into GMS background, the hand emasculation process can be completely eliminated thus significantly saving huge resources for commercial hybrid seed production. Since the GMS lines are maintained as sib population with 50% sterile plants and 50% fertile plants at every generation, all fertiles plants from one of the GMS inbred can be quickly eliminated even before field transplanting. The presence of confirmed sterile plants in the hybrid seed production plot ensures high quality seed. Any line can be converted into GMS line using conventional backcross breeding methods using the available GMS donor line. However, conventional breeding methods take at least 6 backcross generations and alternate selfing generations (because of recessive genetics) to identify heterozygous plant for backcrossing (10 field seasons/5 years). With the help of molecular markers associated with GMS gene, all selfing generations can be eliminated and conversions can be completed very quickly (50% lesser time). The GMS markers can be also utilized for parent sib-QC to confirm GMS trait purity before hybrid production
Different Genetic male sterility genes have been reported in Capsicum annuum so far and linked markers reported in a very few cases. However, these genes are spread across different chromosomes and available only in specific donor lines, thereby making it difficult to use in universally across breeding programs.
Hence, there is need for methods that allow faster trait introgression, eliminate additional selfing during BC stages, reduce commercial seed production cost by eliminating hand emasculation and improve commercial hybrid seed production quality by eliminating fertile plants even before they are transplanted. The present invention aims to solve these problems associated with current knowledge.
SUMMARY OF THE DISCLOSURE
Addressing the aforesaid need in the art, the present disclosure provides a method of identifying presence or absence of a gene associated with genetic male sterility (GMS) in a Capsicum annuum plant or part thereof, said method comprising detecting at least one single nucleotide polymorphism (SNP) in chromosome 1 of the Capsicum annuum.
In some embodiments, said SNP is detected in sequence selected from a group comprising: SEQ ID No. 1, SEQ ID No. 3, SEQ ID No. 5 and SEQ ID No. 7, or any combination thereof. Accordingly, the corresponding sequence comprising said SNP is selected from a group comprising SEQ ID No. 2; SEQ ID No. 4; SEQ ID No. 6; and SEQ ID No. 8, respectively.
In some embodiments, presence of at least one of the sequences selected from SEQ ID No. 2; SEQ ID No. 4; SEQ ID No. 6; and SEQ ID No. 8 in a Capsicum annuum plant or part thereof confirms presence of a gene associated with genetic male sterility (GMS).
The present disclosure also relates to a method of distinguishing a genetically sterile Capsicum annuum plant or part thereof from a fertile Capsicum annuum plant or part thereof, said method comprising detecting presence of at least one single nucleotide polymorphism (SNP) in chromosome 1 of the Capsicum annuum.
In some embodiments, said SNP is detected in sequence selected from a group comprising: SEQ ID No. 1, SEQ ID No. 3, SEQ ID No. 5 and SEQ ID No. 7, or any combination thereof. Accordingly, the corresponding sequence comprising said SNP is selected from a group comprising SEQ ID No. 2; SEQ ID No. 4; SEQ ID No. 6; and SEQ ID No. 8, respectively.
In some embodiments, the sequence comprising the SNP co-segregates with a gene associated with genetic male sterility (GMS) in Capsicum annuum, and presence of at least one SNP indicates a genetically sterile Capsicum annuum plant or part thereof.
The present disclosure also provides a method of producing a Capsicum annuum offspring having a genetic male sterility (GMS) trait, said method comprising: (a) crossing a first Capsicum annuum plant having at least one SNP detected in sequence selected from a group comprising: SEQ ID No. 1, SEQ ID No. 3, SEQ ID No. 5 and SEQ ID No. 7, or any combination thereof, with a second Capsicum annuum plant; and (b) selecting a progeny comprising at least one of the said SNPs to obtain a Capsicum annuum offspring characterized by the GMS trait.
In some embodiments, the first Capsicum annuum plant and the progeny comprises at least one of SEQ ID No. 2, SEQ ID No. 4, SEQ ID No. 6 and SEQ ID No. 8 as part of genome of a sterile Capsicum annuum.
In some embodiments, the selection of the progeny comprising the SNP is carried out by amplification or hybridization techniques.
The present disclosure also provides a kit comprising at least one primer or probe for detecting at least one SNP selected from a group comprising:
a. SNP at 24th position of SEQ ID No. 1, wherein the SNP is characterized by deletion of T at said 24th position of SEQ ID No. 1;
b. SNP at 21st position of SEQ ID No. 3, wherein the SNP is characterized by replacement of G with A at said 21st position of SEQ ID No. 3;
c. SNP at 21st position of SEQ ID No. 5, wherein the SNP is characterized by replacement of C with T at said 21st position of SEQ ID No. 5; and
d. SNP at 21st position of SEQ ID No. 7, wherein the SNP is characterized by replacement of G with A at said 21st position of SEQ ID No. 7;
along with amplification or hybridization reagents and an instruction manual.
The present disclosure also relates to a Capsicum annuum plant or part thereof having genetic male sterility (GMS) trait, characterized by presence of at least one SNP in sequence selected from a group comprising: SEQ ID No. 1, SEQ ID No. 3, SEQ ID No. 5 and SEQ ID No. 7, or any combination thereof; or characterized by presence of at least one of SEQ ID No. 2, SEQ ID No. 4, SEQ ID No. 6 and SEQ ID No. 8.
BRIEF DESCRIPTION OF THE ACCOMPANYING FIGURES
Figure 1 shows genetic representation of GMS segregation in plants.
Figure 2 shows field phenotype representation of GMS fertile and sterile plant flowers.
BRIEF DESCRIPTION OF THE ACCOMPANYING SEQUENCES
Sequence 1 represented as SEQ ID No. 1 is a Capsicum annuum sequence containing reference allele (T) at 24th position.
Sequence 2 represented as SEQ ID No. 2 is a Capsicum annuum sequence containing SNP allele where (T) at 24th position of SEQ ID No. 1 is deleted.
Sequence 3 represented as SEQ ID No. 3 is a Capsicum annuum sequence containing reference allele (G) at 21st position.
Sequence 4 represented as SEQ ID No. 4 is a Capsicum annuum sequence containing SNP allele (A) at 21st position of SEQ ID No. 3.
Sequence 5 represented as SEQ ID No. 5 is a Capsicum annuum sequence containing reference allele (C) at 21st position.
Sequence 6 represented as SEQ ID No. 6 is a Capsicum annuum sequence containing SNP allele (T) at 21st position of SEQ ID No. 5.
Sequence 7 represented as SEQ ID No. 7 is a Capsicum annuum sequence containing reference allele (G) at 21st position.
Sequence 8 represented as SEQ ID No. 8 is a Capsicum annuum sequence containing SNP allele (A) at 21st position of SEQ ID No. 7.
Sequence 9 represented as SEQ ID No. 9 is SEQ ID No. 1 as part of a larger genomic sequence.
Sequence 10 represented as SEQ ID No. 10 is SEQ ID No. 2 as part of a larger genomic sequence.
Sequence 11 represented as SEQ ID No. 11 is SEQ ID No. 3 as part of a larger genomic sequence.
Sequence 12 represented as SEQ ID No. 12 is SEQ ID No. 4 as part of a larger genomic sequence.
Sequence 13 represented as SEQ ID No. 13 is SEQ ID No. 5 as part of a larger genomic sequence.
Sequence 14 represented as SEQ ID No. 14 is SEQ ID No. 6 as part of a larger genomic sequence.
Sequence 15 represented as SEQ ID No. 15 is SEQ ID No. 7 as part of a larger genomic sequence.
Sequence 16 represented as SEQ ID No. 16 is SEQ ID No. 8 as part of a larger genomic sequence.
DETAILED DESCRIPTION OF THE DISCLOSURE
In view of the limitations discussed above, and to remedy the need in the art for better control on plant breeding, the present disclosure aims to provide methods for quick and easy identification of a sterile Capsicum annuum plant or part thereof. In particular, the present disclosure provides methods that allow identification of presence or absence of a gene associated with genetic male sterility (GMS) in a Capsicum annuum and facilitate distinguishing of sterile plants from their fertile counterparts. The methods of the present disclosure make use of genetic markers such as single nucleotide polymorphism (SNP) that are tightly linked to GMS trait in Capsicum annuum.
However, before describing the invention in greater detail, it is important to take note of the common terms and phrases that are employed throughout the present disclosure for better understanding of the technology provided herein.
Throughout the present disclosure, the terms ‘Single Nucleotide Polymorphism’ or ‘SNP’ or the likes are intended to convey the ordinary conventional meaning of the term known to a person skilled in the art and intends to cover a variation of a single nucleotide at a specific position in genome of a plant. Such a variation includes substitution, addition or deletion of the nucleotide at a given position. SNP within the ambit of the present disclosure therefore covers substitution, addition or deletion of any nucleotide selected from adenine (A), cytosine (C), guanine (G), and thymine (T), in a reference allele or sequence, with any nucleotide selected from adenine (A), cytosine (C), guanine (G), and thymine (T), in a SNP allele or sequence. Thus, the term ‘SNP allele’ or ‘SNP sequence’ as used interchangeably in the present disclosure intends to represent an allele or sequence which is different from the reference allele or sequence because of at least one substitution, addition or deletion in the reference allele or sequence. For example, reference in the present disclosure is made to SNP at ‘X’ position of SEQ ID No. ‘Y’, where SEQ ID No. ‘Y’ represents a reference allele or sequence, and once a nucleotide change has occurred at its position ‘X’, the sequence will then be represented by SEQ ID No. ‘Z’ (referred to as SNP allele or sequence).
