Abstract: Hepatocellular Carcinoma (HCC) is the foremost reason for death caused by different types of cancer and the global burden of incidence of new cases & deaths caused by cancer is increasing continuously day by day. Generally, liver cancer is diagnosed in the advanced stage of the infection due to the absence the reliable and potential biomarkers. Currently, no relevant early diagnostic markers are available for the early diagnosis of HCC. However, some biochemical markers claimed by some researchers are not relevant to the early-stage detection of this disease. So, there is a need of the hour to develop an efficient prognostic molecular marker for early-stage detection of HCC. However, miR-21 is an oncomir i.e., the expression of this micro-RNA is generally recorded as upregulated in case of development of the cancers while miR-122 is a liver-specific marker only observed the dysregulation of this micro-RNA in case of liver-related cancer development i.e., Hepatocellular carcinoma. So, combined evaluation of miR-21 & miR-122 expression may be a good molecular marker in early-stage development of the HCC.
1. Micro-RNA (miR122) based molecular diagnostic kit for early diagnosis of hepatocellular carcinoma (HCC) system is comprises miR-21 is an oncomir i.e. the expression of this micro-RNA is generally recorded as upregulated in case of development of the cancers while miR-122 is a liver specific markers only observed the dysregulation of this micro-RNA in case of liver related cancer development i.e. Hepatocellular carcinoma, therefore combined evaluation of miR-21 & miR-122 expression may be a good molecular morkar in early stage development of the HCC.
Field of the Invention
This invention relates to a micro-RNA (miR122) based molecular diagnostic kit for early diagnosis of hepatocellular carcinoma (HCC)
Background of the Invention
CN201010253909XA: The invention discloses a micro-nucleic acid marker for early diagnosis or development and prognosis judgment of liver diseases, particularly microRNA-122 (micro-ribonucleic acid-122). The invention also discloses a method for diagnosing liver diseases, which comprises the following steps: (a) respectively measuring the expression level of the microRNA-122 in a human-derived detected sample and a reference sample; (b) comparing the expression level of the microRNA-122 in the detected sample with the expression level of the microRNA-122 in the reference sample; (c) if the expression level of the microRNA-122 in the detected sample is obviously different from the expression level of the microRNA-122 in the reference sample, indicating that the individual suffers from a liver disease. The invention also discloses a method and reagent for detecting the expression level of the microRNA-122 in the detected sample.
Research Gap:
Authors claimed for the miR-122 as a serum marker for liver diseases however our claim differs from this in the following relation:
(i) We have not targeted only miR-122 but combined targeting of miR-122 & miR-21 is used.
(ii) We have a claim for miR-21 & miR-122 in Hepatocellular carcinoma.
None of the prior art indicates above either alone or in combination with one another discloses what the present invention has disclosed. The present invention is a combined evaluation of miR-21 & miR-122 expression as an early diagnostic marker for the development of Hepatocellular Carcinoma (HCC)
SUMMARY OF THE INVENTION
This summary is provided to introduce a selection of concepts, in a simplified format, that are further described in the detailed description of the invention.
This summary is neither intended to identify key or essential inventive concepts of the invention and nor is it intended for determining the scope of the invention.
To further clarify advantages and features of the present invention, a more particular description of the invention will be rendered by reference to specific embodiments thereof, which is illustrated in the appended drawings. It is appreciated that these drawings depict only typical embodiments of the invention and are therefore not to be considered limiting of its scope. The invention will be described and explained with additional specificity and detail with the accompanying drawings.
Liver cancer is the third most common cause of cancer death globally, and it is among the five most common causes of cancer death in 90 countries across the world. The major modifiable risk factors for primary liver cancer are infection with hepatitis B virus (HBV) and hepatitis C virus (HCV) (Rumgay et al., 2021). As per recent research published in Journal of Hepatology submitted by the scientific group of International Agency for Research on Cancer (IARC), WHO and partner institutions, which is based on the global burden estimation of liver cancer in year 2020. They foretell in their research that annual number of new cases and deaths due to liver cancer will increase by more than 55% by year 2040 (Rumgay et al., 2022).
DETAILED DESCRIPTION OF THE INVENTION
The detailed description of various exemplary embodiments of the disclosure is described herein with reference to the accompanying drawings. It should be noted that the embodiments are described herein in such details as to clearly communicate the disclosure. However, the amount of details provided herein is not intended to limit the anticipated variations of embodiments; on the contrary, the intention is to cover all modifications, equivalents, and alternatives falling within the scope of the present disclosure as defined by the appended claims.
