Abstract: The present disclosure relates to an architecture of energy redistribution that can sustain the increased formation of cofactors like NADH/NADPH and key metabolites like pyruvate that are implicated in the production of isobutanol through biotransformation. Genetically modified microorganisms comprising altered genes are disclosed wherein said alteration optionally along with subjecting the genetically modified microorganism to nutrient stress induces redistribution of energy ultimately resulting in maximum production of isobutanol.
1. A genetically modified micro-organism comprising altered genes, selected from a group comprising ackA, ldhA, adhE and kivD or any combination thereof.
2. The genetically modified micro-organism as claimed in claim 1, wherein the micro-organism is Escherichia coli strain B; and wherein the Escherichia coli strain B is selected from a group comprising Escherichia coli BL21 and Escherichia coli BL21 (DE3).
3. The genetically modified micro-organism as claimed in claims 1 and 2, wherein the Escherichia coli strain B comprising the altered genes is capable of survival under nitrogen deficient condition.
4. The genetically modified micro-organism as claimed in claim 3, wherein the nitrogen deficiency leads to the activation of ilvG gene even under anaerobic condition.
5. The genetically modified micro-organism as claimed in claim 1, wherein expression of the gene is altered to facilitate redistribution of energy for optimizing biochemical pathway for production of isobutanol.
6. The genetically modified micro-organism as claimed in claim 5, wherein the production of isobutanol is enhanced by at least 2 fold under nitrogen deficient condition.
7. The genetically modified micro-organism as claimed in claim 5, wherein the expression of the gene is altered by method selected from a group comprising knock out and engineering of the gene or any combination of method thereof.
8. The genetically modified micro-organism as claimed in claims 5 and 7, wherein the expression of the gene is altered by knocking out of the gene selected from a group comprising ackA, ldhA and adhE, or any combination thereof; and wherein the expression of the gene is altered by engineering of codon optimized ketoisovalerate decarboxylase (KIVD) sequence set forth as SEQ ID No. 1.
9. The genetically modified micro-organism as claimed in claim 8, wherein the kivD gene is isolated from bacterium Lactococcus lactis and codon-optimized for Escherichia coli to obtain said sequence.
10. A process for obtaining a genetically modified micro-organism comprising altered genes, selected from a group comprising ackA, ldhA, adhE and kivD or any combination thereof, said process comprising altering expression of the genes by: a) knocking out a gene selected from a group comprising ackA, ldhA and adhE, or any combination thereof; or b) engineering of the codon optimized ketoisovalerate decarboxylase (KIVD) sequence set forth as SEQ ID No. 1; or any combination of alterations thereof.
11. The process as claimed in claim 10, wherein the micro-organism is Escherichia coli strain B; and wherein the Escherichia coli strain B is selected from a group comprising Escherichia coli BL21 and Escherichia coli BL21 (DE3).
12. The process as claimed in claim 10, wherein expression of the gene is altered to facilitate redistribution of energy for optimizing the biochemical pathway for production of isobutanol.
13. The process as claimed in claim 12, wherein the production of isobutanol is enhanced by at least 2 fold under nitrogen deficient condition.
14. The process as claimed in claim 10, wherein the knocking out of the gene is carried out by method comprising acts of: a) growing phage on donor strain for packaging of genome fragment with antibiotic marker to obtain phage lysate; b) infecting recipient strain with the phage lysate to integrate the genome fragment by homologous recombination; and c) identifying the recipient strain through the antibiotic marker to confirm knocking out of gene to obtain single knock out.
15. The process as claimed in claim 10, wherein the knocking out of more than one of the genes is carried out by method comprising acts of: a) obtaining single knock out as claimed in claim 14; b) transforming the single knock out with plasmid expressing flippase employed in FLP-FRT system; c) excising gene flanked by the flippase to obtain a knock out of two genes or a double knock out; optionally d) conducting the step b) with the double knock out of step c) to obtain a knock out of three genes or a triple knock out.
16. A method for inducing redistribution of energy within a micro-organism, said method comprising act of: (a) altering expression of genes corresponding to biomolecules involved in predetermined biochemical pathways within the micro-organism; or (b) growing the micro-organism under nutrient stress condition; or performing a combination of steps (a) and (b), to induce the redistribution of energy.
17. The method as claimed in claim 16, wherein the step (a) comprises acts of: a) identifying biochemical pathway responsible for distribution of energy within a microorganism; b) identifying biomolecule participating in said distribution of energy and the corresponding gene involved in the pathway of step a); c) altering expression of said genes to modulate the participation of said biomolecules for inducing said redistribution of energy.
18. The method as claimed in claim 16, wherein the nutrient stress is caused by deficiency of nitrogen in conditions employed for the growth of micro-organism.
19. The method as claimed as claim 16, wherein the micro-organism is Escherichia coli strain B; and wherein the Escherichia coli strain B is selected from a group comprising Escherichia coli BL21 and Escherichia coli BL21 (DE3).
20. The method as claimed in claim 17, wherein the identification of the biochemical pathway and said biomolecules is carried out by conventional methods; and wherein the biomolecule is selected from a group comprising NADH, NAD, NADPH, NADP, ATP, ADP, GTP, GDP, FADH, FAD, Pyruvate, Ubiquinone and Acetyl CoA or any combination thereof.
21. The method as claimed in claim 16, wherein the gene involved in the biochemical pathway responsible for distribution of energy with the microorganism is selected from a group comprising ackA, ldhA, adhE and kivD or any combination thereof.
22. The method as claimed in claim 16, wherein the expression of the gene is altered by method selected from a group comprising knock out, overexpression and engineering of the gene or any combination of method thereof.
23. The method as claimed in claim 22, wherein the expression of the gene is altered by knocking out of the gene selected from a group comprising ackA, ldhA and adhE or any combination thereof; and wherein the expression of the gene is altered by engineering of codon optimized ketoisovalerate decarboxylase (KIVD) sequence set forth as SEQ ID No. 1.
24. The method as claimed in 16, wherein said redistribution of energy results in sustainable biomass levels for production of isobutanol.
25. A method for producing isobutanol from a genetically modified micro-organism, said method comprising act of; (a) obtaining genetically modified micro-organism comprising altered genes corresponding to biomolecules involved in predetermined biochemical pathways; and (b) optionally, growing the micro-organism obtained in step (a) under nutrient stress condition, to induce the redistribution of energy for production of said isobutanol.
26. The method as claimed in claim 25, wherein the micro-organism is Escherichia Coli strain B; and wherein the Escherichia coli strain B is selected from a group comprising Escherichia coli BL21 and Escherichia coli BL21 (DE3).
27. The method as claimed in claim 25, wherein the genetically modified micro-organism comprise altered genes, selected from a group comprising ackA, ldhA, adhE and kivD or any combination thereof.
28. The method as claimed in claim 25, wherein the redistribution of energy within the microorganism is induced by method as claimed in claim 16.
29. The method as claimed in claim 25, wherein the nutrient stress is caused by deficiency of nitrogen in conditions employed for the growth of micro-organism.
30. The method as claimed in claim 25, wherein the method enhances the production of the isobutanol at least by 2 fold when compared to the production of the isobutanol by wild type microorganism without said redistribution of energy.
TECHNICAL FIELD
The present disclosure relates to a novel architecture of energy redistribution in microbes that can sustain the increased formation of biofuel like isobutanol and key cofactors like NADH/NADPH. Genetically modified microorganisms comprising altered genes are disclosed wherein said alteration optionally along with subjecting the genetically modified microorganism to nutrient stress induces redistribution of energy ultimately resulting in maximum production of isobutanol.