In the present disclosure, any reference to wild type allele is meant to refer to a plant which is fertile, whereas any reference to SNP allele or mutated allele or mutant allele is meant to refer to a plant which is sterile and comprises at least one SNP of the present disclosure.
Throughout the present disclosure, the terms ‘Genetic Male Sterility’, ‘Genic Male Sterility’ or ‘GMS’ or the likes are intended to convey the ordinary conventional meaning of the term known to a person skilled in the art and intends to cover a condition in plants which is characterized by the impairment of the male reproductive development as a result of underlying genetic causes and leads to the malformation of male gametes and/or pollen (figure 2). GMS therefore leads to non-functional pollen grains being produced in flowering plants. Reference to GMS in the present disclosure is made with respect to the condition as such, as well as to the genetic trait of the plant. In embodiments of the present disclosure, reference to a sterile plant intends to cover a plant that is characterized by trait of GMS.
Throughout the present disclosure, the term ‘Capsicum annum’ is used to represent all plants belonging to said species of capsicum or peppers. Unless otherwise stated, any reference to Capsicum annum inherently covers reference to a Capsicum annum plant as a whole, or any part thereof, including its genome as a whole, or a part of the genome.
Accordingly, to reiterate, the present disclosure relates to a method of identifying presence or absence of a gene associated with genetic male sterility (GMS) in a Capsicum annuum plant or part thereof. The said method comprises detecting at least one single nucleotide polymorphism (SNP) in chromosome 1 of the Capsicum annuum.
In some embodiments, the SNP is detected in chromosome 1 Capsicum annuum comprising reference sequence selected from a group comprising: SEQ ID No. 1, SEQ ID No. 3, SEQ ID No. 5 and SEQ ID No. 7, or any combination thereof.
Accordingly, in some embodiments, the present disclosure relates to a method of identifying presence or absence of a gene associated with genetic male sterility (GMS) in a Capsicum annuum plant or part thereof, wherein the method comprises detecting at least one single nucleotide polymorphism (SNP) in SEQ ID No. 1 of chromosome 1 of the Capsicum annuum.
Similarly, in some embodiments, the present disclosure relates to a method of identifying presence or absence of a gene associated with genetic male sterility (GMS) in a Capsicum annuum plant or part thereof, wherein the method comprises detecting at least one single nucleotide polymorphism (SNP) in SEQ ID No. 3 of chromosome 1 of the Capsicum annuum.
Likewise, in some embodiments, the present disclosure relates to a method of identifying presence or absence of a gene associated with genetic male sterility (GMS) in a Capsicum annuum plant or part thereof, wherein the method comprises detecting at least one single nucleotide polymorphism (SNP) in SEQ ID No. 5 of chromosome 1 of the Capsicum annuum.
Similarly, in some embodiments, the present disclosure relates to a method of identifying presence or absence of a gene associated with genetic male sterility (GMS) in a Capsicum annuum plant or part thereof, wherein the method comprises detecting at least one single nucleotide polymorphism (SNP) in SEQ ID No. 7 of chromosome 1 of the Capsicum annuum.
In some embodiments, the present disclosure relates to a method of identifying presence or absence of a gene associated with genetic male sterility (GMS) in a Capsicum annuum plant or part thereof, wherein the method comprises detecting at least one single nucleotide polymorphism (SNP) in SEQ ID No. 1, SEQ ID No. 3, SEQ ID No. 5 and SEQ ID No. 7 of chromosome 1 of the Capsicum annuum.
In some embodiments, the method comprises detecting at least one single nucleotide polymorphism (SNP) in any combination of SEQ ID No. 1, SEQ ID No. 3, SEQ ID No. 5 and SEQ ID No. 7 of chromosome 1 of the Capsicum annuum.
For instance, in some embodiments, the method comprises detecting at least one single nucleotide polymorphism (SNP) in SEQ ID No. 1 and SEQ ID No. 3 of chromosome 1 of the Capsicum annuum. Similarly, in some embodiments, the method comprises detecting at least one single nucleotide polymorphism (SNP) in SEQ ID No. 1, SEQ ID No. 3 and SEQ ID No. 5 of chromosome 1 of the Capsicum annuum. Similarly, in some embodiments, the method comprises detecting at least one single nucleotide polymorphism (SNP) in SEQ ID No. 1, SEQ ID No. 3 and SEQ ID No. 7 of chromosome 1 of the Capsicum annuum. Similarly, in some embodiments, the method comprises detecting at least one single nucleotide polymorphism (SNP) in SEQ ID No. 1, SEQ ID No. 5 and SEQ ID No. 7 of chromosome 1 of the Capsicum annuum. Alternatively, in some embodiments, the method comprises detecting at least one single nucleotide polymorphism (SNP) in SEQ ID No. 1 and SEQ ID No. 5 of chromosome 1 of the Capsicum annuum. Similarly, in some embodiments, the method comprises detecting at least one single nucleotide polymorphism (SNP) in SEQ ID No. 1 and SEQ ID No. 7 of chromosome 1 of the Capsicum annuum.
Likewise, in some embodiments, the method comprises detecting at least one single nucleotide polymorphism (SNP) in SEQ ID No. 3 and SEQ ID No. 5 of chromosome 1 of the Capsicum annuum. Similarly, in some embodiments, the method comprises detecting at least one single nucleotide polymorphism (SNP) in SEQ ID No. 3 and SEQ ID No. 7 of chromosome 1 of the Capsicum annuum. Alternatively, in some embodiments, the method comprises detecting at least one single nucleotide polymorphism (SNP) in SEQ ID No. 3, SEQ ID No. 5 and SEQ ID No. 7 of chromosome 1 of the Capsicum annuum.
Similarly, in some embodiments, the method comprises detecting at least one single nucleotide polymorphism (SNP) in SEQ ID No. 5 and SEQ ID No. 7 of chromosome 1 of the Capsicum annuum.
In some embodiments, the SNP detected in chromosome 1 of Capsicum annuum comprising sequence selected from a group comprising: SEQ ID No. 1, SEQ ID No. 3, SEQ ID No. 5 and SEQ ID No. 7, or any combination thereof is selected from a group comprising:
a. SNP at 24th position of SEQ ID No. 1, wherein the SNP is characterized by deletion of T at said 24th position of SEQ ID No. 1;
b. SNP at 21st position of SEQ ID No. 3, wherein the SNP is characterized by replacement of G with A at said 21st position of SEQ ID No. 3;
c. SNP at 21st position of SEQ ID No. 5, wherein the SNP is characterized by replacement of C with T at said 21st position of SEQ ID No. 5; and
d. SNP at 21st position of SEQ ID No. 7, wherein the SNP is characterized by replacement of G with A at said 21st position of SEQ ID No. 7.
In some embodiments, the SNP allele or sequence corresponding to the reference sequences 1, 3, 5 and 7 is selected from a group comprising: SEQ ID No. 2; SEQ ID No. 4; SEQ ID No. 6; and SEQ ID No. 8, respectively.
Thus, when one or more of the SNPs of the present disclosure are present in Capsicum annuum, the said Capsicum annuum shall contain one or more sequence selected from a group comprising: SEQ ID No. 2; SEQ ID No. 4; SEQ ID No. 6; and SEQ ID No. 8.
Accordingly, since presence of one or more of SNPs of the present disclosure is associated with presence of GMS gene or trait in Capsicum annuum, it is clear that a Capsicum annuum comprising any one or more of SEQ ID No. 2; SEQ ID No. 4; SEQ ID No. 6; and SEQ ID No. 8 would be a sterile Capsicum annuum.
Thus, the SNPs of the present disclosure act as markers for detecting of GMS trait in Capsicum annuum.
Since the present disclosure employs SNPs as markers associated with gene for GMS, identification of these markers or SNPs also allows for distinguishing a genetically sterile Capsicum annuum plant or part thereof from a fertile Capsicum annuum plant or part thereof.
Thus, the present disclosure also relates to a method of distinguishing a genetically sterile Capsicum annuum plant or part thereof from a fertile Capsicum annuum plant or part thereof, said method comprising detecting presence of at least one single nucleotide polymorphism (SNP) in chromosome 1 of the Capsicum annuum.
In some embodiments, said SNP is detected in sequence selected from a group comprising: SEQ ID No. 1, SEQ ID No. 3, SEQ ID No. 5 and SEQ ID No. 7, or any combination thereof.
Accordingly, in some embodiments, the present disclosure relates to a method of distinguishing a genetically sterile Capsicum annuum plant or part thereof from a fertile Capsicum annuum plant or part thereof, wherein the method comprises detecting at least one single nucleotide polymorphism (SNP) in SEQ ID No. 1 of chromosome 1 of the Capsicum annuum.
Similarly, in some embodiments, the present disclosure relates to a method of distinguishing a genetically sterile Capsicum annuum plant or part thereof from a fertile Capsicum annuum plant or part thereof, wherein the method comprises detecting at least one single nucleotide polymorphism (SNP) in SEQ ID No. 3 of chromosome 1 of the Capsicum annuum.
Likewise, in some embodiments, the present disclosure relates to a method of distinguishing a genetically sterile Capsicum annuum plant or part thereof from a fertile Capsicum annuum plant or part thereof, wherein the method comprises detecting at least one single nucleotide polymorphism (SNP) in SEQ ID No. 5 of chromosome 1 of the Capsicum annuum.
Similarly, in some embodiments, the present disclosure relates to a method of distinguishing a genetically sterile Capsicum annuum plant or part thereof from a fertile Capsicum annuum plant or part thereof, wherein the method comprises detecting at least one single nucleotide polymorphism (SNP) in SEQ ID No. 7 of chromosome 1 of the Capsicum annuum.
In some embodiments, the present disclosure relates to a method of distinguishing a genetically sterile Capsicum annuum plant or part thereof from a fertile Capsicum annuum plant or part thereof, wherein the method comprises detecting at least one single nucleotide polymorphism (SNP) in SEQ ID No. 1, SEQ ID No. 3, SEQ ID No. 5 and SEQ ID No. 7 of chromosome 1 of the Capsicum annuum.