It is also to be understood that various arrangements may be devised that, although not explicitly described or shown herein, embody the principles of the present disclosure. Moreover, all statements herein reciting principles, aspects, and embodiments of the present disclosure, as well as specific examples, are intended to encompass equivalents thereof.
The terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of example embodiments. As used herein, the singular forms “a",” “an” and “the” are intended to include the plural forms as well, unless the context clearly indicates otherwise. It will be further understood that the terms “comprises,” “comprising,” “includes” and/or “including,” when used herein, specify the presence of stated features, integers, steps, operations, elements and/or components, but do not preclude the presence or addition of one or more other features, integers, steps, operations, elements, components and/or groups thereof.
It should also be noted that in some alternative implementations, the functions/acts noted may occur out of the order noted in the figures. For example, two figures shown in succession may, in fact, be executed concurrently or may sometimes be executed in the reverse order, depending upon the functionality/acts involved.
In addition, the descriptions of "first", "second", “third”, and the like in the present invention are used for the purpose of description only, and are not to be construed as indicating or implying their relative importance or implicitly indicating the number of technical features indicated. Thus, features defining "first" and "second" may include at least one of the features, either explicitly or implicitly.
Unless otherwise defined, all terms (including technical and scientific terms) used herein have the same meaning as commonly understood by one of ordinary skill in the art to which example embodiments belong. It will be further understood that terms, e.g., those defined in commonly used dictionaries, should be interpreted as having a meaning that is consistent with their meaning in the context of the relevant art and will not be interpreted in an idealized or overly formal sense unless expressly so defined herein.
These and other advantages of the present subject matter would be described in greater detail with reference to the following figures. It should be noted that the description merely illustrates the principles of the present subject matter. It will thus be appreciated that those skilled in the art will be able to devise various arrangements that, although not explicitly described herein, embody the principles of the present subject matter and are included within its scope. Micro-RNAs are endogenous, single chain non-coding, interfering, small RNAs of approx 21-30 nucleotides having function in post-transcription regulation. These have major negative regulatory action by binding to 3’ UTR (un-translated region) on target mRNA. Circulating miRNAs released by cancerous tissues possibly helpful for initial recognition of cancer because they are readily available and stable for clinical analysis. By comparing HCC and the corresponding non-cancerous tissues, miRNA expression profiles enable the differentiation of various liver cancer types (Wei et al., 2013). Different recent researches have shown that changed expression profiles of serum miRNA in HCC patients have improved sensitivity and specificity for liver cancer diagnosis (Qi et al., 2013). MiR-21 is the foremost discovered oncogenic micro RNA i.e. oncomiR, have role in cell cycle regulation and cancer genesis (Zhang et al., 2020). It could be served as an early-stage prognostic potential biomarker for hepatocellular carcinoma (Demerdash et al., 2017; Hayes & Chayama, 2016). Different research result data suggested that miR-21 expression pattern was reported constantly higher in diagnosis of patient with liver diseases in comparison to healthy people, signifying it could be serve as a probable diagnostic and therapeutic molecule (Wagenaar et al., 2015; Bautista-Sánchez et al., 2020). The miR-122 is a good category biomarker because this is specific injuries to hepatocytes has direct involvement in the expression of this micro-RNA in Liver cancer (Haider et al., 2014). Approx 66,000 copies of miR-122 per hepatic cell are found in the liver, and generally this micro-RNA is highly expressed in any liver tissue (Jopling, 2012). The miR-122 is most important micro RNA specifically found in liver makes it major potential candidate for clinical significance and its expression status can be used to differentiate between healthy persons & liver cancer patients.
Expression status of miR-21 & miR-122 combindly evaluated by the use of Real Time PCR approach. The complete experimental design of the research done are as follows:
Categorisation of overall research into two groups: Group-I (G-I) included 10 healthy individuals as control, while Group-II (G-II) included 10 Hepatitis-C positive patients.
(This classification was carried out in two groups as G-I & G-II, after confirmation of HCV positivity by the real time PCR)
mi-RNA isolation from the serum sample separated from the blood collected from all twenty individuals.