BACKGROUND AND PRIOR ART OF THE DISCLOSURE
Butanol or butyl alcohol is a primary alcohol with a 4 carbon structure and the molecular formula of C4H9OH.There are four isomeric structures for butanol. The straight chain isomer with the alcohol functional group at the terminal carbon, which is also known as «-butanol or 1-butanol. The straight chain isomer with the alcohol at an internal carbon is sec-butanol or 2-butanol. The branched isomer with the alcohol at a terminal carbon is isobutanol, and the branched isomer with the alcohol at the internal carbon is fert-butanol; 2-methyl-2-propanol.
n-Butanol and isobutanol have limited solubility, while the other two isomers are fully miscible with water and hence less suitable as next-generation biofuel.
With the rapidly depleting global fossil fuel reservoirs, in the coming years there will be a limited availability of petroleum based fuel that drives the world economy. This has catalyzed a global awareness for the need of regenerative/alternate fuels. In this aspect, the generation of biofuel through biotransformation is slowly emerging as a viable alternative and is certain to play a pre-eminent role in the coming years. Currently the production of ethanol through whole cell biocatalysis is proving to be the best bet at manufacturing alternative biofuel. However it is now an accepted fact that isobutanol is a better choice as the
replacement/addon biofuel in comparison to ethanol. It is non-hygroscopic and has a higher energy content than ethanol, enabling better fuel economy.
Also, isobutanol requires no infrastructure modifications for transport and use because, unlike ethanol, isobutanol is not hygroscopic and is not corrosive to motor engines. It should also be noted that isobutanol can be blended with gasoline at higher ratios (16%) when compared to ethanol (10%), increasing both the green footprint of the blend and the market.
There is an extensive history in the production of butanol through microbial fermentation. ABE fermentation method- as the name suggests is a method used for the production of Acetone, Butanol (n-butanol) and Ethanol. The source used during this fermentation procedure is starch and this fermentation takes place under anaerobic conditions.
In 1861, Pasteur produced butanol by biological means for the first time. In 1905, Schardinger produced Acetone in a similar manner. In 1911, Fernbach used starch for the production of n-butanol.
Industrial exploitation of ABE fermentation started in 1916 with Charles Weizmann's isolation of Clostridium acetobutylicum. These solvents are produced in a ratio of 3-6-1, or 3 parts Acetone, 6 parts Butanol and 1 part Ethanol. The bacterium Clostridium acetobutylicum and Clostridium beijerinkii were used to produce these fuels in a moderate industrial scale. ABE fermentation however, lost out due to profitability factor when compared to the production of these solvents from petroleum. As such, there are no currently operating ABE plants. During the 1950s and 1960s, ABE fermentation was replaced by petroleum chemical plants. Due to different cost structures, ABE Fermentation was viable in South Africa until the early 1980s, with the last plant closing in 1983. Butanol due to its high energy density came to the fuel map about three decades ago. However, there was a choice to subsidize either Ethanol or Butanol and due to the production efficiency, the choice was Ethanol.
The key hurdles for n-butanol production were:
1) Use of Clostridium acetobutylicum for Butanol production.
• It is a slow growing bacteria.
• It is not easy to genetically manipulate and improve the strain.
2) Use of ABE fermentation process:-Production of Acetone, Butanol and Ethanol in the ratio 6:3:1.ABE fermentation process yield only 1.3 gallon Butanol/bushel of corn, where as yeast fermentation produces 2.5 gallon of Ethanol/bushel of corn.
3) Butanol is toxic to Clostridium acetobutylicum at the threshold level of 1-2%, thus hindering higher yield.
4) Poor distillation process:-Boiling point of n-butanol is around 118°C which is even higher than that of water. Thus its distillation is energy inefficient.
In the post genomic era, the use of systems biology and heterologous gene expression has ushered a revival in "biobutanol". Atsumi et al (2008) showed that integration of the Elrich pathway into the branched chain amino acid pathway of E.coli lead to the generation of isobutanol in E.coli under non-fermentive conditions. In a subsequent publication, it was shown that only the addition of heterologous gene KIVD (ketoisovalerate decarboxylase) from L.lactis was required as the conversion of isobutanal to isobutanol could be efficiently carried by the yqhD, one of the six native alcohol dehydrogenase present in E.coli (Atsumi 2010). In another subsequent publication, it was shown that in E.coli there are five isobutyraldehyde dehrogenases namely, yqhD, adhP, eutG, yjgB, fucO which have significant activity in converting isobutanal to isobutanol (Rodriguez etal, 2012).
One of the major drawbacks of the prior arts referred above is the unstability of the microorganisms (bacteria) caused due to several insertions and/or knock outs which ultimately affects the desired isobutanol production. In other words, it is well known that as more number of genes are altered, the bacterium becomes unstable. Therefore, the aim of the instant disclosure is to address such limitations in the art by providing a self-sustaining balanced system which can be efficiently employed for maximum isobutanol production.
STATEMENT OF THE DISCLOSURE:
Accordingly, the present disclosure relates to a genetically modified micro-organism comprising altered genes, selected from a group comprising ackA, ldhA, adhE and kivD or any combination thereof; a process for obtaining a genetically modified micro-organism comprising altered genes, selected from a group comprising ackA, ldhA, adhE and kivD or any combination thereof, said process comprising altering expression of the genes by: a) knocking out a gene selected from a group comprising ackA, ldhA and adhE, or any combination thereof, or b) engineering of the codon optimized ketoisovalerate
decarboxylase (KIVD) sequence set forth as SEQ ID No. 1, or any combination of alterations thereof; a method for inducing redistribution of energy within a micro-organism, said method comprising act of: (a) altering expression of genes corresponding to biomolecules involved in predetermined biochemical pathways within the micro-organism, or (b) growing the micro-organism under nutrient stress condition, or performing a combination of steps (a) and (b), to induce the redistribution of energy; and a method for producing isobutanol from a genetically modified micro-organism, said method comprising act of: (a) obtaining genetically modified micro-organism comprising altered genes corresponding to biomolecules involved in predetermined biochemical pathways, and (b) optionally, growing the micro-organism obtained in step (a) under nutrient stress condition, to induce the redistribution of energy for production of said isobutanol.
BRIEF DESCRIPTION OF ACCOMPANYING FIGURES
In order that the invention may be readily understood and put into practical effect, reference will now be made to exemplary embodiments as illustrated with reference to the accompanying figures. The figures together with a detailed description below, are incorporated in and form part of the specification, and serve to further illustrate the embodiments and explain various principles and advantages, in accordance with the present disclosure where:
Figure 1 depicts minimal pathways required for the production of isobutanol. Note: The enzyme Keto isovalerate decarboxylase (KIVD) is depicted in the figure as kdc.
Figure 2 depicts pyruvate flux distribution to multiple pathways.
Figure 3 depicts the computational model under simulation showing the simulation relationship between Nitrogen availability versus Biomass production rate when Isobutanol pathway is constrained to divert a given carbon flux.
Figure 4 depicts the computational model under simulation showing the simulation relationship between the ability for the microbe pathway to sustain a constrained level of carbon diversion into the Iso-butanol pathway when a minimal Nitrogen availability of 10 % of normal requirement is maintained.
Figure 5 depicts the computational model under simulation showing the simulation relationship between the ability for the microbe pathway with an ackA knockout to sustain a constrained level of carbon diversion into the Iso-butanol pathway when a minimal Nitrogen availability of 10 % of normal requirement is maintained along.
Figure 6 depicts the computational model under simulation showing the simulation relationship between the ability for the microbe pathway with an adhE knockout to sustain a constrained level of carbon diversion into the Iso-butanol pathway when a minimal Nitrogen availability of 10 % of normal requirement is maintained.
Figure 7 depicts the computational model under simulation showing the simulation relationship between the ability for the microbe pathway having a combined knockout of adhE, ackA and ldhA to sustain a constrained level of carbon diversion into the Iso-butanol pathway when a minimal Nitrogen availability of 10 % of normal requirement is maintained.
Figure 8A depicts the plasmid pUC57.
Figure 8B depicts the multiple cloning site on the plasmid pUC57.
Figure 9 depicts the plasmid pUCKl.