In some embodiments, the method of distinguishing a genetically sterile Capsicum annuum plant or part thereof from a fertile Capsicum annuum plant or part thereof, comprises detecting at least one single nucleotide polymorphism (SNP) in any combination of SEQ ID No. 1, SEQ ID No. 3, SEQ ID No. 5 and SEQ ID No. 7 of chromosome 1 of the Capsicum annuum.
In some embodiments, the SNP detected in chromosome 1 of Capsicum annuum comprising sequence selected from a group comprising: SEQ ID No. 1, SEQ ID No. 3, SEQ ID No. 5 and SEQ ID No. 7, or any combination thereof is selected from a group comprising:
a. SNP at 24th position of SEQ ID No. 1, wherein the SNP is characterized by deletion of T at said 24th position of SEQ ID No. 1;
b. SNP at 21st position of SEQ ID No. 3, wherein the SNP is characterized by replacement of G with A at said 21st position of SEQ ID No. 3;
c. SNP at 21st position of SEQ ID No. 5, wherein the SNP is characterized by replacement of C with T at said 21st position of SEQ ID No. 5; and
d. SNP at 21st position of SEQ ID No. 7, wherein the SNP is characterized by replacement of G with A at said 21st position of SEQ ID No. 7.
In some embodiments of the methods of the present disclosure, the sequence comprising the SNP co-segregates with a gene associated with genetic male sterility (GMS) in a Capsicum annuum, and presence of at least one SNP indicates a genetically sterile Capsicum annuum plant or part thereof.
In some embodiments, the SNP allele or sequence corresponding to the reference sequences 1, 3, 5 and 7 is selected from a group comprising: SEQ ID No. 2; SEQ ID No. 4; SEQ ID No. 6; and SEQ ID No. 8, respectively.
Thus, when one or more of the SNPs of the present disclosure are present in Capsicum annuum, the said Capsicum annuum shall contain one or more sequence selected from a group comprising: SEQ ID No. 2; SEQ ID No. 4; SEQ ID No. 6; and SEQ ID No. 8.
Accordingly, since presence of one or more of SNPs of the present disclosure is associated with GMS in Capsicum annuum, it is clear that a Capsicum annuum comprising any one or more of SEQ ID No. 2; SEQ ID No. 4; SEQ ID No. 6; and SEQ ID No. 8 would be a sterile Capsicum annuum.
Thus, the SNPs of the present disclosure act as markers for detecting of GMS trait in Capsicum annuum.
In some embodiments, each of the SNPs in sequences 1, 3, 5 and 7 occur within 60,000 base pairs of each other on chromosome 1 of Capsicum annuum. Thus, each of the four SNPs of the present disclosure are linked by presence on same chromosome (chromosome 1), close physical positioning within the chromosome and ability to co-segregate with GMS gene, for identification and use as a marker for sterile Capsicum annuum.
Since the methods of the present disclosure involve detection of one or more SNPs, the methods are performed on genetic sequences or nucleotide sequences obtained from a Capsicum annuum which is to be tested for presence or absence of the SNPs.
In some embodiments, the methods of the present disclosure comprise obtaining nucleic acid from the Capsicum annuum plant or part thereof, and subjecting it to amplification or hybridization for detecting at least one single nucleotide polymorphism (SNP) in chromosome 1 of the plant.
In some embodiments, the amplification is carried out by polymerase chain reactions, including but not limiting to techniques such as Kompetitive allele-specific PCR (KASP).
While KASP is a common genotyping technology for detecting SNPs, a person skilled in the art would readily understand that any alternative genotyping/detection method may also be employed for detecting presence or absence of the SNPs of the present disclosure. All such methods known to a person skilled in the art are accordingly envisaged and encompassed by the present disclosure. For the sake of clarity, it is reiterated that the primary aspect of the present disclosure revolves around detection of said SNPs, and not around the ways/means/manner in which such detection is carried out.
Accordingly, while the present disclosure provides sequences 1, 3, 5 and 7 that comprise respective positions at which the SNP must be present for use of the SNP as a GMS marker/indicator, the said sequences are only one type of representative sequences that have around 20 nucleotide bases on either side of each SNP position. A person skilled in the art would readily understand that the total length of the sequences can vary depending on the method or technology being employed for the detection of SNP. In some embodiments, the flanking sequence only acts as a template to design primers for appropriate detection of the SNP in each sequence.
An example of such variation in length is provided by sequences captured in SEQ ID Nos. 9 to 16. Here, SEQ ID No. 9 represents a larger sequence comprising SEQ ID No. 1, whereas SEQ ID No. 10 represents a larger sequence comprising SEQ ID No. 2.
Similarly, SEQ ID No. 11 represents a larger sequence comprising SEQ ID No. 3, and SEQ ID No. 12 represents a larger sequence comprising SEQ ID No. 4. Likewise, SEQ ID No. 13 represents a larger sequence comprising SEQ ID No. 5, and SEQ ID No. 14 represents a larger sequence comprising SEQ ID No. 6. Similarly, SEQ ID No. 15 represents a larger sequence comprising SEQ ID No. 7, and SEQ ID No. 16 represents a larger sequence comprising SEQ ID No. 8.
Thus, as was the case with SEQ ID Nos. 1, 3, 5, and 7, their corresponding larger sequences, SEQ ID Nos. 9, 11, 13 and 15 can also be used for detecting of SNPs in chromosome 1 of the Capsicum annuum.
Accordingly, as was the case with SEQ ID Nos. 2, 4, 6, and 8, if any of their corresponding larger sequences, SEQ ID Nos. 10, 12, 14 and 16 are found in chromosome 1 of the Capsicum annuum, the said Capsicum annuum would be a sterile Capsicum annuum.
Accordingly, in some embodiments, one or more of the SEQ ID No. 1, SEQ ID No. 3, SEQ ID No. 5, SEQ ID No. 7, SEQ ID No. 9, SEQ ID No. 11, SEQ ID No. 13 and SEQ ID No. 15 are present as part of genome of a fertile Capsicum annuum plant or part thereof.
On the other hand, in some embodiments, one or more of the SEQ ID No. 2, SEQ ID No. 4, SEQ ID No. 6, SEQ ID No. 8, SEQ ID No. 10, SEQ ID No. 12, SEQ ID No. 14 and SEQ ID No. 16 are present as part of genome of a sterile Capsicum annuum plant or part thereof.
Thus, depending on the technology employed for detecting the SNPs of the present disclosure, and the length of the genomic sequence used for such detection, appropriate primers or probes can be designed by a person skilled in the art.
In some embodiments, each of the SNPs in sequences 1, 3, 5 and 7 or sequences 9, 11, 13 and 15 occur within 60,000 base pairs of each other on chromosome 1 of Capsicum annuum.
The following table provides respective sequences and associated description in line with the present disclosure:
Sequence Identifier Sequence per se
(bold and underlined region represents the reference allele/corresponding SNP allele) Remarks
SEQ ID No. 1 –
Reference Allele GTTATGTTAAAATACAGCATATTTAACACAGAAAGAAACAGAGA
SNP is deletion of the highlighted thymine (T) at 24th position
SEQ ID No. 2 - SNP Allele GTTATGTTAAAATACAGCATATTAACACAGAAAGAAACAGAGA
SEQ ID No. 3 –
Reference Allele ATGCGATAAGCTAGGACACAGGATGCGAGAGTGTAGAGTAA
SNP is replacement of the highlighted guanine (G) at 21st position with adenine (A)
SEQ ID No. 4 –
SNP Allele ATGCGATAAGCTAGGACACAAGATGCGAGAGTGTAGAGTAA
SEQ ID No. 5 –
Reference Allele AATGACATTGTTACAATCAACGAAACTAGCAGTCGCAGATG
SNP is replacement of the highlighted cytosine (C) at 21st position with thymine (T)
SEQ ID No. 6 –
SNP Allele AATGACATTGTTACAATCAATGAAACTAGCAGTCGCAGATG
SEQ ID No. 7 –
Reference Allele AATTTTCAATGAACCAATGCGGCGTACTGGCCATCGCGTCG SNP is replacement of the highlighted guanine (G) at 21st position with adenine (A)
SEQ ID No. 8 –
SNP Allele AATTTTCAATGAACCAATGCAGCGTACTGGCCATCGCGTCG
SEQ ID No. 9 –
Reference Allele TTAGTATTACAAGTAGCAGTGGGAGGAAAATAGTTGTCAT
GGTTCTCTTTTTTTTACAAAAAAAAAAAAAAAAGTTGAAG
TTATGTTAAAATACAGCATATTTAACACAGAAAGAAACAG
AGAAGACATCAATCAACAGAAGGGAAGATGTTTACCCAAC
TCCAGTGAACAACATTCAAAGGTACATAAATGATTTCTTT
SEQ ID No. 1 as part of a larger genomic sequence
SEQ ID No. 10 –
SNP Allele TTAGTATTACAAGTAGCAGTGGGAGGAAAATAGTTGTCAT
GGTTCTCTTTTTTTTACAAAAAAAAAAAAAAAAGTTGAAG
TTATGTTAAAATACAGCATATTAACACAGAAAGAAACAG
AGAAGACATCAATCAACAGAAGGGAAGATGTTTACCCAAC
TCCAGTGAACAACATTCAAAGGTACATAAATGATTTCTTT
SEQ ID No. 2 as part of a larger genomic sequence
SEQ ID No. 11 –
Reference Allele TTGGTACCAATCTGCTTTACAGAGAATATGGTAAGAACCG
TAAGAGAGTGTGTAGAGCTGGCAGTGATGTATATTTTAGA
TGCGATAAGCTAGGACACAGGATGCGAGAGTGTAGAGTA
ATGGCTCAGAGGGAAAAGGATTTACGCCAACAAGGTCAG
TTCGACCATTCTTCAGCTCAGTCCGGTCGCCTGAATCAGCAG
SEQ ID No. 3 as part of a larger genomic sequence
SEQ ID No. 12 –
SNP Allele TTGGTACCAATCTGCTTTACAGAGAATATGGTAAGAACCG
TAAGAGAGTGTGTAGAGCTGGCAGTGATGTATATTTTAGA
TGCGATAAGCTAGGACACAAGATGCGAGAGTGTAGAGTA
ATGGCTCAGAGGGAAAAGGATTTACGCCAACAAGGTCAG
TTCGACCATTCTTCAGCTCAGTCCGGTCGCCTGAATCAGCAG
SEQ ID No. 4 as part of a larger genomic sequence
SEQ ID No. 13 –
Reference Allele TGGTACATGTTTACCACTGCAATGGATGAGCTAAATAACA
ATATACAAAACTAAGTTTTCATGATGCATGTTATTTACAAA
TGACATTGTTACAATCAACGAAACTAGCAGTCGCAGATGA
CTCGACCAAAGGTTGGAGTAGAGGAACACACTCTTCTAAG
ATAAATAGATGTAGGACGAGATATGAAGTGAAAGGTCAG
SEQ ID No. 5 as part of a larger genomic sequence
SEQ ID No. 14 –
SNP Allele TGGTACATGTTTACCACTGCAATGGATGAGCTAAATAACA
ATATACAAAACTAAGTTTTCATGATGCATGTTATTTACAAA
TGACATTGTTACAATCAATGAAACTAGCAGTCGCAGATGA
CTCGACCAAAGGTTGGAGTAGAGGAACACACTCTTCTAAG
ATAAATAGATGTAGGACGAGATATGAAGTGAAAGGTCAG
SEQ ID No. 6 as part of a larger genomic sequence
SEQ ID No. 15 –
Reference Allele GTCAGTAGGTGTCCGACGTGATCTCGATGCGCTGCATCGA
CTATTGCATAGATAAATATTTTTATCTAGCTCCCAGTGTAA
TTTTCAATGAACCAATGCGGCGTACTGGCCATCGCGTCGA
TTCCAACAACGTGGTGCATCGGTCTGCGCATTGCTAGGCCA
GTTGTTCATTCATTAAAAATAACATCCAGAGGGGTAAA
SEQ ID No. 7 as part of a larger genomic sequence
SEQ ID No. 16 –
SNP Allele GTCAGTAGGTGTCCGACGTGATCTCGATGCGCTGCATCGA
CTATTGCATAGATAAATATTTTTATCTAGCTCCCAGTGTAA
TTTTCAATGAACCAATGCAGCGTACTGGCCATCGCGTCGA
TTCCAACAACGTGGTGCATCGGTCTGCGCATTGCTAGGCCA
GTTGTTCATTCATTAAAAATAACATCCAGAGGGGTAAA
SEQ ID No. 8 as part of a larger genomic sequence