(Kit used for the mi-RNA isolation micro-RNA Isolation miRNeasy Mini Kit, Qiagen)
cDNA synthesis from isolated miRNA
(Kit used for cDNA synthesis miRCURY LNA RT Kit Qiagen)
Further Real-time Quantitative PCR (qRT-PCR) for synthesized cDNA template using miR-21 and miR-122 specific synthesized primer by Rotor-Gene Q 5-Plex HRM instrument, QIAGEN
(Kit used for Real TimePCR SsoFast EvaGreen Supermix, Biorad)
Primer sequences are
S. No. Gene Primer sequences
1. miR-122 Fp 5'- TGGAGTGTGACAATGGTGTTTG 3'
Universal primer Rp 5'- GCGAGCACAGAATTAATACGAC -3'
2. miR-21 Fp 5'- TAGCTTATCAGACTGATGTTGA -3'
Universal primer Rp 5'- GCGAGCACAGAATTAATACGAC -3'
3. miR-U6 Fp 5’ CGCTTCGGCAGCACATATACTA 3’
Rp 5’ CGCTTCACGAATTTGCGTGTCA 3’
Relative quantification of miRNAs (miR-21 & miR-122) by 2^-??CT method using U6-miRNA as the internal reference.
Upregulation in the expression of miR-21 as well as miR-122 however more upregulated expression in miR-21 in comparision of miR-122
ADVANTAGES OF THE INVENTION:
• The miRNAs are highly stable in compare to m-RNA, oppose to degradation up to 4 days at room temperature and in harmful situation such as multiple freeze-thaw cycles, boiling, and high or low pH.
• miR-122 is highly expressed in the liver specifically, accounting for 70% of its total miRNA content. More than 66,000 copies of miR-122 per hepatocyte are present in the liver, and miR-122 is generally most highly expressed in any liver tissue.
• Krek et al., 2005 suggested on the basis of their result that combinatorial microRNA target predictions may be a good approach for the prediction of mi-RNAs involved in the disease development.
• miR-21 is an oncomir i.e. the expression of this micro-RNA is generally recorded as upregulated in case of development of the cancers while miR-122 is a liver specific markers only observed the dysregulation of this micro-RNA in case of liver related cancer development i.e. Hepatocellular carcinoma. So, combined evaluation of miR-21 & miR-122 expression may be a good molecular morkar in early stage development of the HCC.
We Claims:
1. Micro-RNA (miR122) based molecular diagnostic kit for early diagnosis of hepatocellular carcinoma (HCC) system is comprises miR-21 is an oncomir i.e. the expression of this micro-RNA is generally recorded as upregulated in case of development of the cancers while miR-122 is a liver specific markers only observed the dysregulation of this micro-RNA in case of liver related cancer development i.e. Hepatocellular carcinoma, therefore combined evaluation of miR-21 & miR-122 expression may be a good molecular morkar in early stage development of the HCC.
| # | Name | Date |
|---|---|---|
| 1 | 202311011619-STATEMENT OF UNDERTAKING (FORM 3) [21-02-2023(online)].pdf | 2023-02-21 |
| 2 | 202311011619-REQUEST FOR EARLY PUBLICATION(FORM-9) [21-02-2023(online)].pdf | 2023-02-21 |
| 3 | 202311011619-POWER OF AUTHORITY [21-02-2023(online)].pdf | 2023-02-21 |
| 4 | 202311011619-FORM-9 [21-02-2023(online)].pdf | 2023-02-21 |
| 5 | 202311011619-FORM FOR SMALL ENTITY(FORM-28) [21-02-2023(online)].pdf | 2023-02-21 |
| 6 | 202311011619-FORM 1 [21-02-2023(online)].pdf | 2023-02-21 |
| 7 | 202311011619-EVIDENCE FOR REGISTRATION UNDER SSI(FORM-28) [21-02-2023(online)].pdf | 2023-02-21 |
| 8 | 202311011619-EVIDENCE FOR REGISTRATION UNDER SSI [21-02-2023(online)].pdf | 2023-02-21 |
| 9 | 202311011619-EDUCATIONAL INSTITUTION(S) [21-02-2023(online)].pdf | 2023-02-21 |
| 10 | 202311011619-DECLARATION OF INVENTORSHIP (FORM 5) [21-02-2023(online)].pdf | 2023-02-21 |
| 11 | 202311011619-COMPLETE SPECIFICATION [21-02-2023(online)].pdf | 2023-02-21 |
| 12 | 202311011619-Proof of Right [21-10-2023(online)].pdf | 2023-10-21 |
| 13 | 202311011619-FORM 18 [13-06-2025(online)].pdf | 2025-06-13 |