Figure 10 depicts the verification study for double knock out using colony PCR with ackA and adhE primers. Lane 1 and 2- ackA without Kan cassette (about 755 bps) with ackA primers, Lanes 5 and 7- adhE with Kan cassette with adhE primers (1900 bps), Lane 12- NEB 1 kb ladder (sizes in base pairs indicated).
Figure 11 depicts the verification study for triple knock out using colony PCR with ldhA primers. Lanes 1,2,4- ldhA with the Kan cassette amplified with ldhA primers (2.023 bps), lane 3-Gene ruler 1 kb marker (sizes are given next to the gel picture).
DETAILED DESCRIPTION OF THE DISCLOSURE
The present disclosure relates to a genetically modified micro-organism comprising altered genes, selected from a group comprising ackA, ldhA, adhE and kivD or any combination thereof.
In an embodiment of the present disclosure, the micro-organism is Escherichia coli strain B; and wherein the Escherichia coli strain B is selected from a group comprising Escherichia coli BL21 and Escherichia coli BL21 (DE3).
In another embodiment of the present disclosure, the Escherichia coli strain B comprising the altered genes is capable of survival under nitrogen deficient condition.
In yet another embodiment of the present disclosure, the nitrogen deficiency leads to the activation of ilvG gene even under anaerobic condition.
In still another embodiment of the present disclosure, expression of the gene is altered to facilitate redistribution of energy for optimizing biochemical pathway for production of isobutanol.
In still another embodiment of the present disclosure, the production of isobutanol is enhanced by at least 2 fold under nitrogen deficient condition.
In still another embodiment of the present disclosure, the expression of the gene is altered by method selected from a group comprising knock out and engineering of the gene or any combination of method thereof.
In still another embodiment of the present disclosure, the expression of the gene is altered by knocking out of the gene selected from a group comprising ackA, ldhA and adhE, or any combination thereof; and wherein the expression of the gene is altered by engineering of codon optimized ketoisovalerate decarboxylase (KIVD) sequence set forth as SEQ ID No. 1.
In still another embodiment of the present disclosure, the kivD gene is isolated from bacterium Lactococcus lactis and codon-optimized for Escherichia coli to obtain said sequence.
The present disclosure further relates to a process for obtaining a genetically modified micro-organism comprising altered genes, selected from a group comprising ackA, ldhA, adhE and kivD or any combination thereof, said process comprising altering expression of the genes by: a) knocking out a gene selected from a group comprising ackA, ldhA and adhE, or any
combination thereof, orb) engineering of the codon optimized ketoisovalerate decarboxylase (KIVD) sequence set forth as SEQ ID No. 1, or any combination of alterations thereof.
In an embodiment of the present disclosure, the micro-organism is Escherichia coli strain B; and wherein the Escherichia coli strain B is selected from a group comprising Escherichia coli BL21 and Escherichia coli BL21 (DE3).
In another embodiment of the present disclosure, expression of the gene is altered to facilitate redistribution of energy for optimizing the biochemical pathway for production of isobutanol.
In yet another embodiment of the present disclosure, the production of isobutanol is enhanced by at least 2 fold under nitrogen deficient condition.
In still another embodiment of the present disclosure, the knocking out of the gene is carried out by method comprising acts of: a) growing phage on donor strain for packaging of genome fragment with antibiotic marker to obtain phage lysate, b) infecting recipient strain with the phage lysate to integrate the genome fragment by homologous recombination, and c) identifying the recipient strain through the antibiotic marker to confirm knocking out of gene to obtain single knock out.
In still another embodiment of the present disclosure, the knocking out of more than one of the genes is carried out by method comprising acts of: a) obtaining single knock out as claimed in claim 14, b) transforming the single knock out with plasmid expressing flippase employed in FLP-FRT system, c) excising gene flanked by the flippase to obtain a knock out of two genes or a double knock out, optionally d) conducting the step b) with the double knock out of step c) to obtain a knock out of three genes or a triple knock out.
The present disclosure further relates to a method for inducing redistribution of energy within a micro-organism, said method comprising act of: (a) altering expression of genes corresponding to biomolecules involved in predetermined biochemical pathways within the micro-organism, or (b) growing the micro-organism under nutrient stress condition, or performing a combination of steps (a) and (b), to induce the redistribution of energy.
In an embodiment of the present disclosure, the alteration of expression of genes comprises acts of: a) identifying biochemical pathway responsible for distribution of energy within a microorganism, b) identifying biomolecule participating in said distribution of energy and the corresponding gene involved in the pathway of step a), c) altering expression of said genes to modulate the participation of said biomolecules for inducing said redistribution of energy.
In another embodiment of the present disclosure, the nutrient stress is caused by deficiency of nitrogen in conditions employed for the growth of micro-organism.
In yet another embodiment of the present disclosure, the micro-organism is Escherichia coli strain B; and wherein the Escherichia coli strain B is selected from a group comprising Escherichia coli BL21 and Escherichia coli BL21 (DE3).
In still another embodiment of the present disclosure, the identification of the biochemical pathway and said biomolecules is carried out by conventional methods; and wherein the biomolecule is selected from a group comprising NADH, NAD, NADPH, NADP, ATP, ADP, GTP, GDP, FADH, FAD, Pyruvate, Ubiquinone and Acetyl CoA or any combination thereof.
In still another embodiment of the present disclosure, the gene involved in the biochemical pathway responsible for distribution of energy with the microorganism is selected from a group comprising ackA, ldhA, adhE and kivD or any combination thereof.
In still another embodiment of the present disclosure, the expression of the gene is altered by method selected from a group comprising knock out, overexpression and engineering of the gene or any combination of method thereof.
In still another embodiment of the present disclosure, the expression of the gene is altered by knocking out of the gene selected from a group comprising ackA, ldhA and adhE or any combination thereof; and wherein the expression of the gene is altered by engineering of codon optimized ketoisovalerate decarboxylase (KIVD) sequence set forth as SEQ ID No. 1.
In still another embodiment of the present disclosure, the redistribution of energy results in sustainable biomass levels for production of isobutanol.
The present disclosure further relates to a method for producing isobutanol from a genetically modified micro-organism, said method comprising act of: (a) obtaining genetically modified micro-organism comprising altered genes corresponding to biomolecules involved in predetermined biochemical pathways, and (b) optionally, growing the micro-organism obtained in step (a) under nutrient stress condition, to induce the redistribution of energy for production of said isobutanol.
In an embodiment of the present disclosure, the micro-organism is Escherichia Coli strain B; and wherein the Escherichia coli strain B is selected from a group comprising Escherichia coli BL21 and Escherichia coli BL21 (DE3).
In another embodiment of the present disclosure, the genetically modified micro-organism comprise altered genes, selected from a group comprising ackA, ldhA, adhE and kivD or any combination thereof.
In yet another embodiment of the present disclosure, the redistribution of energy within the microorganism is induced by method as described above.
In still another embodiment of the present disclosure, the nutrient stress is caused by deficiency of nitrogen in conditions employed for the growth of micro-organism.
In still another embodiment of the present disclosure, the method enhances the production of the isobutanol at least by 2 fold when compared to the production of the isobutanol by wild type microorganism without said redistribution of energy.
Any heterologous expression involving the production of a foreign molecule in a microorganism like E.coli, requires a suitable nutrient source and redistribution of energy for optimal production. In a cell, high energy is generally associated with Pyruvate, Acetyl Coenzyme A, ATP and NADH and NADPH. The present disclosure focuses on optimizing the yield of isobutanol by redistributing the flux of these molecules by altered nutrient source, specific knockouts, expressions of desired homologous/heterologous genes or by any combination of said aspects.