Since the SNP markers of the present disclosure are able to distinguish sterile Capsicum annuum, the present disclosure also provides a method of producing a Capsicum annuum offspring having a genetic male sterility (GMS) trait.
Accordingly, the present disclosure provides a method of producing a Capsicum annuum offspring having a genetic male sterility (GMS) trait, said method comprising: (a) crossing a first Capsicum annuum plant having at least one SNP detected in sequence selected from a group comprising: SEQ ID No. 1, SEQ ID No. 3, SEQ ID No. 5 and SEQ ID No. 7, or any combination thereof, with a second Capsicum annuum plant; and (b) selecting a progeny comprising at least one of the said SNPs to obtain a Capsicum annuum offspring characterized by the GMS trait.
Thus, in some embodiments, the present disclosure provides a method of producing a Capsicum annuum offspring having a genetic male sterility (GMS) trait, said method comprising: (a) crossing a first Capsicum annuum plant having at least one SNP detected in SEQ ID No. 1, with a second Capsicum annuum plant; and (b) selecting a progeny comprising at least one of the said SNPs to obtain a Capsicum annuum offspring characterized by the GMS trait.
Similarly, in some embodiments, the present disclosure provides a method of producing a Capsicum annuum offspring having a genetic male sterility (GMS) trait, said method comprising: (a) crossing a first Capsicum annuum plant having at least one SNP detected in SEQ ID No. 3, with a second Capsicum annuum plant; and (b) selecting a progeny comprising at least one of the said SNPs to obtain a Capsicum annuum offspring characterized by the GMS trait.
Likewise, in some embodiments, the present disclosure provides a method of producing a Capsicum annuum offspring having a genetic male sterility (GMS) trait, said method comprising: (a) crossing a first Capsicum annuum plant having at least one SNP detected in SEQ ID No. 5, with a second Capsicum annuum plant; and (b) selecting a progeny comprising at least one of the said SNPs to obtain a Capsicum annuum offspring characterized by the GMS trait.
Similarly, in some embodiments, the present disclosure provides a method of producing a Capsicum annuum offspring having a genetic male sterility (GMS) trait, said method comprising: (a) crossing a first Capsicum annuum plant having at least one SNP detected in SEQ ID No. 7, with a second Capsicum annuum plant; and (b) selecting a progeny comprising at least one of the said SNPs to obtain a Capsicum annuum offspring characterized by the GMS trait.
In some embodiments, the present disclosure provides a method of producing a Capsicum annuum offspring having a genetic male sterility (GMS) trait, said method comprising: (a) crossing a first Capsicum annuum plant having at least one SNP detected in SEQ ID No. 1, SEQ ID No. 3, SEQ ID No. 5 and SEQ ID No. 7, with a second Capsicum annuum plant; and (b) selecting a progeny comprising at least one of the said SNPs to obtain a Capsicum annuum offspring characterized by the GMS trait.
Accordingly, in some embodiments, the first Capsicum annuum plant and the progeny comprises at least one of SEQ ID No. 2, SEQ ID No. 4, SEQ ID No. 6 and SEQ ID No. 8 as part of genome of a sterile Capsicum annuum.
In some embodiments, the second Capsicum annuum plant is either fertile or sterile and is characterized by GMS trait.
In some embodiments, the second Capsicum annuum plant comprises wild type or reference allele as described here, and is fertile.
In some embodiments of the method of producing a Capsicum annuum offspring having a genetic male sterility (GMS) trait, the selection of the progeny comprising the SNP is carried out by amplification or hybridization techniques.
In some embodiments of the method of producing a Capsicum annuum offspring having a genetic male sterility (GMS) trait, the progeny is selfed or crossed with a third or further Capsicum annuum plant to produce subsequent offspring generations having the genetic male sterility (GMS) trait, characterized by presence of at least one SNP in sequence selected from a group comprising: SEQ ID No. 1, SEQ ID No. 3, SEQ ID No. 5 and SEQ ID No. 7, or any combination thereof; or characterized by presence of at least one of SEQ ID No. 2, SEQ ID No. 4, SEQ ID No. 6 and SEQ ID No. 8.
In some embodiments, a person skilled in the art would readily know and understand the best of use of the methods of the present disclosure purposes of breeding and developing commercially useful plant populations. The methods of the present disclosure are therefore useful for any breeding program that requires identification, selection and/or screening of sterile Capsicum annuum plants from a mixed population of fertile and sterile Capsicum annuum plants.
In some embodiments, once sterile Capsicum annuum plants are produced, the plants themselves can be cultivated in accordance with conventional procedures. The sterile progeny may be obtained through sexual reproduction. The seeds resulting from sexual reproduction can be recovered from the fruit of sterile plants and planted or otherwise grown as a means of propagation.
In some embodiments, the sterile progeny may also be obtained from sterile Capsicum annuum plants through asexual reproduction. Protoplast or propagules (e.g., cuttings, scions or rootstocks) can be recovered from sterile plants or parts thereof and may be employed to propagate sterile plants.
In some embodiments, the present disclosure also provides progeny of Capsicum annuum plants having GMS trait, produced by the presently described methods. As used herein, progeny include not only, without limitation, the products of any cross (be it a backcross or otherwise) between two plants, but all progeny whose pedigree traces back to the original cross.
In some embodiments, the present disclosure does not exclude combination of the current methods/markers along with one or more of previously known SNPs that co-segregate with the GMS trait and known to a person skilled in the art prior to the instant disclosure. Thus, any method that uses at least one of the SNPs of the present disclosure with or without previously known SNPs from the literature still fall within the ambit of the present disclosure.
In some embodiments, sterile Capsicum annuum plants are be used in breeding programs to combine GMS with additional traits of interest. In some embodiments GMS can be combined with any additional trait, including but not limited to disease resistant traits, yield traits, and fruit quality traits. For example, breeding programs can be used to combine the GMS in Capsicum annuum with one or more disease resistance traits, such as resistance to diseases caused by plant bacteria, virus and fungi. In some embodiments, the traits that are combined are co-inherited in subsequent crosses along with GMS.
As mentioned previously, the detection of SNPs within the ambit of the methods of the present disclosure is carried out through amplification or hybridization techniques, that involve use of primers or probes against the respective sequences containing the SNPs.
Accordingly, the present disclosure also provides a kit comprising at least one primer or probe for detecting at least one SNP selected from a group comprising:
a. SNP at 24th position of SEQ ID No. 1, wherein the SNP is characterized by deletion of T at said 24th position of SEQ ID No. 1;
b. SNP at 21st position of SEQ ID No. 3, wherein the SNP is characterized by replacement of G with A at said 21st position of SEQ ID No. 3;
c. SNP at 21st position of SEQ ID No. 5, wherein the SNP is characterized by replacement of C with T at said 21st position of SEQ ID No. 5; and
d. SNP at 21st position of SEQ ID No. 7, wherein the SNP is characterized by replacement of G with A at said 21st position of SEQ ID No. 7;
along with amplification or hybridization reagents and an instruction manual.
In some embodiments, the kit comprises at least one primer or probe for detecting the SNP at 24th position of SEQ ID No. 1, wherein the SNP is characterized by deletion of T at said 24th position of SEQ ID No. 1, along with amplification or hybridization reagents and an instruction manual.
In some embodiments, the kit comprises at least one primer or probe for detecting the SNP at 21st position of SEQ ID No. 3, wherein the SNP is characterized by replacement of G with A at said 21st position of SEQ ID No. 3, along with amplification or hybridization reagents and an instruction manual.
In some embodiments, the kit comprises at least one primer or probe for detecting the SNP at 21st position of SEQ ID No. 5, wherein the SNP is characterized by replacement of C with T at said 21st position of SEQ ID No. 5, along with amplification or hybridization reagents and an instruction manual.
In some embodiments, the kit comprises at least one primer or probe for detecting the SNP at 21st position of SEQ ID No. 7, wherein the SNP is characterized by replacement of G with A at said 21st position of SEQ ID No. 7, along with amplification or hybridization reagents and an instruction manual.
In some embodiments, the kit comprises at least one primer or probe for detecting the SNP at 24th position of SEQ ID No. 1, wherein the SNP is characterized by deletion of T at said 24th position of SEQ ID No. 1; SNP at 21st position of SEQ ID No. 3, wherein the SNP is characterized by replacement of G with A at said 21st position of SEQ ID No. 3; SNP at 21st position of SEQ ID No. 5, wherein the SNP is characterized by replacement of C with T at said 21st position of SEQ ID No. 5; and SNP at 21st position of SEQ ID No. 7, wherein the SNP is characterized by replacement of G with A at said 21st position of SEQ ID No. 7, along with amplification or hybridization reagents and an instruction manual.
Once the methods and kit of the present disclosure are employed a Capsicum annuum plant or part thereof having genetic male sterility (GMS) trait can be identified.
Accordingly, the present disclosure also relates to a Capsicum annuum plant or part thereof having genetic male sterility (GMS) trait, characterized by presence of at least one SNP in sequence selected from a group comprising: SEQ ID No. 1, SEQ ID No. 3, SEQ ID No. 5 and SEQ ID No. 7, or any combination thereof; or characterized by presence of at least one of SEQ ID No. 2, SEQ ID No. 4, SEQ ID No. 6 and SEQ ID No. 8.
In some embodiments, the present disclosure relates to a seed of Capsicum annuum having genetic male sterility (GMS) trait, characterized by presence of at least one SNP in sequence selected from a group comprising: SEQ ID No. 1, SEQ ID No. 3, SEQ ID No. 5 and SEQ ID No. 7, or any combination thereof; or characterized by presence of at least one of SEQ ID No. 2, SEQ ID No. 4, SEQ ID No. 6 and SEQ ID No. 8.
To identify the SNPs of the present disclosure, the inventors employed a novel approach to locate candidate regions co-segregating with GMS gene in sib-population extreme phenotype bulks. A modified bulk-WGS method was used to identify all potential variants across genome. Potential polymorphisms were declared as trait-associated variants using a new criteria/process. All potential sequence SNP variations shortlisted were further validated in sib-populations and breeding germplasm for haplotype association and validation for deployment. The experimental data confirmed high accuracy of SNP markers for eliminating fertile plants during commercial seed production (close to 96-100% accuracy).
Wild type marker allele/gene is present in most Capsicum annuum lines/varieties and it is dominant for fertility. Mutant marker allele (sterile) is tightly linked to GMS gene present in the GMS source is recessive for fertility. SNP marker can therefore clearly distinguish heterozygous fertile vs homozygous fertile allele and sterile allele in segregating populations or GMS female line, and this unique characteristic of the present SNP markers can easily save 50% of the time for GMS line conversion (conversion of any fertile line into GMS version) combined with foreground and background genome selection. Moreover, SNP markers can clearly distinguish GMS trait purity in any new or existing commercial GMS female lines and sterile plants can be eliminated immediately after seed germination rather than waiting till flowering data. Overall, these markers are helpful to reduce all additional selfing generations in the back-cross trait conversion program, thus significantly saving conversion time. Since (based on the genetics of the trait) only fertile plants are expected during BC1F1 to BC6F1 or later stages of all backcross conversion, plants must be selfed at alternate generations to identify heterozygous allelic configuration at GMS gene for backcrossing, which adds additional generations in GMS conversion program. Heterozygous fertile plants can be easily identified by markers linked to GMS gene without selfing requirement. The SNP markers will be helpful in the commercial female or any GMS female QC even with seed DNA or germinated seed based tissue because only sterile plants need to be retained in the field for commercial GMS based hybrid seed production.
In some embodiments, advantages of the present disclosure include but are not limited to:
• Tightly linked molecular markers can save 50% of the time in case of trait introgression;
• Completely eliminate additional selfing generations during BC stages;
• GMS forward breeding through linked markers completely eliminate trait introgression process and save significant amount of time and resources;
• Significant costs can be saved for commercial hybrids seed production since fertile plants can be eliminated before transplanting itself based on linked markers;
• No hand emasculation is required, which reduces labor costs; and
• Molecular markers tightly linked to genetic male sterility (ms) genes facilitate an efficient and rapid transfer of ms genes into different genetic backgrounds through marker-assisted backcrossing. These markers increase the efficacy of the male sterility genes for breeding, as they are useful in developing the male sterile versions of parental inbred lines of commercial hybrids through marker-assisted backcrossing, hybrid seed production, and genetic purity testing of hybrid seeds.

EXAMPLES
The present disclosure is further described with reference to the following examples, which are only illustrative in nature and should not be construed to limit the scope of the present disclosure in any manner.
Example 1 – Evaluation of GMS gene stability and phenotype consistency
To check the stability of GMS gene phenotype consistency (environmental influence on the trait expression), breeding crosses experiments were conducted at various generations including sib-population, F2, F3 and BC stages.
A sib-mating mapping population of our GMS source was planted at Hyderabad and phenotypically evaluated for fertility and sterility over seasons based on clear visual flower-anthers phenotype. Based on flowering data, a Mendelian segregation of 1F:1S genetic ratio, expected for single gene influence, was confirmed in 491G sib population (Table 1). Since it was a sib-mating population, only heterozygous fertile were expected in this population.
Total Plant Population Total sterile plants Total fertile plants
472 215 257
Table 1: Genetic analysis through phenotypic field evaluation in sib-mating population of 491G
The heterozygous nature of fertile plants from the same population was further confirmed by advancing random fertile plants as a head to row progeny to next generations (F2 – Table 2 / F3 – Table 3) and genetics was further confirmed as 3:1 for heterozygous fertile plants (figure 1).
Accession Number Generation Rows Total Sterile Plants Total Fertile Plants Sterile Plants Ratio Fertile Plants Ratio
HXD140491G F2 3 21 75 1 3.57
HXD140491G Sib cross
(Self seed) 3 54 44 1 0.81
HXD140491G Sib cross
(Self seed) 3 40 39 1 0.98
HXD140491G F2 1 7 25 1 3.57
HXD140491G F2 1 6 24 1 4.00
HXD140491G F2 1 5 20 1 4.00
HXD140491G F2 1 11 21 1 1.91
Table 2: Genetic analysis through phenotypic field evaluation in large GMS F2 population derived by selfing of random fertile plants from 491G sib mating population and original 491G sib-population.
Accession Number Source Rows Total Flowering Plants Total Sterile Plants Total Fertile Plants % of Sterile Plants % of Fertile Plants