The composite pathway connecting Glycolysis to Elrich pathway via. BCAA (branched chain amino acid) synthesis is depicted in Figure 1 which illustrates the minimal pathways required for the production of isobutanol. It is well accepted that in all living cells including microbes, the pathway from Glucose to ketoisovalerate is generally present. The first phase of the pathway which is from glucose to pyruvate, is a part of the Glycolytic pathway, while the second phase, which is from pyruvate to ketoisovalerate is a part of the amino acid valine synthesis pathway. The two enzymes viz. keto isovalerate decarboxylase (KIVD) and ADH (specific alchohol dehydrogenase whose substrate is isobutanal) that are required to convert ketoisovalerate to isobutanol are not universally present but are a part of the Elrich pathway present in microoraginsms like Lactococous latis. In a well characterised microbe like E.coli, there are several genes of the alcohol dehydrogenase family (YqhD, AdhP, FucO, EutG, YaiY, BetA, EutE, YjbB) which can convert the penultimate metabolite isobutanal to isobutanol with different catalytic efficiency and cofactor specificity. One critical feature of all the metabolites (the list is provided in Table 1) that are formed from glucose, i.e. glucose-6-phosphate to isobutanol they do not contain the element nitrogen. Thus, in an embodiment of the present disclosure, the biomass is generated by standard media (such as M9+ Glucose, Luria Bertani, etc.) and thereafter, the culture is shifted to a specialized media which has either zero or limited amount of nitrogen. Due to this shift, there is a large diversion of flux towards the production of isobutanol since all other pathways require the element Nitrogen. This aspect of shift of media wherein all other constituents except Nitrogen are at optimum concentration is termed as "Nitrogen Swap" (N-Swap). It is well known that nitrogen is an essential molecule for cellular growth and is a part of proteins and DNA. Thus, under a condition of nitrogen swap, the growth of the cell is halted. However, since other nutrients like carbon, hydrogen, oxygen etc. are present in the media, the metabolite flux will only proceed through Nitrogen independent pathway.
Table 1: List of metabolites that are formed from glucose, i.e. glucose-6-phosphate to isobutanol
Under anerobic growth conditions the enzyme ilvD gets inactivated by the NO formed. Further, under this condition, the ilvD bound dinitrosyl iron complex is an inactive enzyme complex making the cells BCAA auxotroph. Thus, the inactivation of BCAA pathway effectively halts the isobutanol production. On the contrary, an added advantage of N-swap as described in the present disclosure is that under limiting or no nitrogen conditions, the NO formation is effectively stunted which helps in keeping the flux active through the BCAA pathway. This complex has been shown to be activated under aerobic condition without the formation of new enzyme. This understanding of the anerobic switch is exploited by the present disclosure in devising a strategy of N-swap coupled with micro-aerophilic conditions through the fermentation process to maximize isobutanol production.
In yet another embodiment, it is evident from Figure 2 that in addition to the levels of enzymes (as shown in Fig 1), there are various other factors such as the concentration of metabolites like pyruvate and cofactors like NADH/NADPH which are central to the yield of isobutanol. In most microbes including E.coli, there are multiple pathways that flow out of pyruvate. Some of these pathways include the TCA cycle, the branched chain amino acid metabolism (BCAA), and pathways that lead to the production of acetate, lactate, ethanol and
formate which are secreted out of the organism. Figure 2 illustrates this multiple branch-outs. In a simple formulation, one can shut of some of these pathways and expect to increase the isobutanol production. However, shutting of all the excretory pathways is deleterious to the rate of growth of the organism. Thus, to maximize isobutanol output it is necessary to maximize the biomass formation.
In another embodiment, the present disclosure describes an in-silico formulation to identify the gene deletions/alterations that maximize the production of isobutanol without compromising the biomass formation.
The requirement for constant supply of energy is a common factor for any application of microorganisms for a synthetic process. A redistribution of energy is required within the cells to ensure a sustainable supply of intermediates for synthesis of the desired product. The ensuing cellular processes, as do most others, utilize energy molecules ATP, NADH and NADPH. This load of extra energy usage causes the growth rate of the cell to fall drastically thus jeopardizing the entire aim of synthesizing these molecules economically. The solution of this problem is in the generation of a self-sustaining balanced system which is achieved by the present disclosure.
In an exemplary embodiment of the present disclosure, a self-sustaining balanced system is achieved through an in-silico simulation of a computational model of the microbial cell. Based on the results of the simulation, the engineering/ re-construction of the strain (gene deletions and over-expressions in specific sections of the microbial pathways in the cell) is estimated so that possible strains that have the simultaneous capability of growth and yield of the product viz. isobutanol can be identified and subsequently constructed.
Another illustrative embodiment of the present disclosure relates to a genetically modified micro-organism comprising combination of biochemical pathways for redistribution of energy for the optimum production of isobutanol.
According to another aspect of the present disclosure, the embodiment relates to a method for inducing redistribution of energy within a micro-organism, said method comprising steps of-a) identifying biochemical pathway(s) to be optimized within said organism,
b) identifying native genes involved in the pathway(s) of step (a) along with introducing heterologous genes for optimizing the pathway(s) within the organism, and
c) altering the expression of genes of step (b) for inducing redistribution of energy.
According to another illustrative embodiment, the present disclosure relates to a method for producing isobutanol from a genetically modified micro-organism, said method comprising steps of-
a) identifying native genes involved in biochemical pathway(s) within the organism,
b) introducing heterologous genes for biochemical pathway(s) of the metabolite in the micro-organism and
c) altering expression of the genes to produce said metabolite.
In yet another illustrative embodiment, the in-silico simulation of a computational model of a microbial cell is described by the present disclosure, the methods and features of which are illustrated below:
E.coli in-silico Platform:
Simulating the functioning of the whole cell vis-a-vis its response to internal and external perturbations at the molecular and kinetic levels is carried out. The computational results described in this disclosure is based on an in-silico model of the microbe E.coli. Further, the same can been extended/extrapolated easily to other microorganisms by a person skilled in the art.
In the current phase, the genome of a number of organisms have been sequenced and nearly entire metabolic pathway constructed in chemical detail such that all the substrate inter-conversions are described in topological detail with few open ends. However this is akin to a static map. The present disclosure is able to convert the static map to a dynamic one by detailing the kinetic parameters of enzymes to enliven the static pathway platform. In a previous disclosure the first simulation of the bacterium E.coli computational model was successfully demonstrated with the platform which is briefly described as follows:
E.coli in-silico Platform-
The in-silico simulation of whole cell functioning and its response to internal and external
perturbations at the molecular and kinetic detail is carried out. Such an in-silico model is a
computational model of the E.coli. With the genome of a number of organisms sequenced and nearly entire metabolic pathway constructed in chemical detail, what remains is the dovetailing of the kinetic to the static pathway platform. The first simulation of the bacterium E.coli computational model is successfully demonstrated with the platform of the present disclosure. In this platform the control of the enzymatic and pathway functioning is simulated by interconnecting the behaviour of each enzyme in the pathway translating as an ability to sustain a rate of reaction flow with the necessary regulation parameters that provide the cross-talk between these enzymes as feedback and feed forward mechanisms, controlling growth from a given carbon source. This computational mathematical framework, built by using intercellular enzyme concentration and other control parameters responds in a similar fashion to perturbations the way the natural system in question would. This type of modelling has the ability to solve systems comprising of unlimited number (in thousands) of simultaneous control pathways interconnected in a complex way and able to maintain stoichiometry and provide a test platform for a given carbon source of a given mole quantity. The predictive power of this platform in E.coli is experimentally validated. Enzymes in a number of pathways including TCA, Glycolytic, Glyoxylate bypass, Branched chain amino acid synthesis, CoA biosynthesis, Nucleotide Biosynthesis and Nicotinamide Biosynthesis pathway are evaluated. Enzymes in pathways that are either vulnerable or relatively immune to inhibition of a specific type are delineated and experimentally corroborated. The disclosure herein show an example set of computations in usage of this computational model for isobutanol production from Glucose and the carbon source and the predicted changes that need to be done in re-engineering this organism to enable higher isobutanol yields and limits of mole to mole conversion of glucose to isobutanol.