HPXD140491G 28833-P1 2 30 9 21 30 70

HPXD140491G 28833-P10 2 9 3 6 33 67

HPXD140491G 28833-P14 2 38 12 26 32 68



HPXD140491G 28833-P38 2 25 6 19 24 76

HPXD140491G 28833-P15 1 11 0 11 0 100

HPXD140491G 28833-P26 1 11 3 8 27 73

Table 3: Genetic analysis through phenotypic field evaluation in F3 lines derived from fertile plants of 491G sib-mating population.

Example 2 – Genomic analysis of fertile and sterile plants for identification of putative markers and the position of markers in the genome chromosome
A random set of 10 fertile plants and 10 sterile plants were individually collected during Kharif-2019 field experiment and post DNA extraction two bulks were prepared (one fertile bulk and one sterile bulk by mixing DNA from individual plants of the respective phenotypic classes). A whole genome re-sequencing was performed for these two bulks using illumina nov-seq platform (~30X coverage) using standard methods followed by standard informatics for SNP and Indel discovery in two bulks. Six putative candidate markers, located on six different chromosomes differentiating these two bulks were identified by using a QTL-seq and a novel in-house method. Subsequently, all shortlisted markers were further screened in individual plants of each bulk by Sanger sequencing method for heterozyocity and homozygocity confirmation in fertile and sterile individual plants which were used to prepare fertile and sterile bulks, respectively, and marker-trait association.
Genetic analysis experiments based on field evaluation of original GMS source and its derived segregating populations were also conducted to identify how many genes are present in the original GMS line source and stability over years/seasons. The data confirmed a single gene responsible for fertility/sterility phenotype in the GMS line source, and further molecular mapping exercise confirmed its genetic and physical position on chromosome CHR 1-NC_029977.1.
Accordingly, Sanger sequencing method further narrowed down the candidate region on chromosome CHR 1-NC_029977.1 with significant association with field phenotypes. Based on marker allele field phenotype association in individual plants of each bulk, involvement of other chromosomes was ruled out.

Example 3 – Further analysis of SNP markers of Chromosome 1 of Capsicum annuum
Post sanger confirmation, a set of SNP markers on chromosome CHR 1-NC_029977.1 were further genotyped and validated for the GMS trait association using standard SNP genotyping methods in 491G sib-population, a larger F2 population, germplasm inbred pool and BC segregating breeding populations for prediction accuracy and genetic linkage confirmation. A set of 4 SNPs on chromosome CHR 1-NC_029977.1, either individual or joint haplotype found to be robust for GMS trait conversion and fertile/sterile plant selections.
Results & Inference: Based on the data collected and results obtained, the following inference is drawn with respect to correlation of the respective SNPs with the resulting phenotype, and in-turn with co-segregation of the GMS gene:
1. Chromosome 1_First Round GMS marker validation in 491G sib population (during Kharif season – August):
o Total Fertile Phenotype = 50 [no SNP detected]
o Total Sterile Phenotype = 43
? No. of plants in which SNP was detected in SEQ ID No. 1 = 42
? No. of plants in which SNP was detected in SEQ ID No. 3 = 42
Inference: As can be seen, about 98% of plants showed direct correlation between sterile phenotype and presence of at least one SNP of the present disclosure. Accordingly, this confirms co-segregation of the SNPs with the GMS trait.