The present disclosure is a continuum of the above wherein the concept of nutrient swap is tested out to identify which constructs including Knockouts and overexpressions yield the best production of isobutanol. The disclosure herein show an example set of computations in usage of this computational model for isobutanol production from Glucose and the carbon source and the predicted changes that need to be done in re-engineering the organism to enable higher isobutanol yields and limits of mole to mole conversion of glucose to isobutanol.
In an embodiment, a computational systemic model of the microorganism model is used to study the effects of nitrogen depletion referred as the "Nitrogen Swap" and the diversion of
the pyruvate flux into the targeted Isobutanol pathway. The computational model enables detection of limits of a possible computational solution to the system for producing Isobutanol against constrained conditions for growth. The solution set on this computational model for different constrained growth rates provide quantitative estimates of the nitrogen requirements to sustain the constrained growth.
The results of the computational model are depicted in Figures 3 to 7 wherein:
"Figure 3" shows the computational model under simulation showing the simulation relationship between Nitrogen availability Vs. Biomass production rate when Isobutanol pathway is constrained to divert a given carbon flux. '301' shows the reference biomass production with respect to Nitrogen availability as shown when there is no diversion of carbon flux through the Isobutanol pathway for computational analysis. This is treated as the control reference. Nitrogen availability is normalized to the maximum level needed with unit Glucose flow through the simulation model. The carbon source in this simulation is exclusively glucose. The simulation analysis aims at proving the biomass growth trends with various levels of Nitrogen available in the growth medium.
A second variation of constraining the model to force a percentage of the carbon flux through the isobutanol pathway is also made in the simulation to simulate biomass growth for these constraints for all selections of Nitrogen availability. Accordingly, '302' shows that with a 15 % re-routing carbon flux from Glucose through the Isobutanol pathway. Likewise, '303', '304' and '305' show the variation of Biomass production with respect to availability of nitrogen, 30%,45% and 60% respectively. The simulation results show that, for the computational model growth directly depends on availability of Nitrogen and increasing carbon diversion into the isobutanol pathways cuts back growth.
In summary, 'Figure 3' depicting the computational analysis provides a relationship between Nitrogen availability, Biomass production rate and the effect on the diversion of additional carbon flux available towards Isobutanol pathway. As we increase the percentage of carbon flux from 15% to 60%, although the Biomass production rate is reduced, the redistribution of carbon flux towards isobutanol production is feasible without inhibiting the biomass production completely.
"Figure 4" shows the computational model under simulation depicting the simulation relationship between the ability of the microbe pathway to sustain a constrained level of carbon diversion into the Iso-butanol pathway when a minimal Nitrogen availability of 10 % of normal requirement is maintained. The computational analysis further evaluates, with respect to the specific constrained minimum carbon flux made to flow through the Isobutanol pathway, the various other pathways like Acetate, Lactate, Etanol and carbon-dioxide etc. into which the glucose carbon source is also utilized as part of the carbon metabolism of the microbe. An assessment is made on this sum total of diversion, other than the iso-butanol pathway. This pooled diversion, in summation, is represented also in arbitrary units by 401 . "Degree Of Freedom" (DOF) is then defined as the quantitative estimate of a part of this pooled diversion that can be re-routed through the iso-butanol pathway by specific gene deletions to shut down respective parts of the pathways that constitute the summation previously estimated. With this analysis, 402 shows this DOF which is available to re-route additional carbon flux through the iso-butanol pathway. From this figure-4, it is estimated that for a constraint of diverting over 25 % carbon flux through the iso-butanol pathway, the DOF rapidly drops to zero from a sustainable limit of about 20 % through the isobutanol pathway. Over this range of constrained iso-butanol use of carbon from glucose feed, 402 remains reasonably constant signifying that the model predicts a stable level of producing other metabolites that represent carbon utilization including the major metabolites like Acetate , Lactate , Ethanol and Carbon-dioxide etc. Thus, in summary, Figure 4 indicates that microbe sustains when up to 20 % of carbon flux available is re-routed for 'Isobutanol production'.
"Figure 5" shows the computational model under simulation showing the simulation relationship between the ability for the microbe pathway to sustain a constrained level of carbon diversion into the Iso-butanol pathway when a minimal Nitrogen availability of 10 % of normal requirement is maintained and an ackA knockout is carried out. '502' shows the "Degree Of Freedom" (DOF) that is available to re-route additional carbon flux through the iso-butanol pathway with this knockout. The model results show that a 'ackA knockout' results in substantially reduced acetate production and therefore, the conserved carbon is routable through the Iso-butanol pathway as predicted by the DOF which is higher at the increased constraint of 45 % diversion to the isobutanol pathway.
In summary, 'Figure 5' depicts that with a combination of low Nitrogen availability of 10 % and ackA knockout, acetate production is substantially reduced and up to 45% additional carbon flux available can be diverted for isobutanol production.
"Figure 6" shows the computational model under simulation showing the simulation relationship between the ability for the microbe pathway to sustain a constrained level of carbon diversion into the Iso-butanol pathway when a minimal Nitrogen availability of 10 % of normal requirement is maintained and an adhE knockout is carried out. '602' shows the "Degree Of Freedom" (DOF) which is available to re-route additional carbon flux through the iso-butanol pathway with this knockout. The model results show that an adhE knockout results in substantially reduced Ethanol production and therefore, the conserved carbon is routable through the Iso-butanol pathway as predicted by the DOF which is higher at the increased constraint of 50 % diversion to the isobutanol pathway.
In summary, 'Figure 6' depicts that with to a combination of low Nitrogen availability of 10 % and adhE knockout, ethanol production is substantially reduced and up to 50% additional carbon flux available can be diverted for isobutanol production.
"Figure 7" shows the computational model under simulation showing the simulation relationship between the ability for the microbe pathway to sustain a constrained level of carbon diversion into the Iso-butanol pathway when a minimal Nitrogen availability of 10 % of normal requirement is maintained and a combined knockout of adhE, ackA and ldhA is carried out. '702' shows the "Degree Of Freedom" (DOF) that is available to re-route additional carbon flux through the iso-butanol pathway with this knockout set. The model results show that the conserved carbon is routable through the Iso-butanol pathway as predicted by the DOF which is higher with the combined knockouts.
In summary, 'Figure 7' depicts that with a combination of low Nitrogen availability of 10 % and (adhE+ ackA+ ldhA gene knockouts), up to 60% additional carbon flux available can be diverted for isobutanol production. Further, it is established that a combination of gene knock-outs results in a synergistic affect (i.e. 60% carbon diversion) when compared to individual knock-outs (45 and 50% respectively).
Thus, the in-silco computational simulation results as described above establishes that the yield of isobutanol can be maximized by redistributing the carbon flux which can be achieved by various factors such as altered nutrient source (Nitrogen availability), specific gene knockouts, expressions of desired homologous/heterologous genes or by any combination of said factors.
The present disclosure utilizes a codon optimized kivD gene sequence represented by SEQ ID NO. 1 and cloning the said sequence into plasmid puc57, to obtain a cloned plasmid named pucKl.
In an embodiment of the present disclosure, the in-vitro model comprising E.coli single knock outs are generated by way of P1 transduction system using P1 lysate and FLP-FRT system.
In another embodiment of the present disclosure, double and triple knock outs are also generated using the P1 transduction protocol.
Further, it is important to note that the present disclosure utilizes biological material which is available in the prior art and in public domain, and which has been suitably modified to arrive at the instant disclosure. Although the E. coli BL21 strain has not been sequenced till date, a closely related variant, E.coli BL21(DE3) has been. The two strains are represented as follows:
• BL21
E. coli B F- dcm ompT hsdS(rB- mB-) gal [malB+]K-12(XS)
• BL21(DE3)
K coli B F- ompT gal dcm Ion hsdSB(rB- mB-) X(DE3 [lad lacUV5-T7 gene 1 indl sam7 nin5])
It is thus clear that E. coli BL21 (DE3) is an E. coli B strain with DE3, i.e., a X prophage carrying the T7 RNA polymerase gene and laclq. In the said E. coli BL21 (DE3), transformed
plasmids containing T7 promoter driven expression are repressed until IPTG induction of T7 RNA polymerase from a lac promoter.