2. Chromosome 1_First Round GMS marker validation in sib and inbred population (during Kharif season – August):
o Total Fertile Phenotype = 37 [no SNP detected in 26 plants]
o Total Sterile Phenotype = 5
? No. of plants in which SNP was detected in SEQ ID No. 1 = 5
? No. of plants in which SNP was detected in SEQ ID No. 3 = 5
Inference: As can be seen, all plants showed direct correlation between sterile phenotype and presence of at least one SNP of the present disclosure. Accordingly, this confirms co-segregation of the SNPs with the GMS trait.

3. Chromosome 1_Second Round GMS marker validation in 491G sib population (during Kharif season – October):
o Total Fertile Phenotype = 74 [no SNP detected]
o Total Sterile Phenotype = 77
? No. of plants in which SNP was detected in SEQ ID No. 1 = 75
? No. of plants in which SNP was detected in SEQ ID No. 3 = 74
Inference: As can be seen, about 96% of plants showed direct correlation between sterile phenotype and presence of at least one SNP of the present disclosure. Accordingly, this confirms co-segregation of the SNPs with the GMS trait.

4. Chromosome 1_Second Round GMS marker validation in BC3 population (during Kharif season – October):
o Total Fertile Phenotype = 27 [no SNP detected in 24 plants]
o Total Sterile Phenotype = 5
? No. of plants in which SNP was detected in SEQ ID No. 1 = 5
? No. of plants in which SNP was detected in SEQ ID No. 3 = 5
Inference: As can be seen, all plants showed direct correlation between sterile phenotype and presence of at least one SNP of the present disclosure. Accordingly, this confirms co-segregation of the SNPs with the GMS trait.

5. Chromosome 1_Third Round GMS marker validation in F2 population derived from fertile 491G (during Summer season – March):
o Total Fertile Phenotype = 464 [no SNP detected in 462 plants]
o Total Sterile Phenotype = 158
? No. of plants in which SNP was detected in SEQ ID No. 5 = 153
? No. of plants in which SNP was detected in SEQ ID No. 7 = 153
Inference: As can be seen, about 97% of plants showed direct correlation between sterile phenotype and presence of at least one SNP of the present disclosure. Accordingly, this confirms co-segregation of the SNPs with the GMS trait.