Thus, basically the T7 RNA polymerase has been inserted into E.coli BL21 to construct the strain BL21 (DE3). The T7 RNA polymerase gene sequence is provided as SEQ ID No. 7.
However, since the aspects of the present disclosure do not require a T7 promoter driven expression, or an IPTG inducible system, the T7 RNA polymerase gene sequence is not required by the genetically modified E. coli obtained in the present disclosure. However, even when such T7 RNA polymerase gene sequence is not required for the aspects of the instant disclosure, it is also noted that the presence of such T7 RNA polymerase gene sequence will not adversely affect the aspects of the instant disclosure in any manner.
Thus, the genetically modified organism obtained in the present disclosure is a genetically modified E. coli BL21. In other words, for the purposes of sequence identity, the said genetically modified organism is BL21 (DE3) minus the T7 RNA polymerase gene sequence.
However, having said the above, it is understood to a person skilled in the art that all the aspects of the present disclosure will be applicable to both E. coli BL21, as well as E. coli BL21 (DE3) strains.
Further, it is also important to note that the knocking out of genes within the purview of the instant disclosure requires deletion of the entire gene sequence, from start codon to the respective stop codon, and re-joining the remaining sequence in order to obtain a knocked-out sequence. Hence, since the native form of the microorganism strain is known [as mentioned above], and since the sequences of the genes to be knocked out is also provided, a person skilled in the art will have no problem or no undue experimental burden in carrying out the procedure of the instant disclosure and to arrive at the final genetically modified organism of the instant disclosure.
Similarly, the overexpression and engineering of the genes within the purview of this disclosure requires overexpression and/or inserting specific genes within a native form of the microorganism strain. Such specific genes are provided in the instant disclosure and hence, a person skilled in the art will have no problem or no undue experimental burden in carrying
out the procedure of the instant disclosure and to arrive at the final genetically modified organism of the instant disclosure.
Additional embodiments and features of the present disclosure will be apparent to one of ordinary skill in art based upon description provided herein. The embodiments herein and the various features and advantageous details thereof are explained with reference to the non-limiting embodiments in the description. Descriptions of well-known/conventional methods and techniques are not detailed so as to not unnecessarily obscure the embodiments herein. The examples used herein are intended merely to facilitate an understanding of ways in which the embodiments herein may be practiced and to further enable those of skill in the art to practice the embodiments herein. Accordingly, the following examples should not be construed as limiting the scope of the embodiments herein.
Example 1
General Experimental protocol for isobutanol production with various knockouts
and/or media swap
The following generalized protocol is employed to obtain the genetically modified microorganisms possessing excellent isobutanol production characteristics:
1) Knock-outs (selected from a group of ackA, adhE, ldhA or any combination of knockouts) are generated using PI transduction and homologous recombination by linear DNA, after which clones are picked and the specific gene deletions confirmed by PCR.
2) Competent cells carrying the various knock-outs are prepared.
3) Plasmid containing codon optimized KIVD under inducible lac promoter is transformed into the desired knock-out and plated on ampicillin plates (50-100 ug/ml) and incubated.
4) The next day overnight (i.e. after about 16-18 hours), starter cultures are started from a single colony in M9 + CA+ 0.4%Glucose + Amp 100 media. Media such as LB and other conventionally known media can also be employed for the growth of cells.
5) Early next morning (i.e. after about 16- 18hours), secondary cultures in M9 + 3.6% Glucose + Amp 100 media are initiated with overnight (O/N) starters with a starting optical density (O.D.) of either 0.05/0.075.
6) The secondary cultures are grown till O.D reaches about 0.6-0.8 after which it is induced with about 0.1 mM IPTG.
7) The cultures are incubated for about 3-4 hours at about 37 degrees and about 200 rpm.
8) The O.Ds of the cells are monitored after which the cultures are divided (depending on various conditions and time points of swap) followed by centrifugation at about 4000 g, and at 20 degrees for about 7-10 minutes.
9) The pellets obtained post centrifugation are re-suspended in nitrogen deficient media [ M9+(0%,1%,3%,10%)N +3.6%Glucose + Amp 100].
10) After re-suspension, all cultures are transferred to 250 ml screw capped conical
flasks, they are shut tight and their mouths are parafilmed to maintain an anerobic
environment. They are incubated for various time points at about 30 degrees and at
about 50 rpm.
11) Cultures are harvested after about 24 and 48 hours, their O.Ds are monitored; remaining glucose concentrations, pH is also monitored and the cultures are further plated (in plain LB/LB-Amp plates) to give a projection/estimate of the number of cells alive after various time points.
12) Concentration of isobutanol in the cell supernatant is measured by Head space Gas Chromatograph (Agilent) and/or by HPLC.
Example 2:
Heterologous expression of KIVD from LJactis:
In the present disclosure, the KIVD (keto isovalerate decarboxylase) is codon optimized from L.lactis. It is known that there is a bias for usage of the degenerate codon among each organism. The codon for the highly expressed genes are different from the moderate and low/lesser expressed genes. The concentration of tRNA in the cell is directly proportional to the codon usage (Ikemura, T. (1981) J. Mol. Biol. 146,1-21; Dong, H., Nilsson, L. and Kurland,C.G. (1996) J. Mol. Biol. 260,649-663; Kane, J.F. (1995) Curr.Opin. Biotechnol. 6, 494-500.) Thus, keeping the amino acid of the gene unchanged, modification of the codon is carried out to suit the maximal expression of the gene. In order to have the gene under a strong promoter, the gene is cloned downstream of the pTrc Promoter without the lac operator sequence. The sequence of the synthetic gene construct is given below.
CODON OPTIMISED kivD: [SEQ ID NO: 1] THE GENE STARTS FROM THE SECOND LINE
The -10 and -35 promoter sequence is in bold and italic. The start codon ATG and stop codon TAA is in bold.
In an embodiment of the present disclosure, the entire sequence is cloned in the plasmid pUC57. The clone is named pUCKl.
In another embodiment of the present disclosure, the plasmid pUC57 is 2710 bp in length and is a derivative of pUC19. pUC57 MCS (multiple cloning site) contains 6 restriction sites with protruding 3'-ends, which are resistant to E.coli exonuclease III. This vector is designed for cloning and generating ExoIII deletions. The exact position of genetic elements is shown on the map- Figure 8 (termination codons included). DNA replication initiates at position 890 (+/- 1) and proceeds in indicated direction. The bla gene nucleotides 2510-2442 (compl. strand) code for a single peptide.
pUC 57 Sequence (wild type): [SEQ ID NO: 2]
tcgcgcgtttcggtgatgacggtgaaaacctctgacacatgcagctcccggagacggtcacagcttgtctgtaagcggatgccggga
gcagacaagcccgtcagggcgcgtcagcgggtgttggcgggtgtcggggctggcttaactatgcggcatcagagcagattgtactg
agagtgcaccatatgcggtgtgaaataccgcacagatgcgtaaggagaaaataccgcatcaggcgccattcgccattcaggctgcgc
aactgttgggaagggcgatcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcgattaagttgg
gtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgaattcgagctcggtacctcgcgaatgcatctagatatcgg
atcccgggcccgtcgactgcagaggcctgcatgcaagcttggcgtaatcatggtcatagctgtttcctgtgtgaaattgttatccgctcac
aattccacacaacatacgagccggaagcataaagtgtaaagcctggggtgcctaatgagtgagctaactcacattaattgcgttgcgct
cactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggccaacgcgcggggagaggcggtttgcgtattgg
gcgctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatac
ggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccg
cgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacag
gactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcct
ttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtg
cacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccact
ggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggcta
cactagaagaacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaac
caccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacg
gggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaatta
aaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgat
ctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgca
atgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtc
ctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttg
ccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatc
ccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatg
gcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgt
atgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccacatagcagaactttaaaagtgctcatcattggaaa
acgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagc
atcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgt
tgaatactcatactcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaata
aacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgtctaagaaaccattattatcatgacattaacctataaaaata
ggcgtatcacgaggccctttcgtc
Synthesized kivD in puc57 (cloned vector with gene of interest kivD- pucKl) - 4428 bp: ISEQ ID NO: 31
Example 3:
Protocol for P1 transduction in E.coli -
To move portions of E.coli genome from one variant to another and to generate knock outs, P1 transduction homologous recombination is employed. In brief, phage is first grown on a donor strain during which host genome fragments of about 100kb along with selectable antibiotic markers when present are packaged in them resulting as a phage lysate. This lysate is used to infect recipient strains that would incorporate into their chromosomes foreign
bacterial DNA by means of homologous recombination. The selection markers aid the tracking of transduced fragments of DNA. (Thomason,L.C.,Costantino.N,and Court D.L (2001) E.coli Genome Manipulation by P1 Transduction, in Current Protocols in Molecular Biology,John Wiley & Sons Inc.)
Methodology for making the P1 lysate-
About 5ml culture of donor strain is grown at about 37°C in LB (Luria Broth), with about 0.2% glucose, about 5mM CaC12 is thereafter added to make the culture barely turbid. Thereafter, about 10 microlitres PI vir (phage titre of 109-1010) is added and continued to incubate at about 37°C with good aeration until lysis occurs. Further, the debris are centrifuged out and lysate is filtered using about 0.45 uM filter and stored at about 4°C.
Carrying out the P1 Transduction-
Recipient strain is grown overnight. About 5ml culture is centrifuged at about 2000-3000 x g and resuspended in about 2.5ml of P1 solution (10mM CaC12 + 5mM MgS04). Thereafter, about 100 microlitres of these cells is mixed in P1 with about 1, 10, and 100 microlitres of phage lysate in different tubes and a control is included without phage lysate. This mixture is further incubated for about 20 minutes at about 37°C. To the obtained mixture, about 200 microlitres of 1M Na-citrate and about 1ml LB is added and incubated for about 1 hour at about 37°C. Thereafter, the cells are centrifuged, resuspend in about 100 microlitres LB and plated on selective plates containing 5mM Na-Citrate. Thereafter, single colonies are streaked out on fresh selective plates with 5mM Na-Citrate. Transduction with the new gene fragment if confirmed by PCR.
Aim behind generating multiple knockouts:
Multiple knockouts are generated to reduce competition for common substrates, lessen unnecessary by-product formation, for the successful regeneration of essential cofactors and most importantly to drive the metabolic flux towards our desired product formation.
In the present disclosure, the prime focus is on generating a knockout of 3 genes in BL21 strain (individually or in combination i.e. single/multiple knock-outs) namely ackA [SEQ ID NO. 4] (which prevents formation of acetyl phosphate and acetate from pyruvate), adhE [SEQ ID NO. 5] (codes for alcohol dehydrogenase which would act on acetyl CoA and prevents further action on acetaldehyde. This in-turn increases the production of ethanol. By
knocking out adhE, ethanol levels are reduced, and knocking out of ldhA [SEQ ID NO. 6] prevents glycolytic flux from pyruvate towards lactate.
Eliminating Antibiotic resistance gene:
The single gene knockout strains that are part of the Keio collection (Baba et al 2006. paper and Datsenko & Wanner , 2000) are obtained from E.coli Genetic Resources at Yale CGSC. To make double gene knockouts, it is essential to remove the Kanamycin marker cassette. A simple strategy involving the use of FLP-FRT system is engineered into the knockouts of the Keio collection.
pCP20, a temperature sensitive plasmid that expresses a flippase is transformed into a knockout and incubated overnight at 30°C with ampicillin (30ug/ml).When colonies from this are grown under permissible temperatures, the flippase recognizes the FRT sites that flank the kanamycin cassette and excises it out, leaving a marker less knockout. The plasmid is eliminated by selecting the knockouts on antibiotic free conditions at 43°C.
Methodology for obtaining triple knockout-
ackA knockout is first generated as aforementioned. Thereafter, pCP20 DNA is transformed into BL21 ackA knockout and plated overnight in the presence of ampicillin at about 30°C. The following day a few colonies are grown in different snap-cap tubes in the presence of antibiotic ampicillin at about 30°C till they reach an OD of about 0.6. The colonies are then transferred to about 37°C for about 2 hours. These colonies are then diluted into fresh LB and left at about 43°C without ampicillin for about 4 hours. The colonies so diluted are replica plated on LB, Kan30 (30ug/ml) and AmplOO (100ug/ml) plates. If the colonies grow only on LB plates, then it means we are able to successfully flip out Kan cassette and can proceed for second knockout after verifying with colony PCR.
Following the above mentioned PI transduction protocol an adhE donor and ackA recipient without Kan cassette is used to generate a double knockout. This is verified with colony PCR with ackA and adhE primers (figure 10). Again as before Kan cassette from adhE is flipped out and ldhA is brought in to make it a BL21 ackA, adhE, ldhA triple knockout. Again verification is done by colony PCR with ldhA primers (figure 11).
Example 4:
Experimental Results:
Various E.coli strains of BL21 genre are obtained by following the protocol as described in Example 1. The comparison of isobutanol yields of the various strains are shown below:
Table 2: HPLC analysis of Isobutanol yields (in ppm) under various conditions
The yield as provided in the above Table 2 is estimated as the amount of isobutanol produced in ppm per ml. 10 %, 3 % and 0 % N-swap indicates the amount of nitrogen in the media compared to the normal concentration (100 %) which is about 5gm/L of NH4C1.
Table 2 clearly establishes the increased isobutanol production in single knock-outs (BL21ack), double knock-outs (BL21ack/adhE) and triple knock-outs (BL21ack/adhE/ldhA) when compared to the control (i.e. E.coli BL21).
Thus, the present disclosure is able to successfully overcome the various deficiencies of prior art and provide for genetically improved microorganisms possessing increased metabolite production characteristics (such as isobutanol), especially when grown under nutrient stress
conditions. Such genetically modified microorganisms and the methods of present disclosure can be successfully employed to produce various metabolites of interest, especially isobutanol for its application as biofuel.
The foregoing description of the specific embodiments will so fully reveal the general nature of the embodiments herein that others can, by applying current knowledge, readily modify and/or adapt for various applications such specific embodiments without departing from the generic concept, and, therefore, such adaptations and modifications should and are intended to be comprehended within the meaning and range of equivalents of the disclosed embodiments. It is to be understood that the phraseology or terminology employed herein is for the purpose of description and not of limitation. Therefore, while the embodiments in this disclosure have been described in terms of preferred embodiments, those skilled in the art will recognize that the embodiments herein can be practiced with modification within the spirit and scope of the embodiments as described herein.
We Claim:
1. A genetically modified micro-organism comprising altered genes, selected from a group comprising ackA, ldhA, adhE and kivD or any combination thereof.
2. The genetically modified micro-organism as claimed in claim 1, wherein the micro-organism is Escherichia coli strain B; and wherein the Escherichia coli strain B is selected from a group comprising Escherichia coli BL21 and Escherichia coli BL21 (DE3).
3. The genetically modified micro-organism as claimed in claims 1 and 2, wherein the Escherichia coli strain B comprising the altered genes is capable of survival under nitrogen deficient condition.
4. The genetically modified micro-organism as claimed in claim 3, wherein the nitrogen deficiency leads to the activation of ilvG gene even under anaerobic condition.
5. The genetically modified micro-organism as claimed in claim 1, wherein expression of the gene is altered to facilitate redistribution of energy for optimizing biochemical pathway for production of isobutanol.