6. Chromosome 1_Third Round GMS marker validation in 491G derived F2 population (during Summer season – March):
o Total Fertile Phenotype = 55 [no SNP detected in 53 plants]
o Total Sterile Phenotype = 52
? No. of plants in which SNP was detected in SEQ ID No. 5 = 51
? No. of plants in which SNP was detected in SEQ ID No. 7 = 51
Inference: As can be seen, about 98% of plants showed direct correlation between sterile phenotype and presence of at least one SNP of the present disclosure. Accordingly, this confirms co-segregation of the SNPs with the GMS trait.
The genetic co-segregation data generated in Capsicum annuum plants across different seasons clearly confirm their tight linkage with a novel gene present in the original GMS source. The level of linkage and prediction ability (over 96%-100%) reported in the present study clearly demonstrates superiority of SNP markers and extremely low recombination between gene and marker.
As is well known in the art, unlinked markers generally show a normal Mendelian segregation pattern, and the same would be expected for SNP markers of the present disclosure as well. This is especially in view of the fact that no GMS genes have been reported on chromosome 1 of Capsicum annuum in the vicinity of any of the sequences 1, 3, 5 and 7 of the present disclosure.
However, on the contrary, the SNPs of the present disclosure show tight co-segregation with GMS trait, indicating presence of a novel GMS gene on chromosome 1 of Capsicum annuum, thereby making this invention surprising and unexpected.
Additional embodiments and features of the present disclosure will be apparent to one of ordinary skill in art based on the description provided herein. The embodiments herein provide various features and advantageous details thereof in the description. Descriptions of well-known/conventional methods and techniques are omitted so as to not unnecessarily obscure the embodiments herein.
The foregoing description of the specific embodiments fully reveals the general nature of the embodiments herein that others can, by applying current knowledge, readily modify and/or adapt for various applications such specific embodiments without departing from the generic concept, and, therefore, such adaptations and modifications should and are intended to be comprehended within the meaning and range of equivalents of the disclosed embodiments. It is to be understood that the phraseology or terminology employed herein is for the purpose of description and not of limitation. Therefore, while the embodiments in this disclosure have been described in terms of preferred embodiments, those skilled in the art will recognize that the embodiments herein can be practiced with modification within the spirit and scope of the embodiments as described herein.
Throughout this specification, the word “comprise”, or variations such as “comprises” or “comprising” wherever used, will be understood to imply the inclusion of a stated element, integer or step, or group of elements, integers or steps, but not the exclusion of any other element, integer or step, or group of elements, integers or steps. Similarly, terms such as “include” or “have” or “contain” and all their variations are inclusive and will be understood to imply the inclusion of a stated element, integer or step, or group of elements, integers or steps, but not the exclusion of any other element, integer or step, or group of elements, integers or steps.
The terms "about" or “approximately” are used herein to mean approximately, in the region of, roughly, or around. When the term "about" is used in conjunction with a numerical value/range, it modifies that value/range by extending the boundaries above and below the numerical value(s) set forth. In general, the term "about" is used herein to modify a numerical value(s) or a measurable value(s) such as a parameter, an amount, a temporal duration, and the like, above and below the stated value(s) by a variance of +/-20% or less, +/-10% or less, +/-5% or less, +/-1% or less, and +/-0.1% or less of and from the specified value, insofar such variations are appropriate to perform in the disclosed invention, and achieves the desired results and/or advantages as disclosed in the present disclosure. It is to be understood that the value to which the modifier “about” or “approximately” refers is itself also specifically, and preferably, disclosed.
With respect to the use of substantially any plural and/or singular terms herein, those having skill in the art can translate from the plural to the singular and/or from the singular to the plural as is appropriate to the context and/or application. The various singular/plural permutations may be expressly set forth herein for sake of clarity. As used in this specification and the appended claims, the singular forms “a,” “an” and “the” includes both singular and plural references unless the content clearly dictates otherwise. The use of the expression ‘at least’ or ‘at least one’ suggests the use of one or more elements or ingredients or quantities, as the use may be in the embodiment of the disclosure to achieve one or more of the desired objects or results. As such, the terms “a” (or “an”), “one or more”, and “at least one” can be used interchangeably herein.
Numerical ranges stated in the form ‘from x to y’ include the values mentioned and those values that lie within the range of the respective measurement accuracy as known to the skilled person. If several preferred numerical ranges are stated in this form, of course, all the ranges formed by a combination of the different end points are also included.
As regards the embodiments characterized in this specification, it is intended that each embodiment be read independently as well as in combination with another embodiment. For example, in case of an embodiment 1 reciting 3 alternatives A, B and C, an embodiment 2 reciting 3 alternatives D, E and F and an embodiment 3 reciting 3 alternatives G, H and I, it is to be understood that the specification unambiguously discloses embodiments corresponding to combinations A, D, G; A, D, H; A, D, I; A, E, G; A, E, H; A, E, I; A, F, G; A, F, H; A, F, I; B, D, G; B, D, H; B, D, I; B, E, G; B, E, H; B, E, I; B, F, G; B, F, H; B, F, I; C, D, G; C, D, H; C, D, I; C, E, G; C, E, H; C, E, I; C, F, G; C, F, H; C, F, I, unless specifically mentioned otherwise.
Any discussion of documents, acts, materials, devices, articles and the like that has been included in this specification is solely for the purpose of providing a context for the disclosure. It is not to be taken as an admission that any or all of these matters form a part of the prior art base or were common general knowledge in the field relevant to the disclosure as it existed anywhere before the priority date of this application.
While considerable emphasis has been placed herein on the particular features of this disclosure, it will be appreciated that various modifications can be made, and that many changes can be made in the preferred embodiments without departing from the principles of the disclosure. These and other modifications in the nature of the disclosure or the preferred embodiments will be apparent to those skilled in the art from the disclosure herein, whereby it is to be distinctly understood that the foregoing descriptive matter is to be interpreted merely as illustrative of the disclosure and not as a limitation.
All references, articles, publications, general disclosures etc. cited herein are incorporated by reference in their entireties for all purposes. However, mention of any reference, article, publication etc. cited herein is not, and should not be taken as, an acknowledgment or any form of suggestion that they constitute valid prior art or form part of the common general knowledge in any country in the world.
, Claims:We claim:
1. A method of identifying presence or absence of a gene associated with genetic male sterility (GMS) in a Capsicum annuum plant or part thereof, said method comprising detecting at least one single nucleotide polymorphism (SNP) in chromosome 1 of the Capsicum annuum, wherein said SNP is detected in sequence selected from a group comprising: SEQ ID No. 1, SEQ ID No. 3, SEQ ID No. 5 and SEQ ID No. 7, or any combination thereof.
2. The method as claimed in claim 1, wherein said SNP is selected from a group comprising:
a. SNP at 24th position of SEQ ID No. 1, wherein the SNP is characterized by deletion of T at said 24th position of SEQ ID No. 1;
b. SNP at 21st position of SEQ ID No. 3, wherein the SNP is characterized by replacement of G with A at said 21st position of SEQ ID No. 3;
c. SNP at 21st position of SEQ ID No. 5, wherein the SNP is characterized by replacement of C with T at said 21st position of SEQ ID No. 5; and
d. SNP at 21st position of SEQ ID No. 7, wherein the SNP is characterized by replacement of G with A at said 21st position of SEQ ID No. 7.
3. The method as claimed in claim 2, wherein the corresponding sequence comprising said SNP is selected from a group comprising:
a. SEQ ID No. 2;
b. SEQ ID No. 4;
c. SEQ ID No. 6; and
d. SEQ ID No. 8, respectively.
4. The method as claimed in claim 3, wherein presence of at least one of the sequences selected from SEQ ID No. 2; SEQ ID No. 4; SEQ ID No. 6; and SEQ ID No. 8 in a Capsicum annuum plant or part thereof confirms presence of a gene associated with genetic male sterility (GMS).
5. A method of distinguishing a genetically sterile Capsicum annuum plant or part thereof from a fertile Capsicum annuum plant or part thereof, said method comprising detecting presence of at least one single nucleotide polymorphism (SNP) in chromosome 1 of the Capsicum annuum, wherein said SNP is detected in sequence selected from a group comprising: SEQ ID No. 1, SEQ ID No. 3, SEQ ID No. 5 and SEQ ID No. 7, or any combination thereof.
6. The method as claimed in claim 5, wherein said SNP is selected from a group comprising:
a. SNP at 24th position of SEQ ID No. 1, wherein the SNP is characterized by deletion of T at said 24th position of SEQ ID No. 1;
b. SNP at 21st position of SEQ ID No. 3, wherein the SNP is characterized by replacement of G with A at said 21st position of SEQ ID No. 3;
c. SNP at 21st position of SEQ ID No. 5, wherein the SNP is characterized by replacement of C with T at said 21st position of SEQ ID No. 5; and
d. SNP at 21st position of SEQ ID No. 7, wherein the SNP is characterized by replacement of G with A at said 21st position of SEQ ID No. 7.
7. The method as claimed in claim 5, wherein the sequence comprising the SNP co-segregates with a gene associated with genetic male sterility (GMS) in Capsicum annuum, and presence of at least one SNP indicates a genetically sterile Capsicum annuum plant or part thereof.
8. The method as claimed in claim 5, wherein presence of at least one of the sequences selected from SEQ ID No. 2; SEQ ID No. 4; SEQ ID No. 6; and SEQ ID No. 8 in a Capsicum annuum plant or part thereof confirms genetic sterility of the said Capsicum annuum.
9. The method as claimed in claim 1 or claim 5, wherein the method comprises obtaining nucleic acid from the Capsicum annuum plant or part thereof, and subjecting it to amplification or hybridization for detecting at least one single nucleotide polymorphism (SNP) in chromosome 1 of the plant.
10. The method as claimed in claim 9, wherein the amplification or hybridization is carried out in presence of primers or probes designed for detecting at least one single nucleotide polymorphism (SNP) in chromosome 1 of the plant.
11. The method as claimed in claim 1 or claim 5, wherein one or more of the SEQ ID No. 1, SEQ ID No. 3, SEQ ID No. 5 and SEQ ID No. 7 are present as part of genome of a fertile Capsicum annuum plant or part thereof.
12. The method as claimed in claim 1 or claim 5, wherein one or more of the SEQ ID No. 2, SEQ ID No. 4, SEQ ID No. 6 and SEQ ID No. 8 are present as part of genome of a sterile Capsicum annuum plant or part thereof.
13. The method as claimed in claim 1 or claim 5, wherein the sterility is genetic male sterility characterized by non-functional or non-viable pollen grains.
14. A method of producing a Capsicum annuum offspring having a genetic male sterility (GMS) trait, said method comprising: (a) crossing a first Capsicum annuum plant having at least one SNP detected in sequence selected from a group comprising: SEQ ID No. 1, SEQ ID No. 3, SEQ ID No. 5 and SEQ ID No. 7, or any combination thereof, with a second Capsicum annuum plant; and (b) selecting a progeny comprising at least one of the said SNPs to obtain a Capsicum annuum offspring characterized by the GMS trait.
15. The method as claimed in claim 14, wherein the first Capsicum annuum plant and the progeny comprises at least one of SEQ ID No. 2, SEQ ID No. 4, SEQ ID No. 6 and SEQ ID No. 8 as part of genome of a sterile Capsicum annuum.
16. The method as claimed in claim 14, wherein the selection of the progeny comprising the SNP is carried out by amplification or hybridization techniques.
17. The method as claimed in claim 14, wherein the progeny is selfed or crossed with a third or further Capsicum annuum plant to produce subsequent offspring generations having the genetic male sterility (GMS) trait, characterized by presence of at least one SNP in sequence selected from a group comprising: SEQ ID No. 1, SEQ ID No. 3, SEQ ID No. 5 and SEQ ID No. 7, or any combination thereof; or characterized by presence of at least one of SEQ ID No. 2, SEQ ID No. 4, SEQ ID No. 6 and SEQ ID No. 8.
18. A kit comprising at least one primer or probe for detecting at least one SNP selected from a group comprising:
a. SNP at 24th position of SEQ ID No. 1, wherein the SNP is characterized by deletion of T at said 24th position of SEQ ID No. 1;
b. SNP at 21st position of SEQ ID No. 3, wherein the SNP is characterized by replacement of G with A at said 21st position of SEQ ID No. 3;
c. SNP at 21st position of SEQ ID No. 5, wherein the SNP is characterized by replacement of C with T at said 21st position of SEQ ID No. 5; and
d. SNP at 21st position of SEQ ID No. 7, wherein the SNP is characterized by replacement of G with A at said 21st position of SEQ ID No. 7;
along with amplification or hybridization reagents and an instruction manual.
19. A Capsicum annuum plant or part thereof having genetic male sterility (GMS) trait, characterized by presence of at least one SNP in sequence selected from a group comprising: SEQ ID No. 1, SEQ ID No. 3, SEQ ID No. 5 and SEQ ID No. 7, or any combination thereof; or characterized by presence of at least one of SEQ ID No. 2, SEQ ID No. 4, SEQ ID No. 6 and SEQ ID No. 8.

Documents

Application Documents

# Name Date
1 202221045910-STATEMENT OF UNDERTAKING (FORM 3) [11-08-2022(online)].pdf 2022-08-11
3 202221045910-Sequence Listing in PDF [11-08-2022(online)].pdf 2022-08-11
4 202221045910-FORM 1 [11-08-2022(online)].pdf 2022-08-11
5 202221045910-DRAWINGS [11-08-2022(online)].pdf 2022-08-11
6 202221045910-DECLARATION OF INVENTORSHIP (FORM 5) [11-08-2022(online)].pdf 2022-08-11
7 202221045910-COMPLETE SPECIFICATION [11-08-2022(online)].pdf 2022-08-11
8 202221045910-FORM-26 [12-10-2022(online)].pdf 2022-10-12
9 Abstract1.jpg 2022-11-10
10 202221045910-Proof of Right [09-12-2022(online)].pdf 2022-12-09
11 202221045910-FORM 18 [19-03-2024(online)].pdf 2024-03-19