6. The genetically modified micro-organism as claimed in claim 5, wherein the production of isobutanol is enhanced by at least 2 fold under nitrogen deficient condition.
7. The genetically modified micro-organism as claimed in claim 5, wherein the expression of the gene is altered by method selected from a group comprising knock out and engineering of the gene or any combination of method thereof.
8. The genetically modified micro-organism as claimed in claims 5 and 7, wherein the expression of the gene is altered by knocking out of the gene selected from a group comprising ackA, ldhA and adhE, or any combination thereof; and wherein the
expression of the gene is altered by engineering of codon optimized ketoisovalerate decarboxylase (KIVD) sequence set forth as SEQ ID No. 1.
9. The genetically modified micro-organism as claimed in claim 8, wherein the kivD gene is isolated from bacterium Lactococcus lactis and codon-optimized for Escherichia coli to obtain said sequence.
10. A process for obtaining a genetically modified micro-organism comprising altered genes, selected from a group comprising ackA, ldhA, adhE and kivD or any combination thereof, said process comprising altering expression of the genes by:
a) knocking out a gene selected from a group comprising ackA, ldhA and adhE, or any combination thereof; or
b) engineering of the codon optimized ketoisovalerate decarboxylase (KIVD) sequence set forth as SEQ ID No. 1; or
any combination of alterations thereof.
11. The process as claimed in claim 10, wherein the micro-organism is Escherichia coli strain B; and wherein the Escherichia coli strain B is selected from a group comprising Escherichia coli BL21 and Escherichia coli BL21 (DE3).
12. The process as claimed in claim 10, wherein expression of the gene is altered to facilitate redistribution of energy for optimizing the biochemical pathway for production of isobutanol.
13. The process as claimed in claim 12, wherein the production of isobutanol is enhanced by at least 2 fold under nitrogen deficient condition.
14. The process as claimed in claim 10, wherein the knocking out of the gene is carried out by method comprising acts of:
a) growing phage on donor strain for packaging of genome fragment with antibiotic marker to obtain phage lysate;
b) infecting recipient strain with the phage lysate to integrate the genome fragment by homologous recombination; and
c) identifying the recipient strain through the antibiotic marker to confirm knocking out of gene to obtain single knock out.
15. The process as claimed in claim 10, wherein the knocking out of more than one of the
genes is carried out by method comprising acts of:
a) obtaining single knock out as claimed in claim 14;
b) transforming the single knock out with plasmid expressing flippase employed in FLP-FRT system;
c) excising gene flanked by the flippase to obtain a knock out of two genes or a double knock out; optionally
d) conducting the step b) with the double knock out of step c) to obtain a knock
out of three genes or a triple knock out.
16. A method for inducing redistribution of energy within a micro-organism, said method
comprising act of:
(a) altering expression of genes corresponding to biomolecules involved in predetermined biochemical pathways within the micro-organism; or
(b) growing the micro-organism under nutrient stress condition;
or performing a combination of steps (a) and (b), to induce the redistribution of energy.
17. The method as claimed in claim 16, wherein the step (a) comprises acts of:
a) identifying biochemical pathway responsible for distribution of energy within
a microorganism;
b) identifying biomolecule participating in said distribution of energy and the
corresponding gene involved in the pathway of step a);
c) altering expression of said genes to modulate the participation of said
biomolecules for inducing said redistribution of energy.
18. The method as claimed in claim 16, wherein the nutrient stress is caused by
deficiency of nitrogen in conditions employed for the growth of micro-organism.
19. The method as claimed as claim 16, wherein the micro-organism is Escherichia coli strain B; and wherein the Escherichia coli strain B is selected from a group comprising Escherichia coli BL21 and Escherichia coli BL21 (DE3).
20. The method as claimed in claim 17, wherein the identification of the biochemical pathway and said biomolecules is carried out by conventional methods; and wherein the biomolecule is selected from a group comprising NADH, NAD, NADPH, NADP, ATP, ADP, GTP, GDP, FADH, FAD, Pyruvate, Ubiquinone and Acetyl CoA or any combination thereof.
21. The method as claimed in claim 16, wherein the gene involved in the biochemical pathway responsible for distribution of energy with the microorganism is selected from a group comprising ackA, ldhA, adhE and kivD or any combination thereof.
22. The method as claimed in claim 16, wherein the expression of the gene is altered by method selected from a group comprising knock out, overexpression and engineering of the gene or any combination of method thereof.
23. The method as claimed in claim 22, wherein the expression of the gene is altered by knocking out of the gene selected from a group comprising ackA, ldhA and adhE or any combination thereof; and wherein the expression of the gene is altered by engineering of codon optimized ketoisovalerate decarboxylase (KIVD) sequence set forth as SEQ ID No. 1.
24. The method as claimed in 16, wherein said redistribution of energy results in sustainable biomass levels for production of isobutanol.
25. A method for producing isobutanol from a genetically modified micro-organism, said method comprising act of;
(a) obtaining genetically modified micro-organism comprising altered genes corresponding to biomolecules involved in predetermined biochemical pathways; and
(b) optionally, growing the micro-organism obtained in step (a) under nutrient stress condition,
to induce the redistribution of energy for production of said isobutanol.
26. The method as claimed in claim 25, wherein the micro-organism is Escherichia Coli strain B; and wherein the Escherichia coli strain B is selected from a group comprising Escherichia coli BL21 and Escherichia coli BL21 (DE3).
27. The method as claimed in claim 25, wherein the genetically modified micro-organism comprise altered genes, selected from a group comprising ackA, ldhA, adhE and kivD or any combination thereof.
28. The method as claimed in claim 25, wherein the redistribution of energy within the microorganism is induced by method as claimed in claim 16.
29. The method as claimed in claim 25, wherein the nutrient stress is caused by deficiency of nitrogen in conditions employed for the growth of micro-organism.
30. The method as claimed in claim 25, wherein the method enhances the production of the isobutanol at least by 2 fold when compared to the production of the isobutanol by wild type microorganism without said redistribution of energy.
| # | Name | Date |
|---|---|---|
| 1 | Form-5.pdf | 2012-09-14 |
| 2 | Form-3.pdf | 2012-09-14 |
| 3 | Form-1.pdf | 2012-09-14 |
| 4 | Drawings.pdf | 2012-09-14 |
| 5 | 3717-CHE-2012 CORRESPONDENCE OTHERS 07-03-2013.pdf | 2013-03-07 |
| 6 | 3717-CHE-2012 FORM-1 07-03-2013.pdf | 2013-03-07 |
| 7 | 3717-CHE-2012 POWER OF ATTORNEY 07-03-2013.pdf | 2013-03-07 |
| 8 | 3717-CHE-2012 FORM-5 05-09-2013.pdf | 2013-09-05 |
| 9 | 3717-CHE-2012 FORM-3 05-09-2013.pdf | 2013-09-05 |
| 10 | 3717-CHE-2012 FORM-1 05-09-2013.pdf | 2013-09-05 |
| 11 | 3717-CHE-2012 FORM-9 10-09-2013.pdf | 2013-09-10 |
| 12 | 3717-CHE-2012 FORM-18 10-09-2013.pdf | 2013-09-10 |
| 13 | Drawings _ IP21505.pdf | 2013-09-17 |
| 14 | COMPLETE SPECIFICATION_IP21505.pdf | 2013-09-17 |
| 15 | 3717-CHE-2012 FORM-5 02-12-2013.pdf | 2013-12-02 |
| 16 | 3717-CHE-2012 FORM-1 02-12-2013.pdf | 2013-12-02 |
| 17 | 3717-CHE-2012 CORRESPONDENCE OTHERS 02-12-2013.pdf | 2013-12-02 |
| 18 | 3717-CHE-2012-FER.pdf | 2018-02-12 |
| 19 | 3717-CHE-2012-AbandonedLetter.pdf | 2018-11-15 |
| 1 | 3717che2012_08-02-2018.pdf |